Sign In to Follow Application
View All Documents & Correspondence

Microorganism Having L Lysine Productivity And Method For Producing L Lysine By Using Same

Abstract: The present invention relates to a microorganism having L lysine productivity and a method for producing L lysine by using the same. More particularly the present invention relates to: a Corynebacterium sp. microorganism having been mutated such that the activity of a protein associated with cell wall hydrolysis is inactivated in comparison to the intrinsic activity thereof; and a method for producing L lysine by using the same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
23 January 2018
Publication Number
17/2018
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2021-04-26
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330 Dongho ro Jung gu Seoul 04560

Inventors

1. LEE Peter
127 704 36 Gwongwang ro 260beon gil Yeongtong gu Suwon si Gyeonggi do 16532
2. KIM Hyung Joon
106 2104 343 Gyeongin ro Guro gu Seoul 08226
3. CHOI Hyang
246 1504 16 Bongyeong ro 1744beon gil Yeongtong gu Suwon si Gyeonggi do 16711
4. RYU Song Gi
203 2003 34 Geumdang ro 39beon gil Jangan gu Suwon si Gyeonggi do 16281
5. LEE Sang Mok
206 1203 158 Gangseo ro 47 gil Gangseo gu Seoul 07634

Specification

[1]The present invention relates to a microorganism and production of L- lysine using the same method with L- lysine-producing ability.
[2]
BACKGROUND
[3]
L- amino acids are used in animal feed or human pharmaceutical or cosmetics industry, particularly L- lysine is mainly produced by fermentation using strains of the genus Corynebacterium or the genus Escherichia spp. Accordingly, research on high-efficiency production strain and although various studies have been carried out for the fermentation process technology, cells can still be a cause of late fermentation production capacity decreases to control dissolution for the production of L- lysine is insufficient.
[4]
[5]
On the other hand, the cell wall hydrolase (cell wall hydrolases) are known as enzymes that break down the cell walls of bacteria, peptidoglycan is present in all the microorganisms having the glycans (peptidoglycan) (Rice KC & Bayles KW. Microbiol Mol Biol Rev. 2008 72: 85-109). While this is going on in the cell wall, such that a variety of studies for the bacteria hydrolase, is not known for its correct active control mechanism.
[6]
The model for the mechanism of cell lysis that occurred recently during culture of the microorganism has been suggested in pneumonia ssanggugyun (Pneumococcal) (Mellroth P et al J Biol Chem 2012. 287:.. 11018-29). Specifically, first, when the cells are exposed to various stresses, the cell wall degradation is initiated by the cellular activity of cell wall hydrolytic enzyme present in the outer wall increases. When the cells are dissolved in this continuous operation of such cell wall hydrolases, the cell wall hydrolytic enzymes present in the cell cytoplasm is exposed to the outside. There is a series of process is continued up when the amount of the cell wall hydrolases cells over an external threshold (threshold) that the mechanism around the cells dissolved reported. However, no known bar with respect to the relationship between the fermentation culture process, cell lysis and production of amino acids that occur during.
[7]
Detailed Description of the Invention
SUMMARY
[8]
The present inventors have sought an example result, the gene encoding a protein involved in cell wall hydrolysis to continue to search for effective transfection of increasing the L- lysine-producing ability In the exemplary L- lysine-producing strain Corynebacterium spp If the defect was identified that increased capability L- lysine production. In addition, the present invention has been completed by confirming that the effect on gene-deficient when lysine-producing ability increases encoding a protein to a similar function in addition.
[9]
Problem solving means
[10]
One object of the invention to provide a microorganism of the genus Corynebacterium having an L- lysine-producing ability.
[11]
Another object of the invention to provide a method for producing L- lysine using the microorganism of the genus Corynebacterium having the L- lysine-producing ability.
[12]
Effects of the Invention
[13]
The microorganism of the genus Corynebacterium microorganism reduction or inactivation than the intrinsic activity of proteins involved in cell wall hydrolysis according to the present invention is a new strain led to an increase in the late fermentation production capacity, has a stiffness that L- lysine-producing ability Yes bacterium is applied as a new paradigm in the Solarium in microorganisms, it can provide a microorganism capable of producing L- lysine with a high yield. Accordingly, the manufacturing L- lysine, as well as animal feed or animal feed additive can be applied to various products, such as human food or food additives, pharmaceutical products.
[14]
Best Mode for Carrying Out the Invention
[15]
In order to achieve the above object, the present invention provides a microorganism of the genus Corynebacterium having, L- lysine-producing ability such that the activity of the mutant cell wall hydrolysis related protein inactivation than the endogenous activity In some embodiments.
[16]
[17]
The term "cell wall hydrolytic related protein" in the present invention means a related protein which can hydrolyze the cell wall in Corynebacterium spp. Decomposing the cell wall associated protein hydrolysis is cell wall-associated hydrolase (cell wall-associated hydrolase or N- acetyl mu L'days -L- alanine amidase (N-acetylmuramoyl-L-alanine amidase) may be a protein, limited to It is not.
[18]
If it has the relevant protein activity capable of hydrolyzing the cell wall in a microorganism as described above, the protein and gene sequences can be obtained from a known database. Examples, but the GenBank, such as NCBI, but are not limited to, .
[19]
[20]
The cell wall-associated hydrolase may be particularly useful for but not limited to, the genus Corynebacterium microorganism, specifically, Corynebacterium of glutamicum origin NCgl1480 gene encoding the protein, NCgl2107 gene encoding a protein or NCgl2108 gene encoding protein . Specific examples cell wall-associated hydrolase, but may have an amino acid sequence, the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 3 of SEQ ID NO: 1, protein sequence having the activity can be included without limitation. Further, the cell wall-associated hydrolysis if the nucleotide sequence encoding a protein having the enzymatic activity may be included, without limitation, and specific examples SEQ ID NO: 5 of the sequence, of SEQ ID NO: 6 DNA sequence or SEQ ID NO: encoded by the nucleotide sequence of the 7 It may be a protein, but not limited thereto.
[21]
[22]
The N- acetyl mu L'days -L- alanine amidase (N-acetylmuramoyl-L-alanine amidase) may be the genus Corynebacterium microorganism, specifically, Corynebacterium glutamicum origin of the NCgl2986 gene encoding protein . Specific examples are the N- acetyl mu L'days -L- alanine amidase, but may have an amino acid sequence of SEQ ID NO: 4, the amino acid sequence thereof, if the protein having the activity can be included without limitation. In addition, the N- acetyl mu L'days -L- alanine amidase, and a protein having the enzymatic activity can include, without limitation, if the nucleotide sequence encoding, may be a protein encoded by the nucleotide sequence of SEQ ID NO: 8. A specific example, this not limited.
[23]
[24]
Wherein each protein is the amino acid sequence, as well as the sequence that is 80% or more, preferably at least 90%, more preferably at least 95%, particularly preferably at least 97% homology based on each sequence number the of the present invention a may include an amino acid sequence having. If the amino acid sequence shown represents the protein substantially the same as or equivalent to the efficacy and the respective protein sequences as having such homology include, without limitation. Also, if the amino acid sequence having a homology of these, incorporated in the part, it is obvious sequence is deleted, modified, substituted or added in the amino acid sequence of the scope of the present invention.
[25]
In addition, genes encoding each of the proteins of the present invention is the not only the nucleotide sequence encoding the amino acid described in each SEQ ID NO, the sequence that is at least 80%, preferably at least 90%, more preferably at least 95% , and more preferably contains no more than 98%, most preferably substantially if the gene sequence coding for a protein showing the efficacy of the same or correspond to each of the protein as the nucleotide sequence shown by at least 99% homology to restriction. Also, if the base sequence having a homology of these, incorporated in the part, it is obvious sequence is deleted, modified, substituted or added in the nucleotide sequence is also the scope of the invention.
[26]
It means a similar degree of the term "homologous" refers to nucleotide sequences or amino acids of the gene encoding the protein sequence to be used in the present invention, when the homology is high enough expression product of the gene may have the same or similar activity have. In other words, it refers to the percent of identity between two polynucleotide or polypeptide base ET. Sequence homology between from one mode to the other one of the parent ET ET castle may be determined by the known art. For example, it can be determined by directly aligning the sequence information between two polynucleotide molecules, or two polypeptide molecules by using a homology retrieving possible to align the sequence information and computer program easily. The computer program may be such as BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlignTM (DNASTAR Inc). In addition, polynucleotide homology between After hybridizing polynucleotide under conditions forming a stable duplexes between homologous regions, single-can be determined by determining the amount of the decomposed fragment was digested zero-specific nuclease-stranded.
[27]
[28]
As used herein, the term "intrinsic activity" means an active state of the protein that has the state of the state prior to the original or natural microorganism strain.
[29]
The said "the variation of the enzymatic activity to be inactivated relative to intrinsic activity", even if the or expression if the expression of the gene coding for the enzyme that is not at all expressed in comparison to the strain before the wild-type strain or a strain decreased, or that the active It means.
[30]
Thus, when it is activated is inactivated compared to the endogenous activity compared with the activity of the enzyme in the original microorganisms have in a state before state or modified natural, it means that a reduced or no its activity. The reduction in the cell in the case of the enzyme itself active with such variation of the gene encoding the enzyme decreased compared to the activity of the enzyme in the original microorganisms have, inhibiting expression of the gene encoding it, or translated (translation) inhibition, etc. If the degree of overall enzyme activity lower than the strain before the wild-type strain or a strain, a combination thereof is also a concept including.
[31]
The "if there is no activity," is the expression of the gene coding for the enzyme even though this does not at all expressed and / or expression compared to the wild-type strain prior to the strain or deformation indicates a case where its activity have been removed.
[32]
Methods of mutation to inactivation of this enzyme activity may be achieved by application of various methods well-known in the art. An example of the method, the method that a mutant gene such that the activity of the enzyme reduced, including a case in which the activity of the enzyme has been removed, a replacement gene encoding the enzyme on a chromosome; A method of introducing a mutation into an expression control sequence of the gene on the chromosome encoding the enzyme; How to replace the expression control sequence of the gene coding for the enzyme with low or no activity sequences; A method of deleting the entire or part of the gene on the chromosome encoding the enzyme; To antisense oligonucleotide to bind to complementary to the transcript of the gene on the chromosome inhibit translation of the enzyme from the mRNA introducing a nucleotide (e.g., antisense RNA); Of the artificially added in 2 ORF (open reading frame) of the method and the corresponding sequence attached that make this possible in order to form a structure ribosomes (ribosome) the SD sequence and the sequence complementary to the front end of SD sequence of the gene coding for the enzyme 3 'and the like, RTE (reverse transcription engineering) method of adding the promoter to reverse transcription at the terminal, a combination of the two can also be achieved, but is not particularly limited by the examples.
[33]
[34]
Specifically, a method for deleting a part or all of the gene coding for the enzyme is that switching a polynucleotide encoding my intrinsic target protein chromosome through a bacterial vector for in chromosome insert as part of the nucleic acid sequence is deleted polynucleotides or marker gene by it may be performed. In one example of a method for deleting a part or all of these genes may be used a method of deleting a gene by homologous recombination.
[35]
Means "part" in the poly differ according to the type of the nucleotide, but, specifically, is 1 to 300, specifically, 1100 to, and more specifically, but can clear up 1 to 50, it is not particularly limited.
[36]
"Homologous recombination (homologous recombination)" in the above refers to a genetic recombination takes place through the exchange connection in the gene locus of the chain with a homology to each other.
[37]
According to the embodiments of the present invention it was inactivated by homologous recombination of the protein.
[38]
[39]
Specifically, the method of modifying the expression control sequence is performed by inducing a deletion, insertion, Vivo wholly or conservative substitution or a mutation on the expression control sequence into a combination of a nucleic acid sequence of the expression control sequence, or replace it with a weaker promoter method can be carried out by such as. And the expression control sequence includes a sequence for controlling the sequence, and termination of transcription and decryption encoding a promoter, operator sequence, a ribosome binding site.
[40]
In addition, the method of modifying the gene sequence on the chromosome has deletion of the gene sequence such that the activity of the enzyme reduced further, inserting, Vivo wholly or conservative substitutions or performed by inducing a mutation on the sequence, or more weakly activated by a combination of both have can be performed by replacing into the gene sequence is improved so that an improved gene sequence or active.
[41]
[42]
"Microorganism having an L- lysine-producing ability" terminology, in this invention means a microorganism strain capable of producing L- lysine by fermentation. For example, to ensure that lags the present invention, the activity of cell wall hydrolytic protein involved inactivated compared to the endogenous activity by the operation according to the control by the cell lysis that occurs during the fermentation for lysine production, increasing the L- lysine-producing ability It can include, but are not limited to the strain which.
[43]
In the present invention, the microorganism having the L- lysine-producing ability may include all the genus Corynebacterium microorganism which is active in the cell wall hydrolysis-related proteins of the invention may be mutated to inactivate compared to the endogenous activity. Examples of Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Brevibacterium Plastic boom ( Brevibacterium flavum ), or Brevibacterium lactofermentum ( Brevibacterium fermentum ), but such can be used, but are not limited to. One example, the microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum may be used). The mutated microorganism of the genus Corynebacterium, has an enhanced ability L- lysine production characteristics as compared to the activity of the microbial cell wall-associated protein hydrolysis is not mutated to inactivate compared to the endogenous activity.
[44]
[45]
The present invention also comprising: culturing a microorganism of the genus Corynebacterium having an aspect as (i) of the invention wherein the cell wall associated protein hydrolysis activity of endogenous activity in the non-mutated as compared to activation, L- lysine-producing ability of .; And (ii) provides a method for producing, L- lysine recovering the L- lysine from the culture or the microorganism according to the above culture.
[46]
The L- lysine-producing Corynebacterium spp increased ability are as described above.
[47]
The term "culture" in this invention means that the growth in the environmental conditions which control the microorganisms with artificially appropriately. How to culture the L- lysine using a bacterial microorganism of the genus Corey four in the present invention can be carried out using a method well known in the art. Specifically, the culture is not however be cultured in a continuous manner to the injection batch process a batch process, a batch or repeated injection (fed batch or repeated fed batch process), this limit.
[48]
The medium used to culture should meet the requirements of the particular strains in a suitable manner. There are four Corey culture medium for bacterial strains is known (e.g., Manual of Methods for General Bacteriology. American Society for Bacteriology. Washington DC, USA, 1981). Which can be used members include glucose, sucrose, lactose, paroxetine lactose, maltose, starch, cellulose and and carbohydrates, soybean oil, sunflower oil as per, castor oil, oils and fats such as coconut oil, palmitic acid, stearic acid, , an alcohol such as a fatty acid, glycerol and ethanol, such as linoleic acid, gluconic acid, may be included the organic acids such as acetic acid, pyruvic acid, without being limited thereto. These materials may be used in separation or in combination. The nitrogen source which can be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, but may include the ammonium carbonate and ammonium nitrate, this is not limited. Nitrogen sources may also be used separately or as a mixture. Personnel to that may be used include phosphate, sodium or potassium phosphate or the corresponding potassium susoyi - but not containing salt may be included are, limited. Also, culture media may contain metal salts such as magnesium sulfate or iron sulfate needed for growth. Finally, the required growth substances such as amino acids and vitamins can be used in addition to the above materials. Also may be used, suitable precursors to the culture medium. The above described material may be added in a batch-wise or continuously by a suitable manner to the culture medium in culture. These various culture methods, for example, are disclosed in literature ( "Biochemical Engineering" by James M. Lee, Prentice-Hall International Editions, pp 138-176).
[49]
With an acid compound such as phosphoric acid or sulfuric acid or a basic compound such as sodium hydroxide, potassium hydroxide, ammonia in a suitable manner it is possible to adjust the pH of water culture. It is also possible to use anti-foaming agents such as fatty acid polyglycol ester can suppress foam generation. To maintain aerobic conditions, oxygen or oxygen into the culture medium-containing gas can be injected (for example, air). The temperature of the culture medium may be a usual 20 ℃ to 45 ℃, preferably from 25 ℃ to 40 ℃, it is possible to change according to conditions. Culture can continue until the desired amount of L- amino acids obtained the maximum. For this purpose can be achieved in a normal 10 to 160 hours. L- lysine may be contained in, or released into the culture medium, cells.
[50]
A method of producing L- lysine of the present invention can comprise the step of recovering lysine from the medium or the microorganism. Microorganism or method for recovering L- lysine from the culture method known in the art, such as centrifugation, filtration, anion exchange chromatography, but this can be used, such as crystallization and HPLC, but are not limited to these examples.
[51]
The recovering step may comprise a step of purification.
[52]
Mode for the Invention
[53]
It will be described in more detail the present invention to the following examples. These examples are only intended to illustrate the invention and are not construed the scope of the present invention is not limited to these examples.
[54]
[55]
Example 1: a transposon making random mutant libraries using
[56]
For the purpose of obtaining a gene that increases the lysine-producing ability to prepare a vector library by following the steps below. First, EZ-Tn5 ™ Tnp Transposome ™ is a plasmid KCCM11016P (the microorganism obtained using the Kit (Epicentre) was published KFCC10881, the material deposited in the Budapest Treaty servant international deposition deposited by KCCM11016P number the reception, by transforming Republic of Korea Patent No. 10-0159812 by the arc) strain as the parent strain, and spread on a plate medium composite kanamycin (with a 25 mg / l) were obtained from about 20,000 colonies were given.
[57]
[58]

[59]
Glucose 10 g, peptone 10 g, Beef extract 5 g, yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, urea 2 g, Sorbitol 91 g, agar 20 g (in 1 liter of distilled water)
[60]
[61]
Example 2: a transposon random mutant libraries screened using
[62]
Example 1 In to the inoculated to about 20,000 colonies on the selection medium 300 ㎕ each obtained from 32 ℃ in 96 deep well plate, and cultured for about 24 hours with 1000 rpm. To analyze the production of L- lysine production in the culture medium was used as a way ninhydrin (Moore, S., Stein, WH, Photometric ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem.1948, 176, 367-388). After incubation is complete, as variations showing the higher absorbance compared to the culture supernatant 10 ㎕ and non-hard lean reaction solution was a 190 ㎕ at 65 ℃ 30 minutes of reaction, and measuring the absorbance at a wavelength of 570 nm with spectrophotometer control KCCM11016P strain about It was screened in more than 60 kinds of colonies. Other colonies showed a similar or decreased absorbance and the KCCM11016P strain used as a control.
[63]
Wherein the selection of more than 60 kinds of strains were selected as a result KCCM11016P strain compared to L- lysine-producing ability of strains improved top 10 species were cultured in the same manner as do non-high the reaction gave repeated.
[64]
[65]

[66]
Glucose 10 g, 5.5 g ammonium sulfate, MgSO4 · 7H2O 1.2 g, KH2PO4 0.8 g, K2HPO4 16.4 g, biotin 100 ㎍, thiamine HCl 1000 ㎍, calcium pantothenate 2000 ㎍, nicotinamide 2000 ㎍ (in 1 liter of distilled water)
[67]
[68]
Example 3: The selected randomly from mutants L- lysine -producing ability Analysis
[69]
Example 2 a reproducibility test in a flask with the culture medium to a final screening to increase the strain capability of the production of L- lysine to target the strains of the 10 kinds of selection was performed on. 250 ㎖ corner containing a seed medium for 25 ㎖ to the strain and the control of the 10 species for inoculation in bapeul flask, and 20 hours at 30 ℃, then this was cultured with shaking in 200 rpm. Then, 250 ㎖ corner containing the production medium in 24 ㎖ to a seed culture in 1 ㎖ -, then this was cultured with shaking at 200 rpm for inoculation in bapeul flask, and 96 hours at 37 ℃. Composition of the seed medium and the production medium was as follows, respectively. After incubation is complete by HPLC was analyzed in L- lysine concentration of the culture medium, are shown the concentration producing L- lysine of the respective mutants in Table 1 below.
[70]
[71]
<종배지 (pH 7.0)>
[72]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, Biotin 100 ㎍, thiamine HCl 1000 ㎍, calcium pantothenate 2000 ㎍, nicotinamide 2000 ㎍ ( 1 liter of distilled water)
[73]
[74]

[75]
Glucose 100 g, (NH4) 2SO4 40 g, Soybean protein 2.5 g, corn steep solids (Corn Steep Solids) 5 g, urea 3 g, KH2PO4 1 g, MgSO4 · 7H2O 0.5 g, Biotin 100 ㎍, thiamine hydrochloride 1000 ㎍, calcium pantothenate 2000 ㎍, nicotinamide 3000 ㎍, CaCO3 30 g (per liter of distilled water).
[76]
[77]
[Table 1] Concentration of L- lysine-producing mutants selected 10 kinds of
Strain L- lysine (g / l)
Placed one Placed second Placed third Average
Controls KCCM11016P 42.5 42.8 42.7 42.7
1 KCCM11016P/mt-1 48.8 48.9 48.5 48.7
2 KCCM11016P/mt-2 43.0 43.1 43.4 43.2
3 KCCM11016P/mt-3 42.7 43.1 42.9 42.9
4 KCCM11016P/mt-4 44.9 45.1 45.3 45.1
5 KCCM11016P/mt-5 44.3 44.1 44.0 44.1
6 KCCM11016P/mt-6 42.4 42.9 42.8 42.7
7 KCCM11016P/mt-7 43.8 43.2 43.7 43.6
8 KCCM11016P/mt-8 47.2 46.9 47.1 47.1
9 KCCM11016P/mt-9 44.1 44.4 44.2 44.2
10 KCCM11016P/mt-10 43.1 43.7 43.2 43.3

[78]
[79]
The ability of the selected 10 kinds of mutant L- lysine-producing means so as enhanced strain KCCM11016P / mt-1, and KCCM11016P / mt-8 was the final selection.
[80]
[81]
Example 4: End of the week in the selected L- lysine production capacity related to genes identified and added to the candidate gene screening
[82]
In the present embodiment it was to identify the genetic defect by the random insertion of a transposon in Example 3 with the final destination the selected strains. After the digest extracts KCCM11016P / mt-1 and Genomic DNA of KCCM11016P / mt-8 by ligation and transformed into E. coli DH5α, which was plated on LB solid medium containing kanamycin contains a (25 mg / l). After transfection, each selection of the conversion colony 20 kinds was obtained a plasmid containing the gene portion of the image, a sequence of EZ-Tn5 ™ SEQ ID NO: 9 and SEQ ID NO: 10 in the Tnp Transposome ™ Kit the analysis of the base sequence with (Table 2), and found that each NCgl2108, NCgl2986 gene in the mutant non-active.
[83]
[84]
TABLE 2
order SEQ ID NO:
Primer Kit ACCTACAACAAAGCTCTCATCAACC 9
Primer Kit CTACCCTGTGGAACACCTACATCT 10

[85]
[86]
In the third embodiment of the NCgl2108, NCgl2986 gene identified as deficient in the selection gene present in the mutant strain in the intrinsic Corynebacterium, it was identified as a protein involved in cell wall hydrolysis.
[87]
[88]
In the same, random mutants of the protein based on the selected result associated with the two types of cell wall hydrolysis in using a transposon, loss of the genes involved in cell wall hydrolysis was determined would be effective to increase L- lysine-producing ability . Therefore, it explores the genes involved in cell wall hydrolysis than NCgl2108 NCgl2986 and the US National Biological Information Center (NCBI).
[89]
Search result, Corey four NCgl1480 and NCgl2107 gene inherently present in tumefaciens, was selected as a protein involved in cell wall degradation further hydrolysis. Accordingly, even when the NCgl1480 and NCgl2107 gene defect, in order to ensure that the impact neunge L- lysine production, the two genes were selected for further candidate gene defect.
[90]
[91]
Example 5: NCgl1480 , NCgl2107 , NCgl2108 , NCgl2986 produced recombinant plasmids for the inactivation of the gene
[92]
In this embodiment, NCgl1480, NCgl2107, NCgl2108, in order to determine the effect of inactivation of the NCgl2986 gene and L- lysine production, Corynebacterium a NCgl1480, NCgl2107, NCgl2108, NCgl2986 genes selected in Example 4 L- lysine producing a recombinant plasmid was prepared for deletion strain on the chromosome.
[93]
On the basis of the base sequences reported in (NIH Genbank) gene bank of the National Institutes of Health by NCgl1480, NCgl2107, NCgl2108, and SEQ ID NO: of the NCgl2986 1, 2, 3, and SEQ ID NO: to 4 amino acids, and each encoding the 5, 6, the sequence of the 7 and 8 nucleotides was obtained. To make each NCgl1480, NCgl2107, NCgl2108, NCgl2986 of the open reading frame of the gene fragment loss in the internal (open reading frame), on the basis of the SEQ ID NO: 5, 6, 7, and 8, respectively, SEQ ID NO 11 to 14, primers of 15 to 18, 19 to 22, and 23 to 26 were produced. To the sequences thereof are shown in Table 3.
[94]
[95]
TABLE 3
primer order SEQ ID NO:
NCgl1480 primer CCGGGGATCCTCTAGAACCTTGAAACTTCCACTC 11
NCgl1480 primer CTCCTGACGAACTATTTCAAATCCCCTATCAACCTC 12
NCgl1480 primer CACCGAGGTAAATTGCCATGCAAGCGCAATCAACGC 13
NCgl1480 primer GCAGGTCGACTCTAGAAACCACACATTATCGATC 14
NCgl2107 primer CCGGGGATCCTCTAGAGCACAGGGCACCCCTGTTG 15
NCgl2107 primer CTCCTGACGAACTATTTCAAATCCCCTATCAACCTC 16
NCgl2107 primer GAGGTTGATAGGGGATTTGAAATAGTTCGTCAGGAG 17
NCgl2107 primer GCAGGTCGACTCTAGAAACCACACATTATCGATC 18
NCgl2108 primer CCGGGGATCCTCTAGAGAACCCTTAGTAGTTGGG 19
NCgl2108 primer GTAATCCAAGGAGTGCTCACCCACTGATGAAACTCC 20
NCgl2108 primer GGAGTTTCATCAGTGGGTGAGCACTCCTTGGATTAC 21
NCgl2108 primer GCAGGTCGACTCTAGACGAGCCTCAATATCAATC 22
NCgl2986 primer CCGGGGATCCTCTAGATTAGGAGAAACCATGAGC 23
NCgl2986 primer ATCAGTCAGAACTGCCAGGACTGCAGTAAGAATACC 24
NCgl2986 primer GGTATTCTTACTGCAGTCCTGGCAGTTCTGACTGAT 25
NCgl2986 primer GCAGGTCGACTCTAGAGTTGAGGCGTTTGGATAC 26

[96]
[97]
Corynebacterium glutamicum ATCC13032 genomic DNA subject to a template SEQ ID NO: 11 and SEQ ID NO: 12, SEQ ID NO: 13 and SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21 and SEQ ID NO: 22, using the SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26 as primers PCR [Sambrook et al, Molecular Cloning, a Laboratory Manual (1989), Cold Spring the Harbor Laboratories] was performed. PCR conditions were denaturation 95 ℃, 30 seconds; ℃ annealing 50, 30 seconds; And the polymerization reaction 72 ℃, was repeated 30 times for 1 minute.
[98]
[99]
As a result, two sets of DNA containing the NCgl1480 gene the front and rear portions of the 319bp and 410bp fragments (NCgl1480-A and NCgl1480-B), two sets of DNA fragments containing the NCgl2107 gene the front and rear portions of the 324bp and 300bp ( NCgl2107-a and NCgl2107-B), two sets of DNA containing the NCgl2108 gene the front and rear portions of the 381bp and 377bp fragments (NCgl2108-a and NCgl2108-B), and including a NCgl2986 gene the front and rear portions of the 356bp and 374bp to give the two pairs of DNA fragment (a-NCgl2986 and NCgl2986-B). The above DNA fragment was amplified by PCR after the use the Infusion Cloning Kit (Invitrogen) conjugated to pDZ plasmid (Republic of Korea Patent No. 10-0924065 call) is transformed into E. coli DH5α, and contains a kanamycin 25 mg / L LB It was plated on solid medium. After screening the gene of interest it is transformed with a plasmid inserted through the colony PCR, using the conventional plasmid extraction method known to obtain a plasmid. This plasmid was named as each pDZ-ΔNCgl1480, pDZ-ΔNCgl2107, pDZ-ΔNCgl2108, pDZ-ΔNCgl2986. pDZ-ΔNCgl1480 is a gene of 1672bp NCgl1480, pDZ-ΔNCgl2107 is a gene of 1026bp NCgl2107, pDZ-ΔNCgl2108 is a gene of 576bp NCgl2108, pDZ-ΔNCgl2986 was missing a gene of 1092bp NCgl2986.
[100]
[101]
Example 6: lysine -producing strain KCCM11016P protein gene inactivated strain Production and evaluation related to the cell wall-derived hydrolysis
[102]
Making an exemplary L- lysine-producing Corynebacterium strain in a cell wall hydrolysis related protein gene inactivated strains screened KCCM11016P strain based on the above, and was to evaluate its lysine-producing ability.
[103]
[104]
The embodiment using the example 5 the four kinds of recombinant plasmids (pDZ-ΔNCgl1480, pDZ-ΔNCgl2107, pDZ-ΔNCgl2108, pDZ-ΔNCgl2986) for making the electrical pulse the method of Corynebacterium glutamicum and each transformant in KCCM11016P, the strains enable the desired gene on a chromosome by homologous recombination fire was prepared by the PCR method. The manufactured inactivated strain was named respectively :: ΔNCgl1480 KCCM11016P, KCCM11016P ΔNCgl2107 ::, :: ΔNCgl2108 KCCM11016P, KCCM11016P :: ΔNCgl2986.
[105]
250 ㎖ corner containing a seed medium for 25 ㎖ to the strain and the control of the above mentioned four-inoculation in the bapeul flask, 30 ℃ for 20 hours, then this was cultured with shaking in 200 rpm. Then, 250 ㎖ corner containing the production medium in 24 ㎖ to a seed culture in 1 ㎖ -, then this was cultured with shaking at 200 rpm for inoculation in bapeul flask, and 96 hours at 37 ℃. Composition of the seed medium and the production medium was as follows, respectively.
[106]
[107]
<종배지 (pH 7.0)>
[108]
Glucose 20 g, (NH4) 2SO4 10 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 · H2O 0.5 g, biotin 100 ㎍, thiamine HCl 1000 ㎍, calcium pantothenate 2000 ㎍, nicotinamide 2000 ㎍ (in 1 liter of distilled water)
[109]
[110]

[111]
Glucose 100 g, (NH4) 2SO4 40 g, Soybean protein 2.5 g, corn steep solids (cornsteep solid) 5 g, urea 3 g, KH2PO4 1 g, MgSO4 · H2O 0.5 g, biotin 100 ㎍, thiamine hydrochloride 1000 ㎍, calcium pantothenate 2000 ㎍, nicotinamide ㎍ 3000, CaCO 3 30 g (per liter of distilled water)
[112]
[113]
After the end of incubation, it showed a L- lysine concentration analyzed by HPLC in the following Table 4. The results in Table 4 is an experimental result repeated three times, was evaluated by the average value-producing ability.
[114]
[115]
TABLE 4
  Lysine g / L
Placed one Placed second Placed third Average
KCCM11016P 42.7 42.6 43.0 42.8
KCCM11016P-ΔNCgl1480 44.3 44.1 44.0 44.1
KCCM11016P-ΔNCgl2107 45.1 44.9 45.2 45.1
KCCM11016P-ΔNCgl2108 48.1 48.3 48.0 48.1
KCCM11016P-ΔNCgl2986 49.3 49.1 49.2 49.2

[116]
[117]
The result was increased by 3.2% lysine-producing ability, 5.4%, 13%, 15% NCgl1480, NCgl2107, NCgl2108, NCgl2986 gene is inactivated strain from the parent strain KCCM11016P As shown in Table 4.
[118]
[119]
These results, which would suggest that the Corynebacterium by the fire of proteins involved in cell wall hydrolysis, which can cause cell fusion in the microbial activation can improve L- lysine production capacity.
[120]
[121]
Thus, it was tested in the following whether the similar effect even when inactivate said cell wall associated protein hydrolysis in wide range of additional Corynebacterium spp.
[122]
[123]
Example 7: L- lysine -producing strain KCCM10770P Production and evaluation of the proteins inactivated strain involved in cell wall-derived hydrolysis
[124]
The lysine biosynthetic pathway is enhanced L- lysine-producing strain Corynebacterium glutamicum KCCM10770P (Korea Patent Registration No. 10-0924065 call) is involved in cell wall protein inactivation effect hydrolysis similar to the results of Example 6 from in order to compare resin, prepared in the same manner of a strain non-active proteins involved in the four types of cell wall hydrolysis as in example 6 to KCCM10770P :: ΔNCgl1480, KCM10770P :: ΔNCgl2107, KCCM10770P :: ΔNCgl2108, KCM10770P :: ΔNCgl2986 was named, it was compared with L- lysine production capacity.
[125]
[126]
After culturing by the same method as in Example 6, with the respective control group compared to the lysine-producing ability of the strain, and the end the culture, L- lysine concentration was analyzed by HPLC it is shown in Table 5. The results in Table 5 are repeated 3 times experimental results were evaluated by the average value-producing ability.
[127]
[128]
Table 5
  Lysine g / L
Placed one Placed second Placed third Average
KCCM10770P 46.0 46.3 46.1 46.1
KCCM10770P-ΔNCgl1480 47.3 47.1 47.0 47.1
KCCM10770P-ΔNCgl2107 48.0 48.2 48.1 48.1
KCCM10770P-ΔNCgl2108 51.7 51.9 51.6 51.7
KCCM10770P-ΔNCgl2986 53.1 52.9 52.1 52.7

[129]
[130]
The result was increased by 2.2% lysine-producing ability in the NCgl1480, NCgl2107, NCgl2108, NCgl2986 gene is inactivated strain from each parent strain KCCM10770P, 4.3%, 12.1%, 14.2%, as shown in Table 5.
[131]
Thus, it confirmed that Corynebacterium glutamicum KCCM10770P (Republic of Korea Patent No. 10-0924065 call) can also improve the L- lysine-producing ability by activation of proteins involved in the sixth embodiment, similar to the cell wall hydrolysis fire It was.
[132]
[133]
Example 8: L- lysine -producing strain KCCM11347P Production and evaluation of the proteins inactivated strain involved in cell wall-derived hydrolysis
[134]
Is produced by artificial variation law Corynebacterium glutamicum L- lysine-producing strains KCCM11347P (the microorganism was unveiled KFCC10750 be re-deposited at the International Depositary Authority under the Budapest Treaty, it has received a grant KCCM11347P. Patent No. 10 Korea in order to confirm the effects of the arc -0073610) in the non-protein involved in cell wall hydrolysis activation, prepared in the same manner of the protein are inactivated strains relevant to four types of cell wall hydrolysis as in example 6 KCCM11347P :: ΔNCgl1480 , KCCM11347P: ΔNCgl2107, KCCM11347P :: ΔNCgl2108, KCCM11347P: ΔNCgl2986 La was named, was compared L- lysine production capacity.
[135]
[136]
After culturing by the same method as in Example 6, with the respective control group compared to the lysine-producing ability of the strain, and the end the culture, L- lysine concentration was analyzed by HPLC it is given in Table 6. The results in Table 6 is a repeat experiment the result three times to evaluate the production performance as an average value.
[137]
[138]
TABLE 6
  Lysine g / L
Placed one Placed second Placed third Average
KCCM11347P 38.2 38.6 38.3 38.4
KCCM11347P-ΔNCgl1480 39.0 39.4 39.1 39.2
KCCM11347P-ΔNCgl2107 39.1 39.5 39.3 39.3
KCCM11347P-ΔNCgl2108 39.8 40.2 39.9 42.9
KCCM11347P-ΔNCgl2986 39.9 40.3 40.1 43.9

[139]
[140]
The result was increased by 2% in the lysine-producing ability NCgl1480, NCgl2107, NCgl2108, NCgl2986 gene is inactivated strain from the parent strain KCCM11347P, 2.4%, 11.7%, 14.4%, as shown in Table 6.
[141]
[142]
Thus, Corynebacterium glutamicum KCCM11347P (Republic of Korea Patent No. 10-0073610 call) can also improve the L- lysine-producing ability by the Example 6 and similarly to deactivate the proteins involved in cell wall hydrolysis 7 It was OK.
[143]
[144]
Example 9: L- lysine -producing strain CJ3P Production and evaluation of the proteins inactivated strain involved in cell wall-derived hydrolysis
[145]
Corynebacterium glutamicum mutant of the three main species in the wild [pyc (P458S), hom (V59A), lysC (T311I)] now have a L- lysine-producing ability Corynebacterium glutamicum by introducing CJ3P ( Binder et al Genome Biology 2012, 13:. R40) in example 6, 7 and 8. as with proteins involved in the four types of cell wall hydrolysis to light in order to examine the effect of inactivation of the protein involved in cell wall hydrolysis activation the manufacture of the strain in the same manner as example 6 CJ3P :: ΔNCgl1480, CJ3P :: ΔNCgl2107, CJ3P :: ΔNCgl2108, CJ3P :: ΔNCgl2986 la was named, was compared to L- lysine-producing ability.
[146]
[147]
After culturing by the same method as in Example 6, with the respective control group compared to the lysine-producing ability of the strain, and the end the culture, L- lysine concentration was analyzed by HPLC it is given in Table 7. The results in Table 7 are repeated three times experimental results were evaluated by the average value-producing ability.
[148]
[149]
Table 7
  Lysine g / L
Placed one Placed second Placed third Average
CJ3P 7.8 8.0 7.9 7.9
CJ3P-ΔNCgl1480 8.3 8.0 8.1 8.1
CJ3P-ΔNCgl2107 8.0 7.9 8.1 8.0
CJ3P-ΔNCgl2108 8.8 8.9 9.0 8.9
CJ3P-ΔNCgl2986 9.1 9.2 9.2 9.2

[150]
[151]
The result was increased by 3% from the lysine-producing ability NCgl1480, NCgl2107, NCgl2108, NCgl2986 gene is inactivated strain from the parent strain CJ3P, 1.3%, 12.7% 16% As shown in Table 8.
[152]
Thus, it was confirmed that Corynebacterium glutamicum CJ3P in an L- lysine-producing ability can be improved by similarly inactivating proteins involved in cell wall hydrolysis in the Example 6, 7 and 8. The experimental results of the.
[153]
[154]
Example 10: L- lysine -producing strain KCCM11016P Production and evaluation of a protein involved in the simultaneous inactivation strain derived from the cell wall hydrolysis
[155]
The embodiments from the L- lysine-producing strain of the genus Corynebacterium in cell wall hydrolysis, if related to each inactivating proteins After confirming the L- lysine-producing ability is increased, the related proteins of two or more simultaneously fire even if activate It was to ensure that the increased ability L- lysine production.
[156]
Thus, to L- lysine-producing strain Corynebacterium glutamicum to confirm the effect of the simultaneous inactivation of proteins involved in cell wall hydrolysis in KCCM11016P was performed the following experiments. Protein genes involved in cell wall hydrolysis of the effect on high-2 alone L- lysine-producing ability improved when the defect species KCCM11016P (NCgl2108 and NCgl2986) strains were obtained by preparing an inactivated strain at the same time in the same manner as in Example 6: LA was named ΔNCgl2108 / ΔNCgl2986, compared L- lysine production capacity.
[157]
[158]
After culturing by the same method as in Example 6 with the control group, and ends the culture to compare the lysine-producing ability of the strain, L- lysine concentration was analyzed by HPLC it is shown in Table 8. The results in Table 8 is repeated three times experimental results were evaluated by the average value-producing ability.
[159]
[160]
Table 8
  Lysine g / L
Placed one Placed second Placed third Average
KCCM11016P 43.4 43.1 43.2 43.2
KCCM11016P-ΔNCgl2108/ ΔNCgl2986 52.6 52.4 52.7 52.6

[161]
[162]
As a result, the increase of about 21.6% was lysine-producing ability in a strain NCgl2108 and NCgl2986 gene is inactivated simultaneously from the parent strain KCCM11016P As shown in Table 8.
[163]
Such a result is that not only one kinds of the proteins involved in cell wall hydrolysis, suggesting that L- lysine-producing ability can be improved even if an inert crystallized from Corynebacterium spp simultaneously two or more of them.
[164]
[165]
Thus, the strain, named KCCM11016P-ΔNCgl2986 to CA01-2292 and, CA01-2292 by the 12 May 2014 date of the international deposit under the Budapest Treaty on the International Deposit firm Korea Culture Center of Microorganisms (KCCM) with Accession Number given KCCM11627P received.
[166]
[167]
Sikineunde of the results from increasing the L- lysine-producing ability by controlling the cells generated during inactivation is fermented soluble than the intrinsic activity of proteins involved in cell wall hydrolysis in the L- lysine-producing strain was confirmed that this is effective. In addition, this cell wall proteins involved in the hydrolysis are one kinds confirmed that this as well as can also increase the L- lysine-producing ability activation of two or more simultaneously active light, could provide a novel L- lysine-producing strain.
[168]
[169]
From the above description, those skilled in the art will appreciate that may be embodied in other specific forms of the present invention without changing the technical spirit or essential characteristics. In this regard, the embodiments described above are only to be understood as exemplary rather than limiting in all aspects. The scope of the invention should be construed as the meaning and scope, and all such modifications as derived from the equivalent concepts of the claims to be described later, rather than the description above within the scope of the invention.
[170]

Claims

[Claim 1]The activity of the cell wall-associated protein hydrolysis genus Corynebacterium microorganism having a mutation that inactivated, L- lysine production capacity compared to the endogenous activity.
[Claim 2]
The method of claim 1, wherein the cell wall associated protein hydrolysis is Corynebacterium having the SEQ ID NO: 1 to 4 to the one or more proteins selected from the group consisting of a protein having the amino acid sequence shown in, L- lysine-producing ability Solarium spp.
[Claim 3]
The method of claim 1, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum ) which, genus Corynebacterium microorganism having an L- lysine-producing ability.
[Claim 4]
(I) any one of claims 1 to culturing any one of the genus Corynebacterium microorganism or 3, wherein in a medium; And (ii), method for producing L- lysine recovering the L- lysine from the medium or the microorganism according to the above culture.

Documents

Application Documents

# Name Date
1 201817002652-STATEMENT OF UNDERTAKING (FORM 3) [23-01-2018(online)].pdf 2018-01-23
2 201817002652-SEQUENCE LISTING(PDF) [23-01-2018(online)].pdf 2018-01-23
3 201817002652-SEQUENCE LISTING [23-01-2018(online)].jpg 2018-01-23
4 201817002652-REQUEST FOR EXAMINATION (FORM-18) [23-01-2018(online)].pdf 2018-01-23
5 201817002652-POWER OF AUTHORITY [23-01-2018(online)].pdf 2018-01-23
6 201817002652-FORM 18 [23-01-2018(online)].pdf 2018-01-23
7 201817002652-FORM 1 [23-01-2018(online)].pdf 2018-01-23
8 201817002652-DECLARATION OF INVENTORSHIP (FORM 5) [23-01-2018(online)].pdf 2018-01-23
9 201817002652-COMPLETE SPECIFICATION [23-01-2018(online)].pdf 2018-01-23
10 201817002652-Proof of Right (MANDATORY) [02-02-2018(online)].pdf 2018-02-02
11 201817002652-Power of Attorney-050218.pdf 2018-02-08
12 201817002652-OTHERS-050218.pdf 2018-02-08
13 201817002652-Correspondence-050218.pdf 2018-02-08
14 201817002652-Correspondence-050218-.pdf 2018-02-08
15 201817002652-OTHERS-050218-.pdf 2018-02-27
16 201817002652.pdf 2018-03-24
17 201817002652-FORM 3 [10-07-2018(online)].pdf 2018-07-10
18 201817002652-RELEVANT DOCUMENTS [20-10-2020(online)].pdf 2020-10-20
19 201817002652-PETITION UNDER RULE 137 [20-10-2020(online)].pdf 2020-10-20
20 201817002652-OTHERS [20-10-2020(online)].pdf 2020-10-20
21 201817002652-Information under section 8(2) [20-10-2020(online)].pdf 2020-10-20
22 201817002652-FORM 3 [20-10-2020(online)].pdf 2020-10-20
23 201817002652-FER_SER_REPLY [20-10-2020(online)].pdf 2020-10-20
24 201817002652-COMPLETE SPECIFICATION [20-10-2020(online)].pdf 2020-10-20
25 201817002652-CLAIMS [20-10-2020(online)].pdf 2020-10-20
26 201817002652-certified copy of translation [20-10-2020(online)].pdf 2020-10-20
27 201817002652-ABSTRACT [20-10-2020(online)].pdf 2020-10-20
28 201817002652-Written submissions and relevant documents [27-03-2021(online)].pdf 2021-03-27
29 201817002652-Written submissions and relevant documents [27-03-2021(online)]-1.pdf 2021-03-27
30 201817002652-Annexure [27-03-2021(online)].pdf 2021-03-27
31 201817002652-PatentCertificate26-04-2021.pdf 2021-04-26
32 201817002652-IntimationOfGrant26-04-2021.pdf 2021-04-26
33 201817002652-US(14)-HearingNotice-(HearingDate-17-03-2021).pdf 2021-10-18
34 201817002652-FER.pdf 2021-10-18
35 201817002652-RELEVANT DOCUMENTS [28-09-2022(online)].pdf 2022-09-28
36 201817002652-RELEVANT DOCUMENTS [09-09-2023(online)].pdf 2023-09-09

Search Strategy

1 2020-05-0412-09-43E_04-05-2020.pdf

ERegister / Renewals

3rd: 17 May 2021

From 27/06/2018 - To 27/06/2019

4th: 17 May 2021

From 27/06/2019 - To 27/06/2020

5th: 17 May 2021

From 27/06/2020 - To 27/06/2021

6th: 17 May 2021

From 27/06/2021 - To 27/06/2022

7th: 14 Jun 2022

From 27/06/2022 - To 27/06/2023

8th: 24 Feb 2023

From 27/06/2023 - To 27/06/2024

9th: 07 Mar 2024

From 27/06/2024 - To 27/06/2025

10th: 28 Feb 2025

From 27/06/2025 - To 27/06/2026