Sign In to Follow Application
View All Documents & Correspondence

Microorganism Of Genus Corynebacterium For Producing L Amino Acid And Method For Producing L Amino Acid By Using Same

Abstract: The present application relates to a microorganism of the genus Corynebacterium for producing an L-amino acid and a method for producing an L-amino acid by using the microorganism.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
03 July 2020
Publication Number
36/2020
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
maria@lexipcare.com
Parent Application
Patent Number
Legal Status
Grant Date
2023-09-12
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu, Seoul 04560

Inventors

1. SON, Seung-ju
330, Dongho-ro Jung-gu Seoul 04560
2. YOON, Byoung Hoon
330, Dongho-ro Jung-gu Seoul 04560
3. LEE, Kwang Woo
330, Dongho-ro Jung-gu Seoul 04560
4. KIM, Seon Hye
330, Dongho-ro Jung-gu Seoul 04560
5. BYUN, Hyo Jeong
330, Dongho-ro Jung-gu Seoul 04560
6. CHANG, Jin Sook
330, Dongho-ro Jung-gu Seoul 04560
7. KIM, Hyung Joon
330, Dongho-ro Jung-gu Seoul 04560
8. SHIN, Yong Uk
330, Dongho-ro Jung-gu Seoul 04560

Specification

Title of Invention: Microorganisms of the genus Corynebacterium that produce L-amino acids and methods of producing L-amino acids using the same
Technical field
[One]
The present application relates to a microorganism of the genus Corynebacterium that produces L-amino acid and a method of producing L-amino acid using the same.
[2]
Background
[3]
L-amino acid is a basic constituent unit of protein, and is used as an important material for pharmaceutical raw materials, food additives, animal feed, nutrients, pesticides, and fungicides. Among them, L-lysine is an essential amino acid that is not biosynthesized at all in vivo, and is known to be necessary for promoting growth, promoting calcium metabolism, promoting gastric juice secretion, and increasing resistance to disease. The L-lysine is variously used in feed, medicine, and food. In addition, L-valine is also one of the essential amino acids, and is known to have an antioxidant effect and an effect of directly promoting protein synthesis in muscle cells. The L-valine is used as a health supplement, medicine, food, feed, fragrance, hair and skin conditioning agent. 
[4]
[5]
On the other hand, the strain of the genus Corynebacterium ( Corynebacterium ), in particular Corynebacterium glutamicum ( Corynebacterium glutamicum ) is a Gram-positive microorganism that is widely used in the production of L-amino acids and other useful substances. For the production of the amino acids, various studies have been conducted to develop highly efficient microorganisms and fermentation process technology. For example, in strains of the genus Corynebacterium, a target substance-specific approach such as increasing the expression of a gene encoding an enzyme involved in amino acid biosynthesis or removing a gene unnecessary for amino acid biosynthesis is mainly used ( Korean Registered Patent Publication No. 10-0924065, No. 1208480,). In addition, in addition to these methods, methods for removing genes not involved in amino acid production and methods for removing genes whose specific functions are not known in amino acid production are also being utilized. However, there is still a need for research on a method that can efficiently produce L-amino acids in high yield.
[6]
Detailed description of the invention
Technical challenge
[7]
As a result of intensive research to develop a microorganism capable of producing L-amino acid with high efficiency, the present inventors completed the present application by confirming that the production yield of L-amino acid increases when a specific gene is inactivated.
[8]
Means of solving the task
[9]
One object of the present application is to provide a microorganism of the genus Corynebacterium that produces L-amino acids in which the activity of a protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated.
[10]
Another object of the present application is to provide a method for producing L-amino acids using the microorganism.
[11]
Another object of the present application is to provide a use for increasing the production of L-amino acids by the microorganism.
[12]
Another aspect of the present application provides a method for increasing L-amino acid production, comprising the step of inactivating a protein comprising SEQ ID NO: 1 of the present application in a microorganism of the genus Corynebacterium.
[13]
Effects of the Invention
[14]
The microorganisms producing L-amino acids of the present application can produce L-amino acids with high efficiency. In addition, the prepared L-amino acid can be applied not only to animal feed or animal feed additives, but also to various products such as human food or food additives and pharmaceuticals.
[15]
Best mode for carrying out the invention
[16]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be considered that the scope of the present application is limited by the specific description described below.
[17]
[18]
In order to achieve the above object, the present application provides a microorganism of the genus Corynebacterium producing L-amino acids in which the activity of the protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated as an embodiment.
[19]
[20]
In the present application, the term "L-amino acid" includes all L-amino acids that can be produced by microorganisms through metabolic processes from various carbon sources, specifically. Basic amino acids such as L-lysine, L-arginine, L-histidine, L-valine, L-leucine, L-glycine, L-isoleucine, L-alanine, L-proline, L-methionine, and other non-polar amino acids, L- Polar amino acids such as serine, L-threonine, L-cysteine, L-asparagine, and L-glutamine, aromatic amino acids such as L-phenylalanine, L-tyrosine, and L-tryptophan, acidic amino acids such as L-glutamic acid and L-aspartic acid , L-alanine, L-valine, L-isoleucine, and aliphatic amino acids such as L-serine, and branched chain amino acids such as L-valine, leucine, and isoleucine. More specifically, in the present application, the L-amino acid may be a basic amino acid, an aliphatic amino acid, or a branched chain amino acid. More specifically, it may be L-lysine or L-valine, but is not limited thereto. When the activity of the protein composed of the amino acid sequence of SEQ ID NO: 1 of the present application is inactivated, amino acids whose production capacity is increased are included without limitation.
[21]
[22]
In the present application, the term "protein consisting of the amino acid sequence of SEQ ID NO: 1" refers to a protein that is inherently present in a microorganism of the genus Corynebacterium, which is encoded by the NCgl0275 gene, and specifically, is inherent in a microorganism of the genus Corynebacterium. It refers to a regulatory protein composed of the amino acid sequence of SEQ ID NO: 1. The amino acid sequence of SEQ ID NO: 1 and the polynucleotide sequence of the gene encoding the protein can be obtained from a known database, and examples include GenBank of NCBI, but are not limited thereto. In addition, the protein may be a protein comprising the amino acid sequence of SEQ ID NO: 1, a protein essentially consisting of the amino acid sequence of SEQ ID NO: 1, or a protein consisting of the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
[23]
[24]
In addition, the protein of the present application may be composed of an amino acid sequence having at least 80% homology to SEQ ID NO: 1 as well as the amino acid sequence described in SEQ ID NO: 1. The protein consisting of an amino acid sequence having 80% or more homology to the amino acid sequence of SEQ ID NO: 1 is at least 80% or more, specifically, 83% or more, 84% or more, 88% or more, with the amino acid sequence of SEQ ID NO: 1 , 90% or more, 93% or more, 95% or more, or 97% or more may include a protein consisting of an amino acid sequence having homology or identity. If a sequence having homology or identity to the sequence and an amino acid sequence having a biological activity substantially identical to or corresponding to the protein, some sequences have an amino acid sequence that is deleted, modified, substituted, conservatively substituted, or added. It is obvious that it is included in the scope of this application.
[25]
Even if it is described in the present application as'a protein or polypeptide constituting an amino acid sequence described in a specific sequence number', if it has the same or corresponding activity as a polypeptide consisting of the amino acid sequence of the sequence number, some sequences are deleted, It is obvious that proteins having modified, substituted, conservatively substituted or added amino acid sequences can also be used in the present application. That is, it is apparent that a polypeptide including the amino acid sequence of the corresponding sequence number can also be used in the present application.
[26]
In addition, as a probe that can be prepared from a known gene sequence, for example, a polypeptide encoded by a polynucleotide hybridized under stringent conditions with a complementary sequence to all or part of the nucleotide sequence encoding the polypeptide, the sequence A polypeptide having the same activity as the protein consisting of the amino acid sequence of SEQ ID NO: 1 may also be included without limitation. For example, the protein consisting of the amino acid sequence of SEQ ID NO: 1 is included in the gene containing the polynucleotide sequence of SEQ ID NO: 2 It may be encrypted by In addition, it may include the polynucleotide sequence of SEQ ID NO: 2, consist essentially of the polynucleotide sequence of SEQ ID NO: 2, or may be encoded by a gene consisting of the polynucleotide sequence of SEQ ID NO: 2, but is not limited thereto.
[27]
In addition, the polynucleotide sequence of SEQ ID NO: 2 may include not only the polynucleotide sequence of SEQ ID NO: 2, but also a polynucleotide sequence having at least 80% homology with SEQ ID NO: 2.
[28]
Specifically, if a polynucleotide sequence capable of encoding a protein comprising an amino acid sequence having at least 80% homology with SEQ ID NO: 1 is included in the scope of the present application, at least 80 with respect to the polynucleotide sequence of SEQ ID NO: 2 % Or more, specifically 83% or more, 84% or more, 88% or more, 90% or more, 93% or more, 95% or more, or 97% or more may also include a polynucleotide sequence having homology or identity.
[29]
In addition, the polynucleotide sequence of SEQ ID NO: 2 may also include a polynucleotide that can be translated into a protein consisting of the amino acid sequence of SEQ ID NO: 1 or a protein having homology thereto by codon degeneracy. It is self-evident. In addition, a probe that can be prepared from a known gene sequence, for example, has the activity of a protein consisting of the amino acid sequence of SEQ ID NO: 1 by hydride under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence. Any sequence encoding a protein may be included without limitation.
[30]
The "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. These conditions are described in, e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York). For example, genes with high homology, 40% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically, 99% or more genes Under conditions that hybridize to each other and do not hybridize to genes with lower homology, or to wash conditions for general Southern hybridization, 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1 At a salt concentration and temperature corresponding to% SDS, more specifically 68° C., 0.1×SSC, and 0.1% SDS, the conditions for washing once, specifically two to three times, can be enumerated. Hybridization requires that two polynucleotides have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term “complementary” is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, about DNA, Adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.
[31]
Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
[32]
[33]
In the present application, the term "homology" or "identity" refers to the degree to which a given amino acid sequence or polynucleotide sequence matches, and may be expressed as a percentage. The terms homology and identity can often be used interchangeably. In the present specification, a given amino acid sequence or polynucleotide sequence and its homologous sequence having the same or similar activity as "% homology" are indicated.
[34]
Homology or identity to the amino acid or polynucleotide sequence can be determined, for example, by the algorithm BLAST by literature (Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on this algorithm BLAST, a program called BLASTN or BLASTX has been developed (see: http://www.ncbi.nlm.nih.gov).
[35]
In addition, whether any amino acid or polynucleotide sequence has homology, similarity or identity can be confirmed by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the appropriate hybridization conditions defined are within the scope of the technology, Methods well known to those of skill in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[36]
In the present application, the term "the activity of the protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated" means that the expression of the protein is a natural wild-type strain, a parent strain, or a protein consisting of the amino acid sequence of SEQ ID NO: 1 is unmodified. Compared to the strain, it is not expressed at all, or even if it is expressed, it means that the activity is not present or decreased. In this case, the reduction is due to mutations or deletions in the gene encoding the protein, whereby the activity of the protein is reduced compared to the activity of the original microorganism, and inhibition of expression or translation of the gene encoding the protein. When the overall protein activity level in the cell is lower than that of the native strain or the strain before modification, a combination thereof is also included.
[37]
[38]
In the present application, the inactivation can be achieved by applying various methods well known in the art. Examples of the method include 1) a method of deleting all or part of the gene encoding the protein; 2) modification of the expression control sequence to reduce the expression of the gene encoding the protein, 3) modification of the gene sequence encoding the protein such that the activity of the protein is removed or weakened, 4) the gene encoding the protein Introduction of antisense oligonucleotides (eg, antisense RNA) that complementarily bind to the transcript of 5) A secondary structure is formed by adding a sequence complementary to the sine-Dalgarno sequence to the front end of the sine-Dalgarno sequence of the gene encoding the protein, making it impossible to attach a ribosome. Way; 6) There is a method of adding a promoter transcribed in the opposite direction to the 3'end of the ORF (open reading frame) of the polynucleotide sequence of the gene encoding the protein (Reverse transcription engineering, RTE), etc., and a combination thereof It can also be achieved, but is not particularly limited thereto.
[39]
[40]
Specifically, the method of deleting part or all of the gene encoding the protein is a polynucleotide encoding a chromosome endogenous target protein through a vector for chromosome insertion in a microorganism, a polynucleotide or a marker gene in which some nucleotide sequences are deleted. This can be done by replacing with As an example of a method of deleting some or all of these polynucleotides, a method of deleting a polynucleotide by homologous recombination may be used, but is not limited thereto. As another example, the method of deleting part or all of the gene may be performed by inducing a mutation using light or chemical substances such as ultraviolet rays, and selecting a strain in which the target gene is deleted from the obtained mutant.
[41]
The gene deletion method includes a method by genetic recombination technique. For example, it can be achieved by injecting a polynucleotide sequence or vector including a polynucleotide sequence homologous to a target gene into the microorganism to cause homologous recombination. In addition, the injected polynucleotide sequence or vector may include a dominant selection marker. However, it is not limited thereto.
[42]
[43]
In addition, the method of modifying the expression control sequence can be achieved by applying various methods well known in the art. As an example of the method, deletion, insertion, non-conservative or conservative substitution of the polynucleotide sequence, or a combination thereof to induce mutations in the expression control sequence to further weaken the activity of the expression control sequence, or to have weaker activity This can be done by replacing with a polynucleotide sequence. The expression control sequence includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence controlling termination of transcription and translation.
[44]
In addition, the method of modifying the gene sequence is performed by inducing a mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or a combination of the gene sequence to further weaken the activity of the enzyme, or to have a weaker activity. It can be performed by replacing with an improved gene sequence or an improved gene sequence such that there is no activity, but is not limited thereto.
[45]
[46]
In the present application, the term "microorganism producing L-amino acid" may mean a microorganism having the ability to produce L-amino acid naturally, or a microorganism to which the ability to produce L-amino acid is imparted to a parent strain without the ability to produce L-amino acid. . For example, the microorganism producing the L-amino acid may be a microorganism in which the activity of a protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated. Alternatively, it may be a microorganism in which the expression of a gene encoding an enzyme in the L-amino acid biosynthesis pathway is increased or an enzyme in the degradation pathway is inactivated. Alternatively, it may be a microorganism in which the activity of the protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated in the parent strain in which the expression of the gene encoding the enzyme of the L-amino acid biosynthetic pathway is increased or the enzyme of the degradation pathway is inactivated. Microorganisms that produce the L-amino acids can be prepared by applying various known methods.
[47]
In the present application, "the microorganism of the genus Corynebacterium" may include all microorganisms of the genus Corynebacterium. Specifically, Corynebacterium glutamicum ( of Corynebacterium glutamicum ), Corynebacterium Crew Dirac teeth ( of Corynebacterium crudilactis ), Corynebacterium de Serre-T ( of Corynebacterium Deserti ), Corynebacterium EfficientDynamics City Enschede ( of Corynebacterium efficiens ) , Corynebacterium callunae , Corynebacterium stationis , Corynebacterium singulare , Corynebacterium halotolerans , Corynebacterium Solarium registry Atum ( Corynebacterium striatum ), Corynebacterium ammoniagenes to Ness ( Corynebacterium ammoniagenes ), Corynebacterium pole Ruti Solid ( Corynebacterium pollutisoli ), Corynebacterium imitans Cxorynebacterium imitans ), Corynebacterium testudinoris or Corynebacterium flavescens , and more specifically Corynebacterium glu It could be Tamicum.
[48]
The microorganism of the genus Corynebacterium producing L-amino acids in which the activity of the protein composed of the amino acid sequence of SEQ ID NO: 1 of the present application is inactivated may be a microorganism having an increased L-amino acid production ability. Specifically, the microorganism may be a microorganism having an increased ability to produce L-amino acids compared to the unmodified strain. The unmodified strain may be a natural wild-type strain, a parent strain, or a protein composed of the amino acid sequence of SEQ ID NO: 1. The present application is another aspect, comprising: culturing the microorganism according to the present application in a medium; And it provides a method for producing L-amino acid comprising the step of recovering the L-amino acid from the microorganism or medium.
[49]
The microorganism according to the present application is as described above.
[50]
In the method of the present application, any culture conditions and culture methods known in the art may be used for culturing the microorganisms of the genus Corynebacterium.
[51]
[52]
In the present application, the term "cultivation" refers to growing microorganisms under appropriately artificially controlled environmental conditions. In the present application, a method of culturing L-amino acid using a microorganism producing L-amino acid may be performed using a method widely known in the art. Specifically, the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto. Any medium used for cultivation may be used without particular limitation, and as an example, a culture medium for a Corynebacterium strain is known (for example, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington DC, USA, 1981).
[53]
Sugar sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid. , Fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
[54]
Nitrogen sources that may be used may include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen source may also be used individually or as a mixture, but is not limited thereto.
[55]
Personnel that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or salts containing the corresponding sodium. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth. In addition, essential growth substances such as amino acids and vitamins may be used in addition to the above substances. In addition, precursors suitable for the culture medium may be used. However, it is not limited thereto. The above-described raw materials may be added batchwise or continuously to the culture during the culture process by an appropriate method. However, it is not limited thereto.
[56]
During the culture of the microorganism, a basic compound such as sodium hydroxide, potassium hydroxide, ammonia, or an acid compound such as phosphoric acid or sulfuric acid may be used in an appropriate manner to adjust the pH of the culture. In addition, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Oxygen or an oxygen-containing gas (eg, air) may be injected into the culture to maintain an aerobic condition. However, it is not limited thereto.
[57]
The temperature of the culture may be usually 20 ℃ to 45 ℃, specifically 25 ℃ to 40 ℃. The incubation time may be continued until the desired amount of L-amino acid production is obtained, but specifically, it may be 10 to 160 hours, but is not limited thereto. .
[58]
Recovery of L-amino acids from the culture can be recovered by conventional methods known in the art. For this recovery method, methods such as centrifugation, filtration, chromatography, and crystallization may be used. For example, the culture medium may be centrifuged at a low speed to remove biomass, and the resulting supernatant may be separated through ion exchange chromatography, but is not limited thereto.
[59]
The recovery step may further include a purification process.
[60]
[61]
Another aspect of the present application provides a use for increasing L-amino acid production of microorganisms of the genus Corynebacterium in which the activity of a protein consisting of the amino acid sequence of SEQ ID NO: 1 is inactivated.
[62]
[63]
Another aspect of the present application provides a method for increasing L-amino acid production, comprising the step of inactivating a protein comprising SEQ ID NO: 1 of the present application in a microorganism of the genus Corynebacterium.
[64]
Mode for carrying out the invention
[65]
Hereinafter, the present application will be described in more detail by examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited by these examples.
[66]
[67]
Example 1: Construction of a random mutant library using transposon
[68]
[69]
In order to obtain a strain having an increased lysine-producing ability, a vector library was prepared by the following method.
[70]
First, the plasmid obtained using the EZ-Tn5™ Tnp Transposome™ kit (Epicentre) was used as Corynebacterium glutamicum KCCM11016P (Korean Patent No. 10-0159812; the microorganism was disclosed as KFCC10881. Then, it was re-deposited with an international depository under the Budapest Treaty and assigned a deposit number as KCCM11016P) as the parent strain, transformed by the electric pulse method (Appl. Microbiol. Biothcenol. 52:541-545, 1999), and kanamycin. (25 mg/ℓ) was spread on a composite plate medium containing about 20,000 colonies.
[71]
[72]

[73]
Glucose 10 g, peptone 10 g, beef extract 5 g, yeast extract 5 g, brain heart infusion 18.5 g, NaCl 2.5 g, urea 2 g, sorbitol 91 g, agar 20 g (based on 1 liter of distilled water)
[74]
[75]
Example 2: Random mutant library screening using transposon
[76]
[77]
About 20,000 colonies obtained in Example 1 were inoculated into 300 µl of the following selection medium, respectively, and incubated for about 24 hours at 32° C. and 1000 rpm in a 96-deep well plate.
[78]
[79]

[80]
Glucose 10 g, 5.5 g Ammonium sulfate, MgSO 4 7H 2 O 1.2 g, KH 2 PO 4 0.8 g, K 2 HPO 4 16.4 g, Biotin 100 μg, Thiamine HCl 1 mg, Calcium-pantothenic acid 2 mg , Nicotinamide 2 mg (based on 1 liter of distilled water)
[81]
[82]
The ninhydrin method for use in the chromatography of amino acids. J. Biol. Chem. 1948, was used to analyze the production amount of L-lysine produced in the culture medium (Moore, S., Stein, WH, Photometric ninhydrin method for use in the chromatography of amino acids. 176, 367-388).
[83]
After the cultivation was completed, 10 μl of the culture supernatant and 190 μl of the ninhydrin reaction solution were reacted at 65° C. for 30 minutes, and the absorbance was measured with a spectrophotometer at a wavelength of 570 nm, and the control, Corynebacterium glutamicum. About 60 colonies showing high absorbance compared to the KCCM11016P strain were selected. Other colonies were confirmed to show similar or reduced absorbance to the Corynebacterium glutamicum KCCM11016P strain used as a control.
[84]
After culturing the selected 60 strains again in the same manner as above, the ninhydrin reaction was repeatedly performed, and as a result, the top 10 improved L-lysine production ability compared to the parent strain, Corynebacterium glutamicum KCCM11016P strain. The mutant strains of the species were selected.
[85]
[86]
Example 3: Analysis of L-lysine production ability of selected random mutants
[87]
[88]
In order to finally select strains with reproducibly increased L-lysine-producing ability targeting the 10 mutant strains selected in Example 2, culture was performed in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium, and cultured with shaking at 30° C. for 20 hours and 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, followed by shaking culture at 32°C for 72 hours and at 200 rpm. Compositions of the species medium and production medium are as follows, respectively. After the culture was completed, the L-lysine concentration in the culture medium was analyzed using HPLC (Waters, 2478), and the L-lysine production concentration of each mutant strain is shown in Table 1 below.
[89]
[90]

[91]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 μg, thiamine HCl 1 mg, calcium -Pantothenic acid 2 mg, nicotinamide 2 mg (based on 1 liter of distilled water)
[92]
[93]

[94]
Glucose 100 g, (NH 4 ) 2 SO 4 40 g, Soy protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 0.5 g, Biotin 100 μg, thiamine hydrochloride 1 mg, calcium-pantothenic acid 2 mg, nicotinamide 3 mg, CaCO 3 30 g (based on 1 liter of distilled water)
[95]
[96]
[Table 1] L-lysine production concentration of 10 selected random mutant strains
Strain L-lysine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control KCCM11016P 41.1 40.9 41.5 41.2
One KCCM11016P/mt-1 40.2 39.9 40.5 40.2
2 KCCM11016P/mt-2 41.8 41.5 41.7 41.7
3 KCCM11016P/mt-3 47.1 46.8 47 47.0
4 KCCM11016P/mt-4 42.3 42.1 42.6 42.3
5 KCCM11016P/mt-5 42.7 42.7 42.9 42.8
6 KCCM11016P/mt-6 41.0 40.7 41.2 41.0
7 KCCM11016P/mt-7 41.7 41.2 41.8 41.6
8 KCCM11016P/mt-8 42.5 42.9 42.9 42.8
9 KCCM11016P/mt-9 43.3 43.5 43.8 43.5
10 KCCM11016P/mt-10 42.0 42.3 42.5 42.3
[97]
[98]
Among the selected 10 mutant strains, KCCM11016P/mt-3 was finally selected as a strain having significantly improved L-lysine production capacity.
[99]
[100]
Example 4: Identification of the cause of the increase in L-lysine production capacity in the final selected strains
[101]
[102]
In this example, it was attempted to identify genes that were deleted by random insertion of transposons into the mutant strains finally selected from Example 3 above.
[103]
The genomic DNA of KCCM11016P/mt-3, which has the best L-lysine production ability, was extracted, cut, ligated, transformed into E. coli DH5α, and plated on LB solid medium containing kanamycin (25 mg/ℓ). After selecting 20 transformed colonies, a plasmid containing a part of an unknown gene was obtained, and primer 1 (SEQ ID NO: 3) and primer 2 (SEQ ID NO: 3) of the EZ-Tn5™Tnp Transposome™ kit Base sequence was analyzed using SEQ ID NO: 4).
[104]
As a result, it was confirmed that the polynucleotide sequence of SEQ ID NO: 2 was deleted. The polynucleotide sequence of SEQ ID NO: 2 encodes the amino acid sequence of SEQ ID NO: 1, and a regulatory protein whose function is not clearly defined based on the nucleotide sequence reported to the NIH Genbank of the National Institutes of Health Was confirmed.
[105]
[106]
Primer 1 (SEQ ID NO: 3): ACCTACAACAAAGCTCTCATCAACC
[107]
Primer 2 (SEQ ID NO: 4): CTACCCTGTGGAACACCTACATCT
[108]
[109]
Accordingly, when the activity of the protein is inactivated, the gene was selected as a candidate deletion gene in order to determine whether there is an effect on the L-lysine production ability.
[110]
[111]
Example 5: Construction of recombinant vector for gene deletion
[112]
[113]
In this example, in order to confirm the effect of inactivation of the protein composed of the amino acid sequence of SEQ ID NO: 1 and the production of L-lysine, selection in Example 4 on the chromosome of a microorganism producing L-lysine of the genus Corynebacterium A recombinant plasmid was constructed to delete one gene. To this end, primers 3 to 6 as shown in Table 2 below were synthesized.
[114]
[115]
[Table 2] Primers 3 to 6 for making fragments for deletion of genes
primer Base sequence
Primer 3 (SEQ ID NO: 5) GAATTCGCGCCCCACTGGCCCTTC
Primer 4 (SEQ ID NO: 6) ACCCCGGCGGCGCTGCTCTGGAATCAC
Primer 5 (SEQ ID NO: 7) GAGCAGCGCCGCCGGGGTTTAATTAAT
Primer 6 (SEQ ID NO: 8) GCAGGTCGACCTGGTTACCGGTCTGAATC
[116]
[117]
Specifically, in order to delete the NCgl0275 gene ORF site (SEQ ID NO: 2), primer 3 (SEQ ID NO: 5), primer 4 (SEQ ID NO: 6), so as to have EcoRI at the 5'end and a SalI restriction enzyme site at the 3'end, Primer 5 (SEQ ID NO: 7) and primer 6 (SEQ ID NO: 8) (Table 2) were synthesized, and PCR (Sambrook et al, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratories, 1989) was performed.
[118]
As a result, it was confirmed that the DNA fragments corresponding to the top and bottom of the gene were amplified by 500bp, respectively. At this time, as PCR conditions, denaturation was performed at 95°C for 30 seconds; Annealing at 50° C. for 30 seconds; And the polymerization reaction was carried out by repeating 1 minute 30 times at 72°C and then performing polymerization reaction at 72°C for 7 minutes. The pDZ vector (Korean Patent Registration No. 10-0924065) that cannot be replicated in Corynebacterium glutamicum and the fragment amplified by PCR were treated with the restriction enzymes for chromosome introduction EcoRI and SalI, and then the DNA conjugation enzyme was After ligating using, E. coli DH5α was transformed and plated on LB solid medium containing kanamycin (25 mg/l).
[119]
After selecting a colony transformed with the plasmid into which the target gene was inserted through PCR, a plasmid was obtained using a plasmid extraction method, and this plasmid was named pDZ-ΔNCgl0275.
[120]
[121]
Example 6: Construction of a strain in which the NCgl0275 gene was deleted in Corynebacterium glutamicum KCCM11016P and evaluation of its L-lysine production ability
[122]
[123]
Based on the KCCM11016P strain, a representative L-lysine-producing strain of the genus Corynebacterium, a strain in which the NCgl0275 gene selected above was deleted was constructed, and its L-lysine production ability was evaluated.
[124]
Specifically, the recombinant plasmid pDZ-ΔNCgl0275 prepared in Example 5 was transformed into Corynebacterium glutamicum KCCM11016P, an L-lysine-producing strain, by homologous recombination on a chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).
[125]
After that, secondary recombination was performed in a solid plate medium containing 4% sucrose. The strains in which the gene of SEQ ID NO: 2 was deleted from the chromosome was identified through PCR using primers 3 and 6 for the Corynebacterium glutamicum transformant strain having completed the secondary recombination. The recombinant strain was named Corynebacterium glutamicum KCCM11016P-NCgl0275.
[126]
In order to analyze the L-lysine production ability of the produced Corynebacterium glutamicum KCCM11016P-NCgl0275 strain, it was cultured with the parent strain Corynebacterium glutamicum KCCM11016P in the following manner.
[127]
The parent strain Corynebacterium glutamicum KCCM11016P and the strain Corynebacterium glutamicum KCCM11016P-NCgl0275 prepared in Example 6 were inoculated into a 250 ml corner-baffle flask containing 25 ml of the seed medium below, and 30 At °C for 20 hours, the culture was shaken at 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, and cultured at 30° C. for 72 hours and shaking at 200 rpm. Compositions of the species medium and production medium are as follows, respectively.
[128]
[129]

[130]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 μg, thiamine HCl 1 mg, calcium -Pantothenic acid 2 mg, nicotinamide 2 mg (based on 1 liter of distilled water)
[131]
[132]

[133]
Glucose 100 g, (NH 4 ) 2 SO 4 40 g, Soy protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 0.5 g, Biotin 100 μg, thiamine hydrochloride 1 mg, calcium-pantothenic acid 2 mg, nicotinamide 3 mg, CaCO 3 30 g (based on 1 liter of distilled water)
[134]
[135]
After completion of the culture, the production amount of L-lysine was measured using HPLC, and the analyzed concentration of L-lysine is shown in Table 3 below.
[136]
[137]
[Table 3] Analysis of L-lysine production capacity of KCCM11016P and KCCM11016P-NCgl0275
Strain L-lysine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control KCCM1106P 40.3 40.0 40.4 40.2
Experimental group KCCM1106P-NCgl0275 46.8 47.3 47.1 47.1
[138]
[139]
As described above, when NCgl0275 was deleted from Corynebacterium glutamicum KCCM11016P, which is an L-lysine producing strain, it was confirmed that the L-lysine production capacity increased by an average of 17.2% compared to the parent strain.
[140]
Therefore, it was confirmed that the L-lysine production ability was improved by inactivating the protein composed of the amino acid sequence of SEQ ID NO: 1 in the microorganism of the genus Corynebacterium.
[141]
[142]
In addition, the strain KCCM11016P-NCgl0275 was named CA01-7512, and on November 7, 2017, it was internationally deposited with the Korean Microbiological Conservation Center (KCCM), a depository institution under the Budapest Treaty, and was given a deposit number as KCCM12153P.
[143]
[144]
Example 7: Construction of a strain in which the NCgl0275 gene was deleted in Corynebacterium glutamicum KCCM11347P and evaluation of L-lysine production ability
[145]
[146]
In order to confirm whether the same effect as the above is also in the strains belonging to other Corynebacterium glutamicum that produce L-lysine, Corynebacterium glutamicum, which is an L-lysine producing strain, was carried out in the same manner as in Example 6. KCCM11347P (Korean Registered Patent No. 10-0073610. The microorganism was disclosed as KFCC10750, then re-deposited to an international depository under the Budapest Treaty, and was granted KCCM11347P). It was named as.
[147]
Thereafter, the culture was performed in the same manner as in Example 6, and the production of L-lysine was measured using HPLC after completion of the culture, and the analyzed L-lysine concentration is shown in Table 4 below.
[148]
[149]
[Table 4] Analysis of L-lysine production capacity of KCCM11347P and KCCM11347P-NCgl0275
Strain L-lysine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control KCCM11347P 38.8 39.1 38.7 38.9
Experimental group KCCM11347P-NCgl0275 44.1 44.4 44.2 44.2
[150]
[151]
As shown above, when the NCgl0275 gene was deleted based on the L-lysine-producing strain, Corynebacterium glutamicum KCCM11347P, it was confirmed that the L-lysine production capacity increased by an average of 13.6%.
[152]
Therefore, as in the result of Example 6, it was confirmed that the L-lysine production ability was improved compared to the unmodified microorganism by inactivating the protein composed of the amino acid sequence of SEQ ID NO: 1 in the microorganism of the genus Corynebacterium.
[153]
[154]
Example 8: Construction of a strain in which the NCgl0275 gene was deleted in Corynebacterium glutamicum KCCM10770P and evaluation of L-lysine production ability
[155]
[156]
In order to confirm whether the same effect as described above is also in the strains belonging to other Corynebacterium glutamicum that produce L-lysine, Corynebacterium glutami, which is an L-lysine producing strain, was carried out in the same manner as in Example 6. A strain in which the NCgl0275 gene was deleted was prepared for Kum KCCM10770P (Korean Patent No. 10-0924065) and named as KCCM10770P-NCgl0275.
[157]
Thereafter, the culture was performed in the same manner as in Example 6, and the production of L-lysine was measured using HPLC after completion of the culture, and the analyzed concentration of L-lysine is shown in Table 5 below.
[158]
[159]
[Table 5] Analysis of L-lysine production capacity of KCCM10770P and KCCM10770P-NCgl0275
Strain L-lysine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control KCCM10770P 45.1 44.9 45.5 45.2
Experimental group KCCM10770P-NCgl0275 51.5 52.0 51.9 51.8
[160]
[161]
As described above, when the NCgl0275 gene was deleted based on the L-lysine-producing strain, Corynebacterium glutamicum KCCM10770P, it was confirmed that the L-lysine production capacity increased by an average of 14.6%.
[162]
Therefore, as in the result of Example 7, by inactivating the protein composed of the amino acid sequence of SEQ ID NO: 1 in various microorganisms of the genus Corynebacterium having L-lysine production ability, the L-lysine production ability compared to its parent strain It was confirmed that it can be improved.
[163]
[164]
Example 9: Construction of a strain in which the NCgl0275 gene was deleted in Corynebacterium glutamicum CJ3P and evaluation of L-lysine production ability
[165]
[166]
In order to confirm whether the same effect as the above is also in the strains belonging to other Corynebacterium glutamicum producing L-lysine, Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology 2012, 13:R40), the NCgl0275 gene-deficient strain was constructed and named CJ3P-NCgl0275.
[167]
Thereafter, the culture was performed in the same manner as in Example 6, and the production of L-lysine was measured using HPLC after completion of the culture, and the analyzed concentration of L-lysine was shown in Table 6 below.
[168]
[169]
[Table 6] Analysis of L-lysine production capacity of CJ3P and CJ3P-Ncgl0275
Strain L-lysine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control CJ3P 7.6 7.4 7.9 7.6
Experimental group CJ3P-NCgl0275 8.7 8.9 8.7 8.8
[170]
[171]
As described above, when the NCgl0275 gene was deleted for Corynebacterium glutamicum CJ3P, the L-lysine-producing strain, it was confirmed that the L-lysine production capacity increased by an average of 15.8%.
[172]
Therefore, as in the results of Examples 6 to 8, the L-lysine production ability was improved by inactivating the protein composed of the amino acid sequence of SEQ ID NO: 1 in various microorganisms of the genus Corynebacterium having L-lysine production ability. It was confirmed that it can be done.
[173]
[174]
Example 10: Construction of a strain in which the NCgl0275 gene was deleted in Corynebacterium glutamicum KCCM11201P and evaluation of L-valine production ability
[175]
[176]
In addition to the above-described L-lysine, it was attempted to evaluate whether or not the valine-producing ability was improved through the NCgl0275 gene deletion in Corynebacterium glutamicum having L-valine-producing ability.
[177]
The recombinant plasmid pDZ-ΔNCgl0275 prepared in Example 5 was transformed into the L-valine producing strain, Corynebacterium glutamicum KCCM11201P (Korean Patent No. 10-1117022) by homologous recombination on the chromosome ( van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, secondary recombination was performed in a solid plate medium containing 4% sucrose. A strain in which the NCgl0275 gene was deleted was prepared on the chromosome by PCR using primers 3 and 6 for the Corynebacterium glutamicum transformant strain having completed the secondary recombination. The recombinant strain was named Corynebacterium glutamicum KCCM11201P-NCgl0275.
[178]
In order to compare the L-valine-producing ability of the strain prepared above, the culture medium components were analyzed by culturing in the following manner. Each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the production medium, and cultured with shaking at 30° C. for 72 hours and 200 rpm. Then, the concentration of L-valine was analyzed using HPLC, and the concentration of the analyzed L-valine is shown in Table 7 below.
[179]
[180]

[181]
Glucose 100 g, Ammonium sulfate 40 g, Soy protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, Dibasic potassium phosphate 1 g, Magnesium sulfate 7 hydrate 0.5 g, Biotin 100 μg, Thiamine-HCl 1 mg, calcium pantothenate 2 mg, nicotinamide 3 mg, calcium carbonate 30 g (based on 1 liter of distilled water)
[182]
[183]
[Table 7] L-valine production capacity of KCCM11201P and KCCM11201P-NCgl0275
Strain L-valine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control KCCM11201P 2.8 2.7 2.9 2.8
Experimental group KCCM11201P-NCgl0275 3.3 3.8 3.4 3.5
[184]
[185]
As shown above, it was confirmed that the L-valine production ability of the KCCM11201P-NCgl0275 strain increased by 25.0% compared to the control group. That is, it was confirmed that L- valine production capacity can be improved by deleting the sequence NCgl0275 gene in the microorganism of the genus Corynebacterium.
[186]
In addition, it was confirmed that the ability to produce various L-amino acids can be improved by inactivating the protein composed of the amino acid sequence of SEQ ID NO: 1 in the microorganism of the genus Corynebacterium.
[187]
[188]
Example 11: Construction of a strain in which the NCgl0275 gene was deleted using Corynebacterium glutamicum CJ7V and evaluation of L-valine production ability
[189]
[190]
In order to confirm whether there is the same effect as the above in strains belonging to other Corynebacterium glutamicum producing L-valine, one mutation in the wild strain Corynebacterium glutamicum ATCC14067 [ilvN (A42V) ; Biotechnology and Bioprocess Engineering, June 2014, Volume 19, Issue 3, pp 456-467] was introduced to produce a strain with improved L-valine production capability.
[191]
Specifically, the genomic DNA of the ATCC14067 strain of Corynebacterium glutamicum wild type was extracted according to the protocol provided in the kit using a G-spin Total DNA extraction mini kit (Intron, Cat. No 17045). PCR was performed using the genomic DNA as a template. To construct a vector for introducing the A42V mutation into the ilvN gene, a primer pair of primer 7 (SEQ ID NO: 9) and primer 8 (SEQ ID NO: 10) and primers of primer 9 (SEQ ID NO: 11) and primer 10 (SEQ ID NO: 12) Gene fragments (A, B) were obtained using a pair, respectively. PCR conditions were denatured at 94° C. for 5 minutes; After denatured at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 60 seconds were repeated 25 times; Polymerization was carried out at 72° C. for 7 minutes.
[192]
As a result, a 537 bp polynucleotide was obtained for both fragments A and B. The two fragments were subjected to overlapping PCR using primers 7 (SEQ ID NO: 9) and primer 10 (SEQ ID NO: 12) as templates to obtain a PCR result of 1044 bp (hereinafter, referred to as "mutant introduction fragment").
[193]
The obtained mutant introduction fragment was treated with restriction enzyme XbaI (New England Biolabs, Beverly, MA), and then ligated using pDZ vector and T4 ligase (New England Biolabs, Beverly, MA) treated with the same restriction enzyme. . After transforming the produced gene into E. coli DH5α, it was selected in LB medium containing kanamycin, and DNA was obtained with a DNA-spin plasmid DNA purification kit (iNtRON). The vector for the purpose of introducing the A42V mutation of the ilvN gene was named pDZ-ilvN (A42V).
[194]
[195]
[Table 8] Primers 7 to 10 for constructing a fragment for the purpose of introducing the A42V mutation of the ilvN gene
primer Base sequence
Primer 7 (SEQ ID NO: 9) aatttctagaggcagaccctattctatgaagg
Primer 8 (SEQ ID NO: 10) agtgtttcggtctttacagacacgagggac
Primer 9 (SEQ ID NO: 11) gtccctcgtgtctgtaaagaccgaaacact
Primer 10 (SEQ ID NO: 12) aatttctagacgtgggagtgtcactcgcttgg
[196]
[197]
Thereafter, the recombinant plasmid pDZ-ilvN (A42V) produced above was transformed into wild-type Corynebacterium glutamicum ATCC14067 by homologous recombination on chromosomes (van der Rest et al., Appl Microbiol Biotechnol 52:541 -545, 1999). Then, secondary recombination was performed in a solid plate medium containing 4% sucrose. After secondary recombination was completed, the gene fragment was amplified through PCR using primers 7 and 10 targeting the Corynebacterium glutamicum transformant, and then the mutant introduced strain was identified through gene sequence analysis. The recombinant strain was named Corynebacterium glutamicum CJ7V.
[198]
Finally, a strain in which the NCgl0275 gene was deleted was prepared in the same manner as in Example 9 for Corynebacterium glutamicum CJ7V having L-valine-producing ability, and named CJ7V-NCgl0275. In order to compare the L-valine production ability of the prepared strains, the concentration of L-valine was analyzed by culturing in the same manner as in Example 9, and the analyzed concentration of L-valine is shown in Table 9 below.
[199]
[200]
[Table 9] L-valine production capacity of CJ7V and CJ7V-NCgl0275
Strain L-valine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control CJ7V 3.2 3.7 3.3 3.4
Experimental group CJ7V-NCgl0275 3.9 4.2 3.9 4.0
[201]
[202]
As shown above, it was confirmed that the L-valine producing ability of the CJ7V-NCgl0275 strain was increased by 17.6% compared to the control group. That is, it was confirmed that the production ability of L-valine can be improved by deleting the NCgl0275 gene in various microorganisms of the genus Corynebacterium having the ability to produce L-valine.
[203]
[204]
Accordingly, as in Examples 6 to 10, it was confirmed that the ability to produce various L-amino acids can be improved by inactivating the protein composed of the amino acid sequence of SEQ ID NO: 1 in the microorganism of the genus Corynebacterium.
[205]
[206]
Example 12: Construction of a strain in which the NCgl0275 gene was deleted using Corynebacterium glutamicum CJ8V and evaluation of L-valine production ability
[207]
[208]
In order to confirm whether the same effect as described above is also in the strains belonging to other Corynebacterium glutamicum producing L-valine, 1 in the wild strain Corynebacterium glutamicum ATCC13869 in the same manner as in Example 10. A mutant strain having L-valine-producing ability was prepared by introducing a species mutation [ilvN(A42V)], and the recombinant strain was named Corynebacterium glutamicum CJ8V.
[209]
A strain in which the NCgl0275 gene was deleted was prepared in the same manner as in Example 9 for Corynebacterium glutamicum CJ8V having L-valine-producing ability, and it was named CJ8V-NCgl0275.
[210]
In order to compare the L-valine production ability of the prepared strain, the concentration of L-valine was analyzed by culturing in the same manner as in Example 9, and the analyzed concentration of L-valine is shown in Table 10 below.
[211]
[212]
[Table 10] L-valine production capacity of CJ8V-NCgl0275 derived from CJ8V
Strain L-valine (g/L)
Batch 1 Batch 2 Batch 3 Average
Control CJ8V 2.5 2.8 2.8 2.7
Experimental group CJ8V-NCgl0275 3.2 3.6 3.4 3.4
[213]
[214]
As shown above, it was confirmed that the L-valine production ability of the CJ8V-NCgl0275 strain was increased by 25.9% compared to the control group. That is, as in the results of Examples 10 to 11, it was confirmed that the production ability of L-valine can be improved by deleting the NCgl0275 gene in various microorganisms of the genus Corynebacterium having L-valine producing ability.
[215]
Therefore, as in Examples 6 to 11, it was confirmed that the ability to produce various L-amino acids can be improved by inactivating the protein composed of the amino acid sequence of SEQ ID NO: 1 in the microorganism of the genus Corynebacterium.
[216]
[217]
From the above description, those skilled in the art to which the present application pertains will appreciate that the present application may be implemented in other specific forms without changing the technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including all changes or modified forms derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts thereof.
[218]
[219]

Claims
[Claim 1]
A microorganism of the genus Corynebacterium producing L-amino acids in which the activity of the protein composed of the amino acid sequence of SEQ ID NO: 1 is inactivated.
[Claim 2]
The microorganism of the genus Corynebacterium according to claim 1, wherein the L-amino acid is a basic amino acid, an aliphatic amino acid or a branched chain amino acid.
[Claim 3]
According to claim 1, wherein the L-amino acid is L-lysine (L-lysine) or L-valine (L-valine), Corynebacterium genus microorganism.
[Claim 4]
According to claim 1, The microorganism of the genus Corynebacterium is Corynebacterium glutamicum ( Corynebacterium glutamicum ), the microorganism of the genus Corynebacterium.
[Claim 5]
Culturing the microorganism according to any one of claims 1 to 4 in a medium; And recovering the L-amino acid from the microorganism or the medium.
[Claim 6]
The method of claim 5, wherein the L-amino acid is a basic amino acid, an aliphatic amino acid or a branched chain amino acid.
[Claim 7]
The method of claim 5, wherein the L-amino acid is L-lysine or L-valine.

Documents

Application Documents

# Name Date
1 202017028478-STATEMENT OF UNDERTAKING (FORM 3) [03-07-2020(online)].pdf 2020-07-03
2 202017028478-SEQUENCE LISTING(PDF) [03-07-2020(online)].pdf 2020-07-03
3 202017028478-SEQUENCE LISTING [03-07-2020(online)].txt 2020-07-03
4 202017028478-REQUEST FOR EXAMINATION (FORM-18) [03-07-2020(online)].pdf 2020-07-03
5 202017028478-PRIORITY DOCUMENTS [03-07-2020(online)].pdf 2020-07-03
6 202017028478-FORM 18 [03-07-2020(online)].pdf 2020-07-03
7 202017028478-FORM 1 [03-07-2020(online)].pdf 2020-07-03
8 202017028478-DECLARATION OF INVENTORSHIP (FORM 5) [03-07-2020(online)].pdf 2020-07-03
9 202017028478-COMPLETE SPECIFICATION [03-07-2020(online)].pdf 2020-07-03
10 202017028478-certified copy of translation [14-07-2020(online)].pdf 2020-07-14
11 202017028478-Proof of Right [29-08-2020(online)].pdf 2020-08-29
12 202017028478-FORM-26 [29-08-2020(online)].pdf 2020-08-29
13 202017028478-FORM 3 [02-01-2021(online)].pdf 2021-01-02
14 202017028478.pdf 2021-10-19
15 202017028478-FER.pdf 2022-12-07
16 202017028478-Certified Copy of Priority Document [08-12-2022(online)].pdf 2022-12-08
17 202017028478-FORM 4(ii) [05-06-2023(online)].pdf 2023-06-05
18 202017028478-OTHERS [06-07-2023(online)].pdf 2023-07-06
19 202017028478-Information under section 8(2) [06-07-2023(online)].pdf 2023-07-06
20 202017028478-FORM 3 [06-07-2023(online)].pdf 2023-07-06
21 202017028478-FER_SER_REPLY [06-07-2023(online)].pdf 2023-07-06
22 202017028478-COMPLETE SPECIFICATION [06-07-2023(online)].pdf 2023-07-06
23 202017028478-CLAIMS [06-07-2023(online)].pdf 2023-07-06
24 202017028478-PatentCertificate12-09-2023.pdf 2023-09-12
25 202017028478-IntimationOfGrant12-09-2023.pdf 2023-09-12

Search Strategy

1 202017028478E_06-12-2022.pdf

ERegister / Renewals

3rd: 30 Nov 2023

From 25/01/2021 - To 25/01/2022

4th: 30 Nov 2023

From 25/01/2022 - To 25/01/2023

5th: 30 Nov 2023

From 25/01/2023 - To 25/01/2024

6th: 18 Dec 2023

From 25/01/2024 - To 25/01/2025

7th: 12 Dec 2024

From 25/01/2025 - To 25/01/2026