Detailed description of the invention
Technical challenge
[9]
As a result of the present inventors trying to develop a method capable of simultaneously producing several amino acids, it was found that in a glutamic acid-producing strain, in the case of enhancing HisG activity compared to the parent strain, the ability to produce glycine while maintaining the production ability of glutamic acid can be improved. This application was completed by checking.
[10]
Means of solving the task
[11]
One object of the present application is to provide a microorganism of the genus Corynebacterium in which the activity of ATP phosphoribosyltransferase (HisG) is enhanced and glycine production capacity is increased.
[12]
Another object of the present application is to provide a method for producing a fermentation composition comprising glycine and glutamic acid, comprising the step of fermenting the microorganisms of the genus Corynebacterium in a medium.
[13]
Another object of the present application is to provide a fermentation composition prepared by the above method.
[14]
Effects of the Invention
[15]
The HisG mutation of the present application can be introduced into a microorganism to simultaneously produce glutamic acid and glycine, so it can be usefully used in amino acid production. In addition, by controlling the amount of glutamic acid and glycine in the fermented product, the taste and palatability of the fermented product can be improved and applied to the fermentation broth and seasoning material products using the same.
[16]
Best mode for carrying out the invention
[17]
This is described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the specific description described below.
[18]
[19]
In order to achieve the above object, one aspect of the present application provides a microorganism of the genus Corynebacterium with enhanced activity of ATP phosphoribosyltransferase (HisG) and increased glycine production capacity.
[20]
Specifically, ATP phosphoribosyltransferase (ATP phosphoribosyltransferase: HisG) in which the 233th amino acid of the amino acid sequence represented by SEQ ID NO: 4 is substituted with histidine (H), containing increased glycine-producing ability, microorganisms in Corynebacterium genus Can provide.
[21]
In addition, specifically, ATP phosphoribosyltransferase (ATP phosphoribosyltransferase: HisG) in which the 233th amino acid in the amino acid sequence as in SEQ ID NO: 4 is substituted with histidine (H) and the 235th amino acid is substituted with glutamine (Q). , It can provide microorganisms of the genus Corynebacterium with increased glycine production capacity.
[22]
[23]
In the present application, "ATP phosphoribosyltransferase" is also named "HisG" and refers to an enzyme involved in the histidine synthesis pathway. The histidine synthesis pathway consists of a total of 9 enzymes (HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD), and HisG constitutes the first step.
[24]
It was known that HisG is involved in the production of histidine, but the association with the production of glycine is not known and was first identified by the present inventors. More specifically, the fact that the amount of glycine production is increased through the enhancement of HisG activity, in particular, HisG is subjected to feedback inhibition by the product histidine. The effect of maintaining the amount of glutamic acid produced was first identified by the present inventors.
[25]
In the present application, "enhancing the activity of HisG" means that the activity of the HisG enzyme is increased than the intrinsic activity, which is the active state of the enzyme that the microorganisms of the genus Corynebacteria have in their natural state. Examples of methods for enhancing the activity of HisG, i) a method of additionally inserting a polynucleotide containing a nucleotide sequence encoding HisG into a chromosome or a method of introducing a polynucleotide containing a nucleotide sequence encoding HisG into a vector system A method of increasing the copy number of the nucleotide sequence encoding the enzyme, ii) a method of enhancing the promoter of the hisG gene, for example, a method of replacing with a strong promoter, or a method of introducing a mutation into the promoter. And iii) a method of mutating into an enzyme with strong activity by genetic mutation.
[26]
[27]
Specifically, in the present application, glycine, the 233th amino acid of the HisG amino acid sequence represented by SEQ ID NO: 4, is substituted with histidine, or the 233th amino acid of the HisG amino acid sequence represented by SEQ ID NO: 4 is substituted with glycine and histidine, and the 235th amino acid Phosphorus threonine can be substituted for glutamine. Accordingly, the microorganism of the genus Corynebacterium containing the mutated HisG as described above can significantly increase the glycine production ability while maintaining the ability to produce glutamic acid without any significant effect. The increase in the glycine production capacity may be increased compared to the modification of the present application, that is, a HisG-containing microorganism that does not include the substitution.
[28]
As another example, the promoter of the HisG enzyme may be mutated into a stronger promoter than the intrinsic promoter through mutation or substitution. Instead of the promoter of the intrinsic enzyme, an improved promoter or heterologous promoter having a base substitution mutation may be linked.Examples of the heterologous promoter include the cj7 promoter, the lysCP1 promoter, the EF-Tu promoter, the groEL promoter, the aceA promoter, the aceB promoter, etc. It is not limited.
[29]
In addition, since the hisG gene is composed of the hisE gene and the operon, it is possible to enhance the activity of the HisG enzyme through hisG overexpression due to mutation or substitution in the promoter sequence of the hisEG gene. More specifically, from SEQ ID NO: 1 where the promoter sequence of the hisEG gene is mutated, the 53rd and 55th nucleotides of the polynucleotide sequence are substituted with T, or the 53rd and 55th nucleotides of the polynucleotide sequence are T, and the 60th nucleotide is G By replacing with, it is possible to enhance the activity of the HisG enzyme with a stronger promoter than the intrinsic promoter. According to the literature on the promoter sequence of Corynebacterium glutamicum (Microb Biotechnol. 2013 Mar; 6(2): 103-117.), a number of transcriptional start points (TSPs) and promoters through RNA sequencing (RNA-seq). You will be able to determine the location. Accordingly, the promoter sequence of the hisEG gene was confirmed through RNA seq experiments of the wild-type ATCC13869 strain of Corynebacterium glutamicum, and the overexpression of hisEG was attempted to be induced by modifying the native promoter. As one of the methods of intrinsic promoter modification, there is a method of bringing the promoter closer to the consensus sequence through mutations in the -35 and -10 region sequences of the promoter of Corynebacterium glutamicum. In particular, when the sequence of the -10 region (TATA box) from the promoter sequence of the hisEG gene is mutated close to the consensus sequence, it can be transformed into a strong promoter compared to the intrinsic promoter.
[30]
[31]
Specifically, the ATP phosphoribosyltransferase contained in the microorganism of the genus Corynebacterium may be composed of the amino acid sequence of SEQ ID NO: 5, or the ATP phosphoribosyltransferase may be composed of the amino acid sequence of SEQ ID NO: 6 I can.
[32]
In addition, the amino acid sequence of the present application may be modified by conventionally known mutagenesis methods, for example, direct evolution and site-directed mutagenesis.
[33]
Accordingly, the ATP phosphoribosyltransferase is at least 60% or more, specifically 70% or more, more specifically 80% or more, even more specifically 83% with respect to the amino acid sequence of SEQ ID NO: 5 or 6 It may include HisG including an amino acid sequence having homology of at least 84%, at least 88%, at least 90%, at least 93%, at least 95%, or at least 97%. If a sequence having homology with the above sequence is substantially the same as or corresponding to the amino acid sequence of SEQ ID NO: 5 or 6, and an amino acid sequence having a biological activity corresponding to, some sequences have an amino acid sequence that is deleted, modified, substituted or added It is obvious that also included in the scope of the present application.
[34]
[35]
In this case, the term "glutamic acid" (L-glutamic acid, L-glutamate) is a kind of amino acid and is classified as a non-essential amino acid. It is known as the most common excitatory neurotransmitter in the central nervous system, and its monosodium glutamate (MSG) has been developed and widely used as a seasoning because it has a umami taste. It is generally produced through fermentation of glutamic acid-producing microorganisms.
[36]
In addition, the term "glycine" is a colorless crystalline amino acid having a sweet taste, and is also referred to as glycine. It is mainly used as a food seasoning, and in medicine, it is also used as an infusion solution, antacid, comprehensive amino acid preparation, and nutritional supplement. In general, it is manufactured through an industrial synthesis method such as monochloroacetic acid method and Strecker method, and since the synthesis method is prepared by mixing D-type and L-type amino acids, there is an inconvenience of optical division. Therefore, it is necessary to prepare glycine by a fermentation method having various advantages such as mild reaction conditions, mass production in a short time, environmentally friendly processes, and biodegradability of products.
[37]
[38]
In the present application, the term "homology" means the degree to which it matches a given amino acid sequence or nucleotide sequence, and may be expressed as a percentage. In the present specification, its homologous sequence having the same or similar activity as a given amino acid sequence or nucleotide sequence is indicated as "% homology". Homology to the amino acid sequence or nucleotide sequence is determined, for example, by the algorithm BLAST by literature [see Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on this algorithm BLAST, a program called BLASTN or BLASTX has been developed (see: http://www.ncbi.nlm.nih.gov).
[39]
The “stringent conditions” refer to conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, among genes with high homology, genes with homology of 60% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly 99% or more Under conditions that hybridize to each other and do not hybridize to genes with lower homology, or to wash conditions for general Southern hybridization, 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1 At a salt concentration and temperature corresponding to% SDS, more specifically 68° C., 0.1×SSC, and 0.1% SDS, the conditions for washing once, specifically two to three times, can be enumerated. Hybridization requires that two nucleotides have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term “complementary” is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.
[40]
Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose. The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[41]
[42]
In the present application, the term "microorganism" includes wild-type microorganisms or microorganisms that have undergone natural or artificial genetic modification, and a specific mechanism is weakened due to reasons such as insertion of an external gene or the enhancement or attenuation of the activity of an endogenous gene. It is a concept that includes all microorganisms that have become or fortified.
[43]
[44]
In the present application, the microorganism may include the ATP phosphoribosyltransferase. In addition, the ATP phosphoribosyltransferase may be introduced into the microorganism by transformation through a vector, but is not limited thereto. Furthermore, the microorganism is irrelevant if the HisG can be expressed, the gene encoding the HisG is located on a chromosome or outside the chromosome.
[45]
[46]
In the present application, the term "vector" is an artificial DNA molecule that holds a genetic material so as to express a target gene in a suitable host, and may refer to a DNA preparation comprising the nucleotide sequence of a gene encoding the HisG.
[47]
[48]
The vector used in the present application is not particularly limited as long as it can be expressed in the host cell, and the host cell may be transformed using any vector known in the art. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
[49]
For example, pWE15, M13, λLB3, λBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and pBR-based, pUC-based, pBluescriptII-based plasmid vector , pGEM system, pTZ system, pCL system, pET system, etc. can be used.
[50]
In addition, a polynucleotide encoding HisG of the present application may be introduced into a chromosome through a vector for chromosome insertion into a host cell. For example, pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 vectors, etc. may be used, but are not limited thereto.
[51]
In addition, the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, by homologous recombination.
[52]
Since the vector of the present application can be inserted into a chromosome by causing homologous recombination, it may additionally include a selection marker for confirming whether the chromosome is inserted. Selectable markers are used to select cells transformed with a vector, that is, to confirm whether polynucleotides are inserted, and confer a selectable phenotype such as drug resistance, auxotrophic resistance, resistance to cytotoxic agents, or expression of surface proteins. Markers can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
[53]
[54]
In the present application, the term "transformation" refers to introducing a vector including the polynucleotide or a gene encoding HisG into a host cell so that the gene and HisG can be expressed in the host cell. Furthermore, as long as the gene of interest can be expressed in the host cell, the transformed gene may include the case of all of them regardless of whether it is located on the chromosome of the host cell or outside the chromosome.
[55]
[56]
The transformation method includes all methods of introducing the gene into cells, and may be performed by selecting an appropriate standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method, and the like, but is not limited thereto.
[57]
[58]
In the present application, the microorganism may be included without limitation, as long as the HisG of the present application is introduced to increase glycine production capacity.
[59]
Specifically, the microorganism may be a microorganism of the genus Corynebacterium, more specifically Corynebacterium glutamicum or Corynebacterium flavum , and most specifically Corynebacterium flavum It may be Nebacterium glutamicum, but is not limited thereto.
[60]
[61]
Another aspect of the present application provides a method for producing a fermentation composition comprising glycine and glutamic acid, comprising the step of fermenting the microorganisms of the genus Corynebacterium in a medium.
[62]
Another aspect of the present application provides a fermentation composition prepared by the above method.
[63]
The fermentation composition may have an increased content of glycine.
[64]
The microorganism is as described above.
[65]
[66]
In the present application, the term "culture" refers to growing microorganisms in an appropriately artificially controlled environmental condition. In the present application, a method of producing a target substance using the microorganism may be performed using a method widely known in the art. Specifically, the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto. The medium used for culture must meet the requirements of the specific strain in an appropriate manner. Culture media for Corynebacterium strains are known (eg, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington DC, USA, 1981).
[67]
Sugar sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid. , Fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
[68]
Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen source may also be used individually or as a mixture, but is not limited thereto.
[69]
Personnel that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or salts containing the corresponding sodium. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth. Finally, essential growth substances such as amino acids and vitamins can be used in addition to the above substances. In addition, precursors suitable for the culture medium may be used. The above-described raw materials may be added batchwise or continuously to the culture during the culture process by an appropriate method.
[70]
During the culture of the microorganism, a basic compound such as sodium hydroxide, potassium hydroxide, ammonia, or an acid compound such as phosphoric acid or sulfuric acid may be used in an appropriate manner to adjust the pH of the culture. In addition, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Oxygen or an oxygen-containing gas (eg, air) may be injected into the culture to maintain an aerobic condition.
[71]
The temperature of the culture (medium) may be usually 20°C to 45°C, specifically 25°C to 40°C. The cultivation time may be continued until a desired amount of the target substance is obtained, but may be specifically 10 to 160 hours.
[72]
[73]
Recovery of the target material from the culture (medium) can be separated and recovered by a conventional method known in the art. In this separation method, methods such as centrifugation, filtration, chromatography, and crystallization may be used. For example, the culture medium may be centrifuged at low speed to remove biomass, and the resulting supernatant may be separated through ion exchange chromatography, but is not limited thereto. As another method, it is possible to perform a process of separating and filtering cells from a culture (medium), and recovering the target material without a separate purification process. As another method, the recovery step may further include a purification process.
[74]
[75]
In the present application, the term "the fermentation composition" refers to a composition obtained by culturing the microorganism of the present application. Further, the fermentation composition may include a composition in the form of a liquid or powder obtained after culturing the microorganism and then undergoing an appropriate post-treatment process. In this case, a suitable post-treatment process may include, for example, a process of culturing the microorganism, a process of removing cells, a process of concentration, a process of filtration, and a process of mixing a carrier, and may further include a process of drying. In some cases, the post-treatment process may not include a purification process. The fermentation composition may provide an optimal taste by culturing the microorganisms of the present application to maintain a certain level of glutamic acid while including a composition in which the content of glycine is increased.
[76]
In addition, "the fermentation composition" does not exclude seasoning material products (eg, broth powder products, snack seasoning products, etc.) containing the liquid or powder type composition. Further, "the fermentation composition" refers to a case in which a material obtained by a non-fermentation process and/or another material obtained by a non-natural process are additionally mixed as long as it includes a composition obtained by culturing the microorganism of the present application. Do not exclude
[77]
Mode for carrying out the invention
[78]
Hereinafter, the present application will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited to these examples.
[79]
[80]
Example 1.Introduction of mutation to KFCC11074 strain for increasing glycine production ability and confirmation of glutamic acid and glycine production amount of KFCC11074 introduced mutation
[81]
Example 1-1. Vector creation with mutations
[82]
In order to confirm the effect of increasing the ability to produce klycin by enhancing HisG activity in the glutamic acid-producing strain, a strain that caused a mutation in the promoter of the HisEG gene and a strain that introduced a mutation that canceled histidine feedback inhibition was prepared, and its glycine-producing ability was confirmed. I did.
[83]
On the other hand, HisE and HisG genes are composed of operons, and these genes are genes involved in the histidine biosynthetic pathway. In particular, since the HisG receives feedback inhibition by the product histidine, it was attempted to confirm whether the glycine production capacity of the strain was increased when the activity of the HisG gene was increased by introducing a mutation whose feedback inhibition was released. Accordingly, it was attempted to introduce a HisEG promoter mutation and a histidine feedback inhibition release mutation of HisG into the KFCC11074 strain known as a glutamic acid producing strain (Korean Patent Publication No. 10-0292299), respectively. Specifically, in order to substitute T for the 53rd and 55th nucleotides of the polynucleotide sequence from SEQ ID NO: 1, the 53rd and 55th nucleotides of the polynucleotide sequence with T, and the 60th nucleotide with G A substitution vector was constructed.
[84]
In addition, the 233 th glycine (Gly/G) of the HisG amino acid sequence represented by SEQ ID NO: 4 was substituted with histidine (His/H), and the 233 th and 235 th glycines (Gly/G) and threonine (Thr/T) were A gene replacement vector was constructed to substitute histidine (His/H) and glutamine (Gln/Q). The gene fragment for constructing each substitution vector was obtained through PCR using ATCC13869 genomic DNA as a template. Based on the information on the Corynebacterium glutamicum (ATCC13869) gene and surrounding nucleotide sequences registered in the National Institutes of Health GenBank (NIH GenBank), each primer was prepared.
[85]
PCR conditions for constructing HisEG promoter substitution vector are: After denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute are repeated 30 times, and then polymerization at 72°C for 5 minutes. The reaction was carried out. More specifically, 500 bp polynucleotide amplified using the primers of SEQ ID NOs: 7 and 8 and 500 bp polynucleotide amplified using the primers of SEQ ID NOs: 9 and 10 were obtained. Two genes including hisEG promoter by linking the obtained two gene fragments to a pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) cut with restriction enzyme SalI using an infusion enzyme A substitution vector was constructed, and it was named " pDZ - hisEG -pro- 2mt " . In addition, a 500 bp polynucleotide amplified using the primers of SEQ ID NOs: 7 and 11 and a 500 bp polynucleotide amplified using the primers of SEQ ID NOs: 10 and 12 were obtained. One gene including the HisEG promoter by linking the obtained two gene fragments to a pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) cut with restriction enzyme SalI using an infusion enzyme A substitution vector was constructed, and it was " pDZ - hisEG It was named " -pro- 3mt " . Information on the sequence of the primers used for constructing the vector is shown in Table 1 below.
[86]
In order to substitute H, H, and Q for amino acids 233, 233, and 235 of the HisG amino acid sequence, a gene replacement vector was constructed. Specifically, PCR conditions were: after denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute were repeated 30 times, and then polymerization was performed at 72°C for 5 minutes. A 722 bp polynucleotide amplified using the primers of SEQ ID NOs: 13 and 14 and a 798 bp polynucleotide amplified using the primers of SEQ ID NOs: 15 and 16 were obtained. Containing HisG (G233H) mutation by linking the obtained two gene fragments to a pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) digested with restriction enzyme SalI using an infusion enzyme. A single 1.5kbp gene replacement vector containing polynucleotide was constructed, and this was " pDZ - hisG ( G233H )"It was named as. In addition, a 722bp polynucleotide amplified using the primers of SEQ ID NOs: 13 and 17 and a 798bp polynucleotide amplified using the primers of SEQ ID NOs: 16 and 18 were obtained. HisG (G233H/T235Q) mutation was ligated to the pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) digested with restriction enzyme SalI using an infusion enzyme. A single 1.5kbp gene replacement vector containing the containing polynucleotide was constructed, and it was named “ pDZ - hisG ( G233H / T235Q )” . The primer sequence information used for the construction of the vector is shown in Table 1 below.
[87]
[88]
[Table 1]
Sequence number Primer name 5'SEQ ID NO: 3'
7 hisEG-pro-2mt-AF GATCCTCTAGAGTCGACTTCGACGAATCCCTCG
8 hisEG-pro-2mt-AR CGGT ACATTATA CCACACAACAGTTATCAATG
9 hisEG-pro-2mt-BF GTGG TATAATGT ACCGAGTGAAGACATTTGAC
10 hisEG-pro-2mt-BR ATGCCTGCAGGTCGACTGATACCCAAATCGAG
11 hisEG-pro-3mt-AR CGGT CCATTATA CCACACAACAGTTATCAATG
12 hisEG-pro-3mt-BF GTGG TATAATGG ACCGAGTGAAGACATTTGAC
13 hisG(G233H)-AF GATCCTCTAGAGTCGACCCCAAACAAGGGCTCGC
14 hisG(G233H)-AR CGTGCCAGTGGGGATACCGTTGGGTGGG
15 hisG(G233H)-BF AACCCCAGGCCTATCCCACCCAACGGTATC
16 hisG(G233H)-BR ATGCCTGCAGGTCGACGCAAGGTTGGCAACAAC
17 hisG(G233H/T235Q)-AR CGTGCCAGTGGGGATACCTGTGGGTGGG
18 hisG(G233H/T235Q)-BF AACCCCAGGCCTATCCCACCCACAGGTATC
[89]
Example 1-2. Production of mutation-introduced KFCC11074 and confirmation of glutamic acid and glycine production
[90]
The HisEG promoter replacement vectors pDZ-hisEG-pro-2mt and pDZ-hisEG-pro-3mt prepared in Example 1-1 and the HisG gene replacement vectors pDZ-hisG (G233H) and pDZ-hisG (G233H/T235Q ) Was introduced into each KFCC11074 strain by an electroporation method. Glutamic acid and glycine production strains "KFCC11074_Pro(2mt)_hisEG", "KFCC11074_Pro(3mt)_hisEG", "KFCC11074_hisG(G233H)" and "KFCC11074_hisG (G233H/T235Q)", respectively, into which mutations were introduced were prepared.
[91]
Specifically, the strain was prepared through transformation (Appl. Microbiol. Biotechnol., 1999, 52: 541-545), and the strain into which the vector was inserted on the chromosome by recombination of the homologous sequence was kanamycin 25 mg/L It was selected on agar nutrient medium containing. The selected primary strain was again subjected to a secondary cross-over, and strains into which the target mutation was introduced were respectively selected. The mutation (replacement) of the final transformed strain was confirmed by sequencing after PCR was performed using the primer pairs of SEQ ID NOs: 7 and 10 and the primer pairs of SEQ ID NOs: 13 and 16, respectively.
[92]
Then, the selected strains KFCC11074_Pro(2mt)_hisEG, KFCC11074_Pro(3mt)_hisEG, KFCC11074_hisG(G233H) and KFCC11074_hisG(G233H/T235Q) were plated on a nutrient medium and cultured at 30° C. for 16 hours. Then, 25 ml of the fermentation medium autoclaved at 121° C. for 15 minutes was dispensed into a 250 ml Erlenmeyer flask for shaking, and the strain cultured in the nutrient medium was inoculated and cultured for 48 hours. Culture conditions were adjusted to the number of revolutions 200rpm, temperature 37 ℃, pH 8.0. The composition of the nutrient medium and fermentation medium is as follows.
[93]
[94]
Nutritional medium:
[95]
Glucose 1%, meat juice 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2
[96]
[97]
Fermentation medium:
[98]
Raw sugar 6%, calcium carbonate 5%, ammonium sulfate 2.25%, potassium monophosphate 0.1%, magnesium sulfate 0.04%, iron sulfate 10 mg/L, biotin 0.3 mg/L, thiamine hydrochloride 0.2 mg/L
[99]
[100]
After completion of the culture, L-glutamic acid and glycine production were measured through a method using HPLC, and the measurement results are shown in Table 2 below.
[101]
[102]
[Table 2]
Strain name L-glutamic acid (g/L) L-glycine (mg/L)
KFCC11074 11.5 165
KFCC11074_Pro(2mt)_hisEG 11.4 198
KFCC11074_Pro(3mt)_hisEG 12.0 209
KFCC11074_hisG(G233H) 11.8 210
KFCC11074_hisG(G233H/T235Q) 12.3 433
[103]
As shown in Table 2, the concentration of the strains of Corynebacterium glutamicum KFCC11074_Pro(2mt)_hisEG, KFCC11074_Pro(3mt)_hisEG, KFCC11074_hisG(G233H) and KFCC11074_hisG(G233H/T235Q) strain introduced mutations produced It was confirmed that the concentration of L-glutamic acid produced by the strain of Corynebacterium glutamicum KFCC11074 to which the mutation was not introduced is similar.
[104]
On the other hand, the concentrations of glycine produced by the KFCC11074_Pro(2mt)_hisEG and KFCC11074_Pro(3mt)_hisEG and KFCC11074_hisG(G233H) strains were 33 mg/L, 44 mg/L, and 45 mg, respectively, compared to the glycine concentration produced by the KFCC11074. It was confirmed that /L increased. In particular, in the case of the KFCC11074_hisG(G233H/T235Q) strain, it was confirmed that the glycine concentration increased significantly to 268 mg/L.
[105]
That is, it was confirmed that the mutations, including the HisEG promoter mutation and the release of HisG feedback inhibition, significantly increased the glycine production ability while maintaining the L-glutamic acid production ability of the microorganism without any significant effect.
[106]
[107]
Example 2. Confirmation of the amount of glutamic acid and glycine production of the strain ATCC13869 into which the mutation was introduced
[108]
In order to confirm whether the above mutations do not affect glutamic acid production ability in the wild-type Corynebacterium glutamicum ATCC13869 strain, and have an effect of increasing glycine production ability, the mutation was introduced ATCC13869-based strain.
[109]
The HisEG promoter replacement vectors pDZ-hisEG-pro-2mt and pDZ-hisEG-pro-3mt prepared in Example 1-1 and the HisG gene replacement vectors pDZ-hisG (G233H) and pDZ-hisG (G233H/T235Q ) Were introduced into each ATCC13869 strain by an electroporation method. Glutamic acid and glycine producing strains "ATCC13869_Pro(2mt)_hisEG", ATCC13869_Pro(3mt)_hisEG", "ATCC13869_hisG(G233H)" and "ATCC13869_hisG(G233H/T235Q)", respectively, to which mutations were introduced were prepared.
[110]
Specifically, the strain was prepared through transformation (Appl. Microbiol. Biotechnol., 1999, 52: 541-545), and the strain into which the vector was inserted on the chromosome by recombination of the homologous sequence was kanamycin 25 mg/L It was selected on agar nutrient medium containing. The selected primary strain was again subjected to a secondary cross-over, and strains into which the target mutation was introduced were respectively selected. The mutation (replacement) of the final transformed strain was confirmed by sequencing after PCR was performed using the primer pairs of SEQ ID NOs: 7 and 10 and the primer pairs of SEQ ID NOs: 13 and 16, respectively.
[111]
Each colony was subcultured in nutrient medium and then cultured in fermentation medium for 5 hours. Then, 25% tween 40 was added to each medium at a concentration of 0.4%, and each colony was cultured again for 32 hours.
[112]
[113]
Nutritional medium:
[114]
Glucose 1%, meat juice 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2
[115]
[116]
Fermentation medium:
[117]
Raw sugar 6%, calcium carbonate 5%, ammonium sulfate 2.25%, potassium monophosphate 0.1%, magnesium sulfate 0.04%, iron sulfate 10 mg/L, biotin 0.3 mg/L, thiamine hydrochloride 0.2 mg/L
[118]
[119]
Each colony was cultured under the above conditions, L-glutamic acid concentration was measured using YSI, and glycine concentration was measured using HPLC. The measured concentrations of L-glutamic acid and glycine are shown in Table 3.
[120]
[121]
[Table 3]
Strain name L-glutamic acid (g/L) L-glycine (mg/L)
ATCC13869 13.8 117
ATCC13869_Pro(2mt)_hisEG 13.7 128
ATCC13869_Pro(3mt)_hisEG 14.0 135
ATCC13869_hisG(G233H) 13.5 144
ATCC13869_hisG(G233H/T235Q) 13.7 306
[122]
As shown in Table 3, ATCC13869_Pro(2mt)_hisEG, ATCC13869_Pro(3mt)_hisEG, ATCC13869_hisG (G233H) and ATCC13869_hisG (G233H/T235Q) strains produced by mutations introduced into wild-type Corynebacterium glutamicum (ATCC13869) The concentration of L-glutamic acid was similar to the concentration of L-glutamic acid produced by the ATCC13869 strain, but it was confirmed that the glycine concentration was all increased.
[123]
That is, it was confirmed once again that the mutations, including the HisEG promoter mutation and the release of HisG feedback inhibition, significantly increase the glycine production ability while maintaining the L-glutamic acid production ability of the microorganism without much effect.
[124]
On the other hand, the ATCC13869_hisG (G233H) and ATCC13869_hisG (G233H/T235Q) strains were named "CA02-9216" and "CA02-9217" to the Korean Microbiological Conservation Center (KCCM), a depository institution under the Budapest Treaty, on March 00, 2019. It has been deposited internationally and has been assigned the deposit numbers of "KCCM12458P" and "KCCM12459P".
[125]
[126]
Example 3. Preparation of fermentation composition for manufacturing seasoning material products
[127]
[128]
As described above, it was confirmed that the strain enhancing HisG activity increased the glycine production ability without significantly affecting the L-glutamic acid production ability. Therefore, it was intended to prepare a fermentation composition using the microorganisms of Corynebacterium genus enhancing HisG activity of the present application.
[129]
[130]
Illustratively, it is manufactured with glutamic acid, which is basically a well-known seasoning material, as a main component, but in order to increase the composition of rich taste, fermentation strains and fermentation processes were adjusted to increase by-product components of other seasoning materials.
[131]
[132]
It was intended to prepare a fermentation composition using a 5L fermenter using a strain containing both of the mutations including the HisEG promoter mutation and the HisG feedback inhibition release.
[133]
[134]
All ingredients used in the preparation of the culture medium were only food grade ingredients.
[135]
[136]
Primary seed medium: 1% glucose, 1% yeast extract, 1% peptone, 0.1% ammonium sulfate, 0.25% sodium chloride, 0.15% potassium phosphate, 0.15% potassium phosphate, and have a pH of 8.0 A seed medium was prepared.
[137]
Secondary seed medium: Organic raw sugar of 98.5% purity 4.6%, magnesium sulfate 0.05%, yeast extract 0.5%, potassium phosphate 0.2%, iron sulfate 0.002%, biotin 1mg/l, thiamine hydrochloride 2 mg/l and some A secondary seed medium containing an antifoam and having a pH of 7.2 was prepared.
[138]
Fermentation medium: Organic raw sugar of 98.5% purity 4%, magnesium sulfate 0.03%, yeast extract 1%, phosphoric acid 0.22%, potassium hydroxide 0.4%, biotin 0.2mg/l, thiamine hydrochloride 0.6mg/l, manganese sulfate 0.002%, sulfuric acid A fermentation medium containing 0.002% iron, 0.002% zinc sulfate, 0.0006% copper sulfate, and a slight antifoaming agent was prepared.
[139]
[140]
Dispense 50 ml of the primary seed medium into an Erlenmeyer flask with a capacity of 500 ml and sterilize under pressure at 121°C for 20 minutes to cool, and then inoculate the strains at 200 times/min. It was incubated with shaking for 7 hours.
[141]
[142]
0.25L of the secondary seed medium was prepared in a 1.5L test fermenter, sterilized under pressure at 121°C for 20 minutes to cool, and 50 ml of the primary seed culture solution was inoculated, and the rotational speed was 900 times/min, 31.5°C. Incubated for 15 hours at.
[143]
[144]
0.25 L of the fermentation medium was prepared in a 5 L test fermenter, sterilized under pressure at 121°C for 20 minutes, cooled, and then 0.26 L of the secondary seed culture solution was inoculated, and the rotational speed was 900 times/minute, 30 to 34°C. Cultured in.
[145]
[146]
While culturing under the above conditions, the pH of the fermentation broth during the culture of the Corynebacterium glutamicum was continuously adjusted using 28% aqueous ammonia so that the pH of the fermentation broth was in the range of 7.0 to 7.4. When the concentration of residual sugar reached 0.5 to 1.5% during cultivation, sterilized organic raw sugar was frequently added, and the culture was continued until the total amount of added sugar became 30 to 34% of the amount of fermentation broth.
[147]
[148]
[Table 4]
Strain name Analysis result (g/l)
main ingredient by-product
Solid content Glutamic acid Glycine amino acid Organic acid Residual sugar ion
KFCC11074 140.2 64.2 0.18 11.5 3.5 12.0 11.1
KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 147.3 59.0 2.43 16.4 2.7 15.1 10.7
[149]
As a result, as shown in Table 4, the amount of glutamic acid produced between the two strains was not significantly different, but the mutation was introduced Corynebacterium glutamicum KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG strain produced. It was confirmed that the content of my glycine was significantly increased.
[150]
[151]
Even in the case of a fermentation composition using a 3kL fermentor, the amount of glutamic acid produced between the two strains was not significantly different, but the mutation was introduced Corynebacterium glutamicum KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG strain compared with the KFCC11074 strain. Thus, it was confirmed that the content of glycine was significantly increased (0.2 g/L vs 3.2 g/L) without a significant difference in the amount of glutamic acid produced (64.2 g/L vs 73 g/L).
[152]
[153]
From the above description, those skilled in the art to which the present application pertains will understand that the present application may be implemented in other specific forms without changing the technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including all changes or modified forms derived from the meaning and scope of the claims to be described later rather than the above detailed description, and equivalent concepts thereof.
[154]
[155]

[156]

Claims
[Claim 1]
Microorganisms of the genus Corynebacterium with enhanced glycine production ability, enhanced activity of ATP phosphoribosyltransferase (HisG).
[Claim 2]
The microorganism of claim 1, wherein the ATP phosphoribosyltransferase is that the 233th amino acid of the amino acid sequence represented by SEQ ID NO: 4 is substituted with histidine (H).
[Claim 3]
The method of claim 1, wherein the ATP phosphoribosyltransferase is that the 233th amino acid of the amino acid sequence represented by SEQ ID NO: 4 is substituted with histidine (H), and the 235th amino acid is substituted with glutamine (Q). Microorganisms of the genus Nebacterium.
[Claim 4]
The microorganism of claim 2, wherein the ATP phosphoribosyltransferase consists of the amino acid sequence of SEQ ID NO: 5.
[Claim 5]
The microorganism of claim 3, wherein the ATP phosphoribosyltransferase consists of the amino acid sequence of SEQ ID NO: 6.
[Claim 6]
The microorganism according to any one of claims 1 to 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
[Claim 7]
A method for producing a fermentation composition comprising glycine and glutamic acid, comprising the step of fermenting the microorganism of the genus Corynebacterium according to any one of claims 1 to 5 in a medium.
[Claim 8]
A fermentation composition prepared by the method of claim 7.