Abstract: The present invention relates to a recombinant microorganism for producing putrescine or ornithine and a method for producing putrescine or ornithine by using the same.
Art
[1]
The present invention relates to recombinant microorganisms and using them to produce putrescine or ornithine to a method of producing putrescine or ornithine.
[2]
BACKGROUND
[3]
Biogenic amines (biogenic amines, BAs) is a nitrogen compound which is mainly produced by the decarbonation action of acids, aldehydes and ketones in the amination with an amino group transfer reaction. The biogenic amines are so low molecular weight is synthesized in metabolic processes of the microorganisms, plants and animals are known as components that are commonly found in these cells.
[4]
[5]
The putrescine of God is found in Gram-negative bacteria and fungi are expected to play an important role in the metabolism of microorganisms due to the presence in high concentrations in a variety of species. In general, putrescine worn as an important raw material for synthesizing the polyamines nylon-4,6, is produced mainly by chemical synthesis. The chemical synthesis is composed of a three-step process which includes a hydrogenation step of using the stage and the high-pressure hydrogen using a catalytic oxidation step reaction, cyanides (cyanide) compound. Accordingly, the putrescine more environmentally friendly production and circumstances for God in the way of utilizing biomass that can reduce energy consumption are required.
[6]
Under this background, a method for producing putrescine using microorganisms of different ways of producing putrescine in high concentrations by transforming the E. coli and Corynebacterium spp been published (International Patent Publication WO06 / 005603; International Patent Publication WO09 / 125924; Qian ZD et al, Biotechnol Bioeng 104 (4):... 651-662, 2009; Schneider et al, Appl Microbiol Biotechnol 88 (4):.... 859-868, 2010; Schneider et al ., Appl Microbiol Biotechnol 95:.... 169-178, 2012).
[7]
[8]
On the other hand, ornithine (ornithine) is a precursor used in the biosynthesis of arginine, proline and polyamines with a material which is widely found in plants, animals and microorganisms. Further, ornithine metabolism in vivo in higher animals generating elements from the amino acid or ammonia through the tin circuit plays an important role in the path to discharge from the body. Because of ornithine it is effective in reducing body fat and create muscle, it is used as a nutritional supplement, it is also used as medicine to improve liver cirrhosis and liver failure. A method of producing such a ornithine is a method using a method of processing a milk casein (casein) to the digestive enzymes and transformed with E. coli or Corynebacterium spp conversion is known (Registry No. 10-1372635 No. Republic of Korea; T . Gotoh et al, Bioprocess Biosyst Eng, 33:... 773-777, 2010).
[9]
[10]
Path to the biosynthesis of putrescine from ornithine, or Escherichia coli and Corynebacterium spp are similar but different problem. First, the genus Corynebacterium microorganism argJ ((bifunctional ornithine acetyltransferase / N-acetylglutamate synthase, glutamic acid (glutamic acid by EC 2.3.1.35)) is N- acetyl -L- glutamic acid (N-acetyl-L-glutamic acid ) with N- acetyl ornithine -L- (N-acetyl-L-ornithine) is L- ornithine (has a "circulation path (cyclic pathway)" which is converted to L-ornithine). thereto, compared with E. coli using the argA (N-acetylglutamate synthase, EC 2.3.1.1) and argE (Acetylornithine deacetylase, EC 3.5.1.16) is a "linear path (linear pathway)" in place of the microorganism of the genus Corynebacterium argJ putrescine or ornithine biosynthesis and the tin.
[11]
Corey four in tumefaciens spp ArgJ are ornithine (ornithine) and glutamic acid glutamic acid to acetyl groups (acetyl) of (glutamic acid), but the recycle, ArgA acetyl -CoA (Acetyl-CoA) In E. coli, acetyl group between (glutamate ) given attached to N- acetyl-glutamic acid (N-acetyl-glutamate) generate and ArgE is N- acetyl-ornithine to decompose tin (N-acetyl-ornithine) ornithine to generate tin (ornithine) and acetic acid (acetate) it is known that (. Schneider et al., Appl. Microbiol. Biotechnol. 91, 17-30, 2011).
[12]
On the other hand, pta-ackA (pta, phosphotransacetylase; ackA, Acetate kinase) operon and acs (Acetyl-coenzyme A synthetase) is known as the gene for synthesis of acetyl -CoA using an acetate.
[13]
Detailed Description of the Invention
SUMMARY
[14]
The present inventors have found that improves performance production of ornithine and putrescine produced results of a performance enhancement studies continue purposes, putrescine God ornithine the argA and argE of E. coli-derived, if introduced into the Corynebacterium spp identified by the present invention has been completed.
Problem solving means
[15]
An object of the present invention to provide a recombinant microorganism capable of producing putrescine or ornithine, and a high yield.
[16]
Another object of the invention is to provide a method for producing putrescine or ornithine by using the microorganism.
Effects of the Invention
[17]
If powered acetate Flow further with the case where the introduction of E. coli-derived ArgA and E. coli-derived ArgE the genus Corynebacterium microorganism to produce putrescine, or ornithine to the present invention with the putrescine and ornithine of tin it was confirmed that the yield is increased. The microorganism of the present invention according to is putrescine or ornithine for the production of tin may be widely used, it is to be widely utilized in various polymeric products in economically and environmental side effects and preferred raw material providing means in the production of which is used as a raw material can.
[18]
Brief Description of the Drawings
[19]
A of FIG. 1 is a schematic diagram showing a the putrescine and ornithine biosynthetic pathway (a circulation path) of the microorganism of the genus Corynebacterium B is putrescine and ornithine biosynthetic route (linear path) of E. coli.
[20]
Figure 2 is a schematic diagram showing the biosynthetic pathway with improved production capacity of putrescine and ornithine by introducing an E. coli origin argA and argE derived from E. coli in a state in which the expression of a microorganism of the genus Corynebacterium argJ.
[21]
Best Mode for Carrying Out the Invention
[22]
One aspect of the present invention is derived from E. coli N- acetyl glutamate synthase (N-acetylglutamate synthase) and E. coli-derived acetyl ornithine deacetylase of the activity of (Acetylornithine deacetylase) introduced, putrescine or corridor with ornithine-producing ability It provides a Corynebacterium spp.
[23]
One embodiment of the present invention provides a microorganism of the genus Corynebacterium having the, putrescine or ornithine-producing ability to the E. coli derived from N- acetyl glutamate synthase is composed of the amino acid sequence of SEQ ID NO: 1.
[24]
Another embodiment of the invention provides the E. coli-derived acetyl ornithine deacetylase has the genus Corynebacterium microorganism having the, putrescine or ornithine-producing ability will be composed of the amino acid sequence of SEQ ID NO: 3 .
[25]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Brevibacterium Plastic boom ( Brevibacterium flavum ), and Brevibacterium lactofermentum ( Brevibacterium lactofermentum ) Corynebacterium having the, putrescine or ornithine-producing ability is selected from the group consisting of Solarium It provides spp.
[26]
Yet another embodiment of the present invention enhance the activity of the genus Corynebacterium microorganism further phosphorylation trans deacetylase (phosphotransacetylase) and acetate kinase (acetate kinase) operon (pta-ackA operon) compared to the endogenous activity that provides a Corynebacterium spp with putrescine or ornithine-producing ability.
[27]
Yet another embodiment of the invention the phospholipase trans deacetylase and acid phosphatase operon Corynebacterium having the, putrescine or ornithine-producing ability will be composed of the amino acid sequence of SEQ ID NO: 5 or 7 Solarium It provides spp.
[28]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism further E. coli-derived acetyl -CoA the activity of synthetase (acetyl-CoA synthetase, acs) introduced, putrescine or with ornithine-producing ability It provides a Corynebacterium spp.
[29]
Yet another embodiment of the present invention provides a microorganism of the genus Corynebacterium having the, putrescine or ornithine-producing ability to the acetyl -CoA synthase comprising the amino acid sequence of SEQ ID NO: 9.
[30]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism stiffness with further ornithine dicarboxylic decarboxylase is, putrescine or ornithine to be active, the introduction of (ornithine decarboxylase, ODC) producing ability Yes It provides tumefaciens spp.
[31]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism is additionally i) ornithine carbamoyl transferase dehydratase (ArgF), ii) glutamate X Porter or iii) ornithine carbamoyl transferase dehydratase and the activity of glutamate X-Porter is to provide a Corynebacterium spp with, the putrescine or ornithine-producing ability than the weak intrinsic activity.
[32]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism further acetyl gamma glutamyl phosphate reductase kinase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase ( ArgB), and the acetyl ornithine aminotransferase genus Corynebacterium microorganism is at least one active selected from the group consisting of (ArgD) having a, putrescine or ornithine-producing ability compared to their intrinsic activity to provide.
[33]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism service Corynebacterium spp with additional acetyl transferase of the of kinase activity weakens than endogenous activity, putrescine or ornithine-producing ability do.
[34]
Yet another embodiment of the invention provides the acetyl transferase dehydratase is Corynebacterium spp with a, putrescine or ornithine-producing ability to the protein consisting of the amino acid sequence of SEQ ID NO: 30 or 31 do.
[35]
Yet another embodiment of the present invention is the genus Corynebacterium microorganism further putrescine activity of X Potter-enhanced than endogenous activity, putrescine or ornithine genus Corynebacterium microorganism having a production capability to provide.
[36]
Yet another embodiment of the present invention is the putrescine Expo emitter SEQ ID NO: 26 or SEQ ID NO would a protein consisting of the amino acid sequence of 28, putrescine or ornithine genus Corynebacterium microorganism having a production capability It provides.
[37]
Another aspect of the invention
[38]
(I) culturing in a medium a microorganism of the genus Corynebacterium having the putrescine-producing ability or ornithine; And
[39]
(Ii) provides, putrescine or ornithine method of production comprises the step of recovering the putrescine or ornithine from the medium or the cultured microorganism.
[40]
One embodiment of the invention provides the microorganism of the genus Corynebacterium is Corynebacterium glutamicum in that the, or putrescine production method of ornithine.
[41]
[42]
Hereinafter, the present invention will be described in detail.
[43]
One aspect of the present invention is derived from E. coli N- acetyl glutamate synthase (N-acetylglutamate synthase) and E. coli-derived acetyl ornithine deacetylase of the activity of (Acetylornithine deacetylase) introduced, putrescine or corridor with ornithine-producing ability It is for the Corynebacterium spp.
[44]
As used herein, the term "N- acetyl glutamate synthase (N-acetylglutamate synthase)" is the enzyme that mediates the reaction of the N- acetyl glutamate produced from glutamate and acetyl -CoA, it produced N- acetyl glutamate which is ornithine and it can be used as a precursor of arginine.
[45]
N- acetyl-glutamate synthase in the present invention include, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1, or the sequence that is at least 70%, specifically at least 80%, more specifically at least 90%, still more specifically, more than 95%, even more specifically, if the protein of more than 98%, most specifically at substantially the N- acetyl glutamate synthase activity as the amino acid sequence shown as at least 99% homology can be included without limitation.
[46]
Further, since depending on the species or strain of microorganism there is a case that a difference exists in the amino acid sequence of a protein showing the activity, dehydratase N- acetyl-glutamate synthase in the present invention include but are not limited to the origin, for example, it is derived from E. coli have. If the amino acid sequence having a biological activity substantially the same as or correspond to the protein of SEQ ID NO: 1 as a sequence having homology with said sequence, if some sequence having a deletion, modified, substituted or added in the amino acid sequence also of the present invention included in the category are self-evident.
[47]
Polynucleotide encoding an N- acetyl glutamate synthase of the present invention, the N- acetyl glutamate synthase which has a similar activity to a protein, the amino acid sequence of SEQ ID NO: 1 or the sequence that is at least 70%, specifically at least 80% , more specifically, more specifically more than 90%, is over 95%, even more particularly by at least 98%, and most specifically may comprise a polynucleotide encoding a protein showing a 99% or more homology, illustrated typically it may include a polynucleotide sequence of SEQ ID NO: 2.
[48]
[49]
The term "acetyl ornithine deacetylase (Acetylornithine deacetylase)" used in the present invention is an enzyme that mediates the reaction of acetic acid and ornithine are generated mediated hydrolysis of the acetyl ornithine.
[50]
Acetyl ornithine deacetylase in the present invention include proteins comprising an amino acid sequence of SEQ ID NO: 3, or the sequence that is at least 70%, specifically 80% or more, more specifically 90% or more, more specifically 95 than If% or more, even more specifically, the protein of more than 98%, most specifically at substantially acetyl group activity for the separation of tin from ornithine acetyl ornithine as the amino acid sequence shown by at least 99% homology can be included without limitation.
[51]
Further, since depending on the species or strain of microorganism that if a difference exists in the amino acid sequence of a protein showing the activity, acetyl ornithine deacetylase in the present invention include but are not limited to the origin, for example, be derived from E. coli have. If the amino acid sequence having a biological activity substantially the same as or correspond to the protein of SEQ ID NO: 3 as a sequence having homology with said sequence, if some sequence having a deletion, modified, substituted or added in the amino acid sequence also of the present invention included in the category are self-evident.
[52]
Polynucleotide encoding an acetyl-ornithine deacetylase of the present invention are the acetyl ornithine diacetyl which has a similar activity as cyclase protein, SEQ ID NO: 3 the amino acid sequence or a sequence with at least 70%, specifically at least 80% , more specifically, more specifically more than 90%, is over 95%, even more particularly by at least 98%, and most specifically may comprise a polynucleotide encoding a protein showing a 99% or more homology, illustrated typically it may include a polynucleotide sequence of SEQ ID NO: 4.
[53]
In addition, N- acetyl glutamate synthase or acetyl ornithine diacetyl polynucleotide encoding the cyclase is SEQ ID NO: 2 or 4 or the polynucleotide sequence of a polynucleotide probe (probe) under stringent conditions derived from the sequence of the invention (stringent can be hybridized in conditions), it may be of mutations encoding an N- acetyl glutamate synthase or acetyl ornithine deacetylase to function normally. And in said it means a condition that allows for specific hybridization between the terms "stringent conditions" is a polynucleotide. For example, such stringent conditions are described in detail in the literature (e.g., J. Sambrook et al., Above).
[54]
[55]
The term "homology" in the above refers to the degree of matching the given amino acid sequence or polynucleotide sequence, and can be expressed as a percentage. In this specification, it is represented by its sequence homology to the "% homology" has the same or similar activity with a given amino acid sequence or polynucleotide sequence. For example, the sequence by Southern hybridization experiment under the score (score), identities (identity) and similarity (similarity) standard software, stringent conditions specifically used, define the BLAST 2.0 calculating a parameter (parameter), such as appropriate hybridization conditions is to check, by comparing the definition is within the skill of a method well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, a Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989;. FM Ausubel et al, may be determined in Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[56]
[57]
On the other hand, the microorganism and examples thereof include, and include all of the wild-type or variant of the present invention is Escherichia genus ( Escherichia sp.), Shigella genus ( Shigella sp.), In bakteo a sheet ( Citrobacter sp.), Salmonella in ( Salmonella sp.), Enterobacter genus ( Enterobacter sp.) yeosi California in ( Yersinia sp.), keurep when Ella in ( Klebsiella sp.), air Winiah in ( Erwinia sp.), the genus Corynebacterium ( Corynebacterium sp.), Brevibacterium genus ( Brevibacterium sp.), Lactobacillus genus ( Lactobacillus sp.), celecoxib grandma eggplant in ( Selenomanas sp.), Vibrio genus ( Vibrio sp.), Pseudomonas species ( Pseudomonas sp.), Streptomyces genus sheath ( Streptomyces sp.), in oh Kano bacteria ( Arcanobacterium sp.), alkali Zen in ( Alcaligenes may be a microorganism belonging to the like sp). Specifically, the microorganism of the present invention Corey four may be a microorganism belonging to the genus tumefaciens, more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium to thermoelectric amino Ness ( Corynebacterium thermoaminogenes ), Brevibacterium Plastic boom ( Brevibacterium flavum ), and Brevibacterium lactofermentum ( Brevibacterium lactofermentum can be selected from the group consisting of a), and even more specifically, Corynebacterium glutamicum ( Corynebacterium glutamicum may be a), and the like.
[58]
[59]
In particular, the term "putrescine or ornithine genus Corynebacterium microorganism having a production capability" of the present invention is a Corynebacterium spp, putrescine or ornithine ability production of tin or naturally putrescine or ornithine means a parental strain for production of tin-free capability given production capability of putrescine or ornithine microorganisms.
[60]
The putrescine or ornithine microbe to impart ability tin produced or production, especially useful for but not limited, to enhance the biosynthetic route to the ornithine from glutamate acetyl switching glutamate acetyl glutamate (N-acetylglutamate) glutamate synthase or ornithine for ornithine converted to tin acetyl ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate acetyl-glutamyl-phosphate (N-acetylglutamyl phosphate) acetyl glutamate kinase (ArgB), acetyl glutamyl phosphate to convert acetyl glutamate semi-aldehyde (N-acetylglutamate semialdehyde) acetyl gamma glutamyl phosphate reductase re-switching to dehydratase (ArgC), acetyl glutamate semi-aldehyde acetyl ornithine acetyl ornithine amino transferase to switch to the (N-acetylornithine) azetidine (ArgD ) Is modified to increase the activity compared to the endogenous activity of this can be increased productivity of ornithine is used as a raw material gods putrescine biosynthesis.
[61]
Further, ornithine carbamoyl transferase dehydratase (ornithine carbamoyltransfrase, ArgF), proteins involved in the glutamate-discharge, and / or putrescine put endogenous activity the activity of crystallized acetyl proteins involved in arginine synthesis wherein the microorganism is ornithine in tin to weakness variations and / or to be compared to, ornithine dicarboxylic can be modified to the introduction of the acid la kinase (ornithine decarboxylase, ODC) activity.
[62]
[63]
And it that the term "the introduction of the active" in this invention to mean that the activity of the protein which lack is not present in the microorganisms to be new or increased in the microorganism, of expressing the gene specifically coding for the protein was not present in the microorganism be inserted or transferred into the microorganism, or one comprising the expression with respect to the protein that did not or substantially not in the microorganism induce mutations to enhance expression, and is not limited to the above example.
[64]
[65]
On the other hand, mutation, such as the introduction of the active or in the present invention is active is enhanced or weakened activity can occur through a process known as transfection, and the present invention the term "transfection" is a polynucleotide or activity encoding a specific protein in means that the stronger or induced mutation of the polynucleotide encoding the chromosome of the host cell or to protein to be expressed to a vector comprising such a weak promoter sequence in a host cell by introducing into the host cell. In addition, the polynucleotides include DNA and RNA encoding the target protein. The polynucleotide is introduced into the host cell as long as it can induce expression or mutation, it does not matter whether it is to be introduced in any form. For example, the polynucleotide may be introduced into a host cell in the form of there is expressed by itself in an expression cassette (cassette expression) gene construct containing all the elements required. The expression cassette may include a promoter that is normally operably linked to the polynucleotide (promoter), a transcription termination signal, ribosome binding site and translation termination signal. The expression cassette may be an expression vector form a self-replicable. In addition, the polynucleotide is introduced into a host cell in the form of itself, and may be, which is possibly connected with the operation sequence necessary for the expression in a host cell, and the like.
[66]
In addition, it means that the promoter sequence and the gene sequence to initiate and mediate the transcription of a polynucleotide encoding a specific protein of the invention in the above expectation, the term "operably linked" is functionally connected.
[67]
The term "vector" as used in the present invention means a DNA preparation comprising the nucleotide sequence of the polynucleotide encoding the desired protein operably linked to suitable control sequences so as to express the desired protein in a suitable host. The control sequences include any operator sequence, sequences that control the termination of the sequence, and a transcription and translation encoding a suitable mRNA ribosome-binding site for regulating the promoter, such that transcription can initiate transcription. Vector may then be transformed into a suitable host cell, replicate independently of the host genome, or functions, may be integrated into the genome itself.
[68]
Vector for use in the invention as long as it can replicate in a host cell is not particularly limited, it is possible to use any vector known in the art. Examples of the normal vector to be used may be a naturally occurring or recombinant plasmid of the state, cosmid, virus and bacteriophage. For example, the phage vector or course as mid vector may be used. PWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, etc. Charon4A, and Charon21A, pBR series, pUC system, pBluescriptII system as plasmid vector It may be used based pGEM, pTZ-based, such as pCL and pET-based system. Available vectors in the present invention is not particularly limited and may be a known expression vector. Specifically, it may be used pDZ, pDZTn, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector or the like.
[69]
Thus, it is possible to replace the polynucleotide encoding the target protein in the chromosome via a bacterial vector for insertion within the chromosome in a mutant polynucleotide. Insertion into the chromosome of the above polynucleotides is any method known in the art, for example, but may be made by homologous recombination, but is not limited to this. Vectors of the invention may further comprise a selectable marker (selection marker) to determine the chromosomal insertion causes homologous recombination can be inserted into the chromosome. Selectable marker is designed to determine the transfection screening the transformed cells with a vector, that is, whether the insertion of the target polynucleotide, drug resistance, nutritional requirement, given the selectable phenotype such as expression of the resistance or the surface protein on cytotoxic agent markers that can be used. Since the selective agent in a process environment (selective agent) survive only cells expressing a selectable marker, or reflect a different phenotype, it may be selected for transformed cells.
[70]
[71]
The genus Corynebacterium microorganism of the present invention further phosphorylation trans deacetylase (phosphotransacetylase) and acetate kinase (acetate kinase) operon activity, the putrescine or ornithine enhanced compared to the endogenous activity of the (pta-ackA operon) It may be Corynebacterium spp with a production capacity.
[72]
Phosphorylation trans deacetylase (phosphotransacetylase) and acetate kinase (acetate kinase) operon (pta-ackA operon) in the present invention are the acetyl -CoA produced from glucose and pyruvate metabolism is via the acetylation of conversion to acetic acid and the path thereof, in the opposite direction, the operon comprising genes reversibly mediated pathways.
[73]
Phosphorylation trans deacetylase and acid phosphatase operon In the present invention, a protein comprising the amino acid sequence of SEQ ID NO: 5 or 7, or the sequence that is at least 70%, specifically at least 80%, more specifically at least 90%, than contain no more specifically, more than 95%, even more specifically, if 98% or greater, and most specifically, a protein that is substantially the reaction medium is acetyl -CoA is produced from acetic acid as the amino acid sequence showing a homology of 99% or more restriction can.
[74]
Further, since depending on the species or strain of microorganism that if a difference exists in the amino acid sequence of a protein showing the activity, phosphorylation trans deacetylase and acid phosphatase operon in the present invention is not limited to the origin. If the amino acid sequence that has a substantially SEQ ID NO: 5 or 7 biological activity the same as or correspond to a protein of a sequence having a homology with the sequence, also the case that some sequence having a deletion, modified, substituted or added in the amino acid sequence included in the scope of the invention will be apparent.
[75]
Phosphorylation trans deacetylase and a polynucleotide encoding the acid phosphatase operon of the present invention SEQ ID NO: 5 or 7 amino acid sequence, or the sequence that is at least 70%, specifically at least 80%, more specifically at least 90%, still more specifically, less than 95%, even more particularly by at least 98%, and most specifically may comprise a polynucleotide encoding a protein showing a 99% or more homology, and most specifically of SEQ ID NO: 6 or 8 It may comprise a polynucleotide sequence.
[76]
[77]
It is the term of the present invention, "activity-enhanced" not only includes deriving the effect over the original function is increased introduced new of the protein itself, the active or, implicitly gene amplification from the increase in the intrinsic gene activity, internal or external factors, and the It includes that the activity increased by increasing the number deletions, gene copies of the inhibitory regulator of gene expression, gene introduction from the outside, deformation of the expression control sequences, in particular promoter replacement or modification and gene increased the enzyme activity by the in mutation do.
[78]
Specifically, activity increased in the present invention,
[79]
1) increasing the copy number of the polynucleotide encoding the enzyme,
[80]
2) transformation of the expression control sequences to increase the expression of the polynucleotide,
[81]
3) modification of the polynucleotide sequence on the chromosome so that the activity is enhanced in the enzyme, or
[82]
4) but it can be carried out by such method that modified to enhanced by the combination thereof, but is not limited thereto.
[83]
Wherein 1) increasing the copy number of the polynucleotide is not particularly limited, be performed as operably linked to a vector form, it can be carried out by being inserted into the chromosome in the host cell. Specifically, either a vector capable of polynucleotide is operably linked, and independent of replication and host the ability to encrypt the enzyme of the present invention can be carried out by being introduced into the host cell, the polynucleotide is operably linked to, a host a vector capable of inserting the polynucleotide into the chromosome is introduced into a host cell in the cell by being can be carried out in a way to increase the copy number of the polynucleotide within the chromosome of the host cell.
[84]
Next, 2) a poly modification of expression control sequences so as to express the increase of the nucleotides is especially useful for but not limited to, the polynucleotide sequence so as to further enhance the activity of the expression control sequence deletion, insertion, Vivo wholly or conservative substitution or a combination of the two performed by inducing a mutation on the sequence, or may be performed by replacing as a polynucleotide sequence has a stronger activity. The expression control sequence may comprise a particularly useful for but not limited to promoters, operator sequences, such as sequences that control the termination of the sequence, the transcription and translation coding for a ribosome binding site.
[85]
There is a strong heterologous promoters rather than the original promoter the upper portion of the polynucleotide expression units can be connected, examples of the strong promoter and the like CJ7 promoter, lysCP1 promoter, EF-Tu promoter, groEL promoters, aceA or aceB promoter, more specifically as is lysCP1 promoter of Corynebacterium-derived promoter (WO2009 / 096689) or the CJ7 promoter (Republic of Korea Patent No. 0,620,092 No. and WO2006 / 065095) and work is possible to connect to enhance the expression of the polynucleotide encoding the enzyme However, it not limited to this.
[86]
In addition, 3) modification of the polynucleotide sequence on the chromosome is especially useful for but not limited to, expression control polynucleotide sequence so as to further enhance the activity of the polynucleotide sequence by deletion, insertion, Vivo wholly or conservative substitution or a combination thereof performed by inducing a mutation on the sequence, or may be performed by replacing as in the polynucleotide sequence improved so as to have a stronger activity.
[87]
[88]
In particular, it is the activity of the phospholipase trans deacetylase and acid phosphatase operon (pta-ackA operon) enhanced compared to the endogenous activity in the present invention, the variation in the expression control sequence of the increase in the number within the copy of the operon cell, the operon a method of introducing a method of replacing method for replacing an expression control sequence of on the operon genes with strong active sequence, a gene coding for the chromosome of the enzyme on to the mutated gene to increase the activity of the enzyme constituting the operon and It may be formed through any one or more methods selected from the group consisting of a method of introducing a mutation into the gene on the chromosome encoding the enzyme to enhance the activity of the enzyme constituting the operon. Specifically, the phosphonate trans deacetylase and acetate kinase how to replace a gene expression control sequence of on the operon to a strong active sequences include, for example, instead of the inherent promoter of the deacetylase and acid phosphatase operon CJ7 promoter, lysCP1 promoter , EF-Tu promoter, groEL, but can be replaced with a promoter, aceA or aceB promoter, and the like.
[89]
[90]
The term "intrinsic activity" used in the present invention refers to sense the active state of the enzyme with in a state where the original microbe that is not deformed, it has been "enhanced compared to the endogenous activity", introducing the gene represents the activity or the gene the copy number is increased, deformation of the deletion or expression control sequence of the inhibitory regulatory elements of the gene expression, for microorganism after as compared to the active consisting of the operation having the microbe prior to being operation is performed, such as the use of the promoter improved example with in the active means an increased state.
[91]
[92]
In Corynebacterium microorganism of the present invention is further derived from E. coli acetyl -CoA synthase (acetyl-CoA synthetase, acs) of the number of days the genus Corynebacterium microorganism having an activity is introduced, putrescine or ornithine-producing ability have.
[93]
Acetyl -CoA synthase (acetyl-CoA synthetase, acs) in the present invention is an enzyme that mediates the reaction of acetyl -CoA are generated from ATP, acetate and CoA.
[94]
Acetyl -CoA synthase in the present invention include proteins comprising an amino acid sequence of SEQ ID NO: 9, or a sequence with 70% or more, for example 80% or more, more specifically 90% or greater, still more specifically 95% If more than, and even more specifically, the protein of more than 98%, most specifically at substantially active in mediating acetyl -CoA synthesis as an amino acid sequence showing a homology of 99% or more may be included without limitation.
[95]
Further, depending on the species or strain of microorganism because if a difference exists in the amino acid sequence of a protein showing the activity of acetyl -CoA synthase in the present invention include, for example but not limited to origin, and may be derived from E. coli . If the amino acid sequence having a biological activity substantially the same as or correspond to the protein of SEQ ID NO: 9 as a sequence having homology with said sequence, if some sequence having a deletion, modified, substituted or added in the amino acid sequence also of the present invention included in the category are self-evident.
[96]
Polynucleotide encoding an acetyl -CoA synthase of the present invention is the amino acid sequence or the sequence of SEQ ID NO: 9 and more than 70%, specifically 80% or more, more specifically 90% or greater, still more specifically 95% or more, even more specifically more than 98%, and most specifically may comprise a polynucleotide encoding a protein showing a 99% or more homology, most specifically comprise a polynucleotide sequence of SEQ ID NO: 10.
[97]
[98]
The genus Corynebacterium microorganism of the present invention may be further ornithine dicarboxylic decarboxylase (ornithine decarboxylase, ODC) Corynebacterium spp with a, putrescine or ornithine-producing ability to be activated is introduced into the.
[99]
"Dicarboxylic ornithine decarboxylase" in the present invention mediate the dicarboxylic misfire (decarboxylation) of ornithine by means of the enzyme to produce putrescine. The genus Corynebacterium microorganism which the putrescine biosynthetic enzyme, but the introduction of the ornithine decarboxylase from an external tin (ornithine decarboxylase, ODC) putrescine is discharged outside the cell gods as putrescine god synthesis. Ornithine which can be introduced from the outside of tin decarboxylase, but may be only the active Having utilized in the present invention, regardless of the microorganism-derived, can be specifically derived from E. coli is introduced.
[100]
[101]
The genus Corynebacterium microorganism of the present invention is additionally i) ornithine carbamoyl transferase dehydratase (ArgF), ii) glutamate X Porter or iii) ornithine carbamoyl transferase this endogenous activity Kinase and glutamate activity of X Porter the weakening compared, with ornithine to putrescine or production capacity can be Corynebacterium spp. In Corynebacterium can be a glutamate Expo emitter NCgl1221.
[102]
In addition, the genus Corynebacterium microorganism of the present invention additionally acetyl gamma glutamyl phosphate reductase kinase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine tin amino least one activity selected from the group consisting of azetidine transferase (ArgD) this may be a microorganism of the genus Corynebacterium having the, putrescine or ornithine-producing ability compared to their intrinsic activity.
[103]
In addition, the genus Corynebacterium, of the present invention the microorganism is further acetyl transferase activity of a kinase, in particular of the NCgl1469 activity may be the genus Corynebacterium microorganism having an attenuated than the endogenous activity, putrescine or ornithine-producing ability have.
[104]
Finally, the genus Corynebacterium microorganism of the present invention further putrescine X porter activity, specifically of the NCgl2522 active intensified endogenous activity, putrescine or ornithine producing genus Corynebacterium microorganism having the ability of one can.
[105]
[106]
It is the term of the present invention "weak activity" is reduced in the protein itself, active or inactive, as well as comprise derived the following effects inherent function, reduction of intrinsic gene activity, activation, gene of inhibiting regulatory elements of the gene expression copy number decreases, the deformation of the expression control sequence, in particular, it includes a promoter that is replaced or modified gene and its activity due to inactivation of enzyme activity or reduced by the mutation within the weakened.
[107]
Specifically, the activity of weakening in the present invention, e.g.
[108]
1) Some or all of the deletion of the polynucleotide encoding the protein,
[109]
2) transformation of the expression control sequence to reduce the expression of the polynucleotide,
[110]
3) modification of the polynucleotide sequence on the chromosome so that the activity of the protein of weakening, and
[111]
4) it can be also achieved by a method selected from a combination thereof, and the like.
[112]
Specifically, a method for deleting a part or all of the polynucleotide encoding the protein, a polynucleotide coding for my intrinsic target protein chromosome through a bacterial vector For chromosomal insertion, some polynucleotide sequence deleted polynucleotides or marker gene as it may be done by substitution. The "part" is different according to the kind of a polynucleotide but, specifically, is 1 to 300, more specifically, to 1100, and still more specifically from 1 to 50 atoms.
[113]
Further, the method of modifying the expression control sequence is performed by inducing a mutation on the controlled expression of the polynucleotide sequence to further weaken the activity of the expression control sequence by deletion, insertion, Vivo wholly or conservative substitution or a combination of these sequences or, a polynucleotide sequence having a weaker activity may be carried out by replacing. And the expression control sequence includes a sequence for controlling the sequence, and termination of transcription and decryption encoding a promoter, operator sequence, a ribosome binding site.
[114]
In addition, the method of modifying the polynucleotide sequence on the chromosome is carried out by inducing a sequence variation on the polynucleotide sequence so as to further weaken the activity of the enzyme by deletion, insertion, Vivo wholly or conservative substitution or a combination thereof, or, more weak It can be carried out by changing to a polynucleotide sequence so as to have the improved activity.
[115]
In addition, the method for deleting a regulator for suppressing the expression of the polynucleotides of the enzyme may be performed by replacing the polynucleotide of the expression inhibitor with some polynucleotides polynucleotide or a marker gene sequence is deleted. The "part" is different according to the kind of a polynucleotide but, specifically to 1300, in particular from 1 to 100, and more specifically, from 1 to 50 atoms.
[116]
[117]
In this case, the acetyl-gamma-glutamyl-phosphate reductase kinase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase (ArgB), acetyl ornithine aminotransferase (ArgD), ornithine carbamoyl transferase dehydratase (ArgF), proteins, and ornithine decarboxylase (ODC) which is involved in the glutamate discharged is not particularly limited, specifically, the respective SEQ ID nO: 32, 33, 34, 35, 36, 37 or 38 or the amino acid sequence of this 70%, more specifically at least 80%, and more specifically may include an amino acid sequence having 90% or more homology. In addition, putrescine crystallized acetyl put proteins, particularly, but not limited to, specifically, SEQ ID NO: 30 or 31 amino acid sequence or in this way 70% or more, more specifically at least 80%, more specifically at least 90% homologous having a can comprise the amino acid sequence.
[118]
In addition, in the present invention putrescine Expo emitter SEQ ID NO: 26 or a 28 amino acid sequence, or the 70% or more, more specifically 80% or more, and more particularly may comprise an amino acid sequence having at least 90% homologous .
[119]
[120]
Acetyl-gamma-glutamyl-phosphate reductase kinase in the protein (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase (ArgB), acetyl ornithine aminotransferase (ArgD), ornithine decarboxylase (ODC) and putrescine is an active reinforcement of X Porter, e.g. copy increasing the number of polynucleotides encoding the protein, variant, the enzyme of the expression control sequence that the expression of the polynucleotide increase such that the enhanced activity can be accomplished by a method selected from the deformation of the polynucleotide sequence on the chromosome, deletion, and combinations of the control factors for inhibiting the expression of a polynucleotide of the enzyme.
[121]
[122]
Further, ornithine carbamoyl transferase dehydratase (ArgF), and proteins involved in the release of glutamate, and putrescine put active weakening of the crystallized-acetyl protein, some or all of the deletion of the polynucleotide encoding the protein, the poly modification of expression control sequence to reduce the expression of the nucleotide, the modification of the polynucleotide sequence on the chromosome so that the activity deterioration of the protein, and can be accomplished by a method selected from a combination of the two.
[123]
[124]
In yet one aspect, the present invention
[125]
(I) culturing in a medium a microorganism of the genus Corynebacterium having the putrescine-producing ability or ornithine; And
[126]
(Ii) provides, putrescine or ornithine method of production comprises the step of recovering the putrescine or ornithine from the medium or the cultured microorganism.
[127]
[128]
In the method, the method comprising culturing the microorganism in a culture medium, and may be particularly, but not limited thereto, carried out by the known batch culture method, the continuous culture method, a fed-batch culture method. At this time, the culture conditions, particularly for but not limited to, a basic compound to an appropriate pH using: (phosphoric acid or sulfuric acid for example) (for example, pH 5 to 9, in particular (for example, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound It is pH 6 to 8, most specifically, and to adjust the pH 6.8), oxygen or oxygen-introducing the gas containing the mixture to the culture and maintain the aerobic conditions, the culture temperature is 20 to 45 ℃, specifically 25 to keep to 40 ℃, and it is preferable to incubate for from about 10 to 160 hours. The cost of production by the culture putrescine or ornithine residues can be secreted into the culture medium or into the cell.
[129]
In addition, the sugar is as a carbon source in the medium for culturing is used, and carbohydrates (e.g., glucose, sucrose trehalose, lactose, fructose, maltose, know three, starch and cellulose), maintenance, and fat (such as soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (for example, glycerol and ethanol) and organic acids (e.g. acetic acid) can be used by using individually or mixed, such as, but , but it is not limited thereto. In addition, the nitrogen source of the medium for the culture used is a nitrogen-containing organic compounds (e.g., peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean bakbun and urea), or inorganic compounds (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, but can be used separately or used as a mixture of ammonium carbonate and ammonium nitrate), but is not limited thereto. As a source of a medium for the culture to be used is phosphoric acid, but can be used with or mixture of potassium hydrogen phosphate, potassium susoyi, such as the corresponding sodium-containing salt thereto separately, but is not limited thereto. In addition, the medium for the culture to be used and other metal salts (such as magnesium sulfate or iron sulfate), essential amino acids, and growth, such as vitamins - but may further comprise a promoting material is not limited thereto.
[130]
The method for recovering a putrescine or ornithine produced in the incubation step of the invention the culture process, such as object from a batch, continuous or fed-batch culture in the art using a suitable method known in the art according to the culture method an amino acid that can be collected.
[131]
Mode for the Invention
[132]
And in more details below the present invention through the embodiments. However, these examples are intended to illustrate the invention by way of example, it is not the scope of the present invention is limited to these Examples.
[133]
[134]
Example 1: E. coli-derived argA and the E. coli origin of argE putrescine -producing strain, and the introduction thereof within the new check putrescine-producing ability
[135]
[136]
1-1. ATCC13032 -based putrescine production strains transposon derived from E. coli genes into the E. coli-derived argE argA and production of the co-introduced strain
[137]
[138]
To confirm that the Corynebacterium glutamicum ATCC13032 based putrescine-producing strain putrescine improves performance produced by inserting the E. coli-derived argA and derived from E. coli argE gene on, it was introduced into the argA and argE into the transposon gene of the strains.
[139]
Corynebacterium transfected with vector for the conversion enabling the chromosomal genes introduced by using the transmitter pojon gene regions of Solarium spp was used as the pDZTn (WO 2009/125992), a promoter is lysCP1 promoter (International Patent Publication WO 2009 / 096 689, was used to SEQ ID NO: 39).
[140]
Specifically, the N- acetyl glutamate synthase (N-acetylglutamate synthase) the polynucleotide sequence of E. coli-derived gene argA coding (SEQ ID NO: 2) backbone in SEQ ID NO: 11 and 12 to obtain a homologous recombination fragment of the ORF region of argA a pair of primers were prepared. In addition, making a pair of primers of SEQ ID NOS: 15 and 16 for obtaining the acetyl ornithine deacetylase of E. coli-derived gene encoding a (Acetylornithine deacetylase) argE polynucleotide sequence (SEQ ID NO: 4) homologous recombination fragment of argE ORF site stems from the It was was produced in the polynucleotide sequence a pair of primers of SEQ ID NOS: 13 and 14 to obtain a homologous recombination fragment of lysCP1 area stems from the (SEQ ID NO: 39) of lysCP1 (International Patent Publication WO 2009-096689) (Table 1).
[141]
[142]
TABLE 1
primer Sequence (5 '-> 3')
PlysC-argA-F (SEQ ID NO: 11) GAAAGGTGCACAAAGATGGTAAAGGAACGTAAAACCG
Tn-argA-RXh (SEQ ID NO: 12) GCCCACTAGTCTCGAGCATGCGGCGTTGATTTTG
Tn-PlysC-FXh (SEQ ID NO: 13) GAATGAGTTCCTCGAGCCGATGCTAGGGCGAAAA
PlysC-R (SEQ ID NO: 14) CTTTGTGCACCTTTCGATCTACGTGCTGACAGTTAC
PlysC-argE-F (SEQ ID NO: 15) GAAAGGTGCACAAAGATGAAAAACAAATTACCGCC
Tn-argE-RXh (SEQ ID NO: 16) GCCCACTAGTCTCGAGGTTTGAGTCACTGTCGGTCG
[143]
[144]
First, in order to obtain the argA gene, the E. coli chromosome using the primers of the mold in SEQ ID NO: 11 and 12, the strain W3110 was amplified gene fragment of about 1.6kb. At this time, PCR reaction was repeated for 1 minute 30 seconds 30 times in the process of elongation 95 ℃ for 30 seconds denaturation, annealing, and 72 seconds at 30 ℃ in 55 ℃. Then, the PCR product by electrophoresis on a 0.8% agarose gel and purified by eluting the band of the desired size.
[145]
Also, KCCM10919P (International Patent Publication WO 2009-096689) a chromosome of the strain as a template and using SEQ ID NO: 13 to 14 of a pair of primers modified at the 95 ℃ 30 seconds, 55 ℃ a 30 second process in 30 seconds and annealing at 72 ℃ repeated 30 times to obtain a promoter region lysCP1.
[146]
pDZTn vector was cloned fusion of each PCR product was treated with XhoI and obtained in the above. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). The plasmid obtained as a result was named pDZTn-lysCP1-argA.
[147]
[148]
In order then to obtain the argE gene, a PCR product was obtained by amplifying a gene fragment of about 1.4kb, using the same method as Escherichia coli SEQ ID NO: 15 and 16, the primer pair as a template a chromosome of the W3110 strain with the said promoter lysCP1 Fusion was cloned and the region. The plasmid obtained as a result was named pDZTn-lysCP1-argE.
[149]
[150]
Next, by introducing the plasmid pDZTn-lysCP1-argA by electroporation (electroporation) to KCCM11240P (Republic of Korea Patent Publication No. 10-2013-0082478 call) to give a transformant, and kanamycin (25 ㎍ the transformant on / ㎖) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) in which it contains by plated and cultured to form colonies. Among colonies formed therefrom by selecting colonies of blue color were selected for transformed strains with plasmid-lysCP1 pDZTn-argA is introduced.
[151]
The selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), each 10 -4 from 10 -10 were diluted in order to spread on solid media containing X-gal, and cultured to form colonies. By selecting the white colonies indicated by a relatively low rate from the formed colonies were screened for the final strain is introduced gene encoding the argA by a secondary cross (crossover). Confirmed that using the SEQ ID NO: 12 and 13, the primer pair targeted at the finally selected strains Gene encoding the argA by performing PCR, and the Corynebacterium glutamicum mutant KCCM11240P Tn: named lysCP1-argA It was.
[152]
[153]
For introducing the argE in the production of argA introduced strain, a KCCM11240P Tn the pDZTn-lysCP1-argE in the same manner as in the production earlier: was transformed to lysCP1-argA, intended for the finally selected strains SEQ ID NO: 13 and 16 by using a pair of primers for PCR was performed confirming my argE introduced transposon.
[154]
The Corynebacterium glutamicum mutant selection from which KCCM11240P Tn: was named lysCP1-argE: lysCP1-argA Tn.
[155]
[156]
1-2. ATCC13869 -based putrescine production strains transposon derived from E. coli genes into the E. coli-derived argE argA and production of the co-introduced strain
[157]
[158]
[159]
Corey the Corynebacterium glutamicum ATCC13869 based putrescine-producing strain of DAB12-a ΔNCgl1469 (Republic of Korea Patent Publication No. 10-2013-0082478 call) the DAB12-b termed, and E. coli-derived argA and argE gene derived from E. coli inserted in order to determine whether putrescine involved in the production performance improvements were introduced argA and argE gene within the transposon.
[160]
[161]
First was a pDZTn-lysCP1-argA produced before transformed into Corynebacterium glutamicum DAB12-b in the same manner as in Example 1-1, it was confirmed that the introduction of the transposon in argA. The Corynebacterium glutamicum mutant selection from which to be introduced argA DAB12-b Tn: was named lysCP1-argA.
[162]
For then introducing the argE in the production strain with the argA it introduced, a pDZTn-lysCP1-argE produced before DAB12 Tn-b in the same manner as Example 1-1: was transformed to lysCP1-argA, within the transposon it was confirmed that argE was introduced. The Corynebacterium glutamicum mutant selection from which DAB12-b Tn: was named lysCP1-argE: lysCP1-argA Tn.
[163]
[164]
1-3. E. coli-derived argA and E. coli-derived argE gene is introduced putrescine putrescine production capacity assessment of the production strain Corynebacterium
[165]
[166]
To putrescine is derived from E. coli argA and argE derived from E. coli introduction to the new production strains to confirm the effect of putrescine on the new production, for a mutant strain of Corynebacterium glutamicum prepared in Example 1-1 and 1-2 as it compared to putrescine-producing ability.
[167]
[168]
Specifically, in Example 1-1, and four stiffness of the two kinds of production in 1-2 tumefaciens glutamicum mutant (KCCM11240P Tn: lysCP1-argA Tn:; lysCP1-argE DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) and the parent strain of two (KCCM11240P; DAB12-b) for each 1 mM arginine-containing CM plate medium (glucose 1%, polypeptone 1%, yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea and plated on 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L standard) were incubated at 30 ℃ for 24 hours.
[169]
Each strain cultured therefrom titer medium (Glucose 8% of 25 ml, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 · 7H 2 O 0.05%, urea 0.15%, biotin 100 μg, thiamine hydrochloride 3 mg, calcium pantothenate 3 mg, nicotinamide 3 mg, CaCO 3 5%, and then a platinum-inoculation about a 1 L standard) it in 30 ℃ 200 rpm the cultured with shaking for 98 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measuring the concentration of putrescine produced from each of the cultures, and the results are shown in Table 2 below.
[170]
[171]
TABLE 2
Strain name 퓨 트레 신 (g / L)
KCCM 11240P 12.2
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE 13.4
DAB12-b 13.3
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE 14.6
[172]
[173]
As shown in Table 2, it was confirmed that Escherichia coli-derived argA and argE gene derived from E. coli are the two kinds of Corynebacterium glutamicum putrescine production in both mutant strains introduced at the same time the hayeoteum more than 9.8%.
[174]
[175]
Example 2: E. coli-derived argA and derived from E. coli argE is introduced putrescine production pta-ackA enhanced strain and its putrescine production capacity OK
[176]
[177]
2-1. ATCC13032 -based putrescine production strains pta- ackA production of the promoter-substituted strain
[178]
[179]
To enhance the Example 1 derived from E. coli argA and E. coli-derived additional phosphorylation trans deacetylase (phosphotransacetylase) and acetate kinase (acetate kinase) (pta-ackA) active in the argE gene is introduced putrescine-producing strain produced in neunge its putrescine production was undertaken to determine the impact.
[180]
To this end, the promoter of the pta-ackA operon within a chromosome was introduced lysCP1 promoter (International Patent Publication WO 2009/096689) in front of the start codon as a strong promoter activity than the inherent promoter, specifically.
[181]
[182]
First, lysCP1 containing the promoter, and each end terminal portion of the promoter was obtained by homologous recombination with the original fragment of the sequence on the chromosome pta-ackA. Specifically, the 5'-end of the promoter region lysCP1 was obtained by performing PCR using the primer pair of Corynebacterium glutamicum ATCC13032 SEQ ID NO: genomic DNA as the template 17 and 18. At this time, PCR reaction is a 30 second denaturation, 55 ℃ 30 seconds elongation process in 30 seconds annealing and 72 ℃ in 95 ℃ was repeated 30 times.
[183]
[184]
Also, lysCP1 promoter region is in SEQ ID NO: 14 and using a primer pair 19 was obtained by performing PCR under the same conditions, the 3'-terminal part of lysCP1 promoter of Corynebacterium glutamicum ATCC13032 genomic DNA template of using the primer pair SEQ ID NO: 20 and 21 was obtained by performing PCR under the same conditions. The primers used to obtain the promoter is as shown in Table 1 to Table 3, and.
[185]
[186]
TABLE 3
primer Sequence (5 '-> 3')
Pro-pta-FX (SEQ ID NO: 17) CCGGGGATCCTCTAGAGGGGTTCTAAAAAATGTGGAGT
pta-PlysC-R (SEQ ID NO: 18) GCCGTGCTTTTCGCCCTAGCATCGGACATCGCCTTTCTAATTT
PlysC-F (SEQ ID NO: 19) CCGATGCTAGGGCGAAAAGCACGGC
PlysC-pta-ackA-F (SEQ ID NO: 20) GAAAGGTGCACAAAGATGTCTGACACACCGACCTCAGCTC
Pro-pta-RX (SEQ ID NO: 21) GCAGGTCGACTCTAGATTATCCGGCATTGGCTCT
[187]
[188]
Each PCR product obtained above was cloned fusion with the pDZ vector treated with XbaI. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). The plasmid obtained as a result was named pDZ-lysCP1-1'pta-ackA.
[189]
[190]
Each electroporation in lysCP1-argE (: the plasmid pDZ-lysCP1-1'pta-ackA prepared in KCCM11240P and carrying a Corynebacterium glutamicum mutant KCCM11240P Tn produced in Example 1-1: lysCP1-argA Tn electroporation) to obtain a transformant by introducing into, and kanamycin (25 ㎍ / ㎖) and X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) it is contained BHIS plate the transformant medium to form colonies by culturing the plated on (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%). Among colonies formed therefrom by selecting colonies of blue color it was selected for the plasmid pDZ-lysCP1-1'pta ackA-introduced strain.
[191]
[192]
The selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), each 10 -4 from 10 -10 were diluted in order to spread on solid media containing X-gal, and cultured to form colonies. By selecting the white colonies that appears at a relatively low rate, from the formed colony it was selected a strain finally ackA-pta promoter is substituted with lysCP1 by a secondary cross (crossover).
[193]
Intended for the finally selected strains using the SEQ ID NO: 19 and 21, the primer pair by performing a PCR it was confirmed that the introduction of the promoter in front lysCP1 in pta-ackA initiation codon chromosome. The PCR reaction is a height course of 1 minute denaturation at 95 ℃ for 30 seconds, at 55 ℃ in 30 seconds annealing and 72 ℃ was repeated 30 times.
[194]
A Corynebacterium glutamicum mutants selected therefrom, respectively KCCM11240P lysCP1-1'pta-ackA and KCCM11240P Tn: was named lysCP1-argE lysCP1-1'pta-ackA: lysCP1-argA Tn.
[195]
[196]
2-2. ATCC13869 -based putrescine producing Corynebacterium pta- strains ackA production of the promoter-substituted strain
[197]
[198]
Using the methods disclosed in Examples 2-1, Corynebacterium glutamicum ATCC13869 To confirm the gene and the protein sequence expressed therefrom encoding the derived pta-ackA, Corynebacterium glutamicum ATCC13869 genome of the DNA as a template and SEQ ID NO: PCR was performed using the primer pair 17 and 22 (Table 3, Table 4). At this time, PCR reaction is a process of elongation at 95 modified in ℃ 30-second, 30-second annealing at 55 ℃ and 72 ℃ 3 minutes was repeated 30 times.
[199]
After separation of the PCR products obtained therefrom by gel electrophoresis results of the sequence analysis, the gene encoding the Corynebacterium glutamicum pta-ackA the ATCC13869-derived comprises a polynucleotide sequence represented by SEQ ID NO: 8, and , protein encoded therefrom confirmed that comprises an amino acid sequence represented by SEQ ID NO: 7.
[200]
On the other hand, Corynebacterium glutamicum amino acid sequence of ATCC13032 origin of pta-ackA (SEQ ID NO: 5) and Corynebacterium glutamicum ATCC13869 origin of pta-ackA Comparison of the amino acid sequence, all of which are phase of 99.4% sequence it was confirmed that it has the same sex.
[201]
[202]
TABLE 4
primer Sequence (5 '-> 3')
Pta-ackA-R (SEQ ID NO: 22) TGCAGTTTCACCCCTTAA
13869_pta-PlysC-R (SEQ ID NO: 23) GCCGTGCTTTTCGCCCTAGCATCGGACATCGCCTTTCTAGTTT
[203]
[204]
First, lysCP1 containing the promoter, and each end terminal portion of the promoter was obtained by homologous recombination with the original fragment of the sequence on the chromosome pta-ackA. Specifically, the 5'-end of the promoter region lysCP1 was obtained by performing PCR using the primer pair of Corynebacterium glutamicum ATCC13869 SEQ ID NO: genomic DNA as the template 17 and 23. At this time, PCR reaction is a 30 second denaturation, 55 ℃ 30 seconds elongation process in 30 seconds annealing and 72 ℃ in 95 ℃ was repeated 30 times. Also, lysCP1 promoter region is in SEQ ID NO: 14 and using a primer pair 19 was obtained by performing PCR under the same conditions, the 3'-terminal part of lysCP1 promoter of Corynebacterium glutamicum ATCC13869 genomic DNA template of using the primer pair SEQ ID NO: 20 and 21 was obtained by performing PCR under the same conditions. The primers used for promoter substitution are shown in Table 1, Table 3 and Table 4.
[205]
Each PCR product obtained above was cloned fusion with the pDZ vector treated with XbaI. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). The plasmid obtained as a result was named pDZ-lysCP1-2'pta-ackA.
[206]
The plasmid pDZ-lysCP1-2'pta-ackA prepared in the same manner as in Example 2-1-b and DAB12 a Corynebacterium glutamicum mutant Tn DAB12-b prepared in the above Example 1-2 : it was confirmed that each transfection is lysCP1-argE lysCP1 promoter introduced before the start codon in ackA-pta chromosome by switching on: lysCP1 argA-Tn. The Corynebacterium glutamicum mutants each DAB12-b lysCP1-2'pta-ackA and DAB12-b Tn: was named lysCP1-argE lysCP1-2'pta-ackA: lysCP1-argA Tn.
[207]
[208]
2-3. Putrescine production capacity rating of pta-ackA enhanced strain
[209]
[210]
In order to confirm the effect of pta-ackA enhanced effect in argA derived from E. coli and the E. coli origin of putrescine-producing strain introduced argE, intended for a mutant strain of Corynebacterium glutamicum prepared in the above Examples 2-1 and 2-2 as it compared to putrescine-producing ability.
[211]
Specifically, four kinds of Corynebacterium glutamicum mutant (KCCM11240P lysCP1-1'pta-ackA; KCCM11240P Tn : lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA; DAB12-b lysCP1-2 ' pta-ackA; DAB12-b Tn : lysCP1-argA Tn: lysCP1-argE lysCP1-2'pta-ackA) and the parental strain four kinds (KCCM11240P; KCCM11240P Tn: lysCP1- argA Tn: lysCP1-argE; DAB12-b; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) for each 1 mM arginine-containing CM plate medium (glucose 1%, polypeptone 1% , yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, and plated on 50% NaOH 100 ㎕, agar 2 %, pH 6.8, 1 L standard) were incubated at 30 ℃ for 24 hours. Each strain cultured therefrom titer medium (Glucose 8% of 25 ml, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 · 7H 2 O 0.05%, urea 0.15%, biotin 100 μg, thiamine hydrochloride 3 mg, calcium pantothenate 3 mg, nicotinamide 3 mg, CaCO 3 5%, and then a platinum-inoculation about a 1 L standard) it in 30 ℃ 200 rpm the cultured with shaking for 98 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measuring the concentration of putrescine produced from each of the cultures and were shown in the results in Table 5.
[212]
[213]
Table 5
Strain name 퓨 트레 신 (g / L)
KCCM 11240P 12.2
KCCM 11240P lysCP1-1'pta-ackA 12.3
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE 13.4
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA 14.1
DAB12-b 13.3
DAB12-b lysCP1-2'pta-ackA 13.4
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE 14.6
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-2'pta-ackA 15.2
[214]
[215]
As it is shown in Table 5, putrescine production when sikyeoteul strengthen each pta-ackA in KCCM 11240P and DAB12-b was the same level. However, derived from E. coli argA and derived from E. coli argE gene is the two kinds introduced at the same time (KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) Corey four of tumefaciens glue Tommy when sikyeoteul strengthen each pta-ackA in glutamicum mutant putrescine production was confirmed that it has more than 14.3% compared to the parental strain. In addition, it was confirmed that the mutant with reference hayeoteum is more than 4%.
[216]
Thus, the present inventors putrescine-producing strain Corynebacterium glutamicum introduced into the E. coli-derived argA and E.coli activity of the derived argE in KCCM 11240P and pta-ackA activate the enhanced putrescine productivity is improved the Corynebacterium of in microorganisms (Corynebacterium glutamicum KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE: lysCP1-1'pta-ackA) to the Korea Culture Center of microorganisms as named and dated November 21, 2014 under the Budapest Treaty CC01-1145 (Korean Culture accession to the Center of Microorganisms, KCCM) and were given an accession number KCCM11606P.
[217]
[218]
Example 3: E. coli-derived argA and E. coli-derived argE the introduction of the putrescine -producing strain introduced into E. coli derived careful acs and its putrescine production capacity OK
[219]
[220]
3-1. ATCC13032 -based putrescine production strains transposon production of E. coli strains introduced into the genes derived acs
[221]
[222]
For the introduction of E. coli-derived argA and argE derived from E. coli is introduced into the ATCC13032-based putrescine derived from E. coli in the new production strain acetyl -CoA synthase (acetyl-CoA synthetase, acs) gene To determine whether putrescine improve production capability, using lysCP1 promoter was introduced into the transposon in the gene acs.
[223]
Specifically, to obtain a polynucleotide stems from the sequence of the acs ORF region SEQ ID NO: to obtain a homologous recombination fragment 24 and 25 of the primer pairs and the homologous recombination fragment of lysCP1 region described in SEQ ID NO: 10 of the gene encoding the acs the primer pair SEQ ID NO: 13 and 14 were prepared as shown in Table 1 and Table 6 below.
[224]
[225]
TABLE 6
primer Sequence (5 '-> 3')
PlysC-acs-F (SEQ ID NO: 24) GAAAGGTGCACAAAGATGAGCCAAATTCACAAA
Tn-acs-RXh (SEQ ID NO: 25) GCCCACTAGTCTCGAGAAGGCGTTTACGCCGCATCC
[226]
[227]
Specifically, in order to obtain the acs gene, E. coli using the SEQ ID NO: 24 and 25, the primer pair as a template a chromosome of a W3110 strain was amplified gene fragment of approximately 2kb. At this time, PCR reaction was repeated for 1 minute 30 seconds 30 times in the process of elongation 95 ℃ for 30 seconds denaturation, annealing, and 72 seconds at 30 ℃ in 55 ℃. Then, the PCR product by electrophoresis on a 0.8% agarose gel and purified by eluting the band of the desired size.
[228]
In addition, the promoter region is lysCP1 KCCM10919P (International Patent Publication WO 2009/096689) the chromosome of the strain as a template, SEQ ID NO: 13 and 14 of a pair of primers for annealing and 72 ℃ at 95 ℃ in a 30 second denaturation, 55 ℃ 30 seconds using a 30 second process, was obtained by repeating 30 times.
[229]
pDZTn vector was cloned fusion of each PCR product was treated with XhoI and obtained in the above. Fusion-cloning In Fusion ® was used as HD Cloning Kit (Clontech). The plasmid obtained as a result was named pDZTn-lysCP1-acs.
[230]
[231]
Introduced into each electroporation for lysCP1-argE (electroporation): Next, the plasmid pDZTn-lysCP1-acs KCCM11240P and Examples 1-1 a Corynebacterium glutamicum mutant KCCM11240P Tn produced by: Tn argA-lysCP1 the transformant obtained, and kanamycin to the transformant (25 ㎍ / ㎖) to the X-gal (5-bromo-4-chloro-3-indolin-D-galactoside) containing the BHIS plate medium (Braine heart and plated on infusion 37 g / l, sorbitol 91 g / l, agar 2%) to form colonies by culturing. Among colonies formed therefrom by selecting colonies of blue color it was selected for the plasmid pDZTn-lysCP1-acs is introduced strain.
[232]
The selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), each 10 -4 from 10 -10 were diluted in order to spread on solid media containing X-gal, and cultured to form colonies. By selecting the white colonies indicated by a relatively low rate from the formed colonies were screened for the final strain is introduced gene encoding the acs by a secondary cross (crossover). Intended for the finally selected strains using the SEQ ID NO: 13 and 25, the primer pair do the PCR to confirm that the gene was introduced encoding the acs, said Corynebacterium Tommy glutamicum mutants each KCCM11240P Tn: lysCP1-acs and KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE Tn: it was named lysCP1-acs.
[233]
[234]
3-2. ATCC13869 -based putrescine production strains transposon production of E. coli strains introduced into the genes derived acs
[235]
[236]
As in the aforementioned embodiments 3-1, wherein the produced pDZTn-lysCP1-acs DAB12-b and carried by the same manner as in Example 3-1 produced in Example 1-2 Corynebacterium glutamicum mutant DAB12- b Tn: lysCP1-argA Tn: each transformant was converted to lysCP1-argE, it was confirmed that transposon is introduced within the acs.
[237]
A Corynebacterium glutamicum mutants selected therefrom, respectively DAB12-b Tn: was named acs-lysCP1: lysCP1-acs and DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE Tn.
[238]
[239]
3-3. Putrescine-producing ability of Escherichia coli-derived rating acs introduced strain
[240]
[241]
In order to confirm the effect on the acs introduced in E. coli and the E. coli origin derived argA the putrescine-producing strain introduced argE, intended for a mutant strain of Corynebacterium glutamicum prepared in the above Examples 3-1 and 3-2 Pew Tre compared the new production capacity.
[242]
[243]
Specifically, four kinds of Corynebacterium glutamicum mutant (KCCM11240P Tn: lysCP1-acs; KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs; DAB12-b Tn: lysCP1-acs; DAB12- b Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs) and four species of the parent strain (KCCM11240P; KCCM11240P Tn: lysCP1- argA Tn: lysCP1-argE; DAB12-b; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) for each 1 mM arginine-containing (glucose 1% CM plate medium, polypeptone 1%, yeast extract 0.5 %, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2 %, and plated on pH 6.8, 1 L standard) were incubated at 30 ℃ for 24 hours. Each strain cultured therefrom titer medium (Glucose 8% of 25 ml, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 · 7H 2 O the pantothenic acid 3 mg, nicotinamide 3 mg, CaCO3 5%, 1 L reference) a 200 rpm them at 30 ℃ then platinum is inoculated so on - 0.05%, urea 0.15%, biotin 100 μg, thiamine hydrochloride 3 mg, calcium shaken and incubated for 98 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measuring the concentration of putrescine produced from each of the cultures and were shown in the results in Table 7.
[244]
[245]
Table 7
Strain name 퓨 트레 신 (g / L)
KCCM 11240P 12.2
KCCM 11240P Tn:lysCP1-acs 12.2
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE 13.4
KCCM11240P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs 13.9
DAB12-b 13.3
DAB12-b Tn:lysCP1-acs 13.2
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE 14.6
DAB12-b Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs 15.1
[246]
[247]
As it is shown in Table 7, putrescine production when sikyeoteul introducing each acs on KCCM 11240P and DAB12-b was the same level. However, derived from E. coli argA and derived from E. coli argE gene is the two kinds introduced at the same time (KCCM11240P Tn: lysCP1-argA Tn: lysCP1-argE; DAB12-b Tn: lysCP1-argA Tn: lysCP1-argE) Corey four of tumefaciens glue Tommy when sikyeoteul introducing each acs on glutamicum mutant putrescine production was confirmed that it has more than 13.5% as compared to the parental strain. Also was confirmed that, hayeoteum more than 3.4%, rather than the mutant.
[248]
[249]
Example 4: putrescine discharge capability increased putrescine -producing strain derived from E. coli argA, introduced in argE, ackA-pta promoter and its substituted putrescine production capacity OK
[250]
[251]
4-1. Putrescine discharge capability increased E. coli strains derived from the argA , argE production and introduction of pta-ackA promoter substituted strain
[252]
[253]
Putrescine emissions increased KCCM11401P (Republic of Korea Patent Publication No. 10-2014-0115244 Ho) of E. coli-derived based on the strain derived from E. coli argE and argA introduced and improves performance by Corey four active reinforcement of pta-ackA putrescine production capability In order to ensure that, to prepare the strain.
[254]
Specifically, in Example 1-1 a Corynebacterium a pDZTn-lysCP1-argA making transformed KCCM11401P in the same manner as in Example 1-1 to confirm that the introduction of the transposon within the argA and selected therefrom in Solarium the glutamicum mutant KCCM11401P Tn: was named lysCP1-argA.
[255]
In addition, the Examples 1-1 the argA introduced KCCM11401P Tn a pDZTn-argE-lysCP1 prepared in Example 1-1 in order to introduce the argE strain produced in the same manner: by transforming the argA-lysCP1 transposon within argE confirming that the introduction and the Corynebacterium glutamicum mutant selection from which KCCM11401P Tn: was named lysCP1-argE: lysCP1-argA Tn.
[256]
Next, the embodiment of a pDZ-lysCP1-1'pta ackA-2-1 produced in the same manner as in Example 2-1 KCCM11401P Tn: lysCP1-argA Tn: by transforming the lysCP1-argE chromosome within pta- ackA lysCP1 front of the initiation codon was confirmed that the promoter is introduced. The Corynebacterium glutamicum mutant KCCM11401P Tn: lysCP1-argA Tn: lysCP1-argE was named lysCP1-1'pta-ackA.
[257]
[258]
4-2. Putrescine discharge capability increased E. coli strains derived from the argA , argE introduced and ackA-pta promoter putrescine-producing ability Strain Evaluation of substituted
[259]
[260]
Putrescine to discharge the increased stiffness ability Corynebacterium glutamicum to confirm the effect is derived from E. coli argA and argE derived from E. coli and introduction of active reinforcement of pta-ackA on the producing strain, a Corey prepared in the above Examples 4-1 intended for Corynebacterium glutamicum mutant compared putrescine-producing ability.
[261]
Specifically, Corynebacterium glutamicum mutants to (KCCM11401P Tn: lysCP1-argE lysCP1-1'pta -ackA lysCP1-argA Tn: lysCP1-argE, KCCM11401P Tn:: lysCP1-argA Tn) and the parental strain (KCCM11401P) each 1 mM arginine-containing CM plate medium (glucose 1%, polypeptone 1% , yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L and plated on standard) it was incubated at 30 ℃ for 24 hours. Each strain cultured therefrom titer medium (Glucose 8% of 25 ml, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 · 7H 2 O 0.05%, urea 0.15%, biotin 100 μg, thiamine hydrochloride 3 mg, calcium pantothenate 3 mg, nicotinamide 3 mg, CaCO 3 5%, and then a platinum-inoculation about a 1 L standard) it in 30 ℃ 200 rpm the cultured with shaking for 98 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measuring the concentration of putrescine produced from each of the cultures and were shown in the results in Table 8.
[262]
[263]
Table 8
Strain name 퓨 트레 신 (g / L)
KCCM11401P 11.8
KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE 13.2
KCCM11401P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA 13.7
[264]
[265]
When sikyeoteul strengthening, putrescine discharge capability enhanced KCCM11401P derived from E. coli argA and derived from E. coli when introducing the argE gene, the increase in the parent strain compared to yields of 11.9%, and further pta-ackA in As shown in Table 8, the parental strain this was confirmed over hayeoteum production increased by 16.1%.
[266]
[267]
Example 5: ornithine producing strain derived from E. coli in argA and derived from E. coli argE introduced and confirmation thereof ornithine-producing ability
[268]
[269]
5-1. KCCM11137P based ornithine producing strain transposon produced in E. coli origin of the gene into the argA and argE co-introduced strain derived from E. coli
[270]
[271]
For Corynebacterium glutamicum ATCC13032 and based ornithine producing strain of KCCM11137P (Republic of Korea Patent No. 10-1372635 call) derived from E. coli argA and argE gene derived from E. coli in the insert to ensure that the improved ability ornithine production, Example by using the vector prepared in 1-1 it was introduced into the argA and argE gene in the transposon.
[272]
First, by performing the introduction of electroporation (electroporation) a plasmid-argA pDZTn-lysCP1 prepared in Example 1-1 to obtain a transformant, and KCCM11137P, kanamycin the transformant (25 ㎍ / ㎖) and X-gal (5-bromo-4-chloro-3-indolin - D-galactoside) and contains a BHIS spread on plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, agar 2%) colonies by culturing to form. Among colonies formed therefrom by selecting colonies of blue color it was selected for the plasmid pDZTn-lysCP1 argA-introduced strain.
[273]
The selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), each 10 -4 from 10 -10 were diluted in order to spread on solid media containing X-gal, and cultured to form colonies. By selecting the white colonies indicated by a relatively low rate from the formed colonies were screened for the final strain is introduced gene encoding the argA by a secondary cross (crossover). Confirmed that using the SEQ ID NO: 12 and 13, the primer pair targeted at the finally selected strains Gene encoding the argA by performing PCR, and the Corynebacterium glutamicum mutant KCCM11137P Tn: named lysCP1-argA It was.
[274]
To introduce the argE making the argA introduced strain, in Example 1-1 by the pDZTn-lysCP1-argE same manner as KCCM11137P Tn produced by: it was confirmed that by transforming the argA-lysCP1 in argE transposon is introduced.
[275]
The Corynebacterium glutamicum mutant selection from which KCCM11137P Tn: was named lysCP1-argE: lysCP1-argA Tn.
[276]
[277]
5-2. E. coli-derived argA and E. coli-derived argE gene is introduced Corey four ornithine for ornithine producing strain production capacity evaluation
[278]
[279]
In order to confirm the effect of ornithine during production argA and argE introduced in ornithine producing strain, ornithine intended for a mutant strain of Corynebacterium glutamicum prepared in Example 5-1 were compared to tin-producing ability.
[280]
Specifically, one type of Corynebacterium glutamicum mutant (KCCM11137P Tn: lysCP1-argA Tn : lysCP1-argE) and the parent strain (KCCM11137P) one kind of each of 1 mM arginine-containing CM plate medium (glucose 1%, and plated on polypeptone 1%, yeast extract 0.5% , beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 ㎕, agar 2%, pH 6.8, 1 L standard) were incubated at 30 ℃ for 24 hours . Each strain cultured therefrom titer medium (Glucose 8% of 25 ml, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 · 7H 2 O 0.05%, urea 0.15%, biotin 100 μg, thiamine hydrochloride 3 mg, calcium pantothenate 3 mg, nicotinamide 3 mg, CaCO 3 5%, and then a platinum-inoculation about a 1 L standard) it in 30 ℃ 200 rpm the cultured with shaking for 98 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measuring the concentration of ornithine produced from each of the cultures and were shown in the results in Table 9.
[281]
[282]
Table 9
Strain name 오르니 틴 (g / L)
KCCM11137P 7.8
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE 8.9
[283]
[284]
As shown in Table 9, E. coli derived argA and argE gene derived from E. coli is a mutant strain of Corynebacterium glutamicum introduced at the same time, it was confirmed that the yield ornithine hayeoteum 14.1% increase compared to the parental strain.
[285]
[286]
Example 6: E. coli-derived argA and derived from E. coli argE the pta-ackA enhanced in the introduced ornithine producing strain and confirmation thereof ornithine-producing ability
[287]
[288]
6-1. ATCC13032 based ornithine in the production strain pta- ackA production of the promoter-substituted strain
[289]
[290]
To confirm that E. coli-derived argA and derived from E. coli argE is introduced ATCC13032 based ornithine producing strain improves performance ornithine production of reinforced pta-ackA activity in, chromosome within pta-ackA lysCP1 promoter in front of the start codon of operon (International Patent Publication WO was introduced 2009/096689).
[291]
First Example 2-1 KCCM11137P a plasmid pDZ-lysCP1-1'pta ackA-making in and KCCM11137P Tn: obtained by introducing into the electroporation method (electroporation), respectively lysCP1-argE transformant: lysCP1-argA Tn and kanamycin to the transformant (25 ㎍ / ㎖) and X-gal (5-bromo-4-chloro-3-indolin - D-galactoside) BHIS plate medium (containing the Braine heart infusion 37 g / l , sorbitol and plated on 91 g / l, agar 2%) to form colonies by culturing. Among colonies formed therefrom by selecting colonies of blue color it was selected for the plasmid pDZ-lysCP1-1'pta ackA-introduced strain.
[292]
The selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), each 10 -4 from 10 -10 were diluted in order to spread on solid media containing X-gal, and cultured to form colonies. By selecting the white colonies that appears at a relatively low rate, from the formed colony it was selected a strain finally ackA-pta promoter is substituted with lysCP1 by a secondary cross (crossover). Intended for the finally selected strains using the SEQ ID NO: 19 and 21, the primer pair by performing a PCR it was confirmed that the introduction of the promoter in front lysCP1 in pta-ackA initiation codon chromosome. The PCR reaction is a height course of 1 minute denaturation at 95 ℃ for 30 seconds, at 55 ℃ in 30 seconds annealing and 72 ℃ was repeated 30 times.
[293]
A Corynebacterium glutamicum mutants selected therefrom, respectively KCCM11137P lysCP1-1'pta-ackA and KCCM11137P Tn: was named lysCP1-argE lysCP1-1'pta-ackA: lysCP1-argA Tn.
[294]
[295]
6-2. Ornithine-producing ability evaluation of pta-ackA enhanced strain
[296]
[297]
In order to confirm the effect of pta-ackA enhanced effect in argA derived from E. coli and derived from E. coli argE introduced ornithine producing strain, ornithine intended for a mutant strain of Corynebacterium glutamicum prepared in the above Examples 6-1 Tin-producing ability They were compared.
[298]
Specifically, Corynebacterium glutamicum Solarium of two mutants (KCCM11137P lysCP1-1'pta-ackA; KCCM11137P Tn : lysCP1-argA Tn: lysCP1-argE lysCP1-1'pta-ackA) and the parental strain of the two species ( KCCM11137P; KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE) for each 1 mM arginine-containing CM plate medium (glucose 1%, polypeptone 1% , yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, and plated on 50% NaOH 100 ㎕, agar 2 %, pH 6.8, 1 L standard) were incubated at 30 ℃ for 24 hours. Each strain cultured therefrom titer medium (Glucose 8% of 25 ml, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 · 7H 2 O 0.05%, urea 0.15%, biotin 100 μg, thiamine hydrochloride 3 mg, calcium pantothenate 3 mg, nicotinamide 3 mg, CaCO 3 5%, and then a platinum-inoculation about a 1 L standard) it in 30 ℃ 200 rpm the cultured with shaking for 98 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measuring the concentration of ornithine produced from each of the cultures, and the results are shown in Table 10 below.
[299]
[300]
[Table 10]
Strain name 오르니 틴 (g / L)
KCCM11137P 7.8
KCCM11137P lysCP1-1'pta-ackA 7.7
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE 8.9
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE lysCP1-1'pta-ackA 9.4
[301]
[302]
As shown in Table 10, when ornithine sikyeoteul enhance the pta-ackA in KCCM11137P tin production did not increase, derived from E. coli argA and argE gene derived from E. coli is a mutant strain of Corynebacterium glutamicum KCCM11137P Tn introduced at the same time: lysCP1- argA Tn: when sikyeoteul enhance the pta-ackA-lysCP1 in argE ornithine increases the production of tin and 20.5% compared to KCCM11137P, KCCM11137P Tn: confirmed that the hayeoseoneun increased 5.6% in lysCP1-argE: lysCP1-argA Tn.
[303]
[304]
Example 7: E. coli-derived argA and derived from E. coli argE is introduced ornithine producing bacteria introduced care derived from E. coli and its acs ornithine production check function
[305]
[306]
7-1. KCCM11137P based ornithine producing strain of tin transposon production of E. coli strains introduced into the genes derived acs
[307]
[308]
To confirm that E. coli-derived argA and argE derived from E. coli is introduced into the ATCC13032-based ornithine producing strain of KCCM11137P (Republic of Korea Patent No. 10-1372635 No.) ornithine production improves performance by the introduction of E. coli-derived gene acs in, using the promoter lysCP1 It was introduced by the acs gene within the transposon.
[309]
First Example 3-1 a KCCM11137P, and KCCM11137P plasmid pDZTn-acs-lysCP1 prepared in Tn: lysCP1-argA Tn: obtained by introducing into the lysCP1-argE electroporation (electroporation) to each transformant and the transformant kanamycin conversion element (25 ㎍ / ㎖) and X-gal (5-bromo-4-chloro-3-indolin - D-galactoside) containing the BHIS plate medium (Braine heart infusion 37 g / l, sorbitol 91 g / l, to form a colony by culturing the plated on agar 2%). Among colonies formed therefrom by selecting colonies of blue color it was selected for the plasmid pDZTn-lysCP1-acs is introduced strain.
[310]
The selected strain in CM medium (glucose 10 g / l, polypeptone 10 g / l, yeast extract 5 g / l, beef extract 5 g / l, NaCl 2.5 g / l, urea 2 g / l, pH 6.8) shaking culture (30 ℃, 8 hours), each 10 -4 from 10 -10 were diluted in order to spread on solid media containing X-gal, and cultured to form colonies. By selecting the white colonies indicated by a relatively low rate from the formed colonies were screened for the final strain is introduced gene encoding the acs by a secondary cross (crossover).
[311]
Intended for the finally selected strains using the SEQ ID NO: 13 and 25, the primer pair do the PCR to confirm that the gene was introduced encoding the acs, said Corynebacterium Tommy glutamicum mutants each KCCM11137P Tn: lysCP1-acs and KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE Tn: was named lysCP1-acs.
[312]
[313]
7-2. Ornithine-producing ability of Escherichia coli-derived rating acs transgenic strains
[314]
[315]
In order to confirm the effect on the acs introduced in E. coli derived argA and argE derived from E. coli was introduced ornithine producing strain, compared to the tin producing abilities ornithine intended for a mutant strain of Corynebacterium glutamicum prepared in the above Examples 7-1 It was.
[316]
Specifically, Corynebacterium glutamicum mutant of two (KCCM11137P Tn: lysCP1-acs; KCCM11137P Tn: lysCP1-argA Tn: lysCP1-argE Tn: lysCP1-acs) and two of the parental strain (KCCM11137P; KCCM11137P Tn : lysCP1-argA Tn: lysCP1- argE) for each 1 mM arginine-containing CM plate medium (glucose 1%, polypeptone 1% , yeast extract 0.5%, beef extract 0.5%, NaCl 0.25%, urea 0.2%, 50% NaOH 100 in ㎕, agar 2%, pH 6.8 , 30 ℃ and plated on standard 1 L) and cultured for 24 hours. Each strain cultured therefrom titer medium (Glucose 8% of 25 ml, Soy Protein 0.25%, corn solids 0.50% (NH 4 ) 2 SO 4 4% KH 2 PO 4 0.1%, MgSO 4 · 7H 2 O 0.05%, urea 0.15%, biotin 100 μg, thiamine hydrochloride 3 mg, calcium pantothenate 3 mg, nicotinamide 3 mg, CaCO 3 5%, and then a platinum-inoculation about a 1 L standard) it in 30 ℃ 200 rpm the cultured with shaking for 98 hours. A 1 mM arginine in the culture medium during all of the strains were added. Measuring the concentration of ornithine produced from each of the cultures, and the results are shown in Table 11 below.
[317]
[318]
[Table 11]
Strain name 오르니 틴 (g / L)
KCCM11137P 7.8
KCCM11137P Tn:lysCP1-acs 7.8
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE 8.9
KCCM11137P Tn:lysCP1-argA Tn:lysCP1-argE Tn:lysCP1-acs 9.2
[319]
[320]
As shown in Table 11, although ornithine when sikyeoteul introducing acs on KCCM11137P tin production is not increased, that derived from E. coli argA and derived from E. coli argE gene of Corynebacterium glutamicum mutants simultaneously introduced KCCM11137P Tn: lysCP1-argA Tn : when sikyeoteul introducing the acs lysCP1-argE ornithine confirmed this hayeoteum tin production increased by 17.9% compared to KCCM11137P. Also, KCCM11137P Tn: it was confirmed that it has increased by 3.4% compared to hayeoseoneun lysCP1-argE: lysCP1-argA Tn.
[321]
[322]
Taken together the above, according to putrescine or Corynebacterium strains ornithine producing tin, was via the introduction of E. coli-derived argA and derived from E. coli argE confirmed that the increase in the production of putrescine God and ornithine, additionally when introducing Corynebacterium interior of pta-ackA gene to enhance activity derived from E. coli or acs, putrescine God and it was confirmed that further increase the production of ornithine.
[323]
[324]
From the above description, each agent of the art it will be understood that the present invention without changing the technical spirit or essential features may be embodied in other specific forms. The embodiments described above In this regard, the examples should be understood as illustrative and not be limiting in all aspects. The scope of the invention should be construed as the meaning and scope, and all such modifications as derived from the equivalent concepts of the claims to be described later, rather than the description above within the scope of the invention.
claims.
Claims
[Claim 1]
Derived from E. coli N- acetyl glutamate synthase (N-acetylglutamate synthase) and E. coli-derived acetyl ornithine deacetylase of the activity of (Acetylornithine deacetylase) introduced, putrescine or ornithine genus Corynebacterium microorganism having a production capability.
[Claim 2]
The method of claim 1, wherein the Escherichia coli-derived N- acetyl glutamate synthase is putrescine or ornithine genus Corynebacterium microorganism having a production capacity consisting of the amino acid sequence of SEQ ID NO: 1.
[Claim 3]
The method of claim 1, wherein the Escherichia coli-derived acetyl ornithine deacetylase has, putrescine or ornithine genus Corynebacterium microorganism having a production capacity consisting of the amino acid sequence of SEQ ID NO: 3.
[Claim 4]
The method of claim 1, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum ) which, putrescine or ornithine genus Corynebacterium microorganism having a production capability.
[Claim 5]
The method of claim 1, wherein the genus Corynebacterium microorganism further phosphorylation trans the activity of the deacetylase (phosphotransacetylase) and acetate kinase (acetate kinase) operon (pta-ackA operon) enhanced compared to the endogenous activity, putrescine God or ornithine Corynebacterium spp with a production capacity.
[Claim 6]
The method of claim 5, wherein the trans-phosphorylation deacetylase and acid phosphatase operon SEQ ID NO: 5 or SEQ ID NO: 7 genus Corynebacterium microorganism having putrescine or ornithine-producing ability, comprising of the amino acid sequence of.
[Claim 7]
According to claim 1, wherein the microorganism of the genus Corynebacterium is additionally derived from E. coli acetyl -CoA synthase (acetyl-CoA synthetase, acs) Corynebacterium having the, putrescine or ornithine-producing ability active introduction of Solarium spp.
[Claim 8]
The method of claim 7, wherein the acetyl -CoA synthase genus Corynebacterium microorganism having putrescine or ornithine-producing ability, comprising of the amino acid sequence of SEQ ID NO: 9.
[Claim 9]
The method of claim 1, wherein the genus Corynebacterium microorganism further ornithine dicarboxylic decarboxylase which will be the activity of the (ornithine decarboxylase, ODC) introduced, putrescine Corynebacterium spp with a new or ornithine-producing ability .
[Claim 10]
The method of claim 1, wherein the genus Corynebacterium microorganism is additionally i) ornithine carbamoyl transferase dehydratase (ArgF), ii) glutamate X Porter or iii) ornithine carbamoyl transferase dehydratase and glutamate X Porter the activity was weaker than the endogenous activity, putrescine or ornithine Corynebacterium spp with a production capacity.
[Claim 11]
The method of claim 1, wherein the genus Corynebacterium microorganism further acetyl gamma glutamyl phosphate reductase kinase (ArgC), acetyl glutamate synthase or ornithine acetyl transferase dehydratase (ArgJ), acetyl glutamate kinase (ArgB), and acetyl ornithine aminotransferase (ArgD) of the at least one active selected from the group consisting of enhanced compared to the endogenous activity, putrescine or ornithine genus Corynebacterium microorganism having a production capability.
[Claim 12]
The method of claim 1, wherein the microorganism of the genus Corynebacterium is additionally acetyl transferase of the dehydratase activity than the endogenous activity of weakening, putrescine or ornithine genus Corynebacterium microorganism having a production capability.
[Claim 13]
The method of claim 12, wherein the acetyl transferase is a kinase, a protein consisting of the amino acid sequence of SEQ ID NO: 30 or 31, putrescine or ornithine genus Corynebacterium microorganism having a production capability.
[Claim 14]
The method of claim 1, wherein the microorganism of the genus Corynebacterium is further putrescine X porter activity, the putrescine or ornithine genus Corynebacterium microorganism having a production capability of the reinforcement than endogenous activity.
[Claim 15]
15. The method of claim 14, wherein the putrescine Expo emitter SEQ ID NO: 26 or SEQ ID NO: protein consisting of the amino acid sequence of 28, putrescine or ornithine genus Corynebacterium microorganism having a production capability.
[Claim 16]
(I) the step of a putrescine or genus Corynebacterium microorganism having an ornithine-producing ability according to any one of claims 1 to 15, wherein the culture in a medium; And (ii), putrescine or ornithine method of production of tin, comprising the step of recovering the cultured putrescine or ornithine from a microorganism or the culture medium.
[Claim 17]
17. The method of claim 16 wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum The method of production of putrescine or ornithine.
| Section | Controller | Decision Date |
|---|---|---|
| # | Name | Date |
|---|---|---|
| 1 | 201817004498-STATEMENT OF UNDERTAKING (FORM 3) [06-02-2018(online)].pdf | 2018-02-06 |
| 2 | 201817004498-SEQUENCE LISTING(PDF) [06-02-2018(online)].pdf | 2018-02-06 |
| 3 | 201817004498-SEQUENCE LISTING [06-02-2018(online)].jpg | 2018-02-06 |
| 4 | 201817004498-REQUEST FOR EXAMINATION (FORM-18) [06-02-2018(online)].pdf | 2018-02-06 |
| 5 | 201817004498-POWER OF AUTHORITY [06-02-2018(online)].pdf | 2018-02-06 |
| 6 | 201817004498-FORM 18 [06-02-2018(online)].pdf | 2018-02-06 |
| 7 | 201817004498-FORM 1 [06-02-2018(online)].pdf | 2018-02-06 |
| 8 | 201817004498-DRAWINGS [06-02-2018(online)].pdf | 2018-02-06 |
| 9 | 201817004498-DECLARATION OF INVENTORSHIP (FORM 5) [06-02-2018(online)].pdf | 2018-02-06 |
| 10 | 201817004498-COMPLETE SPECIFICATION [06-02-2018(online)].pdf | 2018-02-06 |
| 11 | 201817004498-FORM-26 [20-02-2018(online)].pdf | 2018-02-20 |
| 12 | abstract.jpg | 2018-02-26 |
| 13 | 201817004498-Power of Attorney-210218.pdf | 2018-02-28 |
| 14 | 201817004498-Correspondence-210218.pdf | 2018-02-28 |
| 15 | 201817004498.pdf | 2018-03-24 |
| 16 | 201817004498-Proof of Right (MANDATORY) [28-03-2018(online)].pdf | 2018-03-28 |
| 17 | 201817004498-OTHERS-280318.pdf | 2018-04-11 |
| 18 | 201817004498-Correspondence-280318.pdf | 2018-04-11 |
| 19 | 201817004498-FORM 3 [20-07-2018(online)].pdf | 2018-07-20 |
| 20 | 201817004498-RELEVANT DOCUMENTS [20-10-2020(online)].pdf | 2020-10-20 |
| 21 | 201817004498-MARKED COPIES OF AMENDEMENTS [20-10-2020(online)].pdf | 2020-10-20 |
| 22 | 201817004498-FORM 13 [20-10-2020(online)].pdf | 2020-10-20 |
| 23 | 201817004498-AMMENDED DOCUMENTS [20-10-2020(online)].pdf | 2020-10-20 |
| 24 | 201817004498-FER.pdf | 2021-10-18 |
| 25 | 201817004498-RELEVANT DOCUMENTS [29-03-2022(online)].pdf | 2022-03-29 |
| 26 | 201817004498-RELEVANT DOCUMENTS [29-03-2022(online)]-2.pdf | 2022-03-29 |
| 27 | 201817004498-RELEVANT DOCUMENTS [29-03-2022(online)]-1.pdf | 2022-03-29 |
| 28 | 201817004498-PETITION UNDER RULE 137 [29-03-2022(online)].pdf | 2022-03-29 |
| 29 | 201817004498-PETITION UNDER RULE 137 [29-03-2022(online)]-2.pdf | 2022-03-29 |
| 30 | 201817004498-PETITION UNDER RULE 137 [29-03-2022(online)]-1.pdf | 2022-03-29 |
| 31 | 201817004498-OTHERS [29-03-2022(online)].pdf | 2022-03-29 |
| 32 | 201817004498-Information under section 8(2) [29-03-2022(online)].pdf | 2022-03-29 |
| 33 | 201817004498-FORM 3 [29-03-2022(online)].pdf | 2022-03-29 |
| 34 | 201817004498-FER_SER_REPLY [29-03-2022(online)].pdf | 2022-03-29 |
| 35 | 201817004498-DRAWING [29-03-2022(online)].pdf | 2022-03-29 |
| 36 | 201817004498-COMPLETE SPECIFICATION [29-03-2022(online)].pdf | 2022-03-29 |
| 37 | 201817004498-CLAIMS [29-03-2022(online)].pdf | 2022-03-29 |
| 38 | 201817004498-certified copy of translation [29-03-2022(online)].pdf | 2022-03-29 |
| 39 | 201817004498-certified copy of translation [29-03-2022(online)]-1.pdf | 2022-03-29 |
| 40 | 201817004498-Response to office action [07-08-2023(online)].pdf | 2023-08-07 |
| 41 | 201817004498-FORM 3 [07-08-2023(online)].pdf | 2023-08-07 |
| 42 | 201817004498-Annexure [07-08-2023(online)].pdf | 2023-08-07 |
| 43 | 201817004498-US(14)-HearingNotice-(HearingDate-18-08-2023).pdf | 2023-08-08 |
| 44 | 201817004498-Information under section 8(2) [17-08-2023(online)].pdf | 2023-08-17 |
| 45 | 201817004498-FORM 3 [17-08-2023(online)].pdf | 2023-08-17 |
| 46 | 201817004498-Correspondence to notify the Controller [17-08-2023(online)].pdf | 2023-08-17 |
| 47 | 201817004498-Written submissions and relevant documents [25-08-2023(online)].pdf | 2023-08-25 |
| 48 | 201817004498-Annexure [25-08-2023(online)].pdf | 2023-08-25 |
| 49 | 201817004498-PatentCertificate29-08-2023.pdf | 2023-08-29 |
| 50 | 201817004498-IntimationOfGrant29-08-2023.pdf | 2023-08-29 |
| 1 | SearchStrategy201817004498E_25-06-2020.pdf |
| 2 | SearchconductedinINPASSE_05-04-2021.pdf |