Title of the invention: variant homoserine dehydrogenase and method for producing homoserine or homoserine-derived L-amino acid using the same
Technical field
[One]
The present application relates to a variant homoserine dehydrogenase, and specifically, a variant homoserine dehydrogenase having a polypeptide including one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity. As a zero, the amino acid substitution is a variant homoserine dehydrogenase including a 285th amino acid substitution with isoleucine, a 398th amino acid substitution with glutamine, or a combination thereof, and homoserine or homoserine using the same A method for producing derived L-amino acid, a composition for producing homoserine or homoserine derived L-amino acid, a method for increasing the production capacity of homoserine or homoserine-derived L-amino acid, or the use of the variant homoserine dehydrogenase will be.
[2]
Background
[3]
Among L-amino acids, L-threonine, L-isoleucine, and L-methionine are homoserine dehydrogenase (hereinafter Hom, EC: 1.1.1.3) from aspartate-semialdehyde (ASA). Homoserine produced by) is commonly used. Therefore, in order to produce the amino acids by fermentation, it is essential to maintain the activity of enzymes used in the biosynthetic pathway above a certain level, and intensive research has been conducted on this.
[4]
In particular, homoserine dehydrogenase acting at the branch point of the biosynthetic pathway of L-lysine and L-threonine is known to be regulated by L-threonine and L-isoleucine. There have been several reports in the past regarding Hom desensitized to feedback inhibition by L-threonine and a method for producing L-threonine using the same. In 1991, Eikmann et al . of Germany reported Hom desensitized by conversion of glycine, which is the 378th amino acid residue of Hom, to glutamate (Eikmanns BJ et al ., Appl. Microbial Biotechnol. 34: 617-622, 1991), 1991 Archer et al . of the United States reported that when the C-terminus of Hom is damaged due to a frame shift mutation, it exhibits desensitization properties (Archer JA et al ., Gene 107: 53-59, 1991).
[5]
Detailed description of the invention
Technical challenge
[6]
The present inventors isolated a new gene encoding a mutant Hom while conducting a study on desensitization of feedback inhibition by threonine, and confirmed that the ability to produce L-amino acids in a microorganism transduced with the new gene is improved. Completed.
[7]
Means of solving the task
[8]
One object of the present application is a variant homoserine dehydrogenase having a polypeptide comprising one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity, wherein the amino acid substitution is the 285th amino acid Or it is to provide a variant homoserine dehydrogenase, including those in which the 398th amino acid is substituted with another amino acid or a combination thereof.
[9]
Another object of the present application is to provide a polynucleotide encoding the variant dehydrogenase.
[10]
Another object of the present application is to provide a microorganism of the genus Corynebacterium, including the mutant homoserine dehydrogenase.
[11]
Another object of the present application is the step of culturing the microorganism in a medium; It is to provide a method for producing homoserine or homoserine-derived L-amino acid, comprising the step of recovering homoserine or homoserine-derived L-amino acid from the microorganism or medium.
[12]
Another object of the present application is to provide a composition for producing homoserine or homoserine-derived L-amino acid, comprising a microorganism containing the mutant homoserine dehydrogenase or the mutant homoserine dehydrogenase of the present application. To provide.
[13]
Another object of the present application is to provide a method for increasing the production capacity of homoserine or homoserine-derived L-amino acid, comprising the step of expressing the mutant homoserine dehydrogenase of the present application in a microorganism of the genus Corynebacterium Is to do.
[14]
Another object of the present application is to provide the use of the variant homoserine dehydrogenase for the production of homoserine or homoserine-derived L-amino acid of the present application.
[15]
Another object of the present application is to provide the use of the polynucleotide for the production of homoserine or homoserine-derived L-amino acid of the present application.
[16]
Another object of the present application is to provide a use of the microorganism of the genus Corynebacterium for the production of homoserine or homoserine-derived L-amino acid of the present application.
[17]
Another object of the present application is to provide the use of the composition for the production of homoserine or homoserine-derived L-amino acid of the present application.
[18]
Effects of the Invention
[19]
The mutant homoserine dehydrogenase of the present application is desensitized to suppress feedback by the final product compared to the natural or wild type, and thus it may be widely used for mass production of more efficient homoserine or homoserine-derived L-amino acids.
[20]
Best mode for carrying out the invention
[21]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be considered that the scope of the present application is limited by the specific description described below.
[22]
[23]
One aspect of the present application for achieving the above object is a variant homoserine dehydrogenase having a polypeptide comprising one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity, the amino acid Substitution provides a variant homoserine dehydrogenase, including those in which the 285th amino acid or the 398th amino acid is substituted with another amino acid or a combination thereof.
[24]
Specifically, as a variant homoserine dehydrogenase having a polypeptide containing one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity, the amino acid substitution is the 285th amino acid substitution with isoleucine or It provides a homoserine dehydrogenase variant, including those in which the 398th amino acid is substituted with glutamine or a combination thereof. More specifically, a variant homoserine dehydrogenase in which the 285th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with isoleucine, the 398th amino acid is substituted with glutamine, or a combination thereof is provided.
[25]
In the present application, homoserine dehydrogenase (EC: 1.1.1.3) refers to an enzyme that catalyzes the synthesis of homoserine, a common intermediate for biosynthesis of methionine, threonine, and isoleucine in plants and microorganisms, Also called homoserine dehydrogenase. In the present application, homoserine dehydrogenase may be included, regardless of origin, as long as it is a protein having the above conversion activity, and enzymes derived from any organism (plants and microorganisms, etc.) may be used. Specifically, the D-homoserine dehydrogenase may be a genus Corynebacterium microorganism-derived, more specifically, Corynebacterium glutamicum ( corynebacterium glutamicum may be) derived. For example, it may be a protein comprising the amino acid sequence of SEQ ID NO: 1. The protein comprising the amino acid sequence of SEQ ID NO: 1 may be used interchangeably with a protein having the amino acid sequence of SEQ ID NO: 1 or a protein consisting of the amino acid sequence of SEQ ID NO: 1.
[26]
In the present application, various methods well known in the art can be applied as a method of securing homoserine dehydrogenase. Examples of the method include gene synthesis technology including codon optimization to ensure high-efficiency protein in Corynebacterium microorganisms, which are commonly used for protein expression, and bioinformatics methods based on large-scale genome information of microorganisms. Therefore, it can be secured through a screening method for useful enzyme resources, but is not limited thereto.
[27]
The protein having the activity of homoserine dehydrogenase in the present application is the amino acid sequence of the protein having the activity of homoserine dehydrogenase, for example, the amino acid sequence of SEQ ID NO: 1, the addition of meaningless sequences before and after the amino acid sequence or natural It does not exclude mutations that may occur as a result, or silent mutations thereof. Corresponds to a protein with antagonistic activity For example, the protein having the activity of homoserine dehydrogenase of the present application is a protein consisting of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80%, 90%, 95%, or 97% or more homology thereto. Can be
[28]
In addition, even if it is described in the present application as'a protein or polypeptide comprising an amino acid sequence described with a specific sequence number', if it is an amino acid sequence that has such homology and exhibits efficacy corresponding to the protein, some sequences are deleted, modified, It is obvious that proteins having substituted or added amino acid sequences are also included within the scope of the present application. For example, a protein having the activity of homoserine dehydrogenase in the present application is Corynebacterium glutamicum ( corynebacterium glutamicum ) can homoserine dehydrogenase derived from the best. More specifically, the amino acid sequence of homoserine dehydrogenase derived from Corynebacterium glutamicum ATCC13032 (SEQ ID NO: 1), the amino acid sequence of homoserine dehydrogenase derived from Corynebacterium glutamicum ATCC14067 ( SEQ ID NO: 49), or the amino acid sequence of homoserine dehydrogenase derived from Corynebacterium glutamicum ATCC13869 (SEQ ID NO: 50). Homoserine dehydrogenase having the above sequence shows 80%, 90%, 95%, or 97% or more homology to each other, and shows corresponding efficacy as homoserine dehydrogenase. It is obvious that it is included in the protein having the activity of genase.
[29]
[30]
The "homology" refers to the percent of identity between two polynucleotide or polypeptide moieties. It means the degree to which it matches a given amino acid sequence or nucleotide sequence, and can be expressed as a percentage. In the present specification, a homologous sequence thereof having the same or similar activity as a given amino acid sequence or base sequence is expressed as "% homology". Homology between sequences from one moiety to another moiety can be determined by known art. For example, using standard software that calculates parameters such as score, identity and similarity, specifically BLAST 2.0, or by using hybridization experiments under defined stringent conditions. It can be confirmed by comparing, and the appropriate hybridization conditions defined are within the scope of the technology, and methods well known to those skilled in the art (eg, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[31]
[32]
In the present application, the term "variant", "variant" or "variant" refers to a culture or individual that exhibits a stable phenotypic change genetically or non-genetically. Specifically, at least one amino acid is mutated on the amino acid sequence corresponding to the protein having the activity of homoserine dehydrogenase, and its activity is efficiently increased compared to the wild type, natural type or non-variant type, or isoleucine, threonine, These analogs or derivatives may refer to mutants in which feedback inhibition is released or both activity increases and feedback inhibition is released.
[33]
In the present application, a variant homoserine dehydrogenase may be used interchangeably as a "mutated homoserine dehydrogenase" or a "homoserine dehydrogenase variant". On the other hand, these variants may be non-naturally occurring.
[34]
The variant homoserine dehydrogenase of the present application is specifically, a variant protein having a polypeptide including one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity, and the amino acid substitution is 285 It may be a variant homoserine dehydrogenase including those in which the th amino acid is substituted with isoleucine, the 398 th amino acid is substituted with glutamine, or a combination thereof. The amino acid sequence of the protein having the activity of homoserine dehydrogenase is as described above, and may be, for example, the amino acid sequence of SEQ ID NO: 1. In addition, the 285th amino acid may be threonine substituted with isoleucine, and the 398th amino acid may be arginine substituted with glutamine.
[35]
In addition, the variant homoserine dehydrogenase of the present application is a variant protein having a polypeptide including one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity, wherein the amino acid substitution is at 378th amino acid It may be a variant homoserine dehydrogenase including those substituted with tryptophan. In addition, as a variant protein having a polypeptide containing one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity, the amino acid substitution is the 285th amino acid substitution with isoleucine or the 398th amino acid glutamine. In the variant homoserine dehydrogenase substituted or substituted with a combination thereof, the 378th amino acid may be additionally substituted with tryptophan. More specifically, the 378 th amino acid may be glycine substituted with tryptophan.
[36]
More specifically, the variant homoserine dehydrogenase of the present application is a variant protein having a polypeptide including one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, and the amino acid substitution is the 285th amino acid to isoleucine. It may be a substituted one, a variant homoserine dehydrogenase, including those in which the 398th amino acid is substituted with glutamine, or a combination thereof. For example, the variant homoserine dehydrogenase of the present application may be a protein including the amino acid sequence of SEQ ID NO: 10, 11, 12 or 13. In addition, insignificant sequence additions before and after the sequence, or mutations that may occur naturally or silent mutations thereof are not excluded, and have the same or corresponding activity as the mutant homoserine dehydrogenase Ramen corresponds to a protein having the activity of the mutant homoserine dehydrogenase of the present application. For a specific example, the variant homoserine dehydrogenase herein is the amino acid sequence of SEQ ID NO: 10, 11, 12, or 13 or an amino acid sequence having at least 80%, 90%, 95%, or 97% homology thereto. It may be a composed protein. In addition, even if it is described in the present application as'a protein or polypeptide having an amino acid sequence described with a specific sequence number', if an amino acid sequence that has such homology and exhibits an efficacy corresponding to the protein, some sequences are deleted, modified, or substituted. Or it is obvious that proteins having an added amino acid sequence are also included within the scope of the present application.
[37]
In addition, the mutant homoserine dehydrogenase of the present application is a mutant homoserine dehydrogenase having a polypeptide including one or more amino acid substitutions in the amino acid sequence of a protein having homoserine dehydrogenase activity. It is obvious that a protein containing an amino acid or a mutation in which the 398th amino acid is substituted with another amino acid and exhibiting corresponding efficacy as homoserine dehydrogenase is also included within the scope of the present application.
[38]
[39]
In addition, the variant homoserine dehydrogenase of the present application is different from the wild-type or natural-type protein or unmodified protein having the activity of homoserine dehydrogenase, the final products of isoleucine, threonine, methionine, homoserine Alternatively, the feedback inhibition by their derivatives or analogs may be released or may have desensitized characteristics. In the present application, the term "feedback inhibition" refers to an end product of metabolism inhibiting a reaction at a previous stage. Therefore, when the feedback inhibition of homoserine dehydrogenase is released or desensitized, the productivity of homoserine and homoserine-derived L-amino acids of microorganisms can be increased compared to the case where they are not.
[40]
The homoserine-derived L-amino acid refers to an L-amino acid that can be biosynthesized using L-homoserine as a precursor, and is not limited as long as it is a material that can be biosynthesized from L-homoserine. The homoserine-derived L-amino acid may include not only homoserine-derived L-amino acids, but also derivatives thereof. For example L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine, O-phospho-L-homoserine, L-methionine and/or L- It may be glycine, but is not limited thereto. More specifically, it may be L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine and/or L-methionine, but is not limited thereto.
[41]
Another aspect of the present application provides a polynucleotide encoding the variant homoserine dehydrogenase.
[42]
The homoserine dehydrogenase and variant are as described above.
[43]
In the present application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide units are connected in a long chain by covalent bonds, and is a DNA or RNA strand having a certain length or more, and more specifically, the variant homoserine It refers to a polynucleotide fragment encoding a dehydrogenase. The polynucleotide encoding the mutant protein of the present application may be included without limitation as long as it is a polynucleotide sequence encoding the mutant protein having homoserine dehydrogenase activity of the present application.
[44]
In the present application, the polynucleotide encoding the amino acid sequence of the homoserine dehydrogenase variant may be specifically derived from a microorganism of the genus Corynebacterium, and more specifically may be derived from Corynebacterium glutamicum. However, it is not limited thereto.
[45]
In addition, the polynucleotide encoding the protein is in the coding region within a range that does not change the amino acid sequence of the protein due to the degeneracy of the codon or in consideration of the preferred codon in the organism to express the protein. Various modifications can be made. Specifically, it may be a polynucleotide comprising a polynucleotide sequence encoding the protein or a polynucleotide sequence having at least 80%, 90%, 95%, or 97% homology thereto. In addition, if a polynucleotide sequence encoding a protein having such homology and exhibiting substantially the same or corresponding efficacy as the protein, a polynucleotide sequence in which some sequences are deleted, modified, substituted or added are also included within the scope of the present application. It is self-evident. The polynucleotide encoding the protein having homoserine dehydrogenase activity of the present application may be a polynucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1. For example, it may be the polynucleotide sequence of SEQ ID NO: 48, but is not limited thereto. In addition, the polynucleotide encoding the mutant homoserine dehydrogenase of the present application may be a polynucleotide sequence encoding a polypeptide including one or more amino acid substitutions in the amino acid sequence of SEQ ID NO: 1, specifically SEQ ID NO: 10 , 11, 12 or 13 may be a polynucleotide sequence encoding. For example, it may be a polynucleotide sequence of SEQ ID NOs: 6, 7, 8, and 9, but is not limited thereto.
[46]
Or a probe that can be prepared from a known gene sequence, for example, by hydride under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence, the activity of the mutant homoserine dehydrogenase of the present application Any sequence encoding a protein having a may be included without limitation. The "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, among genes with high homology, genes with homology of 80% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, and particularly 99% or more Under conditions that hybridize to each other, and do not hybridize to genes with lower homology, or to wash conditions for general Southern hybridization, 60°C, 1xSSC, 0.1% SDS, specifically 60°C, 0.1xSSC, 0.1% SDS, More specifically, the conditions of washing once, specifically, two to three times at a salt concentration and temperature corresponding to 68° C., 0.1xSSC, and 0.1% SDS can be listed. Hybridization requires that two polynucleotides have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between bases of nucleotides capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. therefore, The present application may also include substantially similar nucleotide sequences as well as isolated nucleotide fragments that are complementary to the entire sequence. Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose. The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[47]
[48]
Another aspect of the present application provides a microorganism comprising a variant homoserine dehydrogenase. Specifically, it is to provide a microorganism of the genus of Corynebacterium that produces homoserine or homoserine-derived L-amino acid, including the mutant homoserine dehydrogenase . It is also to provide a microorganism of the genus of Corynebacterium that produces L-alanine, including the mutant homoserine dehydrogenase . However, it is not limited thereto.
[49]
The homoserine dehydrogenase and variant are as described above.
[50]
Specifically, the microorganism containing the mutant homoserine dehydrogenase of the present application is a microorganism naturally capable of producing homoserine or homoserine-derived L-amino acid, or a parent without the ability to produce homoserine or homoserine-derived L-amino acid. It refers to a microorganism that has been given the ability to produce homoserine or homoserine-derived L-amino acid. Specifically, the microorganism containing the homoserine dehydrogenase is a variant homoserine di, in which the 285th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with isoleucine, the 398th amino acid is substituted with glutamine, or a combination thereof. It may be a microorganism expressing a hydrogenase, but is not limited thereto. The microorganism is transformed with a vector containing a polynucleotide encoding the mutant homoserine dehydrogenase or transformed with a vector containing the polynucleotide encoding the mutant homoserine dehydrogenase to express the mutant polypeptide. As a possible cell or microorganism, for the purpose of the present application, the host cell or microorganism may be any microorganism capable of producing homoserine or homoserine-derived L-amino acid including the variant polypeptide.
[51]
The microorganism containing the mutant homoserine dehydrogenase of the present application is homoserine, homoserine-derived L-amino acid or L-alanine compared to the microorganism containing the protein having the activity of wild-type or unmodified homoserine dehydrogenase. Since the production ability of is improved, homoserine, homoserine-derived L-amino acid or L-alanine can be obtained in high yield from these microorganisms.
[52]
In the present application, the type of microorganism containing the mutant homoserine dehydrogenase is not particularly limited, but Enterbacter genus, Escherichia genus, Erwinia genus, Serratia ( Serratia ) genus, Pseudomonas ( Pseudomonas ) genus, Providencia ( Providencia ) genus, Corynebacterium ( Corynebacterium ) genus and Brevibacterium ( Brevibacterium ) may be a microorganism belonging to the genus. More specifically , it may be a microorganism belonging to the genus Corynebacterium .
[53]
In the present application, the "microorganisms of the genus Corynebacterium" specifically refers to Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum , Brevibacterium flabum ( Brevibacterium flavu m), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Corynebacterium epi syeonseu ( Corynebacterium efficiens or the like), it is not limited thereto. More specifically, in the present application, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum .
[54]
Meanwhile, the microorganism containing the mutant homoserine dehydrogenase may be a microorganism into which a vector including a polynucleotide encoding a homoserine dehydrogenase mutant has been introduced. Specifically, the introduction may be performed by transformation, but is not limited thereto.
[55]
The term "vector" as used in the present application refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the protein of interest operably linked to a suitable control sequence so that the protein of interest can be expressed in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. Vectors can be transformed into a suitable host cell and then replicated or function independently of the host genome and can be integrated into the genome itself.
[56]
The vector used in the present application is not particularly limited as long as it can be replicated in the host cell, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used. Specifically, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like may be used, but are not limited thereto.
[57]
The vector usable in the present application is not particularly limited, and a known expression vector may be used. In addition, a polynucleotide encoding a target protein may be inserted into a chromosome through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming whether the chromosome is inserted may be additionally included. Selectable markers are used to select cells transformed with a vector, that is, to confirm the insertion of a desired polynucleotide molecule, and select a selectable phenotype such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface proteins. Markers to give can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
[58]
In the present application, the term "transformation" means introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Transformed polynucleotides may include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression. The expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto. The transformation method includes any method of introducing a polynucleotide into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (Ca(H 2PO 4 ) 2 , CaHPO 4 , or Ca 3 (PO 4 ) 2 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method, and the like, but is not limited thereto.
[59]
In addition, the term "operably linked" in the above means that a promoter sequence for initiating and mediating transcription of a polynucleotide encoding a protein of interest of the present application and the polynucleotide sequence are functionally linked. The operable linkage may be prepared using a gene recombination technique known in the art, and site-specific DNA cleavage and linkage may be prepared using a cleavage and linkage enzyme in the art, but is not limited thereto.
[60]
The microorganism containing the mutant homoserine dehydrogenase may be transformed to include the mutant homoserine dehydrogenase in the microorganism of the genus Corynebacterium. The microorganism of the genus Corynebacterium is exemplarily a strain having resistance to 2-amino-3-hydroxy-valerate (AHV); In order to resolve the feedback inhibition of aspartate kinase (lysC), which acts as the first important enzyme in the threonine biosynthesis pathway, leucine, amino acid 377 of lysC, is substituted with lysine, and L-threo Strains that produce nin; In the strain producing L-threonine, L-threonine dehydratase (L-threonine dehydratase, the first enzyme in the isoleucine biosynthetic pathway) is substituted for the 323th amino acid of ilvA with alanine. Strains producing isoleucine ( Appl. Enviro. Microbiol. , Dec. 1996, p . 4345-4351); O-acetylhomoserine (thiol)-lyase and cystathionine gamma-synthase proteins of the O-acetyl-homoserine decomposition pathway are inactivated. Strains that produce serine; Alternatively, a strain in which methionine cysteine ​​transcriptional regulator protein is inactivated to produce methionine may be included, but is not limited thereto.
[61]
[62]
Another aspect of the present application is a homoserine or homoserine derived L-amino acid comprising the step of culturing the described microorganism in a medium and recovering homoserine or homoserine-derived L-amino acid from the microorganism or medium. Provides a method of production.
[63]
As described above, the microorganism may be a microorganism of the genus Corynebacterium including the homoserine dehydrogenase variant of the present application, and more specifically, may be Corynebacterium glutamicum. In addition, the microorganism of the genus Corynebacterium or Corynebacterium glutamicum may be a microorganism that produces homoserine or homoserine-derived L-amino acid. The homoserine-derived L-amino acid may include not only homoserine-derived L-amino acids, but also derivatives thereof. For example L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine, O-phospho-L-homoserine, L-methionine and/or L- It may be glycine, but is not limited thereto. More specifically, it may be L-threonine, L-isoleucine, O-acetyl-L-homoserine, O-succinyl-L-homoserine and/or L-methionine, but is not limited thereto. In addition, the microorganisms of the genus Corynebacterium or Corynebacterium glutamicum may be microorganisms that produce L-alanine.
[64]
The homoserine or homoserine-derived L-amino acid may be a homoserine or homoserine-derived L-amino acid culture solution produced by the microorganism described in the present application, a supernatant of a culture, a processed product thereof, or a purified form thereof. In addition, it is apparent to those skilled in the art that not only the form itself, but also the salt form thereof.
[65]
The method for producing the homoserine or homoserine-derived L-amino acid can be easily determined by a person skilled in the art under optimized culture conditions and enzyme activity conditions known in the art.
[66]
In the above method, the step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like. At this time, the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used to provide an appropriate pH (eg, pH 5 to 9, specifically Is capable of adjusting pH 6 to 8, most specifically pH 6.8), and maintaining aerobic conditions by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20°C to 45°C, specifically 25°C to 40°C, and may be cultured for about 10 to 160 hours, but is not limited thereto. Threonine, isoleucine, or acetylhomoserine produced by the culture may be secreted into a medium or remain in cells.
[67]
In addition, the culture medium used is a carbon source such as sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molase, starch and cellulose), fats and fats (e.g., soybean oil, sunflower seeds). Oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid, and linoleic acid), alcohols (such as glycerol and ethanol), and organic acids (such as acetic acid) can be used individually or in combination. , Is not limited thereto. Nitrogen sources include nitrogen-containing organic compounds (e.g. peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea), or inorganic compounds (e.g. ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and Ammonium nitrate) or the like may be used individually or in combination, but is not limited thereto. Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a sodium-containing salt corresponding thereto may be used individually or in combination as a source of phosphorus, but are not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins.
[68]
The method of recovering homoserine or homoserine-derived L-amino acid produced in the culturing step of the present application may obtain a desired product from the culture medium using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, and the like may be used, and homoserine or homoserine-derived L-amino acid, which is a target substance, can be obtained from a medium or microorganism using a suitable method known in the art. Can be recovered. In addition, the recovery step may include an additional purification process, and may be performed using a suitable method known in the art. An additional process for increasing the recovery rate of the desired product may be inserted before and after the culturing step or the recovery step.
[69]
As another aspect of the present application, a composition for producing homoserine or homoserine-derived L-amino acid comprising a microorganism containing the mutant homoserine dehydrogenase or the mutant homoserine dehydrogenase to provide.
[70]
The composition for producing homoserine or homoserine-derived L-amino acid is a variant homoserine in which the 285th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with isoleucine, the 398th amino acid is substituted with glutamine, or a combination thereof It refers to a composition capable of producing homoserine or homoserine-derived L-amino acid, including dehydrogenase, a polynucleotide encoding the same, or a microorganism comprising the same. As an example, the polynucleotide may further include, without limitation, a construct capable of operating the polynucleotide, for example, contained in a vector to express a gene operably linked in the introduced host cell. It can be a form.
[71]
In addition, the composition may further include any suitable excipient commonly used in a composition for producing homoserine or homoserine-derived L-amino acid. Such excipients may be, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffering agent, a stabilizer, or an isotonic agent, but are not limited thereto.
[72]
[73]
As another aspect of the present application, the 285th amino acid in the amino acid sequence of SEQ ID NO: 1 having homoserine dehydrogenase activity is substituted with isoleucine, the 398th amino acid is substituted with glutamine, or a combination thereof It provides a method for increasing the production capacity of a microbial homoserine or homoserine-derived L-amino acid comprising the step.
[74]
The terms "homoserine dehydrogenase", and "homoserine or homoserine derived L-amino acid" are as described above.
[75]
[76]
In another aspect of the present application, there is provided a use of the variant homoserine dehydrogenase for the production of homoserine or homoserine-derived L-amino acid.
[77]
As another aspect of the present application, there is provided a use of a polynucleotide encoding the mutant homoserine dehydrogenase for the production of homoserine or homoserine-derived L-amino acid.
[78]
As yet another aspect of the present application, there is provided a use of a microorganism of the genus Corynebacterium, including the variant homoserine dehydrogenase, for the production of homoserine or homoserine-derived L-amino acid.
[79]
As another aspect of the present application, it is to provide a use of a composition for homoserine or homoserine-derived L-amino acid for the production of homoserine or homoserine-derived L-amino acid.
[80]
Mode for carrying out the invention
[81]
Hereinafter, the configuration and effects of the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.
[82]
[83]
Example 1: Screening for AHV-resistant microorganisms through artificial mutation method
[84]
[85]
In this embodiment, the L-threonase of homoserine dehydrogenase (hereinafter, Hom, EC: 1.1.1.3) using Corynebacterium glutamicum KFCC10881 (Korea Patent Registration No. 0159812) as the parent strain is used as the parent strain. In order to release the feedback inhibition by nin, an experiment was conducted to confer resistance to 2-amino-3-hydroxy-valerate (hereinafter, AHV), which is an L-threonine analog.
[86]
Mutation was induced by an artificial mutation method using N-methyl-N'-nitro-N-nitrosoguanidine (N-methyl-N'-nitro-N-nitrosoguanidine: hereinafter, NTG). KFCC10881 strain cultured for 18 hours in the seed medium was inoculated into 4 ml of the seed medium, and then cultured until the OD 660 reached about 1.0. The culture medium was centrifuged to recover the cells, washed twice with 50 mM Tris-malate buffer (pH6.5), and suspended in the final 4 ml of the same buffer solution. NTG solution (2 mg/ml in 0.05M Tris-malate buffer (pH6.5)) was added to the cell suspension and allowed to stand for 20 minutes at room temperature, and then the cells were centrifuged. It was collected, and washed twice with the same buffer solution to remove NTG. Finally, the washed cells were suspended in 4 ml of a 20% glycerol solution and stored at -70°C until use. The NTG-treated strain was plated on a minimal medium containing 3 g/l of AHV, and 155 AHV-resistant KFCC10881 strains were obtained through the above process.
[87]
[88]
Seed medium (pH 7.0)
[89]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium- Pantothenic acid 2000 ㎍, nicotinamide 2000 ㎍ (based on 1 liter of distilled water)
[90]
[91]
Minimum medium (pH 7.2)
[92]
Glucose 5 g, KH 2 PO 4 1 g, (NH 4 ) 2 SO 4 5 g, MgSO 4 7H 2 O 0.4 g, NaCl 0.5 g Biotin 200 μg, Thiamine HCl 100 μg, calcium-pantothenic acid 100 μg, nicotinamide 0.03 g, 2 g of urea, Na 2 B 4 O 7 10H 2 O 0.09 mg, (NH 4 ) 6 Mo 7 O 27 4H 2 O 0.04 mg, ZnSO 4 7H 2 O 0.01 mg, CuSO 4 5H 2O, MnCl 2 4H 2 O 0.01 mg, FeCl 3 6H 2 O 1 mg, CaCl 2 0.01 mg (based on 1 liter of distilled water)
[93]
[94]
Example 2: L-threonine production test for AHV resistant KFCC10881 strain
[95]
[96]
L-threonine production ability test was performed on the 155 strains of AHV-resistant strains obtained in Example 1. After inoculation of the strain of 155 strains obtained in Example 1 into a 250 ml corner-baffle flask containing 25 ml of seed medium, culture was performed with shaking at 30° C. for 20 hours at 200 rpm. 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the following L-threonine production medium, followed by shaking culture at 30° C. for 48 hours at 200 rpm.
[97]
[98]
L-threonine production medium (pH 7.2)
[99]
Glucose 30g, KH 2 PO 4 2g, Urea 3g, (NH 4 ) 2 SO 4 40g, Peptone 2.5g, CSL(Sigma) 5g(10 ml), MgSO 4 .7H 2 O 0.5g, Leucine 400mg, CaCO 3 20g (Based on 1 liter of distilled water)
[100]
[101]
After the cultivation was completed, the production amount of various amino acids produced was measured using HPLC. Table 1 shows the concentrations of amino acids in the culture medium for the top 22 strains, which showed excellent L-threonine production ability among the 155 strains tested. The 22 candidates identified through the above process were named as KFCC10881-1 to KFCC10881-22, respectively.
[102]
[103]
[Table 1] Excellent AHV-resistant strain L-threonine production experiment
OD Thr Hse Gly Ala Ile Lys Thr+Hse +Gly+Ile
KFCC10881 58.5 0.0 0.1 0.3 0.1 0.0 13.3 0.4
KFCC10881-1 60.1 2.0 1.5 2.8 1.6 2.7 5.7 7.7
KFCC10881-2 57.1 3.0 2.2 0.8 3.1 1.3 12.5 7.3
KFCC10881-3 47.3 2.8 2.3 0.8 3.4 1.4 10.5 7.3
KFCC10881-4 51.7 3.2 2.1 0.8 3.2 1.3 13.4 7.4
KFCC10881-5 58.4 3.1 2.2 0.8 3.3 1.3 12.4 7.4
KFCC10881-6 52.6 3.4 2.5 0.7 3.4 1.0 12.8 7.6
KFCC10881-7 14.2 0.4 0.2 0.3 0.2 0.6 11.1 1.5
KFCC10881-8 55.8 3.0 2.0 0.8 3.3 1.3 13.0 7.1
KFCC10881-9 44.3 3.2 2.8 0.6 3.1 0.9 12.6 7.5
KFCC10881-10 47.5 3.7 3.0 0.7 3.4 0.8 12.6 8.2
KFCC10881-11 57.0 2.7 1.8 0.7 3.4 1.2 11.6 6.4
KFCC10881-12 51.8 3.3 3.5 0.6 3.2 0.9 12.4 8.3
KFCC10881-13 49.8 3.0 2.3 0.7 3.4 1.3 12.8 7.3
KFCC10881-14 62.7 2.4 2.1 2.5 3.2 3.0 3.3 10.0
KFCC10881-15 62.4 2.9 2.7 0.7 3.2 1.1 12.3 7.4
KFCC10881-16 59.6 2.8 2.5 0.8 3.3 1.3 11.4 7.4
KFCC10881-17 24.1 0.1 0.2 0.2 1.6 0.2 10.4 0.7
KFCC10881-18 60.5 2.6 2.5 0.7 3.2 1.0 12.3 6.8
KFCC10881-19 60.0 3.0 1.9 2.8 2.7 3.0 5.4 9.3
KFCC10881-20 65.8 2.7 2.0 0.8 3.4 1.4 13.0 6.9
KFCC10881-21 17.3 0.3 0.3 0.3 0.2 0.6 11.1 1.5
KFCC10881-22 60.1 3.5 1.9 2.0 2.5 2.8 2.7 10.2
[104]
[105]
As shown in the results of Table 1, L-threonine, L-homoserine, L-glycine, L-alanine, and L-isoleucine produced by 22 strains with AHV resistance increased compared to the control group, whereas L-lysine was It showed a decreasing result.
[106]
The biosynthetic pathway of L-threonine and L-lysine is split from aspartate-semialdehyde (ASA). That is, as the production of L-threonine increases, the production of L-lysine decreases. Accordingly, as the production of L-threonine increases, homoserine (Hse), L-glycine (Gly), and L-isoleucine (Ile), which can be by-products of the L-threonine biosynthesis pathway, may increase. The total amount of production (Thr + Hse + Gly + Ile) was also confirmed.
[107]
[108]
Therefore, among the AHV-resistant strains, the production of L-lysine decreases, the production of L-threonine is high, and the total production of Thr + Hse + Gly + Ile is high, 4 strains (KFCC10881-1, KFCC10881-14, KFCC10881-19, and KFCC10881-22) were selected as the best AHV resistant strains.
[109]
[110]
Example 3: Base sequence analysis of strains having excellent threonine-producing ability derived from KFCC10881
[111]
[112]
In order to analyze the nucleotide sequence of the L-threonine biosynthetic enzymes of the strains selected in Example 1, the following procedure was performed. Based on the genetic information provided by KEGG (Kyoto Encyclopedia of Genes and Genomes), the nucleotide sequence of hom encoding the homoserine dehydrogenase of Corynebacterium glutamicum ATCC13032 (SEQ ID NO: 1, NCgl1136), homoserine The nucleotide sequence (SEQ ID NO: 2, gene number NCgl1137) of thrB encoding the kinase was obtained, respectively. hom and thrB are known to have an operon structure (Peoples et al ., Mol. Biol. 2(1):63-72, 1988).
[113]
In order to secure a DNA fragment including the hom - thrB operon of the selected strains , PCR was performed using the combination of the primers of SEQ ID NO: 3 and SEQ ID NO: 4, using the cells of the strains as a template. PfuUltra™ high-reliability DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction, and PCR conditions were denaturing 96° C., 30 seconds; Annealing 52° C., 30 seconds; And polymerization reaction at 72° C. for 3 minutes was repeated 30 times. As a result, it was possible to amplify a gene fragment of 2778 bp including 200 bp below the stop codon of SEQ ID NO: 2, including the nucleotide sequence of 300 bp including the promoter site as the upper start codon of SEQ ID NO: 1 (SEQ ID NO: 5).
[114]
[115]
Using the prepared primer, the base sequence was determined by ABI PRISM 3730XL Analyzer (96 capillary type, Applied Biosystems). The nucleotide sequence corresponding to hom in the hom - thrB operon in KFCC10881-1 is the 854th base cytosine of SEQ ID NO: 1 is mutated to thiamine, and the ACT gene codon encoding the threonine residue is changed to the ATT gene codon encoding the isoleucine residue. It was found that it was (hereinafter T285I mutation; SEQ ID NO: 6). In addition, in the nucleotide sequence corresponding to the hom - thrB operon in KFCC10881-14, the 1193 nucleotide guanine in SEQ ID NO: 1 was mutated to adenine, and the CGA gene codon encoding the arginine residue was changed to the CAA gene codon encoding the glutamine residue. It was found (hereinafter, R398Q mutation; SEQ ID NO: 7). In addition, the nucleotide sequence corresponding to the hom - thrB operon in KFCC10881-19 showed that guanine, the 1132th base of SEQ ID NO: 1, was mutated to cytosine, and the GGG gene codon encoding the glycine residue was changed to the TGG gene codon encoding the tryptophan residue. It was found (hereinafter, G378W mutation; SEQ ID NO: 8). Also, hom in KFCC10881-22 -The nucleotide sequence corresponding to the thrB operon shows that the 1132 base guanine in SEQ ID NO: 1 is changed to adenine, and the 1134 base guanine is changed to cytosine, so that the GGG gene codon encoding the glycine residue has been changed to the AGC gene codon encoding the serine residue. It was found (hereinafter G378S mutation; SEQ ID NO: 9). Meanwhile , no mutation was found in thrB corresponding to SEQ ID NO: 2 .
[116]
[117]
As a result of the nucleotide sequence analysis, Hom (SEQ ID NO: 10) expressed in KFCC10881-1 is the threonine, which is the 285th amino acid residue, isoleucine (hereinafter, T285I mutation), Hom expressed in KFCC10881-14. (SEQ ID NO: 11) is the 398th amino acid residue arginine is glutamine (hereinafter referred to as the R398Q mutation), Hom expressed in KFCC10881-19 (SEQ ID NO: 12) is the 378th amino acid residue glycine is tryptophan (hereinafter referred to as G378W mutation), KFCC10881-22 Hom (SEQ ID NO: 13) expressed within was desensitized to feedback inhibition by L-threonine by mutating glycine, which is the 378th amino acid residue, to serine (hereinafter, the G378S mutation).
[118]
[119]
Example 4: Preparation of a new homoserine dehydrogenase-introduced strain
[120]
[121]
In order to prepare a strain in which the variants (T285I, R398Q, G378W, G378S) identified in Example 2 were introduced from the wild-type strain, primers of SEQ ID NO: 14 and SEQ ID NO: 15 were prepared.
[122]
[123]
T285I, R398Q, G378W, G378S hom mutations were respectively extracted from the KFCC10811-1, KFCC10811-14, KFCC10811-19, KFCC10811-22 strains to produce strains of each of the introduced genomic DNA as a template of SEQ ID NO: 14 and SEQ ID NO: 15 Each PCR was performed using primers. PfuUltra ™ high-reliability DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction, and PCR conditions were denaturing 95° C., 30 seconds; Annealing 55° C., 30 seconds; And polymerization reaction at 72° C., 2 minutes were repeated 28 times. As a result, 1668 bp gene fragments each including about 300 bp promoter region of the 1338 bp hom gene were obtained. The amplified product was purified using QUIAGEN's PCR Purification kit and used as an insert DNA fragment for vector construction. Meanwhile, the restriction enzyme smaIAfter treatment, the molar concentration (M) ratio of the pDZ vector heat-treated at 65° C. for 20 minutes and the inserted DNA fragment amplified through the above PCR was 1:2, and provided using the Infusion Cloning Kit of TaKaRa. By cloning according to the manual, vectors pDZ-T285I, pDZ-R398Q, pDZ-G378W, and pDZ-G378S were prepared to introduce mutations of T285I, R398Q, G378W, and G378S onto the chromosome.
[124]
[125]
Each of the prepared vectors was transformed into Corynebacterium glutamicum ATCC13032 by electroporation, and a second crossover process was performed to obtain strains each substituted with a variant base on the chromosome. Appropriate substitutions were determined according to each variant sequence using the mutant allele specific amplification (MASA) PCR technique (Takeda et al ., Hum. Mutation, 2, 112-117 (1993)) using the primer combinations listed below . The primer combination (CTR-T285I: SEQ ID NO: 16 and SEQ ID NO: 17, CTR-R398Q: SEQ ID NO: 16 and SEQ ID NO: 18, CTR-G378W: SEQ ID NO: 16 and SEQ ID NO: 19, CTR-G378S: SEQ ID NO: 16 and SEQ ID NO: In 20), the first was determined by selecting the strain to be amplified, and the hom sequencing of the selected strain was confirmed secondary by analyzing the variant sequence in the same manner as in Example 2 using SEQ ID NO: 16 and SEQ ID NO: 21. The strains substituted with each variant base were named CTR-T285I, CTR-R398Q, CTR-G378W, and CTR-G378S.
[126]
[127]
Example 5: Measurement of homoserine dehydrogenase enzyme activity
[128]
[129]
Hom enzyme activity was measured for the prepared strains. CTR-T285I, CTR-R398Q, CTR-G378W, CTR-G378S and wild-type strains (ATCC13032) prepared in Example 4 were inoculated into 25 ml of the following seed medium, and then cultured until the end of the log phase. The cells were recovered through centrifugation, washed twice with a buffer solution of 0.1 M potassium phosphate pH7.6), and then finally suspended in 2 ml of the same buffer solution containing glycerol at a concentration of 30%. After physically crushing the cell suspension for 10 minutes by a general glass bead vortexing method, the supernatant is recovered through two centrifugation (13,000 rpm, 4°C, 30 minutes), and a crude extract for measuring Hom enzyme activity Was used as. To measure Hom enzyme activity, 0.1 ml crude enzyme solution was added to 0.9 ml of enzyme activity measurement reaction solution (potassium phosphate (pH7.0) buffer solution, 25 mM NADPH, 5 mM aspartate semi-aldehyde), and then reacted at 30°C. I did. Hom enzyme activity U was defined as the number of umol NADPH consumed per minute according to the presence or absence of L-threonine (0mM, 10mM), and the results of measuring the enzyme activity are shown in Table 2 below.
[130]
[131]
Table 2 Measurement of desensitization by Hom enzyme activity (U) and L-threonine
Strain Enzyme activity (U) depending on the amount of L-threonine added (mM)
0 mM 10 mM
ATCC13032 0.92 0.02
CTR-T285I 1.11 0.82
CTR-R398Q 1.31 1.12
CTR-G378W 1.39 1.21
CTR-G378S 1.38 1.22
[132]
[133]
As a result of the experiment, in the case of Hom containing mutations of T285I, R398Q, G378W, and G378S, unlike wild-type Hom, under conditions containing 10 mM L-threonine, the degree of inhibition of activity decreased, resulting in L-threonine. It was found that it was desensitized.
[134]
[135]
Example 6: Preparation and evaluation of microbial strains of the genus Corynebacterium having L-threonine production ability
[136]
[137]
L-threonine-producing strain was developed from wild species Corynebacterium glutamicum ATCC13032. Specifically, in order to resolve the feedback inhibition of aspartate kinase (lysC), which acts as the first important enzyme in the threonine biosynthesis pathway, leucine, amino acid 377 of lysC, was substituted with lysine (sequence Number 22).
[138]
More specifically, PCR was performed using the primers of SEQ ID NO: 23 and SEQ ID NO: 24 or SEQ ID NO: 25 and SEQ ID NO: 26, respectively, using the chromosome of ATCC13032 as a template to prepare strains into which the lysC (L377K) mutation was introduced. PfuUltra ™ high-reliability DNA polymerase (Stratagene) was used as a polymerase for the PCR reaction, and PCR conditions were denaturing 95° C., 30 seconds; Annealing 55° C., 30 seconds; And polymerization reaction at 72° C. for 1 minute was repeated 28 times. As a result, a 515 bp DNA fragment at the 5'upper portion and a 538 bp DNA fragment at the 3'lower portion were obtained, centering on the mutation of the lysC gene. Using the two amplified DNA fragments as a template, PCR was performed with primers of SEQ ID NO: 23 and SEQ ID NO: 26. PCR conditions were denatured at 95° C. for 5 minutes, then denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 2 minutes were repeated 28 times, followed by polymerization at 72° C. for 5 minutes. As a result, a 1023 bp DNA fragment containing a mutation of the lysC gene encoding an aspartokinase variant in which leucine at 377 was substituted with lysine was amplified. The amplified product was purified using QUIAGEN's PCR Purification kit and used as an insert DNA fragment for vector construction. Meanwhile, the restriction enzyme smaIAfter treatment, the molar concentration (M) ratio of the pDZ vector heat-treated at 65° C. for 20 minutes and the inserted DNA fragment amplified through the above PCR was 1:2, and provided using the Infusion Cloning Kit of TaKaRa. By cloning according to the manual, a vector pDZ-L377K was prepared to introduce the L377K mutation onto the chromosome.
[139]
[140]
The prepared vector was transformed into ATCC13032 by electroporation, and through a second crossover process, a strain in which each base mutation was replaced with a mutant base on the chromosome was obtained, which was named CJP1.
[141]
In order to clearly confirm the change in L-threonine production of the strain, the mutations identified in Example 4 were each introduced into the gene encoding homoserine dehydrogenase. Specifically, the pDZ-T285I, pDZ-R398Q, pDZ-G378W pDZ-G378S vectors produced in Example 4 were transformed into CJP1 by electroporation in order to introduce the T285I, R398Q, G378W, and G378S mutations into the CTR-L377K strain, respectively. After conversion, a second crossover process was performed in the same manner as in Example 4 to obtain a strain in which each base mutation was substituted with a variant base on the chromosome. The strains substituted with each variant base were named CJP1-T285I, CJP1-R398Q, CJP1-G378W, and CJP1-G378S.
[142]
The strains CJP1-T285I and CJP1-R398Q were internationally deposited with the Korea Microbial Conservation Center (KCCM), an international depository under the Budapest Treaty, as of September 26, 2017, and were given deposit numbers as KCCM12119P and KCCM12120P, respectively.
[143]
[144]
[Table 3] Confirmation of L-threonine production ability of 4 strains produced
Strain Amino acid (g/l)
Thr Lys
CJP1 0.40 3.60
CJP1-T285I 1.10 3.00
CJP1-R398Q 1.21 2.75
CJP1-G378W 1.30 2.68
CJP1-G378S 1.25 2.78
[145]
[146]
As a result, the strains introduced with each mutation decreased the production of L-lysine and the production of L-threonine increased by 0.7 to 0.9 g/L compared to the control CJP1 strain.
[147]
On the other hand, in order to obtain a strain containing the T285I and R398Q mutations at the same time, the pDZ-R398Q vector was transformed into the CJP1-T285I strain, and strains were obtained in the same manner as above (CJP1-T285I, R398Q). In addition, in order to obtain a strain containing both G378W and R398Q mutations, the pDZ-R398Q vector was transformed into CJP1-G378W, and strains were obtained in the same manner as above (CJP1-G378W, R398Q). In addition, in order to obtain a strain containing the T285I and G378W mutations at the same time, the pDZ-G378W vector was transformed into CJP1-T285I, and strains were obtained in the same manner as above (CJP1-T285I, G378W). The L-threonine production ability test was performed by the method of Example 2, and is shown in Table 4 below.
[148]
[149]
[Table 4] Confirmation of L-threonine production ability of three strains produced
Strain Amino acid (g/l)
Thr Lys
CJP1 0.41 3.55
CJP1-G378W 1.30 2.68
CJP1-T285I,R398Q 1.41 2.65
CJP1-G378W,R398Q 2.12 1.92
CJP1-T285I,G378W 1.92 2.15
[150]
[151]
As a result, compared to CJP1-G378W showing the highest Thr production capacity in the previous example, it was confirmed that the Thr production capacity was higher than that when two variants of the present invention were introduced. In the strains introduced with the two mutations, the threonine production increased by 1.1 to 1.7 g/L compared to the control CJP1 strain, and thus it was confirmed that the Hom desensitization effect was greatly improved.
[152]
[153]
Example 7: Preparation and evaluation of microbial strains of the genus Corynebacterium having L-isoleucine production ability
[154]
[155]
In order to prepare the isoleucine-producing strain, the mutant gene ilvA ( V323A) ( Appl. Enviro. Microbiol. , Dec. 1996, p.4345-4351) was constructed to enhance the expression.
[156]
Specifically, in order to create a mutation introduction vector targeting the ilvA gene, a pair of primers (SEQ ID NOs. Nos. 29 and 30) were devised. In the primers of SEQ ID NOs: 27 and 30, a BamHI restriction enzyme site (indicated by underline) was inserted at each end, and the primers of SEQ ID NOs: 28 and 29 were designed to cross each other so that nucleotide substitution mutations (indicated by underline) were located. I did.
[157]
[158]
[Table 5]
Sequence number Base sequence
27 AC GGATCC CAGACTCCAAAGCAAAAGCG
28 ACACCACG G CAGAACCAGGTGCAAAGGACA
29 CTGGTTCTG C CGTGGTGTGCATCATCTCTG
30 AC GGATCC AACCAAACTTGCTCACACTC
[159]
[160]
Using the wild-type chromosome as a template, PCR was performed using the primers of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, and SEQ ID NO: 30. PCR conditions were denatured at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 30 seconds were repeated 30 times, and then polymerization was performed at 72°C for 7 minutes. As a result, a 627 bp DNA fragment at the 5'upper part and a 608 bp DNA fragment at the 3'lower part were obtained around the mutation of the ilvA gene. Using the two amplified DNA fragments as a template, PCR was performed with primers of SEQ ID NO: 27 and SEQ ID NO: 30. After denaturation at 95° C. for 5 minutes, denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 60 seconds were repeated 30 times, and then polymerization reaction was performed at 72° C. for 7 minutes. As a result, a 1217 bp DNA fragment containing the mutation of the ilvA gene encoding the IlvA variant in which valine at 323 was substituted with alanine was amplified. pECCG117 (Korea Patent Registration No. 10-0057684) vector and a DNA fragment of 1011 bp were treated with restriction enzyme BamHI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid, which was called pECCG117- ilvA (V323A). Named.
[161]
The pECCG117- ilvA (V323A) vector was introduced into the CJP1-T285I, R398Q, CJP1-G378W, R398Q, CJP1-T285I, G378W strains prepared in Example 6 by electroporation, and then contained 25 mg/L of kanamycin. Transformants were obtained by plating on one selection medium. It was cultured in the same manner as in the flask culture method shown in Example 2, and the concentration of L-isoleucine in the culture solution was analyzed, and it is shown in Table 6.
[162]
[163]
[Table 6] Evaluation of the produced strain
Strain L-Isoleucine (g/L)
CJP1/pECCG117- ilvA (V323A) 0.7
CJP1-G378W/pECCG117- ilvA (V323A) 0.9
CJP1-T285I,R398Q/pECCG117- ilvA (V323A) 1.1
CJP1-G378W,R398Q/pECCG117- ilvA (V323A) 1.2
CJP1-T285I,G378W/pECCG117- ilvA (V323A) 1.0
[164]
[165]
As a result, it was confirmed that the L-isoleucine production capacity was improved by 0.2g/L compared to the control strain in the strain containing the hom (G378W) mutation. In addition, the strain containing the hom mutation in which both mutations were introduced at the same time improved L-isoleucine production capacity by 0.3 to 0.5 g/L compared to the control strain, of which CJP1-T285I, R398Q/pECCG117 containing both mutations T285I and R398Q - ilvA is 1.1g / l L- isoleucine were produced in (V323A) strain.
[166]
[167]
Example 8: Production and evaluation of strains producing O-acetyl-homoserine (OAH) substituted with variant Hom
[168]
[169]
8-1: Preparation of ATCC13032 strain substituted with variant Hom
[170]
[171]
In the same manner as in Example 7, T285I and R398Q were introduced into the ATCC13032 strain, and this strain was designated as ATCC13032::Hom FBR .
[172]
[173]
8-2: Deletion of metB gene
[174]
[175]
In this example, through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, the metB gene encoding the cystathionine gamma-synthase of the O-acetyl-homoserine degradation pathway was used. Secured. Based on the NIH GenBank of the National Institutes of Health, the nucleotide sequence information of the metB gene (NCBI registration number Ncgl2360, SEQ ID NO: 31) was obtained, and based on this, the N-terminal portion and linker sequence of the metB gene were obtained. Primers (SEQ ID NOs: 32 and 33), primers containing C-terminal portions and linker portions (SEQ ID NOs: 34 and 35) were synthesized. PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, and oligonucleotides of SEQ ID NOs: 32 and 33 and 34 and 35 as primers. The polymerase was PfuUltra ™ high-reliability DNA polymerase (Stratagene), PCR conditions were denaturing 96° C., 30 seconds; Annealing 53° C., 30 seconds; And polymerization reaction at 72° C. for 1 minute was repeated 30 times. As a result, the 500bp amplified gene and metB containing the linker and the N-terminal portion of the metB gene A 500bp amplified gene containing the C-terminal portion of the gene and a linker was obtained.
[176]
[177]
PCR was performed using the amplified genes obtained above as a template, and PCR conditions were denaturing 96° C., 60 seconds; Annealing 50° C., 60 seconds; And polymerization reaction at 72° C., 1 minute was repeated 10 times, followed by addition of SEQ ID NOs: 32 and 35, and repeated 20 times. As a result, an amplified Δ metB gene of 1000bps, which is a metB inactivation cassette containing the N-terminal-linker-C-terminal of the metB gene, was obtained. Restriction enzymes XbaI and SalI contained in the terminal were treated with the metB gene obtained through the PCR, and cloned into pDZ (KR 0924065) vector treated with restriction enzymes XbaI and SalI through ligation, and finally metB inactivation A pDZ- ΔmetB recombinant vector in which the cassette was cloned was constructed.
[178]
The prepared pDZ- ΔmetB vector was transformed into Corynebacterium glutamicum ATCC13032, ATCC13032::Hom FBR , and the metB gene was inactivated on the chromosome through a secondary crossover process, and Corynebacterium glutamicum ATCC13032 ΔmetB , ATCC13032::Hom FBR ΔmetB was obtained. The inactivated metB gene was finally confirmed through PCR using the primers of SEQ ID NOs: 32 and 35, and then compared with ATCC13032 in which the metB gene was not inactivated.
[179]
[180]
8-3: Deletion of metY gene
[181]
[182]
In this embodiment, through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, O-acetyl-homoserine (thiol)-lyase of the O-acetyl-homoserine degradation pathway The metY gene encoding was obtained. Based on the NIH GenBank of the National Institutes of Health, the nucleotide sequence information of the metY gene (NCBI registration number Ncgl0625, SEQ ID NO: 36) was obtained, and based on this, the N-terminal portion of the metY gene and the linker sequence were obtained. Primers (SEQ ID NOs: 37 and 38) and primers (SEQ ID NOs: 39 and 40) containing a C-terminal portion and a linker portion were synthesized.
[183]
[184]
PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, and oligonucleotides of SEQ ID NOs: 37 and 38 and SEQ ID NOs: 39 and 40 as primers. The polymerase was PfuUltra ™ high-reliability DNA polymerase (Stratagene), and PCR conditions were denaturing 96° C., 30 seconds; Annealing 53° C., 30 seconds; And polymerization reaction at 72° C. for 1 minute was repeated 30 times. As a result, 500bp amplified gene containing the N-terminal portion and linker of metY gene and 500bp amplified gene containing the C-terminal portion and linker of metY gene were obtained. PCR was performed using the amplified genes obtained above as a template, and PCR conditions were denaturing 96° C., 60 seconds; Annealing 50° C., 60 seconds; And polymerization reaction at 72° C., 1 minute was repeated 10 times, followed by addition of SEQ ID NOs: 37 and 40, and then repeated 20 times. As a result, metY amplification of the metB inactivation cassette containing the N-terminal-linker-C- terminal of the gene 1000bps Δ metY to obtain the gene.
[185]
The metY gene obtained through the PCR was treated with restriction enzymes XbaI and SalI contained at the end, and was cloned through ligation into a pDZ (KR2008-0025355) vector treated with restriction enzymes XbaI and SalI, and finally met Y A pDZ- ΔmetY recombinant vector in which the inactivation cassette was cloned was constructed.
[186]
The prepared pDZ- ΔmetY vector was transformed into Corynebacterium glutamicum ATCC13032, ATCC13032::Hom FBR , ATCC13032 ΔmetB , ATCC13032::Hom FBR ΔmetB strain, and the metY gene was inactivated on the chromosome through a secondary crossover process. The Corynebacterium glutamicum ATCC13032 ΔmetY , ATCC13032::Hom FBR ΔmetY , ATCC13032 ΔmetB ΔmetY , ATCC13032::Hom FBR ΔmetB ΔmetY were obtained. The inactivated metY gene was finally confirmed through PCR using the primers of SEQ ID NOs: 37 and 40, and then compared with ATCC13032 in which the metY gene was not inactivated.
[187]
[188]
8-4: O-acetyl-homoserine production strain production and evaluation
[189]
[190]
Constructed in Examples 8-1 to 8-3, the metB, metY, metBY genes were deleted and replaced with a mutant hom gene ATCC13032, ATCC13032 ΔmetB , ATCC13032 ΔmetY , ATCC13032 Δ metB Δ metY , ATCC13032::Hom FBR , ATCC13032 ::Hom FBR Δ metB, ATCC13032::Hom FBR Δ metY, ATCC13032::Hom FBR Δ metB Δ metY strains of O-acetyl-homoserine production capacity were compared.
[191]
[192]
Specifically, a single colony cultured overnight in LB solid medium in an incubator at 32° C. was inoculated into 25 ml of O-acetyl-homoserine titer medium by 1 platinum and incubated at 32° C. at 250 rpm for 42-64 hours. O-acetyl-homoserine from the culture was analyzed by HPLC. The analysis results are shown in Table 7 below.
[193]
[194]
LO-acetylhomoserine production medium (pH 7.2)
[195]
Glucose 30 g, KH 2 PO 4 2 g, Urea 3 g, (NH 4 ) 2 SO 4 40 g, Peptone 2.5 g, CSL(Sigma) 5 g(10 ml), MgSO 4 .7H 2 O 0.5 g, Methionine 400 mg, Leucine 400 mg, CaCO 3 20 g (based on 1 liter of distilled water)
[196]
[197]
[Table 7] O-acetyl-homoserine production evaluation
Strains O-AH production(g/L)
ATCC13032 - 0.0
metB 0.3
metY 0.3
metBY 0.5
ATCC13032::Hom FBR (T285I + R398Q) - 0.0
metB 1.2
metY 1.4
metBY 3.5
[198]
[199]
As a result, when culturing the control strain Corynebacteria glutamicum ATCC13032, as shown in Table 7, O-acetyl-L-homoserine does not accumulate, whereas metB, metY, and metBY are inactivated ATCC13032 Δ metB , ATCC13032 Δ metY , ATCC13032 Δ In the metB Δ metY strain, it was confirmed that 0.3, 0.3, and 0.5 g/L of O-acetyl-L-homoserine were accumulated, respectively.
[200]
In addition, ATCC13032::Hom FBR strain in which the hom gene was replaced in a mutant form, ATCC13032::Hom FBR Δ metB in which metB, metY, and metBY were respectively inactivated in the strain , ATCC13032::Hom FBR Δ metY, ATCC13032::Hom In the case of FBR Δ metB Δ metY strain, it was confirmed that 1.2, 1.4, and 3.5 g/L of O-acetyl-L-homoserine were accumulated, respectively.
[201]
Therefore, from the above results, it was confirmed that the production amount of the target amino acid using homoserine as a precursor can be greatly improved by using the variant hom of the present invention.
[202]
[203]
Example 9: Preparation and evaluation of methionine (Met) producing strain
[204]
[205]
9-1: Construction of a recombinant vector for the deletion of the mcbR gene
[206]
[207]
In this embodiment, in order to produce a methionine production strain, a strain in Example 6 group known cysteine methionine transcription control factor in the production in danbaekjilreul coding mcbR: (J. Biotechnol 103. 51-65 , 2003) the inactivation of the A vector was constructed for this purpose.
[208]
Specifically, a recombinant plasmid vector was constructed by the following method in order to delete the mcbR gene on the Corynebacterium ATCC13032 chromosome. Based on the nucleotide sequence reported to the National Institutes of Health (NIH Genbank), the mcbR gene and peripheral sequence (SEQ ID NO: 41) of Corynebacterium glutamicum were obtained.
[209]
For the purpose of obtaining the defective mcbR gene, PCR was performed using the primers of SEQ ID NO: 42 and SEQ ID NO: 43, SEQ ID NO: 44 and SEQ ID NO: 45 using the chromosomal DNA of Corynebacterium glutamicum ATCC 13032 as a template. I did. PCR conditions were denatured at 95° C. for 5 minutes, then denaturation at 95° C. for 30 seconds, annealing at 53° C. for 30 seconds, and polymerization at 72° C. for 30 seconds were repeated 30 times, followed by polymerization at 72° C. for 7 minutes. As a result, each 700bp DNA fragment was obtained.
[210]
In Corynebacterium glutamicum, the pDZ vector (Korean Patent Registration No. 10-0924065) and the amplified mcbR gene fragments were treated with the restriction enzyme smaI for chromosome introduction, and then, using a DNA conjugation enzyme. After ligating, it was transformed into E. coli DH5α and plated on LB solid medium containing kanamycin (25mg/ℓ). A plasmid was obtained using a plasmid extraction method after selecting a colony transformed with a vector into which the fragments of the target genes were inserted through PCR, and named pDZ-ΔmcbR.
[211]
[212]
9-2: Preparation and evaluation of microbial strains of Corynebacterium genus with L-methionine production ability
[213]
[214]
CJP1-G378W, CJP1-T285I, R398Q, CJP1-G378W, R398Q, CJP1-T285I, G378W and CJP1 strains produced in Example 6 by homologous recombination of the pDZ-ΔmcbR vector produced in Example 9 on chromosome Field was transformed by electroporation (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999). After that, secondary recombination was performed in a solid medium containing X-gal. The strain in which the mcbR gene was deleted was identified through PCR using primers 46 and 47 for the Corynebacterium glutamicum transformant strain having completed the secondary recombination. These recombinant strains are Corynebacterium glutamicum CJP1-G378W/ Δ mcbR, CJP1-T285I, R398Q/ Δ mcbR, CJP1-G378W, R398Q/ Δ mcbR, CJP1-T285I, G378W/ Δ mcbR, CJP1/ Δ mcbR Named this.
[215]
[216]
To analyze the L-methionine production ability of the prepared CJP1-G378W/ Δ mcbR, CJP1-T285I, R398Q/ Δ mcbR, CJP1-G378W, R398Q/ Δ mcbR, CJP1-T285I, G378W/ Δ mcbR strains. It was cultured with the Corynebacterium glutamicum CJP1/ Δ mcbR strain in the following manner.
[217]
Corynebacterium glutamicum CJP1/ Δ mcbR and invention strain Corynebacterium glutamicum CJP1-G378W/ Δ mcbR, CJP1-T285I, R398Q/ Δ mcbR in a 250 ml corner-baffle flask containing the following 25 ml , CJP1-G378W, R398Q/ Δ mcbR, CJP1-T285I, G378W/ Δ mcbR were inoculated, and cultured with shaking at 30° C. for 20 hours and 200 rpm. Then, 1 ml of the seed culture was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, followed by shaking culture at 30° C. for 48 hours and 200 rpm. Compositions of the species medium and production medium are as follows, respectively.
[218]
After culturing by the above culture method, the concentration of L-methionine in the culture solution was analyzed and shown in Table 3.
[219]
[220]

[221]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH2PO4 4 g, K2HPO4 8 g, MgSO4 7H2O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 2000 μg ( 1 liter of distilled water)
[222]
[223]

[224]
Glucose 50 g, (NH4)2S2O3 12 g, Yeast extract 5 g, KH2PO4 1 g, MgSO4·7H2O 1.2 g, biotin 100 µg, thiamine hydrochloride 1000 µg, calcium-pantothenic acid 2000 µg, nicotinamide 3000 µg, CaCO3 30 g ( 1 liter of distilled water).
[225]
[226]
After culturing by the above culture method, the concentration of L-methionine in the culture solution was analyzed and shown in Table 8.
[227]
[Table 8] Evaluation of the produced strain
Strain L-methionine (g/L)
CJP1/ Δ mcbR 0.01
CJP1-G378W/ Δ mcbR 0.13
CJP1-T285I,R398Q/ Δ mcbR 0.18
CJP1-G378W,R398Q/ Δ mcbR 0.20
CJP1-T285I,G378W/ Δ mcbR 0.17
[228]
[229]
As a result, it was confirmed that the L-methionine production ability was improved by 0.12g/L compared to the control strain in the strain containing the G378W hom mutation. In addition, it was confirmed that the strains containing the hom mutation in which the two mutations were introduced at the same time improved the L-methionine production capacity by 0.16 ~ 0.19 g/l compared to the control strain.
[230]
From the above results, it was confirmed that the production amount of L-methionine can be greatly improved by using the variant hom of the present invention.
[231]
[232]
From the above description, those skilled in the art to which the present application pertains will understand that the present application may be implemented in other specific forms without changing the technical spirit or essential features. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including all changes or modified forms derived from the meaning and scope of the claims to be described later rather than the above detailed description, and equivalent concepts thereof.
[233]

[234]

Claims
[Claim 1]
A variant homoserine dehydrogenase in which the 285th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with isoleucine, the 398th amino acid is substituted with glutamine, or a combination thereof.
[Claim 2]
The variant homoserine dehydrogenase according to claim 1, wherein the 378th amino acid in the amino acid sequence of SEQ ID NO: 1 is further substituted with tryptophan.
[Claim 3]
The polynucleotide encoding the variant homoserine dehydrogenase of any one of claims 1 to 2.
[Claim 4]
In the amino acid sequence of SEQ ID NO: 1, the 285th amino acid is substituted with isoleucine, the 398th amino acid is substituted with glutamine, or a combination thereof, including variant homoserine dehydrogenase, microorganisms of the genus Corynebacterium .
[Claim 5]
The microorganism of the genus Corynebacterium according to claim 4, wherein the microorganism of the genus Corynebacterium produces L-amino acids derived from homoserine or homoserine.
[Claim 6]
The microorganism of the genus Corynebacterium according to claim 5, wherein the homoserine-derived L-amino acid is at least one selected from the group consisting of L-threonine, L-isoleucine, O-acetylhomoserine and L-methionine.
[Claim 7]
The microorganism of the genus Corynebacterium according to claim 4, wherein the microorganism of the genus Corynebacterium produces L-alanine.
[Claim 8]
The microorganism according to claim 4, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
[Claim 9]
Cultivating a microorganism containing a mutant homoserine dehydrogenase, in which the 285th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with isoleucine, the 398th amino acid is substituted with glutamine, or a combination thereof ; A method for producing homoserine or homoserine-derived L-amino acid comprising the step of recovering homoserine or homoserine-derived L-amino acid from the microorganism or medium.
[Claim 10]
The method of claim 9, wherein the homoserine-derived L-amino acid is at least one selected from the group consisting of L-threonine, L-isoleucine, O-acetyl-L-homoserine and L-methionine, derived from homoserine or homoserine. Method for producing L-amino acids.
[Claim 11]
A composition for producing homoserine or homoserine-derived L-amino acid, comprising the variant homoserine dehydrogenase of claim 1 or the microorganism of the genus Corynebacterium of claim 4.
[Claim 12]
The method of claim 11, wherein the homoserine-derived L-amino acid is at least one selected from the group consisting of L-threonine, L-isoleucine, O-acetyl-L-homoserine, and L-methionine derived from homoserine or homoserine. Composition for the production of L-amino acids.
[Claim 13]
In the amino acid sequence of SEQ ID NO: 1 having homoserine dehydrogenase activity, the 285th amino acid is substituted with isoleucine, or the 398th amino acid is substituted with glutamine, or a combination thereof A method of increasing the production capacity of homoserine-derived L-amino acids.
[Claim 14]
The method of claim 13, wherein the homoserine-derived L-amino acid is at least one selected from the group consisting of L-threonine, L-isoleucine, O-acetyl-L-homoserine and L-methionine, derived from homoserine or homoserine. Method for producing L-amino acids.
[Claim 15]
The use of the variant homoserine dehydrogenase of claim 1 for the production of homoserine or homoserine-derived L-amino acid.
[Claim 16]
Use of the polynucleotide of claim 3 for the production of homoserine or homoserine derived L-amino acids.
[Claim 17]
Use of the microorganism of the genus Corynebacterium according to claim 4 for the production of homoserine or homoserine-derived L-amino acid.