Abstract: The present application relates to a microorganism producing L-amino acid or a precursor thereof and a method for producing L-amino acid or a precursor thereof by using the microorganism.
[0001] The present disclosure relates to a microorganism producing an L-amino acid or a precursor thereof and a method of producing an L-amino acid or a precursor thereof using the microorganism.
BACKGROUND ART
[0002] L-amino acids, basic constitutional units for protein, have been used to as major raw materials of medicines, food additives, animal feeds, nutritional supplements, pesticides, sterilizers, and the like. Extensive research has been conducted to develop microorganisms and fermentation processes for producing L-amino acids and other beneficial substances with high yields. For example, target-specific approaches, such as a method of increasing the expression of a gene encoding an enzyme involved in L-lysine biosynthesis and a method of removing a gene unnecessary for the biosynthesis have been mainly used (Korean Patent No. 10-0838038).
[0003] Meanwhile, strains of the genus Corynebacterium, particularly, Corynebacterium glutamicum, are gram-positive microorganisms widely used to produce L-amino acids and other beneficial substances. Intensive research has been performed to develop microorganisms and fermentation processes for producing the amino acids with high yields. For example, target-specific approaches, such as a method of increasing expression of a gene encoding an enzyme involved in amino acid biosynthesis or a method of removing a gene unnecessary for the biosynthesis in strains of the genus Corynebacterium have been widely used (Korean Patent Publication Nos. 10-0924065 and 10-1208480). In addition to these methods, a method of removing a gene not involved in production of amino acids and a method of removing a gene whose specific functions are not known with regard to the production of amino acids have also been used. However, there is still a need for research into methods of efficiently producing L-amino acids with high yields.
2
DESCRIPTION OF EMBODIMENTS TECHNICAL PROBLEM
[0004] The present inventors have made extensive efforts to develop a microorganism capable of producing L-amino acids with high yields and have found that productivity of L-amino acids can be increased by introducing a protein derived from another microorganism thereinto, thereby completing the present disclosure.
SOLUTION TO PROBLEM
[0005] An object of the present disclosure is to provide a microorganism
producing an L-amino acid or a precursor thereof, wherein the microorganism is
modified to express a protein comprising an amino acid sequence of SEQ ID
NO: 1 or a functional fragment thereof.
[0006] Another object of the present disclosure is to provide a composition for
producing an L-amino acid or a precursor thereof, wherein the composition
comprises the microorganism that is modified to express a protein comprising an
amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof, or the
protein.
[0007] Still another object of the present disclosure is to provide a method of
producing an L-amino acid or a precursor thereof, the method comprising:
culturing the microorganism in a culture medium; and recovering the L-amino
acid or the precursor thereof from the cultured microorganism or the culture
medium.
[0008] Still another object of the present disclosure is to provide use of a protein
comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment
thereof for increasing production of an L-amino acid or a precursor thereof.
ADVANTAGEOUS EFFECTS OF DISCLOSURE
[0009] The microorganism according to the present disclosure producing an
3
L-amino acid or a precursor thereof, wherein the microorganism is modified to express a protein comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof may produce L-serine, L-tryptophan, L-histidine, L-methionine, L-cysteine, and/or O-phosphoserine.
BEST MODE
[0010] Hereinafter, the present disclosure will be described in more detail.
[0011] Meanwhile, each description and embodiment disclosed in the present
disclosure may be applied herein to describe different descriptions and
embodiments. In other words, all combinations of various components
disclosed in the present disclosure are included within the scope of the present
disclosure. Furthermore, the scope of the present disclosure should not be
limited by the detailed descriptions provided below.
[0012] Additionally, those skilled in the art will be able to recognize or confirm,
using ordinary experiments, many equivalents for specific aspects of the present
disclosure. Such equivalents are intended to be included in the scope of the
present disclosure.
[0013] To achieve the above objects, an aspect of the present disclosure
provides a microorganism producing an L-amino acid or a precursor thereof,
wherein the microorganism is modified to express a protein comprising an amino
acid sequence of SEQ ID NO: 1 or a functional fragment thereof.
[0014] The protein comprising an amino acid sequence of SEQ ID NO: 1 or a
functional fragment thereof may be a protein having a D-3-phosphoglycerate
dehydrogenase activity.
[0015] In the present disclosure, the "D-3-phosphoglycerate dehydrogenase" is
an enzyme primarily catalyzing chemical reactions below.
[0016] 3-phospho-D-glycerate + NAD+ ↔ 3-phosphonooxypyruvate + NADH +
H+
[0017] 2-hydroxyglutarate + NAD+ ↔ 2-oxoglutarate + NADH + H+ [0018] For the purpose of the present disclosure, the D-3-phosphoglycerate dehydrogenase may be SerA, and a sequence thereof may be identified from known database of the NCBI Genbank. Additionally, any other protein having
4
an activity equivalent thereto and derived from microorganisms, which are different from the above-described microorganism producing an L-amino acid or a precursor thereof and including the protein, may also be used without limitation. Specifically, the protein may be a protein comprising an amino acid sequence of SEQ ID NO: 1 and may be interchangeably used with a protein composed of an amino acid sequence of SEQ ID NO: 1, a protein consisting of an amino acid sequence of SEQ ID NO: 1, or a protein having an amino acid sequence of SEQ ID NO: 1, without being limited thereto.
[0019] The protein may have an amino acid sequence of SEQ ID NO: 1 and/or at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of SEQ ID NO: 1. Additionally, it will be obvious that any accessory protein having an amino acid sequence including deletion, modification, substitution, or addition of one or several amino acids is within the scope of the present disclosure, so long as the amino acid sequence retains the above-described homology or identity and an effect equivalent to that of the protein.
[0020] In addition, any polypeptide having the D-3-phosphoglycerate dehydrogenase activity and encoded by a polynucleotide hybridized, under stringent conditions, with a probe constructed using known gene sequences, e.g., a nucleotide sequence entirely or partially complementary to a nucleotide sequence encoding the polypeptide, may also be used without limitation. [0021] Additionally, for the purpose of the present disclosure, the protein may be derived from other microorganisms different from the above-described microorganism producing an L-amino acid or a precursor thereof and including the protein, and the protein may specifically be a protein derived from the genus Azotobacter, a protein identical to that derived from the genus Azotobacter, or any protein capable of increasing production of an L-amino acid or a precursor thereof, without limitation. More specifically, the microorganism of the genus Azotobacter may be Azotobacter agilis, Azotobacter armeniacus, Azotobacter beijerinckii, Azotobacter chroococcum, Azotobacter sp. DCU26, Azotobacter sp. FA8, Azotobacter nigricans, Azotobacter paspali, Azotobacter salinestris, Azotobacter tropicalis, or Azotobacter vinelandii. and in an embodiment of the
5
present disclosure, may be one derived from Azotobacter vinelandii, but the microorganism is not limited thereto.
[0022] As used herein, the term "functional fragment" refers to an amino acid sequence having an effect equivalent to that of the protein, and it will be obvious that any protein having the amino acid sequence including a deletion, modification, substitution, or addition of one or several amino acids and retaining an effect equivalent to that of the protein is within the scope of the present disclosure and may be regarded as a functional fragment for the purpose of the present disclosure.
[0023] As used herein, although the expression "protein or polypeptide comprising an amino acid sequence of a particular SEQ ID NO:", " protein or polypeptide consisting of an amino acid sequence of a particular SEQ ID NO:" or " protein or polypeptide having an amino acid sequence of a particular SEQ ID NO:" is used, it is obvious that any protein having an amino acid sequence including a deletion, modification, substitution, conservative substitution, or addition of one or several amino acids may also be used in the present disclosure so long as the protein has the activity identical or equivalent to the polypeptide consisting of the amino acid sequence of the particular SEQ ID NO:. For example, the protein may have an addition of a sequence to the N-terminus and/or the C-terminus of the amino acid sequence without causing changes in the functions of the protein, naturally occurring mutation, silent mutation, or conservative substitution thereof.
[0024] The term "conservative substitution" refers to a substitution of one amino acid with another amino acid having a similar structural and/or chemical property. Such amino acid substitution may generally occur based on similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of a residue. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. [0025] Another aspect of the present disclosure provides a polynucleotide
6
encoding the protein comprising an amino acid sequence of SEQ ID NO: 1. [0026] As used herein, the term "polynucleotide" has a comprehensive meaning including DNA and RNA molecules, and a nucleotide that is a basic structural unit in a polynucleotide may include not only a natural nucleotide but also an analogue in which a sugar or a base is modified (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, Chemical Reviews, 90:543-584 (1990)).
[0027] The polynucleotide encoding the protein comprising an amino acid sequence of SEQ ID NO: 1 may have any sequence capable of encoding the protein having the D-3-phosphoglycerate dehydrogenase activity derived from Azotobacter vinelandii, without limitation. Alternatively, the polynucleotide may have any sequence encoding a protein having an activity of increasing production of an L-amino acid or a precursor thereof that comprises the amino acid sequence of SEQ ID NO: 1 without limitation.
[0028] The polynucleotide may be, for example, a polynucleotide encoding a polypeptide having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity with the amino acid sequence of SEQ ID NO: 1. Specifically, for example, the polynucleotide encoding the protein comprising an amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 70% homology or identity with the amino acid sequence of SEQ ID NO: 1 may be a polynucleotide sequence of SEQ ID NO: 95 or a polynucleotide having at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence homology or identity with the nucleotide sequence of SEQ ID NO: 95.
[0029] In addition, it is obvious that the polynucleotide may also a polynucleotide which can be translated into a protein comprising the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having at least 70% identity with SEQ ID NO: 1 or a protein having homology or identity therewith by codon degeneracy. Alternatively, the polynucleotide may have a nucleotide sequence that can be hybridized with a probe constructed using known gene sequences, e.g., a nucleotide sequence entirely or partially complementary to the nucleotide
7
sequence under stringent conditions to encode a protein comprising an amino acid sequence having at least 70% identity with SEQ ID NO: 1 without limitation. The term "stringent conditions" refers to conditions allowing specific hybridization between polynucleotides. Such conditions are disclosed in detail in known documents (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). For example, the stringent conditions may include conditions under which genes having a high homology or identity, e.g., at least 70%, 80%, specifically 85%, specifically 90%, more specifically 95%, more specifically 97%, or even more specifically 99% homology or identity, hybridize with each other, while genes having a homology or identity lower than those described above do not hybridize with each other; or conditions under which washing is performed once, and specifically twice or three times in ordinary washing conditions of Southern hybridization at a salt concentration and a temperature corresponding to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, and more specifically 68°C, 0.1×SSC, 0.1% SDS. Hybridization requires that two polynucleotides have complementary sequences, although bases may mismatch due to stringent conditions of hybridization. The term "complementary" is used to describe the relationship between bases of nucleotides capable of hybridizing with each other. For example, with respect to DNA, adenosine is complementary to thymine, and cytosine is complementary to guanine. Thus, the present disclosure may include not only substantially similar polynucleotide sequences but also a polynucleotide fragment isolated thereof complementary to the entire sequence.
[0030] Specifically, the polynucleotide having homology or identity may be detected using the above-described hybridization conditions including a hybridization process using a Tm value of 55°C. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto, and may be appropriately adjusted by those skilled in the art according to the purpose thereof. [0031] The "homology" and "identity" refer to a degree of relevance between two amino acid sequences or nucleotide sequences and may be expressed as a
8
percentage.
[0032] The terms homology and identity may often be used interchangeably. [0033] Sequence homology or identity of conserved polynucleotides or polypeptides may be determined by standard alignment algorithm and default gap penalties established by a program may be used together therewith. Substantially homologous or identical sequences may generally hybridize with each other over the entire sequence or at least about 50%, 60%, 70%, 80%, or 90% of the entire sequence under moderate or highly stringent conditions. In hybridized polynucleotides, polynucleotides including degenerated codon instead of codon may also be considered.
[0034] The homology or identity between polypeptides or polynucleotide sequences may be determined using any algorithm known in the art, e.g., BLAST (see: Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90, 5873, (1993)) or FASTA introduced by Pearson (see: Methods Enzymol., 183, 63, 1990). Based on the algorithm BLAST, programs known as BLASTN or BLASTX have been developed (see: http://www.ncbi.nlm.nih.gov). In addition, the presence of homology, similarity, or identity between amino acid or polynucleotide sequences may be confirmed by comparing these sequences by southern hybridization experiments under defined stringent conditions, and the defined stringent hybridization conditions are within the scope of the subject technology, and may be determined by a method known to one of ordinary skill in the art (for example, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[0035] As used herein, the term "to be expressed/being expressed" with regard to a protein means a state in which a target protein is introduced into a microorganism or, in the case where the protein is present in a microorganism, the activity of the protein is enhanced compared to its endogenous activity or its activity before modification .
[0036] Specifically, the term "introduction of a protein" refers to providing the activity of a particular protein to a microorganism, in which the protein is not
9
originally possessed, or the activity of the protein is enhanced compared to its endogenous activity or the activity before modification. For example, the introduction of a protein may refer to introduction of a polynucleotide encoding a particular protein into chromosome or introduction of a fragment or vector including a polynucleotide encoding the particular protein into a microorganism, thereby capable of expressing the activity of the protein. The "endogenous activity" refers to an activity of a protein originally possessed by a parent strain of a microorganism before transformation when the microorganism is transformed by genetic modification caused by a natural or artificial factor. [0037] As used herein, the term "amino acid or a precursor thereof" refers to an amino acid or a precursor which can be produced by using the protein and it may include serine, tryptophan, histidine, methionine, cysteine, L-cystathionine, L-homocysteine, O-acetylhomoserine, O-succinyl homoserine, L-homoserine, and/or O-phosphoserine, without being limited thereto. In the present disclosure, the amino acid may be an L-amino acid, specifically, L-serine, L-tryptophan, L-histidine, L-methionine, or L-cysteine but may include all L-amino acids produced by microorganisms from various carbon sources via metabolic processes. The precursor may be O-acetylhomoserine or O-succinylhomoserine, which is a precursor converted into methionine by O-acetylhomoserine sulfhydrylase (KR10-1048593); L-homoserine, L-homocysteine, or L-cystathionine, which is a methionine precursor; and acetylserine, which is a L-cystein precursor; and/or O-phosphoserine, which is a precursor converted into cysteine by O-phosphoserine sulfhydrylase, without being limited thereto. More specifically, the amino acid or a precursor thereof may be L-serine, L-tryptophan, L-histidine, L-methionine, O-phosphoserine, or L-cysteine, but is not limited thereto.
[0038] In order to enhance the biosynthesis of the L-amino acids or precursors thereof, the protein comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof according to the present disclosure may be used. For example, in order to enhance the biosynthesis of L-serine, L-tryptophan, L-histidine, L-methionine L-cysteine, L-homocysteine, L-cystathionine, acetylserine, O-acetylhomoserine, O-succinylhomoserine, L-homoserine, and/or
1 0
O-phosphoserine, a microorganism may be modified to express the protein comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof according to the present disclosure. As a specific example, the protein comprising an amino acid sequence of SEQ ID NO: 1 may be introduced or the activity of the protein may be enhanced. Additionally, the ability to produce an L-amino acid or a precursor thereof may further be enhanced by additionally introducing or enhancing the activity of a particular protein or inactivating the activity of a particular protein.
[0039] Specifically, the microorganism may produce L-amino acids or precursors thereof by further including i) phosphoserine phosphatase having weakened activity, ii) 3-phosphoserine aminotransferase having enhanced activity, or iii) both phosphoserine phosphatase having weakened activity and 3-phosphoserine aminotransferase having enhanced activity, without being limited thereto.
[0040] The microorganism may further be modified by enhancement of trp operon, inactivation of tryptophanase (TnaA), inactivation of Mtr membrane protein (Mtr), or any combination thereof, without being limited thereto. [0041] Specifically, the microorganism may further be modified by enhancement of the trp operon by inactivating TrpR that inhibits expression of genes (trpEDCBA) associated with biosynthesis of L-tryptophan involved in production of L-tryptophan, by inactivation of tryptophanase (TnaA) that plays a role in introducing extracellular L-tryptophan into a cell, and by inactivation of Mtr membrane protein that plays a role in decomposing intracellular L-tryptophan and water molecules into indole, pyruvate, and ammonia (NH3), without being limited thereto.
[0042] Additionally, for the purpose of the present disclosure, the microorganism may further be modified by enhancing his operon, without being limited thereto. [0043] Specifically, biosynthesis genes split into 4 operons in total may be introduced into the microorganism in a cluster form, in which the promoter was substituted, to enhance the L-histidine biosynthetic pathway, and the L-histidine biosynthesis cluster is split into 4 operons (hisE-hisG, hisA-impA-hisF-hisI, hisD-hisC-hisB, and cg0911-hisN) in total. The his operon may be enhanced
1 1
by using a vector that can simultaneously introduce the biosynthesis genes into the microorganism, without being limited thereto.
[0044] Additionally, for the purpose of the present disclosure, the microorganism may further be modified by inactivation of transcriptional regulator (McbR), enhancement of methionine synthase (meth), enhancement of sulfite reductase [NADPH] hemoprotein beta-component (cysI), or any combination thereof, without being limited thereto.
[0045] Specifically, the microorganism may further be modified by inactivating McbR, that is a methionine/cysteine transcriptional regulator, enhancing methionine synthase (Meth), enhancing sulfite reductase [NADPH] hemoprotein beta-component, or any combination thereof, without being limited thereto. [0046] The introduction, enhancement, and inactivation of the activity of a particular protein and/or gene may be performed using any appropriate method known in the art.
[0047] As used herein, the term "enhancement" of activity of a protein means that the activity of the protein is introduced or increased when compared with its endogenous activity. The "introduction" of the activity means that a microorganism acquires activity of a particular polypeptide which has not been naturally or artificially possessed by the microorganism.
[0048] As used herein, the term "increase" in the activity of a protein relative to its endogenous activity means that the activity of the protein included in the microorganism is enhanced compared to the endogenous activity of the protein or the activity before modification. The term "endogenous activity" refers to activity of a protein originally possessed by a parent strain of a microorganism or a non-modified microorganism before transformation when the microorganism is transformed by genetic modification caused by a natural or artificial factor. The endogenous activity may also be interchangeably used with activity before modification. The increase in the activity may include both introduction of a foreign protein and enhancement of the endogenous activity of the protein. The increase/enhancement in the activity of the protein may be achieved by increase/enhancement of gene expression. [0049] Specifically, the increase in the activity of a protein according to the
12
present disclosure may be achieved by one of the following methods without
being limited thereto:
[0050] (1) a method of increasing the copy number of a polynucleotide encoding
the protein,
[0051] (2) a method of modifying an expression control sequence to increase
expression of the polynucleotide,
[0052] (3) a method of modifying a polynucleotide sequence on a chromosome
to enhance the activity of the protein,
[0053] (4) a method of introducing a foreign polynucleotide having the activity of
the protein or a codon optimized modification polynucleotide having the activity
of the protein, or
[0054] (5) a method of enhancing the activity by any combination thereof.
[0055] The method of increasing the copy number of a polynucleotide described
in (1) above is not particularly limited, but may be performed in a form operably
linked to a vector or in an integrated form into a chromosome of a host cell.
Specifically, this method may be performed by introducing a vector, which
replicates and functions irrespective of a host and is operably linked to a
polynucleotide encoding the protein of the present disclosure, into a host cell; or
by introducing a vector, which inserts the polynucleotide into the chromosome of
the host cell and is operably linked to the polynucleotide, into a host cell, thereby
increasing the copy number of the polynucleotide in the chromosome of the host
cell.
[0056] Next, the method of modifying the expression control sequence to
increase the expression of the polynucleotide described in (2) above may be
performed by inducing a modification in the nucleotide acid sequence by
deletion, insertion, non-conservative substitution, conservative substitution, or
any combination thereof to further enhance the activity of the expression control
sequence, or by replacing the nucleotide sequence with a nucleotide sequence
having a stronger activity, without being limited thereto. The expression control
sequence may include a promoter, an operator sequence, a ribosome-binding
site encoding sequence, and a sequence for regulating the termination of
transcription and translation, without being limited thereto.
1 3
[0057] A strong heterologous promoter instead of the intrinsic promoter may be linked upstream of the polynucleotide expression unit, and examples of the strong promoter may include CJ1 to CJ7 promoters (Korean Patent No. 0620092 and International Publication No. WO2006/065095), a lysCP1 promoter (International Publication No. WO2009/096689), an EF-Tu promoter, a groEL promoter, an aceA promoter, an aceB promoter, a lac promoter, a trp promoter, a trc promoter, a tac promoter, a lambda phage PR promoter, a PL promoter, a tet promoter, a gapA promoter, a SPL1, SPL7, or SPL13 promoter (Korean Patent No. 10-1783170), or an O2 promoter (Korean Patent No. 10-1632642), without being limited thereto. In addition, the method of modifying the polynucleotide sequence on the chromosome described in (3) above may be performed by inducing a variation in the expression control sequence by deletion, insertion, non-conservative substitution, conservative substitution, or any combination thereof to further enhance the activity of the polynucleotide sequence, or by replacing the nucleotide sequence with a nucleotide sequence modified to have a stronger activity, without being limited thereto [0058] In addition, the method of introducing the foreign polynucleotide sequence described in (4) above may be performed by introducing a foreign polynucleotide encoding a protein having an activity identical/similar to that of the protein, or a codon optimized variant polynucleotide thereof into the host cell. The foreign polynucleotide may be any polynucleotide having an activity identical/similar to that of the protein without limitation. In addition, an optimized codon thereof may be introduced into the host cell to perform optimized transcription and translation of the introduced foreign polynucleotide in the host cell. The introduction may be performed by any known transformation method suitably selected by those of ordinary skill in the art. When the introduced polynucleotide is expressed in the host cell, the protein is produced and the activity thereof may be increased.
[0059] Finally, the method of enhancing the activity by any combination of the methods (1) to (4) described in (5) above may be performed by combining at least one of the methods of increasing the copy number of the polynucleotide encoding the protein, modifying the expression control sequence to increase
1 4
expression thereof, modifying the polynucleotide sequence on the chromosome, introducing the foreign polynucleotide having the activity of the protein or a codon optimized variant polynucleotide thereof.
[0060] As used herein, the term "weakening" of the activity of a protein is a concept that includes both reduction and elimination of the activity compared to endogenous activity.
[0061] The weakening of the activity of a protein may be achieved by a variety of methods well known in the art. Examples of the method may include: a method of deleting a part of or the entire gene encoding the protein on the chromosome, including the case when the activity is eliminated; a method of substituting the gene encoding the protein on the chromosome with a gene mutated to reduce the activity of the protein; a method of introducing a mutation into an expression control sequence of the gene encoding the protein on the chromosome; substituting the expression control sequence of a gene encoding the protein with a sequence having weaker or no activity (e.g., replacing an endogenous promoter of the gene with a weaker promoter); a method of deleting a part of or the entire gene encoding the protein on the chromosome; a method of introducing an antisense oligonucleotide (e.g., antisense RNA) which binds complementarily to a transcript of the gene on the chromosome to inhibit the translation from the mRNA into the protein; a method of artificially adding a sequence complementary to the SD sequence to the upstream of the SD sequence of the gene encoding the protein to form a secondary structure, thereby inhibiting the binding of ribosome thereto, and a method of incorporating a promoter to the 3' terminus of the open reading frame (ORF) to induce a reverse transcription (reverse transcription engineering (RTE)), or any combination thereof, but are not limited thereto.
[0062] Specifically, the method of deleting a part of or the entire gene encoding the protein may be performed by replacing a polynucleotide encoding an endogenous target protein within the chromosome with a polynucleotide or marker gene having a partial deletion in the nucleic acid sequence using a vector for chromosomal insertion into a microorganism. For example, a method of deleting a part of or the entire gene by homologous recombination may be
1 5
used, without being limited thereto. In addition, the term "part", although it may vary according to type of the polynucleotide and may be appropriately determined by one of ordinary skill in the art, refers to 1 nucleotide to 300 nucleotides, specifically, 1 nucleotide to 100 nucleotides, and more specifically, 1 nucleotide to 50 nucleotides, without being limited thereto. [0063] Additionally, the method of modifying the expression control sequence may be performed by inducing a mofication in the expression control sequence via deletion, insertion, conservative substation, or non-conservative substitution, or any combination thereof to further weaken the activity of the expression control sequence or performed by substituting the expression control sequence with a nucleic acid sequence having weaker activity. The expression control sequence may include a promoter, an operator sequence, a sequence encoding a ribosome-binding site, and a sequence for regulating termination of transcription and translation, without being limited thereto. [0064] In addition, the method of modifying the sequence of a gene on the chromosome may be performed by inducing a modification via deletion, insertion, conservative substation, or non-conservative substitution, or any combination thereof to further weaken the activity of the protein in the sequence or performed by substituting the sequence of the gene with a sequence of a gene modified to have weaker or no activity, but is not limited thereto.
[0065] As used herein, the expression "microorganism producing an L-amino acid or a precursor thereof" refers to a microorganism capable of producing an L-amino acid or a precursor thereof in large amounts from carbon sources contained in a culture medium compared with wild-type or non-modified microorganisms. Additionally, the microorganism may refer to a microorganism naturally having the ability to produce an L-amino acid or a precursor thereof or a microorganism prepared by providing the ability to produce an L-amino acid or a precursor thereof to a parent strain of a microorganism which is unable to produce the L-amino acid or a precursor thereof. Specifically, the microorganism may be a microorganism which is modified to express a protein comprising the amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof for producing the L-amino acid or a precursor thereof, but is not limited
1 6
thereto.
[0066] Additionally, the "microorganism producing an L-amino acid or a precursor thereof" includes both wile-type microorganisms and microorganisms in which natural or artificial genetic modification has occurred, such as microorganisms in which a particular mechanism is weakened or enhanced via introduction of an exogenous gene, enhancement or inactivation of an endogenous gene, etc., and in which genetic modification has occurred or the activity has been enhanced in order to produce a target L-amino acid or a precursor thereof. Specifically, the types of the microorganism are not particularly limited, as long as the microorganism is able to produce an L-amino acid or a precursor thereof, but the microorganism may belong to the genus Enterobacter, the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, or the genus Brevibacterium. More specifically, the microorganism may be any microorganism belonging to the genus Corynebacterium or the genus Escherichia. The microorganism of the genus Corynebacterium may be Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium thermoaminogenes, Corynebacterium efficiens, Corynebacterium stationis, or the like, but is not limited thereto. More specifically, the microorganism of the genus Escherichia may be Escherichia coli, and the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum, without being limited thereto.
[0067] For the purpose of the present disclosure, the microorganism may be any microorganism including the protein and is thus capable of producing an L-amino acid and a precursor thereof.
[0068] As used herein, the expression of "microorganism capable of producing an L-amino acid or a precursor thereof" may be used interchangeably with the expressions of "microorganism producing an L-amino acid or a precursor thereof" and "microorganism having the ability to produce an L-amino acid or a precursor thereof".
[0069] Another aspect of the present disclosure provides a composition for producing an L-amino acid or a precursor thereof, in which the composition
17
comprises a microorganism modified to express a protein comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof, or the protein. [0070] The composition for producing an L-amino acid or a precursor thereof refers to a composition capable of producing an L-amino acid or a precursor thereof by the protein according to the present disclosure. The composition may comprise the protein, a functional fragment thereof, or any components used to operate the protein, without limitation.
[0071] Another aspect of the present disclosure provides a method of producing an L-amino acid or a precursor thereof, in which the method comprises culturing the microorganism in a culture medium.
[0072] The method may further include recovering an L-amino acid or a precursor thereof from the cultured medium or culture thereof. [0073] In the above method, the culturing of the microorganism may be performed by, but is not limited to, batch culture, continuous culture, fed-batch, or the like known in the art. In this regard, culture conditions are not particularly limited, but an optimal pH (e.g., pH 5 to 9, specifically pH 6 to 8, and most specifically pH 6.8) may be maintained by using a basic compound (e.g., sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (e.g., phosphoric acid or sulfuric acid). Additionally, an aerobic condition may be maintained by adding oxygen or an oxygen-containing gas mixture to the culture. A culturing temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, and the culturing may be performed for about 10 hours to about 160 hours, without being limited thereto. The amino acid produced during the culturing may be released into the culture medium or remain in the cells. [0074] Examples of a carbon source to be contained in the culture medium may include saccharides and carbohydrates (e.g., glucose, sucrose, lactose, fructose, maltose, molasse, starch, and cellulose), oils and fats (e.g., soybean oil, sunflower oil, peanut oil, and coconut oil), fatty acids (e.g., palmitic acid, stearic acid, and linoleic acid), alcohols (e.g., glycerol and ethanol), and organic acids (acetic acid), which may be used alone or in combination, etc., but are not limited thereto. Examples of a nitrogen source to be contained in the culture medium may be a nitrogen-containing organic compound (e.g., peptone, yeast extract,
1 8
gravy, malt extract, corn steep liquor, soybean flour, and urea), an inorganic compound (e.g., ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate) which may be used alone or in combination, etc., but are not limited thereto. As a phosphorous source, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and sodium-containing salts corresponding thereto may be used alone or in combination without being limited thereto. In addition, the culture medium may include essential growth-promoting materials such as a metal salt (e.g., magnesium sulfate and iron sulfate), amino acids, and vitamins, but are not limited thereto.
[0075] The amino acid produced in the above-described culturing step of the
present disclosure may be recovered by collecting a target amino acid from the
culture solution using any known method selected according to the culturing
method. For example, centrifugation, filtration, anion exchange
chromatography, crystallization, and high-performance liquid chromatography (HPLC) may be used, and the target amino acid may be recovered from the culture medium or the microorganism using any appropriate method in the art, without being limited thereto.
[0076] Additionally, the recovering step may include a purification process which may be performed using an appropriate method well known in the art. Thus, the recovered amino acid may be a purified amino acid or a fermentation broth of a microorganism including an amino acid (Introduction to Biotechnology and Genetic Engineering, A. J. Nair., 2008).
[0077] In addition, for the purpose of the present disclosure, in the case of the microorganism modified to express D-3-phosphoglycerate dehydrogenase derived from the genus Azotobacter, the yields of L-amino acids and precursors thereof including serine, tryptophan, histidine, methionine, and O-phosphoserine increase. It is important that the modified microorganism increases the yields of L-amino acids and precursors thereof, while wild-type strains of the genus Corynebacterium are unable to or able to produce L-amino acids or precursors thereof in a very small amount. [0078] Still another aspect of the present disclosure provides a method of
19
producing an L-amino acid or a precursor thereof using the composition, which comprises a microorganism modified to express a protein comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof, or the protein. [0079] The microorganism modified to express the protein comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof and the microorganism including the same are as described above. [0080] Still another aspect of the present disclosure provides use of a protein comprising an amino acid sequence of SEQ ID NO: 1 or a functional fragment thereof for increasing production of L-amino acid or a precursor thereof. [0081] SEQ ID NO: 1 or the functional fragment thereof, an L-amino acid, and a precursor thereof are as described above.
MODE OF DISCLOSURE
[0082] Hereinafter, the present disclosure will be described in more detail with
reference to the following examples. However, these examples are for
illustrative purposes only and are not intended to limit the scope of the present
disclosure. Meanwhile, technical matters not described in this specification can
be sufficiently understood and easily performed by those skilled in the art in the
technical field of the present application or a similar technical field thereof.
[0083] Example 1: Preparation of Azotobacter-derived
D-3-phosphoglycerate dehydrogenase (serA(Avn))-Overexpressing Vector [0084] In order to identify whether the ability to produce serine and OPS is improved by enhancing Azotobacter vinelandii-derived D-3-phosphoglycerate dehydrogenase (hereinafter, referred to as ‘SerA(Avn)’), an expression vector was prepared.
[0085] A pCL1920 vector (GenBank No. AB236930) was used to express serA(Avn) gene (SEQ ID NO:1) encoding SerA(Avn), and a trc promoter (Ptrc) was used as an expression promotor, thereby constructing a vector in the form of pCL-Ptrc-serA(Avn).
[0086] As a control, a vector including D-3-phosphoglycerate dehydrogenase derived from E. coli, in which the feedback inhibition on serine is released, was prepared and named pCL-Ptrc-serA*(G336V). Sequences of the primers used
20
to prepare the vectors are shown in Table 1 below.
[0087] Table 1
Gene Primer (5’->3’) SEQ ID NO Vector
Ptrc AGGTCGACTCTAGAGGATCCCCCG CTTGCTGCAACTCTCT 2 pCL-Ptrc-serA
(Avn),
pCL-Ptrc-serA
*(G336V)
GATATCTTTCCTGTGTGA 3
serA (Avn) AATTTCACACAGGAAAGATATCATG AGTAAGACCTCCCTG 4 pCL-Ptrc-serA (Avn)
GTGAATTCGAGCTCGGTACCCTCA GAACAGAACCCGTGAG 5
serA* (G336V) AATTTCACACAGGAAAGATATCATG GCAAAGGTATCGCTG 6 pCL-Ptrc-serA *(G336V)
GTGAATTCGAGCTCGGTACCCTTA GTACAGCAGACGGGCG 7
[0088] PCR for Ptrc, which was used in preparation of both vectors, was performed using primers of SEQ ID NOS: 2 and 3. Specifically, PCR for foreign serA(Avn) was performed using primers of SEQ ID NOS: 4 and 5 and PCR for serA*(G336V) was performed using primers of SEQ ID NOS: 6 and 7. Amplified Ptrc and serA(Avn) and serA*(G336V) fragments of the respective genes were cloned into the pCL1920 vector treated with restriction enzyme Smal by Gibson assembly, respectively, thereby constructing pCL-Ptrc-serA(Avn) and pCL-Ptrc-serA*(G336V).
[0089] Example 2: Preparation of Strain by Introducing Azotobacter-derived serA(Avn) into Wile-type E. coli and Evaluation of Serine-producing Ability [0090] By using wild-type E. Coli strain W3110 as a platform strain, strains were prepared by introducing each of the two types of plasmids prepared in Example 1 into the W3110 strain, and then serine-producing abilities of these strains were evaluated.
[0091] Each of the strains was plated on an LB solid medium and cultured overnight in an incubator at 33°C. The strain, which was cultured overnight in
2 1
the LB solid medium, was inoculated into a 25-mL titer medium as shown in Table 2 below and cultured in an incubator at 34.5°C at 200 rpm for 40 hours. The results are shown in Table 3 below. [0092] Table 2
Composition Concentration (/L)
Glucose 40 g
KH2PO4 4 g
(NH4)2SO4 17 g
MgSO4•7H2O 1 g
FeSO4•7H2O 10 mg
MnSO4•4H2O 10 mg
Yeast extract 2 g
Calcium carbonate 30 g
pH 6.8
[0093] Table 3
Strain OD562 nm Glucose consumption
(g/L) L-serine
(g/L)
E. coli W3110 19.5 40.0 0.05
W3110/pCL-Ptrc-serA*(G336V) 18.2 38.2 0.08
W3110/pCL-Ptrc-serA(Avn) 18.1 37.6 0.13
[0094] As shown in Table 3, the W3110/pCL-Ptrc-serA*(G336V) strain , in which the feedback inhibition on serine is released and serA activity is enhanced, showed an increase in serine production by 60% compared to the wild-type strain. In comparison, it was confirmed that the W3110/pCL-Ptrc-serA(Avn) strain including Azotobacter-derived serA(Avn) showed an increase in serine production by 160% compared to the wild-type strain W3110, and also showed an increase by 62.5% compared to the strain W3110/pCL-Ptrc-serA*(G336V). [0095] Example 3: Preparation of Strain In Which serB Activity Is Weakened and Introduced with Foreign Azotobacter-derived serA(Avn) and
22
Evaluation of OPS-producing Ability Of the Strain
[0096] An O-phosphoserine (OPS)-producing microorganism was prepared by
weakening endogenous phosphoserine phosphatase (SerB) in wild-type E. Coli
strain W3110 (also named 'CA07-0012', accession number: KCCM11212P,
disclosed in Korean Patent No. 10-1381048 and US Patent Application
Publication No. 2012-0190081).
[0097] Each of the two types of plasmids prepared in Example 1 was introduced
into CA07-0012, and OPS-producing ability of the prepared strains was
evaluated.
[0098] Each of the strains was plated on an LB solid medium and cultured
overnight in an incubator at 33°C. The strain, which was cultured overnight in
the LB solid medium, was inoculated into a 25 mL titer medium as shown in
Table 4 below and cultured in an incubator at 34.5°C at 200 rpm for 40 hours.
The results are shown in Table 5 below.
[0099] Table 4
Composition Concentration (/L)
Glucose 40 g
KH2PO4 4 g
(NH4)2SO4 17 g
MgSO4•7H2O 1 g
FeSO4•7H2O 10 mg
MnSO4•4H2O 10 mg
L-glycine 2.5 g
Yeast extract 2 g
Calcium carbonate 30 g
pH 6.8
[00100] Table 5
Strain OD562 nm Glucose consumption
(g/L) O-phosphos erine(g/L)
CA07-0012 21.1 40.0 1.4
2 3
CA07-0012/pCL-Ptrc-serA*(G336V) 20.5 38.6 2.2
CA07-0012/pCL-Ptrc-serA(Avn) 20.0 37.8 2.9
[00101] As shown in Table 5 above, the CA07-0012/pCL-Ptrc-serA*(G336V), in which the feedback inhibition on serine is released and serA activity is enhanced, showed an increase in OPS production by 57% compared to the wild-type strain. It was confirmed that the CA07-0012/pCL-Ptrc-serA(Avn) strain including the Azotobacter-derived serA(Avn) showed an increase in OPS production by 107% compared to the wild-type strain, and also showed an increase by 32% compared to the CA07-0012/pCL-Ptrc-serA*(G336V) strain. [00102] Example 4: Preparation of Vector for Co-overexpression of Azotobacter-derived serA(Avn) and E. Coli-derived serC [00103] In order to identify whether the abilities to produce serine and OPS were further improved by introducing serA(Avn) into a strain, in which E. Coli-derived 3-phosphoserine aminotransferase (serC) was overexpressed, a vector in the form of pCL-Ptrc-serA(Avn)-(RBS)serC for expressing serA(Avn) and serC as operons was prepared.
[00104] As a positive control thereof, pCL-Ptrc-serA*(G336V)-(RBS)serC vector was constructed to prepare a microorganism co-expressing serA*(G336V) and serC derived from E. Coli. Sequences of primers used to prepare the vectors are shown in Table 6 below.
[00105] Table 6
Gene Sequence (5'->3') SEQ ID NO Vector
Ptrc_serA (Avn) CCTCACCACGTTGCGTCT CGAGTCAGAACAGAACCC GTGA 8 pCL-Ptrc-serA(Av n)-(RBS)serC
(RBS)serC CTCGAGACGCAACGTGGT GA 9 pCL-Ptrc-serA(Av
n)-(RBS)serC, pCL-Ptrc-serA*(G 336V)-(RBS)serC
AGTGAATTCGAGCTCGGT ACCCTTAACCGTGACGGC GTTC 10
Ptrc_serA* CTCACCACGTTGCGTCTC 11 pCL-Ptrc-serA*(G
2 4
(G336V) GAGTTAGTACAGCAGACG GGCG 336V)-(RBS)serC
[00106] PCR for Ptrc_serA(Avn) was performed using the pCL-Ptrc-serA(Avn) prepared in Example 1, as a template, and primers of SEQ ID NOS: 2 and 8, and PCR for Ptrc_serA*(G336V) was performed using the pCL-Ptrc-serA*(G336V), as a template, and primers of SEQ ID NOS: 2 and 11. E. Coli-derived (RBS)serC, used in both vectors, was obtained via PCR performed using genomic DNA of w3110, as a template, and primers of SEQ ID NOS: 9 and 10. [00107] Amplified Ptrc_serA(Avn) and (RBS)serC fragments and Ptrc_serA*(G336V) and (RBS)serC fragments were cloned with the pCL1920 vector treated with SmaI restriction enzyme by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL. 6, NO. 5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix), respectively, thereby constructing pCL-Ptrc-serA(Avn)-(RBS)serC and pCL-Ptrc-serA*(G336V)-(RBS)serC. [00108] Example 5: Preparation of Strain In Which serC Activity Is Enhanced and Introduced with Azotobacter-derived serA(Avn) Azotobacter-derived serA(Avn) and Evaluation of Serine-producing Ability Of the Strain
[00109] In order to evaluate the serine-producing ability when Azotobacter-derived serA(Avn) was introduced into a strain in which serC was overexpressed, the two types of plasmids prepared in Example 4 were introduced into W3110, respectively.
[00110] Each of the strains was plated on an LB solid medium and cultured overnight in an incubator at 33°C. The strain, which was cultured overnight in the LB solid medium, was inoculated into a 25 mL titer medium as shown in Table 7 below, and cultured in an incubator at 34.5°C at 200 rpm for 40 hours. The results are shown in Table 8 below. [00111] Table 7
Composition Concentration (/L)
Glucose 40 g
KH2PO4 4 g
2 5
(NH4)2SO4 17 g
MgSO4•7H2O 1 g
FeSO4•7H2O 10 mg
MnSO4•4H2O 10 mg
Yeast extract 2 g
Calcium carbonate 30 g
pH 6.8
[00112] Table 8
Strain OD562 nm Glucose
consumptio
n (g/L) L-serine (g/L)
E.CO//w3110 19.5 40.0 0.05
w3110/pCL-Ptrc-serA*(G336V)-(RBS)serC 19.0 39.2 0.21
w3110/pCL-Ptrc-serA(Avn)-(RBS)serC 18.1 38.1 0.29
[00113] As shown in Table 8 above, it was confirmed that the w3110/pCL-Ptrc-serA(Avn)-(RBS)serC strain including Azotobacter-derived serA(Avn) showed an increase in L-serine production compared to the w3110/pCL-Ptrc-serA*(G336V)-(RBS)serC strain including serA*(G336V). That is, it was confirmed that the L-serine-producing ability was further increased by including the Azotobacter-derived serA(Avn) in the strain in which the L-serine-producing ability was increased.
[00114] The w3110/pCL-Ptrc-serA(Avn)-(RBS)serC strain was named CA07-4383 and deposited at the Korean Culture Center of Microorganisms (KCCM) under the Budapest Treaty and designated Accession No. of KCCM12381P on November 9, 2018.
[00115] Example 6: Preparation of Strain In Which serB Activity Is Weakened, serC Activity Is Enhanced, and Azotobacter-derived serA(Avn) Is Introduced and Evaluation of OPS-producing Ability Of the Strain [00116] In order to evaluate the serine-producing ability in the case where Azotobacter-derived serA(Avn) was introduced into a strain in which the serB activity was weakened and the serC was overexpressed, the two types of plasmids prepared in Example 4 were introduced into CA07-0012, respectively,
2 6
and the OPS-producing ability of these strains was evaluated.
[00117] Each of the strains was plated on an LB solid medium and cultured
overnight in an incubator at 33°C. The strain, which was cultured overnight in
the LB solid medium, was inoculated into a 25 mL titer medium as shown in
Table 9 below, and cultured in an incubator at 34.5°C at 200 rpm for 40 hours.
The results are shown in Table 10 below.
[00118] Table 9
Composition Concentration (/L)
Glucose 40 g
KH2PO4 4 g
(NH4)2SO4 17 g
MgSO4•7H2O 1 g
FeSO4•7H2O 10 mg
MnSO4•4H2O 10 mg
L-glycine 2.5 g
Yeast extract 2 g
Calcium carbonate 30 g
pH 6.8
[00119] Table 10
Strain OD562 nm Glucose
consumpti
on (g/L) O-phosphoserin e(g/L)
CA07-0012 21.1 40.0 1.4
CA07-0012/pCL-Ptrc-serA*(G336V) -(RBS)serC 20.5 38.3 2.5
CA07-0012/pCL-Ptrc-serA(Avn)-(R BS)serC 19.8 37.5 3.3
[00120] As shown in Table 10 above, it was confirmed that the
CA07-0012/pCL-Ptrc-serA(Avn)-(RBS)serC strain including Azotobacter-derived
serA(Avn) had higher OPS production than the
27
CA07-0012/pCL-Ptrc-serA*(G336V)-(RBS)serC strain including serA*(G336V). That is, it was confirmed that the OPS-producing ability was further increased by including the Azotobacter-derived serA(Avn) in the strain in which the OPS-producing ability was increased.
[00121] Example 7: Preparation of Strain of the Genus Escherichia Introduced with Azotobacter-derived serA(Avn) and Evaluation of Tryptophan-producing Ability of the Strain
[00122] Example 7-1: Preparation of Microorganism of the genus Escherichia Producing L-tryptophan
[00123] An L-tryptophan-producing strain of the genus Escherichia was developed from the wild-type E. Coli W3110. In order to identify whether L-tryptophan production significantly increases by modification to express a protein having the activity of exporting L-tryptophan, a strain prepared to produce L-tryptophan was used as a parent strain. Specifically, the expression of L-tryptophan biosynthesis genes (trpEDCBA), which are involved in the production of L-tryptophan from chorismate, is inhibited by TrpR. Thus, trpR gene encoding TrpR was removed. In addition, in order to release the feedback inhibition of TrpE polypeptide in accordance with increased production of L-tryptophan, proline, the 21st amino acid from the N-terminus of TrpE, was substituted with serine (J. Biochem. Mol. Biol. 32, 20-24 (1999)). [00124] Mtr membrane protein plays a role in transporting extracellular L-tryptophan into a cell, and TnaA protein plays a role in degrading intracellular L-tryptophan and water molecules into indole, pyruvate, and ammonia (NH3). Thus, the mtr and tnaA genes which inhibit L-tryptophan production and degrade L-tryptophan were removed.
[00125] For the removal of these genes, the λ-red recombination method (One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko KA, Wanner BL., Proc Natl Acad Sci USA. 2000 Jun 6;97(12):6640-5) was used. To remove the mtr gene, PCR was performed using pKD4 vector, as a template, and primers of SEQ ID NOS: 12 and 13 to prepare a gene fragment (1,580 bp) in which an FRT-kanamycin-FRT cassette and a homologous base pair of 50 bp flanking the mtr gene, where chromosomal
2 8
homologous recombination occurs therebetween, are bound. A kanamycin antibiotic marker of the pKD4 vector was used for confirmation of removal of a target gene and insertion of an antibiotic gene, and the FRT region plays a role in removing the antibiotic marker after the removal of the target gene. Solg™TM Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 2 minutes; 27 cycles of denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 1 minute; and polymerization at 72°C for 5 minutes.
[00126] Table 11
SEQ ID NO Primer Sequence (5'-3')
12 Amtr cassette - 1 TGCAATGCATAACAACGCAGTCGCACTAT TTTTCACTGGAGAGAAGCCCTGTGTAGGC TGGAGCTGCTTC
13 ▲mtr cassette - 2 TGCAATGCATAACAACGCAGTCGCACTAT TTTTCACTGGAGAGAAGCCCTGTCCATAT GAATATCCTCCT
[00127] The E. Coli strain W3110 was transformed with the pKD46 vector which expresses λ-red recombinase (gam, bet, and exo) by electroporation and plated on an LB solid medium containing 50 mg/L kanamycin. In the E. Coli strain W3110, which was confirmed to have been transformed with the pKD46 vector, expression of a recombinant enzyme was induced by adding 10 mM L-arabinose thereto when the OD600 reached about 0.1 at 30°C. When the OD600 reached about 0.6, the strain was prepared as competent cells and transformed by electroporation with the linear gene fragment obtained in the above process, in which the FRT-kanamycin-FRT cassette and the homologous base pair of 50 bp flanking the mtr gene were bound. For colonies grown on an LB solid medium containing 25 mg/L kanamycin, colony PCR was performed using primers of SEQ ID NOS: 14 and 15 and the colonies where a 782-bp gene fragment was prepared were selected. [00128] Table 12
2 9
SEQ ID NO
Primer Sequence (5'->3')
14 Confirm_Cassette - 1 GGGCAGGATCTCCTGTCATC
15 Confirm_▲mtr - 2 AAATGTCGGATAAGGCACCG
[00129] The strain from which the mtr gene was removed by homologous recombination was prepared as competent cells to remove the kanamycin antibiotic marker and then transformed with the pCP20 vector by electroporation. The pCP20 vector to recognize the FRT sites flanking the kanamycin antibiotic and bind thereto on the chromosome by expressing the FLP protein, thereby removing the antibiotic marker between the FRT sites. The strain transformed with the pCP20 vector and grown on the LB solid medium containing 100 mg/L ampicillin and 25 mg/L chloroamphenicol was cultured in an LB liquid medium at 30°C for 1 hour, further cultured at 42°C for 15 hours, and plated on an LB solid medium. The grown colonies were cultured in a LB solid medium containing 100 mg/L ampicillin and 25 mg/L chloramphenicol, an LB solid medium containing 12.5 mg/L kanamycin, and an LB solid medium containing no antibiotic. Only the colonies grown in the LB solid medium containing no antibiotic were selected. The removal of the mtr gene was finally confirmed by genome sequencing and the strain was named CA04-9300. [00130] Genetic manipulation was performed by the method as described above to remove the tnaA gene. PCR was performed using the pKD4 vector, as a template, and primers of SEQ ID NOS: 16 and 17 to prepare a gene fragment (1,580 bp) in which an FRT-kanamycin-FRT cassette and a homologous base pair of 50 bp flanking the tnaA gene where chromosomal homologous recombination occurs are bound. Solg™ Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 2 minutes; 27 cycles of denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 1 minute; and polymerization at 72°C for 5 minutes. [00131] Table 13
SEQ ID NO: Primer Sequence (5'->3')
3 0
16 AtnaA cassette - 1 TGTAATATTCACAGGGATCACTGTAATTA AAATAAATGAAGGATTATGTAGTGTAGGC TGGAGCTGCTTC
17 AtnaA cassette - 2 TGTAGGGTAAGAGAGTGGCTAACATCCT TATAGCCACTCTGTAGTATTAAGTCCATA TGAATATCCTCCT
18 Confirm_▲tnaA – 2 ACATCCTTATAGCCACTCTG
[00132] Transformation with the pKD46 vector was confirmed, and the CA04-9300 strain in which recombinases were expressed by adding 10 mM L-arabinose was transformed by electroporation with the linear gene fragment in which the FRT-kanamycin-FRT cassette and the homologous base pair of 50 bp flanking the tnaA gene were bound. For colonies grown on an LB solid medium containing 25 mg/L kanamycin, colony PCR was performed using primers of SEQ ID NOS: 14 and 18 and colonies where a 787-bp gene fragment was prepared were selected.
[00133] The strain from which the tnaA gene was removed by homologous recombination was prepared as competent cells and transformed with the pCP20 vector to remove the kanamycin antibiotic marker, and a strain from which the kanamycin antibiotic marker was removed was prepared by the expression of the FLP protein. The removal of the tnaA gene was finally confirmed by genome sequencing and the strain was named CA04-9301. [00134] To remove the trpR gene, PCR was performed using the pKD4 vector, as a template, and primers of SEQ ID NOS: 19 and 20 to prepare a gene fragment (1,580 bp) in which the FRT-kanamycin-FRT cassette and a homologous pair of 50 bp flanking the trpR gene where chromosomal homologous recombination occurs were bound. Solg™ Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 2 minutes; 27 cycles of denaturation at 95°C for 20 seconds, annealing at 62°C for 40 seconds, and polymerization at 72°C for 1 minute; and polymerization at 72°C for 5 minutes. [00135] Table 14
31
SEQ ID NO Primer Sequence (5'->3')
19 AtrpR cassette - 1 TACAACCGGGGGAGGCATTTTGCTTCCC CCGCTAACAATGGCGACATATTGTGTAG GCTGGAGCTGCTTC
20 AtrpR cassette - 2 GCATTCGGTGCACGATGCCTGATGCGCC ACGTCTTATCAGGCCTACAAAAGTCCATA TGAATATCCTCCT
21 Confirm_▲trpR - 2 AGGACGGATAAGGCGTTCAC
[00136] Transformation with the pKD46 vector was confirmed, and the CA04-9301 strain in which recombinases were expressed by adding 10 mM L-arabinose was transformed by electroporation with the linear gene fragment, obtained in the above-described process, in which the FRT-kanamycin-FRT cassette and the homologous base pair of 50 bp flanking the trpR gene are bound. For colonies grown on an LB solid medium containing 25 mg/L kanamycin, colony PCR was performed using primers of SEQ ID NOS: 14 and 21 and the colonies where a 838-bp gene fragment was prepared were selected. [00137] The strain from which the trpR gene was removed by homologous recombination was prepared as competent cells and then transformed with the pCP20 vector to remove the kanamycin antibiotic marker, and a strain from which the kanamycin antibiotic marker was removed by expression of the FLP protein was prepared. The removal of the trpR gene was finally confirmed by genome sequencing and the strain was named CA04-9307. [00138] To provide the strain CA04-9307 with a feedback resistant trpE trait, PCR was performed using gDNA of E. Coli W3110, as a template, and primers of SEQ ID NOS: 22 and 23 containing an EcoRI restriction enzyme site, thereby obtaining a trpE gene fragment containing an EcoRI sequence (1,575 bp). Solg™ Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 2 minutes; 27 cycles of denaturation at 95°C for 20 seconds, annealing at 62°C for 1 minute, and polymerization at 72°C for 1 minute; and polymerization at 72°C for 5 minutes.
32
[00139] Table 15
SEQ ID NO Primer Sequence (5'->3')
22 trpE - 1 GAATTCATGCAAACACAAAAACCGAC
23 trpE - 2 GAATTCTCAGAAAGTCTCCTGTGCA
[00140] The trpE gene obtained by the method described above and pSG76-C plasmid (JOURNAL OF BACTERIOLOGY, July 1997, p. 4426–4428) were treated with EcoRI restriction enzyme and cloned. E. Coli DH5α was transformed with the cloned plasmid by electroporation, and the transformed E. Coli DH5α was selected from an LB plate containing 25 μg/mL chlororamphenocol to obtain pSG76-C-trpE plasmid.
[00141] Site directed mutagenesis (Stratagene, USA) was performed using the obtained pSG76-C-trpE plasmid and primers of SEQ ID NOS: 24 and 25 to prepare pSG76-C-trpE(P21S).
[00142] Table 16
SEQ ID NO: Name Primer (5’->3’)
24 trpE(P21S) - 1 CGCTTATCGCGACAATTCCACCGC GCTTTTTCACCAG
25 trpE(P21S) - 2 CTGGTGAAAAAGCGCGGTGGAATT GTCGCGATAAGCG
[00143] The strain CA04-9307 was transformed with the pSG76-C-trpE(P21S) plasmid and cultured in an LB-Cm medium (10 g/L yeast extract, 5 g/L NaCl, 10 g/L tryptone, and 25 µg/L chloramphenicol), and colonies resistant to chloramphenicol were selected. The selected transformants are strains in which the pSG76-C-trpE(P21S) plasmid is incorporated into the trpE region of the genome by the first insertion. The strain into which the obtained trpE(P21S) gene is inserted was transformed with pAScep plasmid (Journal of Bacteriology, July 1997, p. 4426 to 4428), which expresses restriction enzyme I-SceI that cleaves an I-SceI region present in the pSG76-C plasmid, and the strain grown in an LB-Ap medium (10 g/L yeast extract, 5 g/L NaCl, 10 g/L tryptone, and 100 µg/L ampicillin) was selected. The trpE gene was amplified in the selected
3 3
strain using primers of SEQ ID NOS: 22 and 23, and substitution with the trpE(P21S) gene was confirmed by sequencing. The prepared strain was named CA04-4303.
[00144] Example 7-2: Preparation of Microorganism of the Genus
Escherichia within Which Azotobacter-derived serA(Avn) Is Introduced
and Evaluation of Tryptophan-producing Ability of the Microorganism
[00145] The pCL-Ptrc-serA(Avn) vector prepared in Example 1 and a pCL1920
vector as a control were introduced into CA04-4303 prepared in Example 1,
respectively, to prepare CA04-4303/pCL1920 and
CA04-4303/pCL-Ptrc-serA(Avn) strains. To examine the L-tryptophan production of CA04-4303/pCL1920 and CA04-4303/pCL-Ptrc-serA(Avn) strains, the two strains were cultured in an LB liquid medium containing 50 mg/L spectinomycin for 12 hours. Subsequently, each of the strains was inoculated onto a 250 ml corner-baffle flask containing 25 ml of a production medium such that an initial OD600 value reached 0.01 and cultured while shaking at 37°C for 48 hours at 200 rpm. Upon completion of the cultivation, the amount of L-tryptophan production was measured by HPLC.
[00146] The results of L-tryptophan production by the CA04-4303/pCL1920 and CA04-4303/pCL-Ptrc-serA(Avn) strains in the culture media are shown in Table 17 below. The CA04-4303/pCL1920 strain showed an L-tryptophan production of 1.2 g/L and an accumulation of indole, which is an intermediate product, in an amount of 37 mg/L. However, the strain introduced with serA(Avn) showed an L-tryptophan production of 1.7 g/L with no accumulation of indole. [00147]
[00148] 70 g of glucose, 20 g of (NH4)2SO4, 1 g of MgSO4•7H2O, 2 g of KH2PO4, 2.5 g of yeast extract, 5 g of Na-citrate, 1 g of NaCl, and 40 g of CaCO3 (based on 1 L of distilled water). [00149] Table 17
[00150] Confirmation of L-tryptophan Production Containing serA(Avn)
Strain OD L-tryptophan
(g/L) Indole (mg/L)
CA04-4303/pCL1920 37.9 1.2 37
3 4
CA04-4303/pCL-Ptrc-serA(Avn)
38.4
1.7
0
[00151] As can be seen in the above results, it was estimated that the supply of
L-serine was sufficient by introducing serA(Avn), and it was confirmed that the
yield of L-tryptophan was increased with no accumulation of indole, that is an
intermediate product, in the final step of the biosynthesis of L-tryptophan.
[00152] Example 7-3: Preparation of Corynebacterium Glutamicum Strain
Producing Tryptophan In Which Foreign Azotobacter-derived serA(Avn) Is
Introduced
[00153] In order to identify the effect of the Azotobacter-derived serA(Avn) gene
on a strain of the genus Corynebacterium producing tryptophan, KCCM12218P
(Korean Patent Application Publication No. 2018-0089329) was used as the
strain of the genus Corynebacterium producing L-tryptophan.
[00154] The strain was prepared by substituting Corynebacterium glutamicum
serA (hereinafter, referred to as serA(Cgl)) gene with the Azotobacter-derived
serA(Avn) gene to be expressed by the gapA promoter.
[00155] For this genetic manipulation, first, a region upstream of the promoter
and a region downstream of the an OFR of the serA (Cgl) gene, where
chromosomal homologous recombination occurs, were obtained. Specifically,
a gene fragment of the promoter upstream region was obtained by performing
PCR using the chromosomal DNA of Corynebacterium glutamicum, as a
template, and primers of SEQ ID NOS: 26 and 27 and a gene fragment of the
downstream region was obtained by performing PCR using primers of SEQ ID
NOS: 28 and 29. Additionally, the gapA promoter region was obtained by
performing PCR using the chromosomal DNA of Corynebacterium glutamicum,
as a template, and primers of SEQ ID NOS: 30 and 31.
[00156] Solg™ Pfu-X DNA polymerase was used as a polymerase, and the PCR
was performed under the following amplification conditions: denaturation at 95°C
for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at
58°C for 30 seconds, and polymerization at 72°C for 60 seconds; and
polymerization at 72°C for 5 minutes.
[00157] The Azotobacter-derived serA(Avn) gene region was obtained by
35
performing PCR using the pCL-Ptrc_-serA(Avn) vector prepared in Example 1, as a template, and primers of SEQ ID NOS: 32 and 33.
[00158] Solg™ Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and polymerization at 72°C for 30 seconds; and polymerization at 72°C for 5 minutes.
[00159] A recombinant plasmid was obtained via cloning using the amplified upstream and downstream regions for the chromosomal homologous recombination, the gapA promoter, the Azotobacter-derived serA(Avn) gene, and a pDZ vector for chromosomal transformation cleaved by the SmaI restriction enzyme by Gibson assembly and named pDZ-PgapA-serA(Avn). The cloning was performed by mixing a Gibson assembly reagent and each of the gene fragments in calculated numbers of moles, followed by incubation at 50°C for 1 hour.
[00160] The Corynebacterium glutamicum strain KCCM12218P producing L-tryptophan was transformed with the prepared pDZ-PgapA-serA(Avn) vector by electroporation and subjected to a second crossover process to obtain a strain in which the serA(cgl) gene was substituted with the Azotobacter serA gene expressed by the gapA promoter. This genetic manipulation was confirmed by performing PCR and genome sequencing using primers SEQ ID NOS: 34 and 35 respectively amplifying the outer regions of the upstream and downstream regions of the homologous recombination in which the gene was inserted, and the resulting strain was named KCCM12218P-PgapA-serA(Avn). [00161] Sequences of the primers used in this example are shown in Table 18 below.
[00162] Table 18
SEQ ID NO Primer Sequence (5'->3')
26 SerA(Cgl)-up-F TCGAGCTCGGTACCCGGAAGATCT AGTCGGATACG
27 SerA(Cgl)-up-R TCGTTTTTAGGCCTCCGACTACTTT GGGCAATCCT
3 6
28 SerA(Cgl)-down-F TCTGTTCTGATTAGAGATCCATTTG CTTGAAC
29 SerA(Cgl)-down-R CTCTAGAGGATCCCCTCACCCAGC TCAAAGCTGAT
30 PgapA-F TGCCCAAAGTAGTCGGAGGCCTAA AAACGACCGAG
31 PgapA-R TCTTACTCATGTTGTGTCTCCTCTA AAG
32 serA(Avn)-F GAGACACAACATGAGTAAGACCTC CCTG
33 serA(Avn)-R GGATCTCTAATCAGAACAGAACCC GTGAG
34 Confirm-serA-F ACCAAGAGTTCGAAGACCAG
35 Confirm-serA-R TTCAGTGGCTTCCACATCGC
[00163] Example 7-4: Evaluation of Tryptophan-producing Ability of Corynebacterium glutamicum Strain In Which Azotobacter-derived serA(Avn) Is Introduced
[00164] The KCCM12218P-PgapA-serA(Avn) strain prepared in Example 7-3 and the parent strain KCCM12218P were cultured according to the following method to identify tryptophan production thereof. Each of the strains was inoculated onto a 250 ml corner-baffle flask containing 25 ml of a seed medium and cultured while shaking at 30°C for 20 hours at 200 rpm. Then, 1 ml of the seed medium was inoculated onto a 250 ml corner-baffle flask containing 25 ml of a production medium and cultured while shaking at 30°C for 24 hours at 200 rpm. Upon completion of the cultivation, the L-tryptophan production by each strain was measured by HPLC. [00165]
[00166] 20 g of glucose, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH2PO4, 8 g of K2HPO4, 0.5 g of MgSO4•7H2O, 100 μg of biotin, 1,000 μg of thiamine HCl, 2,000 μg of calcium pantothenate, and 2,000 μg of nicotinamide (based on 1 L of distilled water).
3 7
[00167]
[00168] 30 g of glucose, 15 g of (NH4)2SO4, 1.2 g of MgSO4•7H2O, 1 g of KH2PO4, 5 g of yeast extract, 900 μg of biotin, 4,500 μg of thiamine HCl, 4,500 μg of calcium pantothenate, and 30 g of CaCO3 (based on 1 L of distilled water) [00169] Table 19
[00170] Confirmation of Tryptophan Production of Corynebacterium Glutamicum Strain Introduced with Foreign Azotobacter-derived serA(Avn)
OD Glucose consumption
(g/L) Tryptophan production
(g/L) Indole (mg/L)
KCCM12218P 43.6 30 2.5 59
KCCM12218P-PgapA-serA(Avn) 42.3 30 3.1 0
[00171] The evaluation results of L-tryptophan production of the KCCM12218P and KCCM12218P-PgapA-serA(Avn) strains are shown in Table 19 above. [00172] While the parent strain KCCM12218P showed an L-tryptophan production of 2.5 g/L and the intermediate product of indole was accumulated in an amount of 59 mg/L, the strain introduced with serA(Avn) showed a L-tryptophan production of 3.1 g/L with no accumulation of indole. [00173] Based on the results, it was estimated that the supply of L-serine was also sufficient by introducing Azotobacter-derived serA(Avn) into Corynebacterium glutamicum producing L-tryptophan, and it was confirmed that the yield of L-tryptophan was also increased with no accumulation of indole that is an intermediate product in the final step of the biosynthesis of L-tryptophan. Therefore, it can be seen that synergistic effects on tryptophan production are improved when production of the precursor is improved together. [00174] The strain KCCM12218P-PgapA-serA(Avn) was named CM05-8935 and deposited at the Korean Culture Center of Microorganisms (KCCM) under the Budapest Treaty and designated Accession No. of KCCM12414P on November 27, 2018. [00175] Example 8: Preparation of Corynebacterium Glutamicum Strain
38
Introduced with Azotobacter-derived serA(Avn) and Evaluation of Histidine-producing Ability of the Strain
[00176] Example 8-1: Preparation of Histidine-producing Corynebacterium Glutamicum Strain
[00177] An L-histidine-producing Corynebacterium glutamicum strain was developed from a wild-type strain ATCC13032. In order to release feedback inhibition of HisG polypeptide, which is the first enzyme of the L-histidine biosynthetic pathway, glycine at the 233rd position from the N-terminus of HisG was substituted with histidine and threonine at the 235th position from the N-terminus was substituted with glutamine, simultaneously (SEQ ID NO: 88) (ACS Synth. Biol., 2014, 3 (1), pp 21–29). Additionally, in order to enhance the L-histidine biosynthetic pathway, biosynthesis genes (hisD-hisC-hisB-hisN) split into 4 operons in total were prepared in a cluster form where the promoter was substituted and introduced into the strain (SEQ ID NO: 89). [00178] For this genetic manipulation, first, the upstream and downstream regions of the modifications of the 233rd and 235th amino acids of hisG where chromosomal homologous recombination occurs were obtained. Specifically, a gene fragment of the upstream and downstream regions of the modifications of the 233rd and 235th amino acids of hisG was obtained by performing PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032, as a template, and primers of SEQ ID NOS: 36 and 37, and a gene fragment of the upstream and downstream regions of the modifications of the 233rd and 235th amino acids of hisG was obtained by performing PCR using primers of SEQ ID NOS: 38 and 39.
[00179] Solg™ Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds; and polymerization at 72°C for 5 minutes.
[00180] A recombinant plasmid was obtained via cloning using the amplified the upstream and downstream regions of the modifications of the 233rd and 235th amino acids of hisG and the pDZ vector (Korean Patent No. 10-0924065) for
39
chromosomal transformation cleaved by the SmaI restriction enzyme by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL. 6, NO. 5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) and named pDZ-hisG(G233H, T235Q). The cloning was performed by mixing a Gibson assembly reagent and each of the gene fragments in calculated number of moles, followed by incubation at 50°C for 1 hour.
[00181] The wild-type Corynebacterium glutamicum strain ATCC13032 was transformed with the prepared pDZ-hisG(G233H, T235Q) vector by electroporation and subjected to a second crossover process to obtain a strain having substitutions of amino acids of HisG from glycine to histidine at the 233rd position and from threonine to glutamine at the 235th position on the chromosome (SEQ ID NO: 88). This genetic manipulation was confirmed by performing PCR and genome sequencing using primers SEQ ID NOS: 40 and 41 respectively amplifying the outer regions of the upstream and downstream regions of the homologous recombination in which the gene was inserted and the resulting strain was named CA14-0011.
[00182] Sequences of the primers used in this example are shown in Table 20 below.
[00183] Table 20
SEQ ID NO Primer Sequence (5'->3')
36 (hisG(G233H, T235Q) F-1) TCGAGCTCGGTACCCATCGCCATCTACG TTGCTGG
37 (hisG(G233H, T235Q) R-1) GTGCCAGTGGGGATACCtgTGGGtgGGAT AAGCCTGGGGTTACTG
38 (hisG(G233H, T235Q) F-2) AACCCCAGGCTTATCCcaCCCAcaGGTAT CCCCACTGGCACGCGA
39 (hisG(G233H, T235Q) R-2) CTCTAGAGGATCCCCGGGACGTGGTTGA TGGTGGT
40 (hisG CF) ATGGAAATCCTCGCCGAAGC
41 (hisG CR) ATCGATGGGGAACTGATCCA
[00184] Additionally, in order to enhance the L-histidine biosynthetic pathway,
4 0
the biosynthesis genes split into 4 operons in total were introduced in the form of cluster where the promoter was substituted. Specifically, the L-histidine biosynthesis cluster was split into four operons (hisE-hisG, hisA-impA-hisF-hisI, hisD-hisC-hisB, and cg0911-hisN) in total, and a vector simultaneously introducing the biosynthesis genes into the microorganism was prepared. [00185] In addition, Ncgl1108 gene encoding gamma-aminobutyrate permease (Microb Biotechnol. 2014 Jan; 7 (1): 5-25)) was used as an insertion site of the biosynthesis cluster.
[00186] For this genetic manipulation, first, upstream and downstream regions of the Ncgl1108 gene where chromosomal homologous recombination occurs were obtained. Specifically, a gene fragment of the upstream region of the Ncgl1108 gene was obtained by performing PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032, as a template, and primers of SEQ ID NOS: 42 and 43, and a gene fragment of the downstream region of the Ncgl1108 gene was obtained by performing PCR using primers of SEQ ID NOS: 44 and 45.
[00187] Solg™ Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds; and polymerization at 72°C for 5 minutes.
[00188] A recombinant plasmid was obtained via cloning using the amplified upstream and downstream regions of the NCgl1108 gene and the pDZ vector (Korean Patent No. 10-0924065) for chromosomal transformation cleaved by the SmaI restriction enzyme by Gibson assembly (DG Gibson et al., NATURE METHODS, VOL. 6, NO. 5, MAY 2009, NEBuilder HiFi DNA Assembly Master
Mix) and named pDZ-▲Ncgl1108. The cloning was performed by mixing a
Gibson assembly reagent and the gene fragments in calculated numbers of moles, followed by incubation at 50°C for 1 hour.
[00189] The CA14-0011 strain was transformed with the prepared pDZ-▲Ncgl1108 vector by electroporation and subjected to a second crossover process to obtain a strain in which the Ncgl1108 gene is disrupted. This
41
genetic manipulation was confirmed by performing PCR and genome
sequencing using primers SEQ ID NOS: 46 and 47 respectively amplifying the
outer regions of the upstream and downstream regions of homologous
recombination where the gene was disrupted and the resulting strain was named
CA14-0736.
[00190] Sequences of the primers used in this example are shown in Table 21
below.
[00191] Table 21
SEQ ID NO Primer Sequence (5'->3')
42 (KO Ncgl1108 F-1) TCGAGCTCGGTACCCATCGCCATC TACGTTGCTGG
43 (KO Ncgl1108 R-1) GAGTCTAGAAGTACTCGAGATGCT GACCTCGTTTC
44 (KO Ncgl1108 F-2) AGCATCTCGAGTACTTCTAGACTC GCACGAAAAAG
45 (KO Ncgl1108 R-2) CTCTAGAGGATCCCCTTTGGGCAG AGCTCAAATTC
46 (KO hisG CF) AGTTTCGTAACCCACCTTGC
47 (KO hisG CR) CGCTTCTCAATCTGATGAGA
[00192] Additionally, in order to enhance the biosynthesis cluster, a promoter region to be substituted with a group of 4 operon genes was obtained. An enhanced lysC promoter (hereinafter, referred to as lysCP1, Korean Patent No. 10-0930203) region and a hisE-hisG region, a gapA promoter region and a hisA-impA-hisF-hisI region, a SPL13 synthesized promoter (Korean Patent No. 10-1783170) region and a hisD-hisC-hisB region, and a CJ7 synthesized promoter (Korean Patent No. 10-0620092 and WO2006/065095) region and a cg0911-hisN region were obtained. Specifically, PCR was performed using the chromosome of KCCM10919P strain (Korean Patent No. 10-0930203), as a template, and primers of SEQ ID NOS: 48 and 49. PfuUltraTM high-fidelity DNA polymerase (Stratagene) was used as a polymerase for PCR, and PCR products amplified thereby were purified by using a PCR Purification kit
4 2
manufactured by QIAGEN to obtain the lysCP1 promoter region. A gene fragment of the hisE-hisG region was obtained by performing PCR using the chromosomal DNA of the Corynebacterium glutamicum CA14-0011, as a template, and primers of SEQ ID NOS: 50 and 51. A gene fragment of the gapA promoter region was obtained by performing PCR using primers of SEQ ID NOS: 52 and 53 and a gene fragment of the hisA-impA-hisF-hisI region was obtained by performing PCR using primers of SEQ ID NOS: 54 and 55. Additionally, PCR was performed using the SPL13 synthesized promoter, as a template, and primers of SEQ ID NOS: 56 and 57, and a gene fragment of the hisD-hisC-hisB region was obtained by performed PCR using the chromosomal DNA of Corynebacterium glutamicum CA14-0011, as a template, and primers of SEQ ID NOS: 58 and 59. Then, PCR was performed using the CJ7 synthesized promoter, as a temperature, and primers of SEQ ID NOS: 60 and 61, and a gene fragment of the cg0911-hisN region was obtained by performing using the chromosomal DNA of Corynebacterium glutamicum CA14-0011, as a template, and primers of SEQ ID NOS: 62 and 63.
[00193] Sequences of the primers used in this example are shown in Table 22 below.
[00194] Table 22
SEQ ID NO Primer Sequence (5'->3')
48 (his cluster F-1) GTCAGCATCTCGAGTGCTCCTTAGGGAG CCATCTT
49 (his cluster R-1) GTCAAATGTCTTCACATGTGTGCACCTTT CGATCT
50 (his cluster F-2) GAAAGGTGCACACATGTGAAGACATTTG ACTCGCT
51 (his cluster R-2) TCGTTTTTAGGCCTCCTAGATGCGGGCG ATGCGGA
52 (his cluster F-3) ATCGCCCGCATCTAGGAGGCCTAAAAAC GACCGAG
53 (his cluster R-3) GACAGTTTTGGTCATGTTGTGTCTCCTCT AAAGAT
4 3
54 (his cluster F-4) TAGAGGAGACACAACATGACCAAAACTG TCGCCCT
55 (his cluster R-4) TGAAGCGCCGGTACCGCTTACAGCAAAA CGTCATT
56 (his cluster F-5) CGTTTTGCTGTAAGCGGTACCGGCGCTT CATGTCA
57 (his cluster R-5) AGTGACATTCAACATTGTTTTGATCTCCT CCAATA
58 (his cluster F-6) GAGGAGATCAAAACAATGTTGAATGTCA CTGACCT
59 (his cluster R-6) CGCTGGGATGTTTCTCTAGAGCGCTCCC TTAGTGG
60 (his cluster F-7) AAGGGAGCGCTCTAGAGAAACATCCCAG CGCTACT
61 (his cluster R-7) AGTCATGCCTTCCATGAGTGTTTCCTTTC GTTGGG
62 (his cluster F-8) CGAAAGGAAACACTCATGGAAGGCATGA CTAATCC
63 (his cluster R-8) CGAGTCTAGAAGTGCCTATTTTAAACGAT CCAGCG
[00195] Solg™TM Pfu-X DNA polymerase was used as a polymerase, and the PCR was performed under the following amplification conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 180 seconds; and polymerization at 72°C for 5 minutes.
[00196] A recombinant plasmid was obtained via cloning using the amplified lysCP1 region and hisE-hisG region, gapA promoter region and hisA-impA-hisF-hisI region, SPL13 synthesized promoter region and hisD-hisC-hisB region, CJ7 synthesized promoter region and cg0911-hisN
region, and the pDZ vector-▲NCgl1108 vector for chromosomal transformation
cleaved by the ScaI restriction enzyme by Gibson assembly (DG Gibson et al.,
44
NATURE METHODS, VOL. 6, NO. 5, MAY 2009, NEBuilder HiFi DNA Assembly
Master Mix) and named
pDZ-▲NCgl1108::lysCP1_hisEG-PgapA_hisA-impA-hisFI-SPL13_HisDCB-CJ7
_cg0911-hisN. The cloning was performed by mixing a Gibson assembly reagent and each of the gene fragments in calculated number of moles, followed by incubation at 50°C for 1 hour. [00197] The CA14-0011 strain was transformed with the prepared
pDZ-▲Ncgl1108::PlysCm1_hisEG-PgapA_hisA-impA-hisFI-SPL13_HisDCB-CJ
7_cg0911-hisN vector by electroporation and subjected to a second crossover process to obtain a strain into which the biosynthesis genes were inserted. This genetic manipulation was confirmed by performing PCR and genome sequencing using primers SEQ ID NOS: 46 and 47 respectively amplifying outer regions of the upstream and downstream regions of the homologous recombination into which the gene was inserted and the transformed strain was named CA14-0737.
[00198] The CA14-0737 strain was deposited at the Korean Culture Center of Microorganisms (KCCM) under the Budapest Treaty and designated Accession No. of KCCM 12411P on November 27, 2018.
[00199] Example 8-2: Preparation of His-Producing Corynebacterium Glutamicum Strain Introduced with Foreign Azotobacter-derived serA(Avn) [00200] In order to identify the effect of the Azotobacter-derived serA(Avn) gene on an increase in L-histidine production, the CA14-0737 strain was used. [00201] A strain was prepared by substituting the serA(Cgl)gene with the Azotobacter-derived serA(Avn) gene to be expressed by the gapA promoter using the pDZ-PgapA-serA(Avn) prepared in Example 7-3. [00202] The Corynebacterium glutamicum strain CA14-0737 producing L-histidine was transformed with the pDZ-PgapA-serA(Avn) vector by electroporation and subjected to a second crossover process to obtain a strain in which the serA(Cgl) gene was substituted with the Azotobacter serA gene expressed by a strong promoter of the gapA promoter. This genetic manipulation was confirmed by performing PCR and genome sequencing using
4 5
primers SEQ ID NOS: 34 and 35 respectively amplifying outer regions of the upstream and downstream regions of the homologous recombination into which the gene was inserted and the resulting strain was named CA14-0738. [00203] Example 8-3: Evaluation of L-histidine-producing Corynebacterium Glutamicum Strain Introduced with Azotobacter-derived serA(Avn) [00204] The CA14-0011, CA14-0736, CA14-0737, and CA14-0738 strains prepared in Examples 8-1 and 8-2 above were cultured according to the following method to identify the L-histidine-producing ability. Each of the strains was inoculated onto a 250 ml corner-baffle flask containing 25 ml of a seed medium and cultured while shaking at 30°C for 20 hours at 200 rpm. Then, 1 ml of the seed medium was inoculated onto a 250 ml corner-baffle flask containing 25 ml of a production medium and cultured while shaking at 30°C for 24 hours at 200 rpm. Upon completion of the cultivation, the L-histidine production was measured by HPLC. [00205]
[00206] 20 g of glucose, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH2PO4, 8 g of K2HPO4, 0.5 g of MgSO4•7H2O, 100 μg of biotin, 1,000 μg of thiamine HCl, 2,000 μg of calcium pantothenate, and 2,000 μg of nicotinamide (based on 1 L of distilled water). [00207]
[00208] 100 g of glucose, 40 g of (NH4)2SO4, 3 g of yeast extract, 1 g of KH2PO4, 0.4 g of MgSO4•7H2O, 0.01 g of FeSO4•7H2O, 50 μg of biotin, 100 μg of thiamine, and 30 g of CaCO3 (based on 1 L of distilled water) [00209] Table 23
[00210] Confirmation of L-histidine Production of Corynebacterium Glutamicum Strain Introduced with Foreign Azotobacter-derived serA(Avn)
OD Glucose consumption (g/L) Histidine production (g/L)
CA14-0011 113.6 100 0.51
CA14-0736 115.1 100 0.50
4 6
CA14-0737 88.9 100 4.09
CA14-0738 84.7 100 5.07
[00211] The evaluation results of L-histidine production of the
L-histidine-producing Corynebacterium glutamicum strains are shown in Table
24 above.
[00212] While the parent strain CA14-0737 having enhanced histidine-producing
ability showed an L-histidine production of 4.09 g/L, the CA14-0738 strain
introduced with serA(Avn) showed an L-histidine production of 5.07 g/L,
indicating an increase in L-histidine production by 20% compared to the parent
strain CA14-0737.
[00213] Based on the results, it was confirmed that the ability to produce
L-histidine was enhanced by introducing the Azotobacter-derived serA(Avn).
The CA14-0738 strain was deposited at the Korean Culture Center of
Microorganisms (KCCM) under the Budapest Treaty and designated Accession
No. of KCCM 12412P on November 27, 2018.
[00214] Example 9: Preparation and Evaluation of Methionine
(Met)-producing Strain Introduced with Azotobacter serA
[00215] Example 9-1: Preparation of Recombinant Vector for Deletion of
mcbR Gene
[00216] In order to prepare a methionine-producing strain, ATCC13032 strain
was used to prepare a vector for inactivating the mcbR gene encoding
methionine/cysteine transcriptional regulator(J. Biotechnol. 103:51–65, 2003).
[00217] Specifically, in order to delete the mcbR gene from the chromosome of
the Corynebacterium glutamicum strain ATCC13032, a recombinant plasmid
vector was prepared according to the following method. Based on nucleotide
sequences deposited in the U.S. National Institutes of Health (NIH) GenBank,
the mcbR gene and flanking sequences of Corynebacterium glutamicum (SEQ
ID NO: 91) were obtained.
[00218] In order to obtain the deleted mcbR gene, PCR was performed using the
chromosomal DNA of Corynebacterium glutamicum ATCC13032, as a template,
47
and primers of SEQ ID NOS: 64, 65, 66, and 67. The PCR was performed under the following amplification conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds; and polymerization at 72°C for 7 minutes. As a result, DNA fragments of 700 bp were obtained, respectively.
[00219] A pDZ vector (Korean Patent No. 10-0924065) unable to replicate in Corynebacterium glutamicum and the amplified mcbR gene fragments were treated with the restriction enzyme SmaI for introduction into the chromosome and ligated using a DNA ligase. E. Coli DH5α was transformed with the vector and plated on an LB solid medium containing 25 mg/L kanamycin. Colonies transformed with the vector into which a fragment having deletion of the target gene was inserted were selected. Then, a plasmid was obtained by a plasmid
extraction method and named pDZ-▲mcbR.
[00220] Sequences of the primers used in this example are shown in Table 24 below.
[00221] Table 24
SEQ ID NO Primer Sequence (5'->3')
64 TCGAGCTCGGTACCCCTGCCTGGTTTG TCTTGTA
65 CGGAAAATGAAGAAAGTTCGGCCACGT CCTTTCGG
66 AGGACGTGGCCGAACTTTCTTCATTTTC CGAAGGG
67 CTCTAGAGGATCCCCGTTTCGATGCCCA CTGAGCA
[00222] Example 9-2: Preparation of Recombinant Vector in Which metH and cysI Are Simultaneously Enhanced
[00223] In order to prepare a methionine-producing strain, the ATCC13032 strain was used to prepare a vector in which both metH gene (Ncgl1450) encoding methionine synthase and cysI gene (Ncgl2718) encoding sulfite reductase well
48
known in the art were enhanced.
[00224] Specifically, in order to additionally insert the metH and cysI genes into the chromosome of Corynebacterium glutamicum ATCC13032, a recombinant plasmid vector was prepared according to the following method. Based on nucleotide sequences deposited in the U.S. National Institutes of Health (NIH) GenBank, the metH gene and flanking sequences (SEQ ID NO: 92) and the cysI gene and flanking sequences (SEQ ID NO: 93) of Corynebacterium glutamicum were obtained.
[00225] First, a vector for removing the Ncgl1021 (transposase) was prepared to insert these genes. Based on nucleotide sequences deposited in the U.S. National Institutes of Health (NIH) GenBank, Ncgl1021 and flanking sequences (SEQ ID NO: 94) of Corynebacterium glutamicum were obtained. In order to obtain the deleted Ncgl1021 gene, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032, as a template, and primers of SEQ ID NOS: 68, 69, 70, and 71. The PCR was performed under the following amplification conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds; and polymerization at 72°C for 7 minutes. As a result, DNA fragments were obtained. The pDZ vector unable to replicate in Corynebacterium glutamicum (Korean Patent No. 10-0924065) and the amplified Ncgl1021 gene fragments were treated with the restriction enzyme xbaI for introduction into chromosome and cloned by Gibson assembly. E. Coli DH5α was transformed with the vector and plated on a LB solid medium containing 25 mg/L kanamycin. Colonies transformed with the vector into which a fragment having deletion of the target gene was inserted were selected. Then, a plasmid was obtained by a plasmid extraction method and named
pDZ-▲Ncgl1021.
[00226] Subsequently, in order to obtain the metH and cysI genes, PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032, as a template, and primers of SEQ ID NOS: 72, 73, 74, and 75. Additionally, Pcj7 promoter was used to enhance the expression of the metH gene and Pspl1 promoter was used to enhance the expression of the cysI gene.
4 9
For the purpose of obtaining these genes, first, the Pcj7 promoter was obtained by performing PCR using the chromosomal DNA of Corynebacterium ammoniagenes ATCC 6872, as a template, and primers of SEQ ID NOS: 76 and 77, and the Pspl1 promoter was obtained by performing PCR using the DNA of spl1-GFP vector known in the art (Korean Patent No. 10-1783170), as a template, and primers of SEQ ID NOS: 78 and 79. The PCR was performed under the following amplification conditions: denaturation at 95°C for 5 minutes; 30 cycles of denaturation at 95°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 30 seconds; and polymerization at 72°C for 7 minutes. As a result, DNA fragments of the metH gene, the cysI gene, the Pcj7 promoter, and the Pspl1 promoter were obtained.
[00227] After a pDZ-▲Ncgl1021 vector unable to replace in Corynebacterium
glutamicum was treated with the restriction enzyme Scal and the amplified 4 DNA fragments were treated with the restriction enzyme ScaI and cloned by Gibson assembly. E. Coli DH5α was transformed with the vector and plated on an LB solid medium containing 25 mg/L kanamycin. Colonies transformed with the vector into which a fragment having deletion of the target gene was inserted were selected. Then, a plasmid was obtained by a plasmid extraction method
and named pDZ-▲Ncgl1021-Pcj7metH-Pspl1cysI.
[00228] Sequences of the primers used in this example are shown in Table 25 below.
[00229] Table 25
SEQ ID NO Primer Sequence (5'->3')
68 ACCCGGGGATCCTCTAGAATGTTTGTGA TGCGCAG
69 GTCAGAGAGTACTTACGCTGATCGGGAG GGAAAGC
70 ATCAGCGTAAGTACTCTCTGACTAGCGT CACCCTC
71 CTGCAGGTCGACTCTAGAAAAGGGATTG GAGTGTT
5 0
72 CAACGAAAGGAAACAATGTCTACTTCAG TTACTTC
73 TCGAGCTCGGTACCCCTGCGACAGCAT GGAACTC
74 ATCAAAACAGATATCATGACAACAACCA CCGGAAG
75 CGCTAGTCAGAGAGTTCACACCAAATCT TCCTCAG
76 CCGATCAGCGTAAGTAGAAACATCCCAG CGCTACT
77 AACTGAAGTAGACATTGTTTCCTTTCGTT GGGTAC
78 TACTTTAACGTCTAAGGTACCGGCGCTT CATGTCA
79 GGTGGTTGTTGTCATGATATCTGTTTTGA TCTCCT
[00230] Example 9-3: Development of L-methionine-producing Strain and L-methionine Production Using the Strain
[00231] The ATCC13032 strain was transformed with each of the pDC-▲mcBR,
pDZ-▲Ncgl1021, and pDZ-▲Ncgl1021-Pcj7metH-Pspl1cysI vectors prepared
as described above by electroporation via chromosomal homologous recombination (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). Then, second recombination was performed in a solid medium containing sucrose. Upon completion of the second recombination, a transformed Corynebacterium glutamicum strain having deletion of the mcBR gene was identified by performing PCR using primers of SEQ ID NOS: 80 and 81, and a transformed strain having deletion of the Ncgl1021 gene and insertion of the Pcj7-metH-Pspl1cysI gene into the Ncgl1021 site was identified by performing PCR using primers of SEQ ID NOS: 82 and 83. The recombinant strains were each named Corynebacterium glutamicum 13032/ΔmcbR, 13032/ΔNcgl1021,
5 1
and 13032/ΔNcgl1021-Pcj7metH-Pspl1cysI.
[00232] Sequences of the primers used in this example are shown in Table 26
below.
[00233] Table 26
SEQ ID NO Primer Sequence (5'->3')
80 AATCTGGATTTCCGCCAGGT
81 CTTCCTAACTCCTGAGGAAG
82 ATCCCCATCGGCATCTTTAT
83 CGATCACACTGGGCTGATCT
[00234] In order to evaluate the L-methionine-producing ability of the prepared
13032/ΔmcbR, 13032/ΔNcgl1021, and
CJP13032/ΔNcgl1021-Pcj7metH-Pspl1cysI strains, these strains and the parent strain Corynebacterium glutamicum ATCC13032 were cultured according to the following method.
[00235] Each of the Corynebacterium glutamicum strain ATCC13032 and the Corynebacterium glutamicum strains 13032/ΔmcbR, 13032/ΔNcgl1021, and 13032/ΔNcgl1021-Pcj7metH-Pspl1cysI of the present invention was inoculated onto a 250 ml corner-baffle flask containing 25 ml of a seed medium below and cultured while shaking at 30°C for 20 hours at 200 rpm. Then, 1 ml of the seed culture was inoculated onto a 250 ml corner-baffle flask containing 24 ml of a production medium and cultured while shaking at 30°C for 48 hours at 200 rpm. Compositions of the seed medium and the production medium are as follows. [00236]
[00237] 20 g of glucose, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH2PO4, 8 g of K2HPO4, 0.5 g of MgSO4•7H2O, 100 μg of biotin, 1,000 μg of thiamine HCl, 2,000 μg of calcium pantothenate, and 2,000 μg of nicotinamide (based on 1 L of distilled water). [00238]
[00239] 50 g of glucose, 12 g of (NH4)2S2O3, 5 g of yeast extract, 1 g of KH2PO4, 1.2 g of MgSO4•7H2O, 100 μg of biotin, 1,000 μg of thiamine HCl, 2,000 μg of calcium pantothenate, 3,000 μg of nicotinamide, and 30 g of CaCO3 (based on 1
5 2
L of distilled water).
[00240] Concentrations of L-methionine contained in the cultures obtained by
culturing the strains according to the method described above were analyzed
and shown in Table 27 below.
[00241] Table 27
[00242] Evaluation of Prepared Strains
Strain L-methionine (g/L)
Corynebacterium glutamicum ATCC13032 (wild-type) 0.00
13032/ΔmcbR 0.12
13032/ΔNcgl1021 0.00
13032/ΔNcgl1 021 -Pcj7metH-Pspl1 cysI 0.18
[00243] As a result, it was confirmed that the strain in which only the mcbR gene was deleted showed an L-methionine production of 0.12 g/L indicating an increase compared to the control strain. In addition, the strain in which the metH and cysI genes were overexpressed with no deletion of the mcBR showed an L-methionine production of 0.18 g/L indicating an increase compared to the control strain.
[00244] Example 9-4: Preparation of Azotobacter-derived
D-3-phosphoglycerate dehydrogenase (serA(Avn))-overexpressing Vector [00245] An expression vector was prepared in order to identify whether the methionine-producing ability is improved by enhancing the Azotobacter-derived D-3-phosphoglycerate dehydrogenase (hereinafter, referred to as serA(Avn)). [00246] In order to express the serA(Avn) gene (SEQ ID NO: 1) encoding SerA(Avn), a shuttle vector pECCG117 (Biotechnology letters vol 13, No.10, p.721-726 1991 or Korean Patent Publication No. 92-7401) available in transformation of Corynebacterium glutamicum was used. As an expression promoter, a spl1 promoter (hereinafter, Pspl1) was used to prepare a pECCG117-Pspl1-serA(Avn) vector. PCR for the Pspl1 was performed using primers of SEQ ID NOS: 84 and 85 and PCR for the foreign serA(Avn) was performed using primers of SEQ ID NOS: 86 and 87. The amplified Pspl1 and serA(Avn) gene fragments were cloned by Gibson assembly using the
5 3
pECCG117 vector treated with a restriction enzyme EcoRV, thereby preparing
pECCG117-Pspl1-serA(Avn).
[00247] Sequences of the primers used in this example are shown in Table 28
below.
[00248] Table 28
SEQ ID NO Primer Sequence (5'->3')
84 ATCGATAAGCTTGATGGTACCGGCGCTTCATGTCA
85 GGAGGTCTTACTCATGATATCTGTTTTGATCTCCT
86 ATCAAAACAGATATCATGAGTAAGACCTCCCTGGA
87 CTGCAGGAATTCGATTCAGAACAGAACCCGTGAGC
[00249] Example 9-5: Preparation of L-methionine-producing Strain
Introduced with Azotobacter-derived serA(Avn) Using Wild-type Strain E.
Coli and Evaluation of L-methionine-producing Ability
[00250] 13032/ΔmcbR and 13032/ΔNcgl1021-Pcj7metH-Pspl1cysI strains were
transformed with the pECCG117-Pspl1-serA(Avn) vector described above by
electroporation, respectively (van der Rest et al., Appl Microbiol Biotechnol
52:541-545, 1999). The recombinant strains were named Corynebacterium
glutamicum 13032/ΔmcbR (pECCG117-Pspl1-serA(Avn)) and
13032/ΔNcgl1021-Pcj7metH-Pspl1cysI (pECCG117-Pspl1-serA(Avn)),
respectively.
[00251] In order to evaluate the L-methionine-producing ability of the prepared recombinant strains of 13032/ΔmcbR (pECCG117-Pspl1-serA(Avn)) and 13032/ΔNcgl1021-Pcj7metH-Pspl1cysI (pECCG117-Pspl1-serA(Avn)), these strains and parent strains thereof (13032/ΔmcbR and 13032/ΔNcgl1021-Pcj7metH-Pspl1cysI) were cultured according to the following method.
[00252] Each of the Corynebacterium glutamicum ATCC13032 and the prepared strains Corynebacterium glutamicum 13032/ΔmcbR, 13032/ΔNcgl1021, 13032/ΔNcgl1021-Pcj7metH-Pspl1cysI strains according to the present disclosure was inoculated onto a 250 ml corner-baffle flask containing 25 ml of a
5 4
seed medium below and cultured while shaking at 30°C for 20 hours at 200 rpm. Then, 1 ml of the seed culture was inoculated onto a 250 ml corner-baffle flask containing 24 ml of a production medium and cultured while shaking at 30°C for 48 hours at 200 rpm. In particular, the strains in which the vector was included were cultured after additionally adding kanamycin (25 mg/l) thereto. Compositions of the seed medium and the production medium are as follows. [00253]
[00254] 20 g of glucose, 10 g of peptone, 5 g of yeast extract, 1.5 g of urea, 4 g of KH2PO4, 8 g of K2HPO4, 0.5 g of MgSO4•7H2O, 100 μg of biotin, 1,000 μg of thiamine HCl, 2,000 μg of calcium pantothenate, and 2,000 μg of nicotinamide (based on 1 L of distilled water). [00255]
[00256] 50 g of glucose, 12 g of (NH4)2S2O3, 5 g of yeast extract, 1 g of KH2PO4, 1.2 g of MgSO4•7H2O, 100 μg of biotin, 1,000 μg of thiamine HCl, 2,000 μg of calcium pantothenate, 3,000 μg of nicotinamide, and 30 g of CaCO3 (based on 1 L of distilled water).
[00257] Concentrations of the L-methionine contained in the culture obtained by culturing the strains according to the method described above were analyzed and shown in Table 29 below. [00258] Table 29
[00259] Evaluation of Prepared Strains
Strain L-methionine (g/L)
13032/ΔmcbR 0.12
13032/ΔNcgl1 021 -Pcj7metH-Pspl1 cysI 0.18
13032/ΔmcbR (pECCG117-Pspl1 -serA(Avn)) 0.22
13032/ΔNcgl1021-Pcj7metH-Pspl1cysI (pECCG117-Pspl1-serA(Avn)) 0.32
[00260] As a result, it was confirmed that both strains transformed with the pECCG117-Pspl1-serA(Avn) showed an increase in L-methionine production compared to the control strain. In addition, the 13032/ΔmcbR (pECCG117-Pspl1-serA(Avn)) strain showed an increase in L-methionine
5 5
production by 83% compared with the control strain and the 13032/ΔNcgl1021-Pcj7metH-Pspl1cysI pECCG117-Pspl1-serA(Avn)) strain showed an increase in L-methionine production by 78% compared with the control strain. Thus, according to this example, it was confirmed that the L-methionine-producing ability of microorganisms was improved by introducing the Azotobacter-derived serA(Avn) thereinto.
[00261] The 13032/ΔmcbR strain was named CM02-0618 and deposited at the Korean Culture Center of Microorganisms (KCCM) under the Budapest Treaty and designated Accession No. of KCCM12425P on January 4, 2019. In addition, the 13032/ΔmcbR (pECCG117-Pspl1-serA(Avn)) strain was named CM02-0693 and deposited at the Korean Culture Center of Microorganisms (KCCM) under the Budapest Treaty and designated Accession No. of KCCM12413P on November 27, 2018.
[00262] While the present disclosure has been described with reference to the particular illustrative embodiments, it will be understood by those skilled in the art to which the present disclosure pertains that the present disclosure may be embodied in other specific forms without departing from the technical spirit or essential characteristics of the present disclosure. Therefore, the embodiments described above are considered to be illustrative in all respects and not restrictive. Furthermore, the scope of the present disclosure should be defined by the appended claims rather than the detailed description, and it should be understood that all modifications or variations derived from the meanings and scope of the present disclosure and equivalents thereof are included in the scope of the present disclosure.
WE CLAIM:
1.A microorganism producing an L-amino acid or a precursor thereof,
wherein the microorganism is modified to express a protein comprising an amino
acid sequence of SEQ ID NO: 1.
2. The microorganism of claim 1, wherein the protein is derived from Azotobacter vinelandii.
3. The microorganism of claim 1, wherein the microorganism further has i) weakened phosphoserine phosphatase activity, ii) enhanced 3-phosphoserine aminotransferase activity, or iii) both weakened phosphoserine phosphatase activity and enhanced 3-phosphoserine aminotransferase activity.
4. The microorganism of claim 1, wherein the microorganism is further modified by enhancement of trp operon, inactivation of tryptophanase (TnaA), inactivation of Mtr membrane protein (Mtr), or any combination thereof.
5. The microorganism of claim 1, wherein the microorganism further has enhanced his operon.
6. The microorganism of claim 1, wherein the microorganism is further modified by inactivation of McbR (transcriptional regulator; mcbR), enhancement of methionine synthase (meth), enhancement of sulfite reductase [NADPH] hemoprotein beta-component (cysI), or any combination thereof.
7. The microorganism of claim 1, wherein the microorganism belongs to the genus Corynebacterium or the genus Escherichia.
8. The microorganism of claim 7, wherein the microorganism is Corynebacterium glutamicum or Escherichia coli.
63
9. The microorganism of claim 1, wherein the L-amino acid or the precursor thereof is selected from the group consisting of L-serine, L-tryptophan, L-histidine, L-methionine, L-cysteine, O-succinylhomoserine, O-acetylhomoserine, L-homoserine, acetylserine, L-cystathionine, L-homocysteine, and O-phosphoserine.
10. A method of producing an L-amino acid or a precursor thereof, the method comprising culturing the microorganism according to any one of claims 1 to 9 in a medium.
11. The method of claim 10, further comprising recovering an L-amino acid or a precursor thereof from the cultured microorganism or the culture medium.
12. The method of claim 10, wherein the L-amino acid or the precursor thereof is selected from the group consisting of serine, tryptophan, histidine, methionine, L-cysteine, O-succinylhomoserine, O-acetylhomoserine, L-homoserine, acetylserine, L-cystathionine, L-homocysteine, and O-phosphoserine.
13. Use of a protein comprising an amino acid sequence of SEQ ID NO: 1 for increasing production of an L-amino acid or a precursor thereof.
14. A composition for producing an L-amino acid or a precursor thereof,
wherein the composition comprises a microorganism, which is modified to
express a protein comprising an amino acid sequence of SEQ ID NO: 1, or the
protein.
6 4
15. A method of producing an L-amino acid or a precursor thereof using the composition of claim 14.
| # | Name | Date |
|---|---|---|
| 1 | 202117045280-FORM 3 [31-03-2022(online)].pdf | 2022-03-31 |
| 1 | 202117045280-STATEMENT OF UNDERTAKING (FORM 3) [05-10-2021(online)].pdf | 2021-10-05 |
| 2 | 202117045280.pdf | 2021-10-22 |
| 2 | 202117045280-SEQUENCE LISTING(PDF) [05-10-2021(online)].pdf | 2021-10-05 |
| 3 | 202117045280-SEQUENCE LISTING [05-10-2021(online)].txt | 2021-10-05 |
| 3 | 202117045280-certified copy of translation [09-10-2021(online)].pdf | 2021-10-09 |
| 4 | 202117045280-FORM-26 [09-10-2021(online)].pdf | 2021-10-09 |
| 4 | 202117045280-REQUEST FOR EXAMINATION (FORM-18) [05-10-2021(online)].pdf | 2021-10-05 |
| 5 | 202117045280-Proof of Right [09-10-2021(online)].pdf | 2021-10-09 |
| 5 | 202117045280-FORM 18 [05-10-2021(online)].pdf | 2021-10-05 |
| 6 | 202117045280-FORM 1 [05-10-2021(online)].pdf | 2021-10-05 |
| 6 | 202117045280-COMPLETE SPECIFICATION [05-10-2021(online)].pdf | 2021-10-05 |
| 7 | 202117045280-DECLARATION OF INVENTORSHIP (FORM 5) [05-10-2021(online)].pdf | 2021-10-05 |
| 8 | 202117045280-FORM 1 [05-10-2021(online)].pdf | 2021-10-05 |
| 8 | 202117045280-COMPLETE SPECIFICATION [05-10-2021(online)].pdf | 2021-10-05 |
| 9 | 202117045280-Proof of Right [09-10-2021(online)].pdf | 2021-10-09 |
| 9 | 202117045280-FORM 18 [05-10-2021(online)].pdf | 2021-10-05 |
| 10 | 202117045280-FORM-26 [09-10-2021(online)].pdf | 2021-10-09 |
| 10 | 202117045280-REQUEST FOR EXAMINATION (FORM-18) [05-10-2021(online)].pdf | 2021-10-05 |
| 11 | 202117045280-certified copy of translation [09-10-2021(online)].pdf | 2021-10-09 |
| 11 | 202117045280-SEQUENCE LISTING [05-10-2021(online)].txt | 2021-10-05 |
| 12 | 202117045280.pdf | 2021-10-22 |
| 12 | 202117045280-SEQUENCE LISTING(PDF) [05-10-2021(online)].pdf | 2021-10-05 |
| 13 | 202117045280-STATEMENT OF UNDERTAKING (FORM 3) [05-10-2021(online)].pdf | 2021-10-05 |
| 13 | 202117045280-FORM 3 [31-03-2022(online)].pdf | 2022-03-31 |