Sign In to Follow Application
View All Documents & Correspondence

“Modified Polypeptide With Attenuated Activity Of Citrate Synthase And Method For Producing L Amino Acid Using The Same”

Abstract: The present application relates to a modified polypeptide with attenuated activity of citrate synthase and a method for producing aspartate-derived L-amino acids using same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
17 June 2020
Publication Number
40/2020
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
sunita@skslaw.org
Parent Application
Patent Number
Legal Status
Grant Date
2024-02-20
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu, Seoul 04560

Inventors

1. JANG, Jaewon
330, Dongho-ro Jung-gu Seoul 04560
2. LEE, Kwang Woo
330, Dongho-ro Jung-gu Seoul 04560
3. SHIN, Yong Uk
330, Dongho-ro Jung-gu Seoul 04560
4. LEE, Imsang
330, Dongho-ro Jung-gu Seoul 04560

Specification

Specification
Title of the invention: Variant polypeptide with weakened activity of citrate synthase and L-amino acid production method using the same
Technical field
[One]
The present application relates to a variant polypeptide having a weakened citrate synthase activity and a method for producing L-amino acid using the same.
[2]
Background
[3]
The genus Corynebacterium microorganisms, particularly Corynebacterium glutamicum , are Gram-positive microorganisms that are widely used in the production of L-amino acids and other useful substances. In order to produce the L-amino acid and other useful substances, various studies have been conducted to develop highly efficient microorganisms and fermentation process technology. For example, a target substance-specific approach such as increasing the expression of a gene encoding an enzyme involved in L-lysine biosynthesis or removing a gene unnecessary for biosynthesis has been mainly used (Korean Patent Registration No. 10- 0838038).
[4]
Meanwhile, among L-amino acids, L-lysine, L-threonine, L-methionine, L-isoleucine, and L-glycine are amino acids derived from aspartate, and the level of synthesis of oxaloacetate, a precursor of aspartate, is the L- It can affect the level of amino acid synthesis.
[5]
Citrate synthase (CS) is an enzyme that generates citrate by polymerizing acetyl COA and oxaloacetate produced in the glycolysis of microorganisms, and is an important enzyme that determines carbon influx into the TCA pathway.
[6]
The changes in the phenotype of the L-lysine-producing strain according to the gltA gene deletion encoding citrate synthase have been reported in prior literature (Ooyen et al., Biotechnol. Bioeng., 109(8):2070-2081, 2012). However, the gltA gene-deficient strain has a disadvantage that not only the growth of the strain is inhibited, but also the sugar consumption rate is significantly reduced, and thus the amount of lysine production per unit time is low. Therefore, there is still a need for a study that considers effective L-amino acid production capacity increase and strain growth.
[7]
Detailed description of the invention
Technical challenge
[8]
The present inventors have completed the present invention by confirming that the production of L-amino acids is increased without delaying the growth rate of the strain when using a novel variant polypeptide having attenuated citrate synthase activity to a specific level.
[9]
Means of solving the task
[10]
One object of the present application is to provide a variant polypeptide having citrate synthase activity in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
[11]
Another object of the present application is to provide a polynucleotide encoding the variant polypeptide.
[12]
Another object of the present application is to provide a microorganism of the genus Corynebacterium genus, which produces aspartate-derived L-amino acids, including the variant polypeptide .
[13]
Another object of the present application is the step of culturing the microorganisms of the genus Corynebacterium in a medium; It is to provide a method for producing L-amino acid, comprising the step of recovering L-amino acid from the cultured microorganism or medium.
[14]
Effects of the Invention
[15]
When using a novel variant polypeptide having a weakened citrate synthase activity of the present application, the production amount of aspartate-derived L-amino acid can be further improved without delaying the growth rate.
[16]
Brief description of the drawing
[17]
1 shows a growth curve of a strain introduced with a gltA gene deletion and mutation.
[18]
Best mode for carrying out the invention
[19]
This is described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the specific description described below.
[20]
[21]
One aspect of the present application for achieving the above object includes one or more mutations in the amino acid sequence of SEQ ID NO: 1, and the mutation includes those in which the 241 th asparagines is substituted with another amino acid, citrate synta It is to provide a variant polypeptide having a citrate synthase activity.
[22]
Specifically, the variant polypeptide may be described as a variant polypeptide having citrate synthase activity, in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
[23]
[24]
In the present application, SEQ ID NO: 1 refers to an amino acid sequence having citrate synthase activity. Specifically, it is a protein sequence having citrate synthase activity encoded by the gltA gene. The amino acid sequence of SEQ ID NO: 1 can be obtained from GenBank of NCBI, a known database. For example, it may be derived from Corynebacterium glutamicum , but is not limited thereto, and a sequence having the same activity as the amino acid sequence may be included without limitation. In addition, the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence having 80% or more homology or identity thereto may be included, but is not limited thereto. Specifically, the amino acid sequence may include an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with SEQ ID NO: 1 and SEQ ID NO: 1. . In addition, it is obvious that proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added can be used in the present application as long as it is an amino acid sequence that has such homology or identity and exhibits efficacy corresponding to the protein.
[25]
That is, even if it is described in the present application as'a protein or polypeptide having an amino acid sequence described by a specific sequence number' or'a protein or polypeptide consisting of an amino acid sequence indicated by a specific sequence number', a polypeptide consisting of the amino acid sequence of the corresponding sequence number and It is obvious that proteins having amino acid sequences in which some sequences are deleted, modified, substituted or added may also be used in the present application if they have the same or corresponding activity. For example, it is obvious that the'polypeptide consisting of the amino acid sequence of SEQ ID NO: 1'can belong to the'polypeptide consisting of the amino acid sequence of SEQ ID NO: 1'if it has the same or corresponding activity. In addition, in the case of having the same or corresponding activity as the variant polypeptide of the present application, in addition to the 241st mutation conferring a specific activity or a mutation in the corresponding position, insignificant sequences before and after the amino acid sequence of the corresponding sequence number may be added or may occur naturally. Excluding mutations, or silent mutations thereof, are not excluded, and it is apparent that even if such sequence additions or mutations are present, they fall within the scope of the present application.
[26]
[27]
In the present application, the term'homology' or'identity' means the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage. The terms homology and identity can often be used interchangeably.
[28]
The sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together. Substantially, homologous or identical (identical) sequences are generally in moderate or high stringent conditions along at least about 50%, 60%, 70%, 80% or 90% of the sequence or full-length. (stringent conditions) can be hybridized. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotide.
[29]
Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: Can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Alternatively, as performed in the Needleman program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) of the EMBOSS package, Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) For example, homology, similarity or identity can be determined using BLAST, or ClustalW of the National Center for Biotechnology Information.
[30]
The homology, similarity or identity of a polynucleotide or polypeptide is described, for example, in Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: 443 can be determined by comparing sequence information using a GAP computer program. In summary, the GAP program is defined as the total number of symbols in the shorter of the two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a monolithic comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps.
[31]
In addition, whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be confirmed by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the appropriate hybridization conditions defined are within the scope of the technology. , Methods well known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition , Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York).
[32]
[33]
In the present application, the term "variant polypeptide" differs from the recited sequence in the conservative substitution and/or modification of one or more amino acids, but functions of the polypeptide ) Or a polypeptide in which properties are maintained. Variant polypeptides differ from the identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one of the polypeptide sequences and evaluating the properties of the modified polypeptide. That is, the ability of the variant form may be increased, unchanged, or decreased compared to the native protein. Such variants can generally be identified by modifying one of the polypeptide sequences and evaluating the reactivity of the modified polypeptide. In addition, some variants may include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the mature protein has been removed from the N- and/or C-terminus. The term "variant" may include terms such as variant, modified, mutated protein, variant polypeptide, mutant, etc. (modification, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.) ,
[34]
In the present application, the term "conservative substitution" means replacing one amino acid with another amino acid having similar structural and/or chemical properties. Such variants may still retain one or more biological activities, while having, for example, one or more conservative substitutions. Such amino acid substitutions can generally occur based on similarity in the polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, among amino acids having an electrically charged amino acid, positively charged (basic) amino acids are arginine, lysine, and histidine, and negatively charged (acidic) amino acids are glutamic acid and arpartic acid. Contains acid; Among the amino acids having an uncharged amino acid, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and are polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine, glutamine, and among the non-polar amino acids, aromatic amino acids include phenylalanine, tryptophan and tyrosine.
[35]
[36]
In addition, variant forms may include deletion or addition of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide can be conjugated with a signal (or leader) sequence at the N-terminus of the protein involved in the transfer of the protein co-translationally or post-translationally. In addition, the polypeptide may be conjugated with other sequences or linkers to identify, purify, or synthesize the polypeptide.
[37]
[38]
The variant polypeptide of the present application includes one or more mutations in the amino acid sequence of SEQ ID NO: 1, and the 241st asparagine is substituted with another amino acid. synthase) activity, may be a variant polypeptide. The variant polypeptide is described as a variant polypeptide having attenuated citrate synthase activity compared to the amino acid sequence of SEQ ID NO: 1, in which the 241st asparagine in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid. I can.
[39]
The'substitution with another amino acid' is not limited as long as it is an amino acid different from the amino acid before substitution. That is, when the 241st amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid, the other amino acid is not limited as long as it is an amino acid other than asparagine.
[40]
The variant polypeptide of the present application may have a reduced or attenuated citrate synthase activity compared to a polypeptide before mutation, a natural wild-type polypeptide, or an unmodified polypeptide, but is not limited thereto.
[41]
Specifically, the variant polypeptide of the present application is the 241st asparagine in the amino acid sequence of SEQ ID NO: 1 is glycine, alanine, arginine, aspartate, cysteine, Glutamate, glutamine, histidine, proline, serine, tyrosine, isoleucine, leucine, lysine, tryptophan, Valine (valine), methionine (methionine), phenylalanine (phenylalanie), or may be a variant sequence substituted with threonine (threonine). More specifically, the variant polypeptide may be a variant polypeptide in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid other than lysine, but is not limited thereto. Alternatively, in the variant polypeptide, asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with an amino acid other than an acidic amino acid and a basic amino acid, or an amino acid having an uncharged amino acid, It may be a variant sequence, but is not limited thereto. Alternatively, the variant polypeptide may be a variant sequence in which the 241st asparagine in the amino acid sequence of SEQ ID NO: 1 is substituted with a nonpolar amino acid or a hydrophilic amino acid, and specifically, an aromatic amino acid (e.g., phenylalanine, tryptophan, Tyrosine) or a hydrophilic amino acid (eg, serine, threonine, tyrosine, cysteine, asparagine, glutamine) substituted, may be a variant sequence, but is not limited thereto. More specifically, the variant polypeptide has a reduced citrate synthase activity in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with threonine, serine, or tyrosine. It may be, but is not limited thereto. More specifically, the variant polypeptide may be one in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with threonine, but is not limited thereto. This variant polypeptide has a weakened citrate synthase activity compared to the sequence of SEQ ID NO: 1. It is obvious that a variant polypeptide in which the 241st amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1 includes a variant polypeptide in which the amino acid at the position corresponding to the 241st is substituted with another amino acid. The variant polypeptide may be one in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with threonine, but is not limited thereto. This variant polypeptide has a weakened citrate synthase activity compared to the sequence of SEQ ID NO: 1. It is obvious that the variant polypeptide in which the 241st amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1 includes a variant polypeptide in which the amino acid at the position corresponding to the 241st is substituted with another amino acid. The variant polypeptide may be one in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with threonine, but is not limited thereto. This variant polypeptide has a weakened citrate synthase activity compared to the sequence of SEQ ID NO: 1. It is obvious that a variant polypeptide in which the 241st amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 1 includes a variant polypeptide in which the amino acid at the position corresponding to the 241st is substituted with another amino acid.
[42]
Specifically, among the variant polypeptides, the variant polypeptide in which the 241st asparagine in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid may consist of SEQ ID NOs: 3, 59, and 61, and more specifically, the amino acid of SEQ ID NO: 1 The variant polypeptide in which the 241st asparagine in the sequence is substituted with threonine, serine, or tyrosine may be composed of SEQ ID NOs: 3, 59, and 61, but is not limited thereto. In addition, the variant polypeptide may include an amino acid sequence of SEQ ID NOs: 3, 59, and 61 or an amino acid sequence having 80% or more homology thereto, but is not limited thereto. Specifically, the variant polypeptide of the present application is at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% above SEQ ID NO: 3, 59, 61 and SEQ ID NO: 3, 59, 61 It may include a polypeptide having homology. In addition, if an amino acid sequence that has such homology and exhibits efficacy corresponding to the protein, in addition to the amino acid sequence at position 241, proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added are also included within the scope of the present application. It is self-evident.
[43]
[44]
The term'citrate synthase (CS)' in the present application is an enzyme that generates citrate by polymerizing acetyl COA and oxaloacetate produced in the glycolysis of microorganisms, and determines carbon inflow into the TCA pathway. It is an important enzyme to do. Specifically, it is a citric acid synthase that plays a role in rate regulation in the first step of the TCA cycle. In addition, the enzyme catalyzes the condensation reaction of a 2-carbon acetate residue from a molecule of acetyl COA and 4-carbon oxaloacetate to form 6-carbon acetate. In the present application, the citrate synthase may be mixed with citrate synthase, citrate synthase, or CS.
[45]
[46]
Another aspect of the present application is to provide a polynucleotide encoding the variant polypeptide.
[47]
In the present application, the term "polynucleotide" refers to a polymer of nucleotides in which a nucleotide unit (monomer) is connected in a long chain by a covalent bond, and is a DNA or RNA strand having a predetermined length or more, more specifically, It means an encoding polynucleotide fragment.
[48]
The polynucleotide encoding the variant polypeptide of the present application may be included without limitation as long as it is a polynucleotide sequence encoding the variant polypeptide having attenuated citrate synthase activity of the present application. In the present application, the gene encoding the amino acid sequence of the citrate synthase polypeptide is the gltA gene, and specifically, may be derived from Corynebacterium glutamicum, but is not limited thereto.
[49]
In the polynucleotide of the present application, various modifications are made to the coding region within a range that does not change the amino acid sequence of the polypeptide due to the codon degeneracy or in consideration of the preferred codon in an organism to express the polypeptide. I can. Specifically, any polynucleotide sequence encoding a variant polypeptide in which the 241st amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid may be included without limitation. For example, the polynucleotide of the present application may be a variant polypeptide of the present application, specifically, a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3, 59, 61, or a polynucleotide sequence encoding a polypeptide having homology thereto. , But is not limited thereto. More specifically, it may be composed of the polynucleotide sequence described in SEQ ID NOs: 4, 60, 62, but is not limited thereto.
[50]
In addition, a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence and hydride under strict conditions, so that the 241st amino acid in the sequence of the amino acid sequence of SEQ ID NO: 1 is different. Any sequence encoding a protein having the activity of a variant polypeptide substituted with an amino acid may be included without limitation.
[51]
The "stringent conditions" refer to conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, genes with high homology, 40% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically, 99% or more genes Under conditions that hybridize to each other and do not hybridize to genes with lower homology, or to wash conditions for general Southern hybridization, 60°C, 1X SSC, 0.1% SDS, specifically 60°C, 0.1X SSC, 0.1% SDS, more specifically 68 DEG C, 0.1X SSC, at a salt concentration and temperature corresponding to 0.1% SDS, one time, specifically two to three times washing conditions can be enumerated. However, it is not limited thereto, and may be appropriately adjusted by a person skilled in the art according to the purpose.
[52]
Hybridization requires that two polynucleotides have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.
[53]
Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. Further, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
[54]
The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[55]
[56]
Another aspect of the present application is to provide a microorganism comprising the variant polypeptide. Specifically, it is to provide a microorganism of the genus Corynebacterium ( Corynebacterium sp.) that produces an L-amino acid containing the variant polypeptide . More specifically, it is to provide a microorganism of the genus Corynebacterium ( Corynebacterium sp.) that produces aspartate-derived L-amino acid, including the variant polypeptide . For example, the microorganism may be to provide a microorganism transformed with a vector containing a polynucleotide encoding a variant polypeptide, but is not limited thereto.
[57]
Since the microorganism containing the variant polypeptide improves the production capacity of L-amino acids without inhibiting the growth of the microorganism or inhibiting the sugar consumption rate compared to the microorganism containing the wild-type polypeptide, L-amino acids are obtained in high yield from these microorganisms. can do. Specifically, the microorganism containing the variant polypeptide controls the activity of citrate synthase, thereby achieving an appropriate balance between the carbon flow to the TCA pathway and the amount of oxaloacetate supplied as a precursor for L-amino acid biosynthesis, and As a result, it can be interpreted that the production of L-amino acids can be increased, but the present invention is not limited thereto.
[58]
[59]
In the present application, the term "L-amino acid" is an organic compound having an amine group and a carboxyl group, and specifically, may be an amino acid or an amino acid in the form of an L-type stereoisomer, , The L-amino acid is asparagine, glycine, alanine, arginine, aspartate, cysteine, glutamate, glutamine, histidine ), proline, serine, tyrosine, isoleucine, leucine, lysine, tryptophan, valine, methionine, phenylalanie ), or threonine, and may be an α-amino acid L-homoserine or a derivative thereof as a precursor of L-amino acid, but is not limited thereto. The L-homoserine derivative may include, for example, at least one selected from the group consisting of O-acetylhomoserine, O-succinylhomoserine, and O-phosphohomoserine, but is limited thereto. It does not become.
[60]
In the present application, the term "aspartic acid" is an α-amino acid used in the biosynthesis of proteins and may be used interchangeably as aspartic acid In general, aspartate is produced from oxaloacetate, its precursor, and then in vivo. It can be converted into L-lysine, L-methionine, L-homoserine or a derivative thereof, L-threonine, L-isoleucine, and the like within.
[61]
In the present application, the term "aspartate-derived L-amino acid" refers to a material that can be biosynthesized using aspartic acid as a precursor, and is not limited as long as it is a material that can be produced through a biosynthetic process using aspartic acid as a precursor. Does not. The aspartate-derived L-amino acid may include not only aspartate-derived L-amino acids, but also derivatives thereof. For example, L-lysine, L-threonine, L-methionine, L-glycine, homoserine or derivatives thereof (O-acetylhomoserine, O-succinylhomoserine, O-phosphohomoserine), L-isoleucine , And/or cadaverine, but is not limited thereto. Specifically, it may be L-lysine, L-threonine, L-methionine, homoserine or a derivative thereof, and/or L-isoleucine, and more specifically, it may be L-lysine, L-threonine and/or L-isoleucine. , Is not limited thereto.
[62]
[63]
The term "vector" refers to a DNA preparation containing the nucleotide sequence of a polynucleotide encoding the protein of interest operably linked to a suitable regulatory sequence so that the protein of interest can be expressed in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling termination of transcription and translation. Vectors can be transformed into a suitable host cell and then replicated or function independently of the host genome, and can be integrated into the genome itself.
[64]
The vector used in the present application is not particularly limited as long as it can be replicated in the host cell, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as a phage vector or cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like can be used.
[65]
The vector usable in the present application is not particularly limited, and a known expression vector may be used. In addition, a polynucleotide encoding a protein of interest may be inserted into a chromosome through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming whether the chromosome is inserted may be additionally included. Selectable markers are used to select cells transformed with a vector, i.e., to confirm the insertion of the desired polynucleotide molecule, and select a selectable phenotype such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface proteins. Markers to give can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
[66]
[67]
In the present application, the term "transformation" means introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Transformed polynucleotides may include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced into a host cell and expressed in any form as long as it can be expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression. The expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto. The transformation method includes any method of introducing a polynucleotide into a cell, and may be performed by selecting an appropriate standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (Ca(H 2PO 4 ) 2 , CaHPO 4 , or Ca 3 (PO 4 ) 2 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method, etc., but is not limited thereto.
[68]
In addition, the term "operably linked" in the above means that a promoter sequence for initiating and mediating transcription of a polynucleotide encoding a protein of interest of the present application and the polynucleotide sequence are functionally linked. The operable linkage may be prepared using a gene recombination technique known in the art, and site-specific DNA cleavage and linkage may be prepared using a cleavage and linkage enzyme in the art, but is not limited thereto.
[69]
[70]
The term "a microorganism comprising a variant polypeptide" as used in the present application is transformed with a vector comprising a polynucleotide encoding a variant polypeptide or a polynucleotide encoding a variant polypeptide to produce a variant polypeptide. It may be a host cell or microorganism capable of expression. The host cell or microorganism may be a natural wild-type or a natural or artificially genetically modified one. Specifically, the microorganism in the present application may be a microorganism expressing a variant polypeptide, having citrate synthase activity by replacing the 241st asparagine in the amino acid sequence of SEQ ID NO: 1 with another amino acid, but is limited thereto. It doesn't work. In addition, the microorganism containing the variant polypeptide may be a microorganism that produces L-amino acid. Specifically, the microorganism containing the variant polypeptide may be a microorganism having an increased L-amino acid production ability compared to a natural or unmodified parent strain, but is not limited thereto. In addition, the microorganism containing the variant polypeptide may be a microorganism that produces aspartate-derived L-amino acid. Specifically, the microorganism containing the variant polypeptide may be a microorganism having an increased ability to produce aspartate-derived L-amino acid compared to a natural or unmodified parent strain, but is not limited thereto.
[71]
The microorganism is specifically exemplified by, Escherichia ( Escherichia ) genus, Serratia marcescens ( Serratia ), An air Winiah ( Erwinia ) genus, Enterobacter bacteria ( Enterobacteria ) genus, Salmonella ( Salmonella ) genus Streptomyces ( Streptomyces ) genus Pseudomonas Microbial strains such as ( Pseudomonas ) genus, Brevibacterium genus, or Corynebacterium genus may be included. Specifically, it may be a microorganism of the genus Corynebacterium.
[72]
The microorganisms of the genus Corynebacterium are, for example, Corynebacterium glutamicum, Corynebacterium ammoniagenes, Brevibacterium lactofermentum , Brevibacterium flavu m , Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Corynebacterium epi syeonseu ( Corynebacterium efficiens or the like), is not limited thereto. More specifically, it may be Corynebacterium glutamicum , but is not limited thereto.
[73]
[74]
The microorganism, for example, in the case of a microorganism that produces L-lysine, increases the activity of the protein encoded by the three mutations pyc , hom , and lysC genes in the microorganism of the genus Corynebacterium , thereby increasing the L-lysine production ability. It may be a microorganism into which the gltA mutation is introduced into the corynebacterium glutamicum .
[75]
In addition, in the case of microorganisms that produce L-threonine and L-isoleucine, a gene encoding homoserine dehydrogenase, which produces homoserine, a common intermediate in the biosynthetic pathway of L-threonine and L-isoleucine It may be a microorganism that has enhanced its activity by introducing a mutation to it. In particular, in the case of a microorganism that produces L-isoleucine, it may be a microorganism that enhances its activity by introducing a mutation into a gene encoding L-threonine dehydratase, but is not limited thereto. Accordingly, for the purposes of the present application, the microorganism producing L-amino acid may further include the variant polypeptide, and thus, the production capacity of the desired L-amino acid may be increased.
[76]
[77]
As another aspect of the present application, the present application comprises the steps of culturing the microorganism in a medium; And recovering L-amino acid from the cultured microorganism or medium. Specifically, the L-amino acid may be an aspartate-derived L-amino acid.
[78]
In the above method, it can be easily determined by a person skilled in the art in optimized culture conditions and enzyme activity conditions known in the art. Specifically, microbial culture is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like. At this time, the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used to provide an appropriate pH (eg, pH 5 to 9, specifically Is capable of adjusting pH 6 to 8, most specifically pH 6.8), and maintaining aerobic conditions by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and may be cultured for about 10 to 160 hours, but is not limited thereto. The L-amino acid produced by the culture may be secreted into the medium or may remain in the cells.
[79]
In addition, the culture medium used is a carbon source such as sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molase, starch and cellulose), fats and fats (e.g., soybean oil, sunflower seeds). Oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid and linoleic acid), alcohols (such as glycerol and ethanol) and organic acids (such as acetic acid) can be used individually or in combination. , Is not limited thereto. Nitrogen sources include nitrogen-containing organic compounds (e.g. peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea), or inorganic compounds (e.g. ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and Ammonium nitrate) or the like may be used individually or in combination, but is not limited thereto. Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a sodium-containing salt corresponding thereto may be used individually or as a phosphorus source, but are not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins, but is not limited thereto.
[80]
The method of recovering the L-amino acid produced in the culture step of the present application may collect the desired amino acid from the culture medium using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc. may be used, and a desired L-amino acid may be recovered from a medium or microorganism using a suitable method known in the art.
[81]
In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art. Accordingly, the recovered L-amino acid may be a purified form or a microbial fermentation broth containing L-amino acid.
[82]
Mode for carrying out the invention
[83]
Hereinafter, the present application will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited to these examples.
[84]
[85]
Example 1: Construction of a vector library for introducing mutations in the gltA gene ORF
[86]
[87]
For the purpose of discovering a variant in which the expression level of the gltA gene of Corynebacterium glutamicum or its activity is attenuated, a library was prepared by the following method.
[88]
First , the GenemorphII Random Mutagenesis Kit (Stratagene) was used for the purpose of introducing mutations per kb of the DNA fragment (1814 bp) containing the gltA (1314 bp) gene. Error-prone PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 (WT) as a template and primers SEQ ID NOs: 5 and 6 (Table 1). Specifically, a reaction solution containing chromosomes (500 ng), primers 5 and 6 (125 ng each), Mutazyme II reaction buffer (1Х), dNTP mix (40 mM), Mutazyme II DNA polymerase (2.5U) of the WT strain After denaturing at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, and polymerization for 3 minutes at 72°C were repeated 25 times, and then polymerization was performed at 72°C for 10 minutes.
[89]
The amplified gene fragment was ligated to a pCRII vector using TOPO TA Cloning Kit (Invitrogen), transformed into E. coli DH5α, and plated on LB solid medium containing kanamycin (25 mg/l). After selecting 20 transformed colonies, a plasmid was obtained, and as a result of nucleotide sequence analysis, it was confirmed that mutations were introduced at different locations with a frequency of 0.5 mutations/kb. Finally, about 10,000 transformed E. coli colonies were taken to extract a plasmid, which was named pTOPO- gltA (mt) library.
[90]
[Table 1]
primer Sequence (5' -> 3')
Primer (SEQ ID NO: 5) ATGTTTGAAAGGGATATCGTG
Primer (SEQ ID NO: 6) TTAGCGCTCCTCGCGAGGAAC
[91]
Example 2: gltA mutant strain screening based on gltA-deficient strain production and growth rate
[92]
[93]
In order to produce a strain in which the gltA gene was deleted in the wild-type Corynebacterium glutamicum ATCC13032, a vector pDZ-Δ gltA in which the gltA gene was deleted was prepared as follows. Specifically, DNA fragments located at the 5'and 3'ends of the gltA gene (600 bp each) were constructed in a form linked to a pDZ vector (Korea Patent Registration No. 10-0924065). Based on the reported gltA gene nucleotide sequence (SEQ ID NO: 2), primers SEQ ID NOs: 7 and 8 with restriction enzyme XbaI recognition sites inserted into 5'fragments and 3'fragments, and primers SEQ ID NO: 9 at 600 bp away from them. And 10 were synthesized (Table 2). Using the chromosome of Corynebacterium glutamicum ATCC13032 as a template, the 5'end gene fragment was prepared by PCR using primers SEQ ID NOs: 7 and 9. GltA in the same way The gene fragment located at the 3'end of the gene was prepared through PCR using SEQ ID NOs: 8 and 10. PCR conditions were denatured at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, and polymerization at 72°C for 40 seconds were repeated 30 times, followed by polymerization at 72°C for 10 minutes. .
[94]
Meanwhile , after treatment with restriction enzyme XbaI , the pDZ vector heat-treated at 65° C. for 20 minutes and the inserted DNA fragment amplified through the above PCR were ligated using an Infusion Cloning Kit, transformed into E. coli DH5α, and kanamycin (25 mg/l ) Was spread on the LB solid medium. After selecting a colony transformed with a vector into which the target gene was inserted through PCR using primers SEQ ID NOs: 7 and 8, a plasmid was obtained using a commonly known plasmid extraction method, and this plasmid was named pDZ-Δ gltA .
[95]
[Table 2]
primer Sequence (5' -> 3')
Primer (SEQ ID NO: 7) CGGGGATCCTCTAGACGATGAAAAACGCCC
Primer (SEQ ID NO: 8) CAGGTCGACTCTAGACTGCACGTGGATCGT
Primer (SEQ ID NO: 9) ACTGGGACTATTTGTTCGGAAAAA
Primer (SEQ ID NO: 10) CGAACAAATAGTCCCAGTTCAACG
[96]
The prepared vector pDZ-Δ gltA was transformed into Corynebacterium glutamicum ATCC13032 with an electric pulse method (Van der Rest et al ., Appl. Microbiol. Biotecnol. 52:541-545, 1999) for homologous chromosome recombination. A strain in which the gltA gene was deleted was produced. Thus, the strain in which the gltA gene was deleted was named Corynebacterium glutamicum WT::Δ gltA .
[97]
In addition, the pTOPO- gltA (mt) library was transformed by the electric pulse method for the WT::Δ gltA strain and plated on a complex plate medium containing kanamycin (25 mg/l) to obtain about 500 colonies. The obtained colonies were inoculated into a 96-well plate containing 200 uL of seed medium, respectively, and incubated for about 9 hours at 32°C and 1000 rpm.
[98]
[99]

[100]
Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitol 91 g, Agar 20 g (based on 1 liter of distilled water)
[101]
[102]

[103]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium- Pantothenic acid 2000 ㎍, nicotinamide 2000 ㎍ (based on 1 liter of distilled water)
[104]
[105]
Cell growth during culture was monitored using a UV-spectrophotometer micro-reader (Shimazu) (FIG. 1). WT and WT::Δ gltA strains were used as controls. Three strains were selected for which the growth rate was maintained higher than that of the WT::Δ gltA strain while having a smaller amount of bacteria compared to the wild-type WT strain . The selected three strains were named WT:: gltA (mt)-1 to 3. Other 497 colonies were similar to WT and WT::Δ gltA strains used as controls , had increased cell mass, or showed slow growth rate.
[106]
[107]
Example 3: Identification of the base sequence of three kinds of gltA mutant strains
[108]
[109]
Three kinds of selection strain WT:: In order to confirm the gltA gene sequence of gltA (mt)-1 to 3 , a DNA fragment containing the gltA gene in the chromosome was prepared using the primers specified in Example 1 (SEQ ID NOs: 5 and 6) . PCR amplification. PCR conditions were denatured at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, polymerization at 72°C for 40 seconds was repeated 30 times, and then polymerization was performed at 72°C for 10 minutes. .
[110]
As a result of analyzing the nucleotide sequence of the amplified gene, it was confirmed that the three strains commonly introduced 1 to 2 mutations into the nucleotide sequence located between the lower 721 to 723 bp from the ORF start codon of the gltA gene. In other words, WT:: gltA (mt)-1 to 3 strains are citrate synthase in which the 721-723 nucleotide sequence is changed from the existing AAC to ACC or ACT, and asparagine, the 241st amino acid from the N-terminus, is substituted with threonine. (CS) was confirmed to be a variant.
[111]
[112]
Example 4: Preparation of various strains in which asparagine, the 241st amino acid of the gltA gene, was substituted with another amino acid
[113]
[114]
At the position of the 241st amino acid in the amino acid sequence 1, substitution with other proteogenic amino acids other than asparagine of the wild type was attempted.
[115]
In order to introduce 19 kinds of heterologous base substitution mutations including N241T, the mutation identified in Example 3, each recombinant vector was constructed by the following method.
[116]
First, using genomic DNA extracted from the WT strain as a template, primers SEQ ID NOs: 11 and 12, which inserted restriction enzyme XbaI recognition sites into 5'fragments and 3'fragments, respectively, about 600 bp back and forth from the 721 to 723 positions of the gltA gene . Synthesized. In order to introduce 19 kinds of heterologous base substitution mutations, primers SEQ ID NOs: 13 to 48 for substituting 721 to 723 nucleotide sequences of the gltA gene were synthesized (Table 3).
[117]
Specifically, the pDZ- gltA (N241A) plasmid was constructed in a form in which DNA fragments located at the 5'and 3'ends of the gltA gene (600 bp each) were linked to a pDZ vector (Korean Patent No. 2009-0094433). Using the chromosome of the WT strain as a template, the 5'end gene fragment was prepared by PCR using primers SEQ ID NOs: 11 and 13. PCR conditions were denatured at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, polymerization at 72°C for 40 seconds was repeated 30 times, and then polymerization was performed at 72°C for 10 minutes. . In the same way, a gene fragment located at the 3'end of the gltA gene was prepared by PCR using SEQ ID NOs: 12 and 14. The amplified DNA fragment was purified using Quiagen's PCR Purification kit, and then used as an insert DNA fragment for vector construction.
[118]
Meanwhile, the pDZ vector treated with restriction enzyme XbaI and then heat-treated at 65° C. for 20 minutes and the inserted DNA fragment amplified through the above PCR were ligated using an Infusion Cloning Kit and transformed into E. coli DH5α. The strain was plated on LB solid medium containing kanamycin (25 mg/l). After selecting colonies transformed with the vector into which the target gene was inserted through PCR using primers SEQ ID NOs: 11 and 12, a plasmid was obtained using a commonly known plasmid extraction method. The plasmid was named pDZ- gltA (N241A).
[119]
In the same manner primer SEQ ID NO: 11 and 15, 12 and 16 using the pDZ- gltA (N241V), using primers of SEQ ID NOS. 11 and 17, 12 and 18 pDZ- gltA (N241Q), primers SEQ ID NO: 11 and 19, 12 and using a 20 pDZ- gltA (N241H), primers SEQ ID NO: 11 and 21, 12 and 22 using the pDZ- gltA by using a (N241R), primers SEQ ID NO: 11 and 23, 12 and 24 pDZ- gltA ( N241P), primers SEQ ID NO: 11 and 25, 12 and 26 using the pDZ- gltA (N241L), primers SEQ ID NO: 11 and 27, 12 and 28 using the pDZ- gltA (N241Y), primers SEQ ID NO: 11 and 29, using 12 and 30 pDZ- gltA (N241S), primers SEQ ID NO: 11 and 31, 12 and 32 using the pDZ- gltA (N241K), primers SEQ ID NO: 11 and 33, 12 and 34 using the pDZ- gltA(N241M), using primers of SEQ ID NOS. 11 and 35, 12 and 36 pDZ- gltA (N241I), primers SEQ ID NO: 11 and 37, 12 and 38 using the pDZ- gltA (N241E), primers SEQ ID NO: 11 and 39 , 12 and 40 using the pDZ- gltA (N241D), primers SEQ ID NO: 11 and 41, 12 and 42 using the pDZ- gltA (N241G), primers SEQ ID NO: 11 and 43, 12 and 44 using the pDZ- gltA (N241W), primers SEQ ID NO: 11 and 45, 12 and 46 using the pDZ- gltA (N241C), using the primers SEQ ID NO: 11 and 47, 12 and 48 pDZ- gltA (N241F), primers SEQ ID NO: 11 and 49 , 12 and 50 were used to prepare pDZ- gltA (N241T).
[120]
[121]
[Table 3]
primer Sequence (5' -> 3')
Primer (SEQ ID NO: 11) CGGGGATCCTCTAGAAGATGCTGTCTGAGACTGGA
Primer (SEQ ID NO: 12) CAGGTCGACTCTAGACGCTAAATTTAGCGCTCCTC
Primer (SEQ ID NO: 13) GGAGGTGGAGCATGCCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 14) GACCACGAGCAGGCATGCTCCACCTCCACC
Primer (SEQ ID NO: 15) GGAGGTGGAGCAGACCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 16) GACCACGAGCAGGTCTGCTCCACCTCCACC
Primer (SEQ ID NO: 17) GGAGGTGGAGCACTGCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 18) GACCACGAGCAGCAGTGCTCCACCTCCACC
Primer (SEQ ID NO: 19) GGAGGTGGAGCAGTGCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 20) GACCACGAGCAGCACTGCTCCACCTCCACC
Primer (SEQ ID NO: 21) GGAGGTGGAGCAGCGCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 22) GACCACGAGCAGCGCTGCTCCACCTCCACC
Primer (SEQ ID NO: 23) GGAGGTGGAGCATGGCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 24) GACCACGAGCAGCCATGCTCCACCTCCACC
Primer (SEQ ID NO: 25) GGAGGTGGAGCACAGCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 26) GACCACGAGCAGCTGTGCTCCACCTCCACC
Primer (SEQ ID NO: 27) GGAGGTGGAGCAGTACTGCTCGTGGTCAGC
Primer (SEQ ID NO: 28) GACCACGAGCAGTACTGCTCCACCTCCACC
Primer (SEQ ID NO: 29) GGAGGTGGAGCAGGACTGCTCGTGGTCAGC
Primer (SEQ ID NO: 30) GACCACGAGCAGTCCTGCTCCACCTCCACC
Primer (SEQ ID NO: 31) GGAGGTGGAGCACTTCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 32) GACCACGAGCAGAAGTGCTCCACCTCCACC
Primer (SEQ ID NO: 33) GGAGGTGGAGCACATCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 34) GACCACGAGCAGATGTGCTCCACCTCCACC
Primer (SEQ ID NO: 35) GGAGGTGGAGCAGATCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 36) GACCACGAGCAGATCTGCTCCACCTCCACC
Primer (SEQ ID NO: 37) GGAGGTGGAGCATTCCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 38) GACCACGAGCAGGAATGCTCCACCTCCACC
Primer (SEQ ID NO: 39) GGAGGTGGAGCAGTCCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 40) GACCACGAGCAGGACTGCTCCACCTCCACC
Primer (SEQ ID NO: 41) GGAGGTGGAGCAGCCCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 42) GACCACGAGCAGGGCTGCTCCACCTCCACC
Primer (SEQ ID NO: 43) GGAGGTGGAGCAGCACTGCTCGTGGTCAGC
Primer (SEQ ID NO: 44) GACCACGAGCAGTGGTGCTCCACCTCCACC
Primer (SEQ ID NO: 45) GGAGGTGGAGCAGCACTGCTCGTGGTCAGC
Primer (SEQ ID NO: 46) GACCACGAGCAGTGCTGCTCCACCTCCACC
Primer (SEQ ID NO: 47) GGAGGTGGAGCAGAACTGCTCGTGGTCAGC
Primer (SEQ ID NO: 48) GACCACGAGCAGTTCTGCTCCACCTCCACC
Primer (SEQ ID NO: 49) GGAGGTGGAGCAGGTCTGCTCGTGGTCAGC
Primer (SEQ ID NO: 50) GACCACGAGCAGACCTGCTCCACCTCCACC
[122]
Each produced vector was transformed into a strain of Corynebacterium glutamicum KCCM11016P (Korean Patent No. 10-0159812) producing lysine by an electric pulse method. As such, 19 strains in which heterologous base substitution mutations were introduced into the gltA gene were KCCM11016P:: gltA (N241A), KCCM11016P:: gltA (N241V), KCCM11016P:: gltA (N241Q), KCCM11016P:: gltA (N241H), KCCM11016P: : gltA (N241R), KCCM11016P :: gltA (N241P), KCCM11016P :: gltA (N241L), KCCM11016P :: gltA (N241Y), KCCM11016P :: gltA (N241S), KCCM11016P :: gltA (N241K), KCCM11016P :: gltA (N241M), KCCM11016P:: gltA(N241I), KCCM11016P:: gltA (N241E), KCCM11016P:: gltA (N241D), KCCM11016P:: gltA (N241G), KCCM11016P:: gltA (N241W), KCCM11016P:: gltA (N241C), KCCM11016P:: gltA (N241C :: KCCM11016P: ), KCCM11016P:: gltA (N241T), respectively.
[123]
[124]
Example 5: Analysis of lysine production ability and measurement of citrate synthase (CS) activity against gltA mutant strain
[125]
[126]
Citrate synthase (CS) activity was measured for the selected strain through a previously reported method (Ooyen et al., Biotechnol. Bioeng., 109(8):2070-2081, 2012). The gltA gene was deleted in the KCCM11016P strain by the method used in Example 1, and this strain was named KCCM11016P::Δ gltA . KCCM11016P, KCCM11016P::Δ gltA strain was used as a control, and 19 selected strains were cultured in the following manner to obtain glucose consumption rate, lysine production yield, glutamic acid (GA) concentration, and CS enzyme as a representative by-product in the culture medium. The activity was measured.
[127]
First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of seed medium, and cultured with shaking at 30°C for 20 hours and 200 rpm. Then, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of the production medium, and cultured with shaking at 32°C for 72 hours and 200 rpm. Compositions of the species medium and production medium are as follows, respectively. After completion of the culture, the concentrations of L-lysine and glutamic acid were measured using HPLC (Waters 2478).
[128]
[129]

[130]
Glucose 20 g, peptone 10 g, yeast extract 5 g, urea 1.5 g, KH 2 PO 4 4 g, K 2 HPO 4 8 g, MgSO 4 7H 2 O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium- Pantothenic acid 2000 ㎍, nicotinamide 2000 ㎍ (based on 1 liter of distilled water)
[131]
[132]

[133]
Glucose 100 g, (NH 4 )2SO 4 40 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH 2 PO 4 1 g, MgSO 4 7H 2 O 0.5 g, Biotin 100 µg, thiamine hydrochloride 1000 µg, calcium-pantothenic acid 2000 µg, nicotinamide 3000 µg, CaCO 3 30 g (based on 1 liter of distilled water).
[134]
After collecting the cells through centrifugation to measure the CS enzyme activity, the cells were washed twice with 100 mM Tris-HCl (pH 7.2, 3mM L-cysteine, 10 mM MgCl 2 ) buffer solution, and the final solution was added to 2 ml of the same buffer solution. Suspended. After physically crushing the cell suspension for 10 minutes by a general glass bead vortexing method, the supernatant is recovered through two centrifugation (13,000 rpm, 4 ℃, 30 minutes), and a crude enzyme solution for measuring CS enzyme activity (crude extract) Was used as. For the measurement of CS enzyme activity, the reaction solution for measuring enzyme activity (50mM Tris, 200mM potassium glutamate, pH 7.5, 0.1mM 5,50-dithiobis (2-nitrobenzoic acid, DTNB), 0.2mM oxaloacetate, 0.15mM A crude enzyme solution was added to acetyl-CoA) and reacted at 30°C. CS activity was defined as the ratio by measuring the absorbance of DTNB decomposed per minute relative to the parent strain at 412 nm.
[135]
[Table 4] Lysine production capacity, sugar consumption rate, culture medium components and CS enzyme activity (%) measurement
Strain CS activity (%) LYS yield (%) GA concentration (mg/L) Per consumption rate (g/hr)
KCCM11016P 100 43.4 436 4.53
KCCM11016P::Δ gltA 2 49.0 13 1.31
KCCM11016P:: gltA (N241A) 36 46.2 430 3.56
KCCM11016P:: gltA (N241V) 61 44.8 428 4.08
KCCM11016P:: gltA (N241Q) 91 43.9 386 4.21
KCCM11016P:: gltA (N241H) 57 44.0 431 4.33
KCCM11016P:: gltA (N241R) 86 43.5 432 4.68
KCCM11016P:: gltA (N241P) 71 43.9 411 4.66
KCCM11016P:: gltA (N241L) 79 44.7 429 4.51
KCCM11016P:: gltA (N241Y) 35 46.9 373 4.59
KCCM11016P:: gltA (N241S) 36 46.8 391 4.48
KCCM11016P:: gltA (N241K) 61 44.1 409 4.19
KCCM11016P:: gltA (N241M) 52 44.0 412 3.89
KCCM11016P:: gltA (N241I) 41 46.5 422 3.65
KCCM11016P:: gltA (N241E) 51 43.8 401 3.90
KCCM11016P:: gltA (N241D) 40 46.1 399 3.51
KCCM11016P:: gltA (N241G) 71 44.9 418 4.12
KCCM11016P:: gltA (N241W) 45 46.2 308 3.54
KCCM11016P:: gltA (N241C) 46 46.6 310 3.69
KCCM11016P:: gltA (N241F) 48 45.7 386 4.09
KCCM11016P:: gltA (N241T) 31 48.6 351 4.51
[136]
In the case of the gltA gene-deficient strain, the lysine yield increased by about 5.5%p compared to the parent strain, but sugar was not consumed until the second half of culture. In other words, when the gltA gene is deleted and there is little CS activity, the growth of the strain is suppressed, and it can be considered that it is difficult to use industrially. In the case of all strains containing the variant polypeptide in which the 241st amino acid of SEQ ID NO: 1 is substituted with another amino acid, it was confirmed that the growth of the strain was maintained at an industrial level and the CS activity was weakened. In addition, as the CS activity was weakened, the lysine yield compared to the parent strain tended to increase by 3~5%p. In particular, among the mutants whose CS activity was weakened by about 30-60%, the lysine yield increased by 3~5%p compared to the parent strain in the case of N241S, N241Y, and N241T in particular, showing similar levels of sugar consumption. In addition, it was confirmed that the amount of glutamic acid (GA) in the culture medium was decreased in the strain in which the lysine yield increased compared to the parent strain. That is, when the mutation of the present application is introduced, it can be interpreted that there is an effect of improving lysine yield and reducing by-products.
[137]
These results show that the production of lysine can be increased through an appropriate balance between the carbon flow to the TCA pathway and the supply of oxaloacetate used as a precursor for lysine biosynthesis through the regulation of CS activity. In particular, considering that the amount of glutamic acid, which is produced a lot as a by-product during lysine cultivation, is reduced, the weakening of the gltA gene inhibits the carbon flow to the TCA pathway, which induces the flow of carbon in the direction of lysine biosynthesis, which has a great effect on increasing lysine production capacity. Confirmed that there is.
[138]
Among the produced strains, KCCM11016P:: gltA (N241T) was deposited with the Korean Culture Center of Microorganisms (KCCM) as an international depository under the Budapest Treaty as CA01-7513 as of November 20, 2017, and the deposit number It has been given KCCM12154P.
[139]
[140]
Example 6: Analysis of the selected gltA mutant lysine production ability
[141]
[142]
Introduced three kinds of gltA gene mutations selected in Example 5 into Corynebacterium glutamicum KCCM10770P (Korean Patent No. 10-0924065) and KCCM11347P (Korean Patent No. 10-0073610) that produce L-lysine. I did. The three species were selected to have a similar sugar consumption rate compared to the parent strain while the CS activity decreased and the lysine yield increased. Three vectors of pDZ- gltA (N241S), pDZ- gltA (N241Y), and pDZ- gltA (N241T) of Example 4 were introduced into two strains of Corynebacterium glutamicum KCCM10770P and KCCM11347P by electric pulse method, and KCCM10770P: : gltA (N241S), KCCM10770P:: gltA (N241Y), KCCM10770P:: gltA (N241T), KCCM11347P:: gltA (N241S), KCCM11347P:: gltA (N241Y), KCCM11347P:: gltA (N241T) 6 strains were produced I did. KCCM10770P used as a control And KCCM11347P strain and the six strains introduced with the gltA gene base substitution mutation were cultured in the same manner as in Example 5 to analyze lysine production capacity, sugar consumption rate, and culture medium components.
[143]
After culturing for a certain period of time, the culture medium lysine production ability, sugar consumption rate, and culture medium components were analyzed. The results are shown in Table 5 below.
[144]
[Table 5] Analysis of gltA mutant lysine production capacity, sugar consumption rate and culture medium composition
Strain LYS yield (%) GA concentration (mg/L) Per consumption rate (g/hr)
KCCM10770P 42.6 406 4.27
KCCM10770P:: gltA (N241S) 46.4 350 4.08
KCCM10770P:: gltA (N241Y) 45.9 368 4.20
KCCM10770P:: gltA (N241T) 48.0 240 4.04
KCCM11347P 38.3 440 5.99
KCCM11347P:: gltA (N241S) 41.7 386 5.85
KCCM11347P:: gltA (N241Y) 42.1 402 5.96
KCCM11347P:: gltA (N241T) 43.5 316 5.84
[145]
As shown in the results of Table 5, when a mutation in which the 241st amino acid of the gltA sequence is substituted with another amino acid in the two types of lysine-producing strains KCCM10770P and KCCM11347P is introduced, the lysine yield increases and the yield of by-products decreases, while the sugar consumption rate Was similar to the parent strain. Among the three mutations, the mutation in which the 241st asparagine was substituted with threonine (N241T) showed the greatest increase in lysine yield as the rate of sugar consumption was similar or slightly increased with that of the parent strain. In addition, it was confirmed that the N241T mutation has the largest reduction in glutamic acid compared to the parent strain. From this, as in the results shown in Example 6, it was confirmed that the TCA pathway was decreased as the gltA gene was weakened, as a decrease in the amount of glutamic acid in the culture medium.
[146]
[147]
Example 7: Preparation of a CJ3P strain into which the gltA mutant (N241T) was introduced and analysis of lysine production ability
[148]
[149]
In order to confirm whether the strain belonging to other Corynebacterium glutamicum that produces L-lysine has the same effect as described above, three kinds of mutations in wild strains [ pyc (P458S), hom (V59A), lysC (T311I) )] to the Corynebacterium glutamicum CJ3P (Binder et al. Genome Biology, 2012, 13:R40) having the ability to produce L-lysine by introducing gltA (N241T) in the same manner as in Example 6 A strain into which the mutation was introduced was prepared. The produced strain was named CJ3:: gltA (N241T). The control group CJ3P strain and CJ3:: gltA (N241T) were cultured in the same manner as in Example 5 to analyze lysine production capacity, sugar consumption rate, and culture medium components, and are shown in Table 6 below.
[150]
[Table 6] Analysis of gltA CJ3P-derived (N241T) mutant lysine production capacity, sugar consumption rate and culture medium composition
Strain LYS yield (%) GA concentration (mg/L) Per consumption rate (g/hr)
CJ3P 9.2 2689 5.86
CJ3P:: gltA (N241T) 13.5 1983 5.51
[151]
As a result of analysis of lysine production ability, glucose consumption rate, and concentration of glutamic acid in the culture medium component, it was confirmed that the lysine yield increased and the concentration of glutamic acid decreased at a level similar to the glucose consumption rate in the strain introduced with the variant of gltA (N241T).
[152]
Example 8: Preparation of a threonine strain into which the gltA mutant (N241T) was introduced and analysis of threonine production ability
[153]
[154]
In order to clearly confirm the change in L-threonine production ability due to the introduction of gltA (N241T) mutations, homoserine dehydrogenase that produces homoserine, a common intermediate of L-threonine and L-isoleucine biosynthetic pathways. ) Was strengthened by introducing a mutation in the coding gene. Specifically, the CJ3P:: gltA (N241T) strain used in Example 7 known as hom (G378E) mutation (R. Winkels, S. et al. , Appl. Microbiol. Biotechnol . 45, 612-620, 1996) ) Was introduced into the strain. In addition, a strain in which only the hom (G378E) mutation was introduced into CJ3P was also prepared as a control . Recombinant vectors for mutation introduction were constructed as follows.
[155]
In order to construct a vector introducing hom (G378E), first, the genomic DNA extracted from the WT strain was used as a template, and the restriction enzyme XbaI was placed in a 5'fragment and a 3'fragment at a position approximately 600bp back and forth from the position 1131 to 1134 of the hom gene. Primers SEQ ID NOs: 51 and 52 into which the recognition site was inserted were synthesized. Primer SEQ ID NOs: 53 and 54 for substituting the base sequence of the hom gene were synthesized (Table 7). The pDZ- hom (G378E) plasmid was constructed in a form in which DNA fragments located at the 5'and 3'ends of the hom gene (600 bp each) were linked to a pDZ vector (Korean Patent No. 2009-0094433). Using the chromosome of the WT strain as a template, a 5'end gene fragment was produced through PCR using primers SEQ ID NOs: 51 and 53. PCR conditions were denatured at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, polymerization at 72°C for 40 seconds was repeated 30 times, and then polymerization was performed at 72°C for 10 minutes. . Hom in the same way A gene fragment located at the 3'end of the gene was constructed through PCR using SEQ ID NOs: 52 and 54. The amplified DNA fragment was purified using Quiagen's PCR Purification kit, and then used as an insert DNA fragment for vector construction. Meanwhile , after treatment with restriction enzyme XbaI , the pDZ vector heat-treated at 65° C. for 20 minutes and the inserted DNA fragment amplified through the above PCR were ligated using an Infusion Cloning Kit, transformed into E. coli DH5α, and kanamycin (25 mg/l ) Was spread on the LB solid medium. After selecting the colony transformed with the vector into which the target gene was inserted through PCR using primer sequences 51 and 52, a plasmid was obtained using a commonly known plasmid extraction method, and the base substitution mutation of hom (G378E) was transferred to the chromosome. The vector pDZ- hom (G378E) was constructed for introduction .
[156]
[Table 7]
primer Sequence (5' -> 3')
Primer (SEQ ID NO: 51) TCCTCTAGACTGGTCGCCTGATGTTCTAC
Primer (SEQ ID NO: 52) GACTCTAGATTAGTCCCTTTCGAGGCGGA
Primer (SEQ ID NO: 53) GCCAAAACCTCCACGCGATC
Primer (SEQ ID NO: 54) ATCGCGTGGAGGTTTTGGCT
[157]
The pDZ- hom (G378E) vector was introduced into the CJ3P and CJ3P:: gltA (N241T) strains in the same manner as in Example 6, in which a nucleotide mutation was introduced into the hom gene, CJ3P:: hom (G378E) and CJ3P:: gltA (N241T). )- hom (G378E) was obtained. The obtained two strains were cultured in the same manner as in Example 5 to analyze threonine production concentration, sugar consumption rate, and culture medium components, and are shown in Table 8 below.
[158]
[Table 8] Threonine production concentration, sugar consumption rate and culture medium components
Strain Thr concentration (g/L) GA concentration (mg/L) Per consumption rate (g/hr)
CJ3P:: hom (G378E) 2.8 2769 5.36
CJ3P:: gltA (N241T)- hom (G378E) 6.1 1891 5.17
[159]
As a result of analysis of threonine production ability, sugar consumption rate, and concentration of glutamic acid in the culture medium, it was confirmed that the threonine concentration increased and the concentration of glutamic acid decreased at a level similar to the sugar consumption rate in the strain introduced with the variant of gltA (N241T).
[160]
[161]
Example 9: gltA mutant strain (N241T) was introduced isoleucine strain production and isoleucine production ability analysis
[162]
[163]
In order to confirm the effect of gltA (N241T) mutation on L-isoleucine production ability, a mutation was introduced into the gene encoding the known threonine dehydratase. Specifically, it used in Example 7 CJ3P :: gltA (N241T) - hom known group in (G378E) strain ilvA (V323A) mutation (Morbach S. et al, Appl Microbiol Enviro.... , 62 (12) : 4345-4351, 1996) was prepared. In addition, a strain in which only the ilvA (V323A) mutation was introduced into CJ3P:: hom (G378E) as its control was also produced. Recombinant vectors for mutation introduction were constructed as follows.
[164]
To construct a vector introducing ilvA (V323A), first, using genomic DNA extracted from WT strain as a template , restriction enzyme XbaI in 5'fragment and 3'fragment at about 600bp back and forth from positions 966 to 969 of the ilvA gene. Primers SEQ ID NOs: 55 and 56 into which the recognition site was inserted were synthesized. In addition, primers SEQ ID NOs: 57 and 58 for substituting the base sequence of the ilvA gene were synthesized (Table 9). The pDZ- ilvA (V323A) plasmid was constructed in a form in which DNA fragments located at the 5'and 3'ends of the ilvA gene (600 bp each) were linked to a pDZ vector (Korean Patent No. 2009-0094433). Using the chromosome of the WT strain as a template, the 5'end gene fragment was prepared through PCR using primers SEQ ID NOs: 55 and 57. PCR conditions were denatured at 94°C for 2 minutes, denaturation at 94°C for 1 minute, annealing at 56°C for 1 minute, polymerization at 72°C for 40 seconds was repeated 30 times, and then polymerization was performed at 72°C for 10 minutes. .
[165]
In the same way, a gene fragment located at the 3'end of the ilvA gene was produced through PCR using SEQ ID NOs: 56 and 58. The amplified DNA fragment was purified using Quiagen's PCR Purification kit, and then used as an insert DNA fragment for vector construction. Meanwhile , after treatment with restriction enzyme XbaI , the pDZ vector heat-treated at 65° C. for 20 minutes and the inserted DNA fragment amplified through the above PCR were ligated using an Infusion Cloning Kit, transformed into E. coli DH5α, and kanamycin (25 mg/l ) Was spread on the LB solid medium. After selecting a colony transformed with a vector into which the target gene is inserted through PCR using primer sequences 55 and 56, a plasmid was obtained using a commonly known plasmid extraction method, and the base substitution mutation of ilvA (V323A) was transferred to the chromosome. The vector pDZ- ilvA (V323A) was constructed for introduction .
[166]
[Table 9]
primer Sequence (5' -> 3')
Primer (SEQ ID NO: 55) ACGGATCCCAGACTCCAAAGCAAAAGCG
Primer (SEQ ID NO: 56) ACGGATCCAACCAAACTTGCTCACACTC
Primer (SEQ ID NO: 57) ACACCACGGCAGAACCAGGTGCAAAGGACA
Primer (SEQ ID NO: 58) CTGGTTCTGCCGTGGTGTGCATCATCTCTG
[167]
The pDZ- ilvA (V323A) vector was introduced into the CJ3P:: hom (G378E) and CJ3P:: gltA (N241T)- hom (G378E) strains in the same manner as in Example 6, in which a nucleotide mutation was introduced into the ilvA gene, CJ3P:: hom (G378E)- ilvA (V323A) and CJ3P:: gltA (N241T)- hom (G378E)- ilvA (V323A) were obtained. The obtained two strains were cultured in the same manner as in Example 5 to analyze the isoleucine production concentration, sugar consumption rate, and culture medium components, and are shown in Table 10 below.
[168]
[Table 10] Isoleucine production concentration, sugar consumption rate and culture medium components
Strain Ile concentration (g/L) GA concentration (mg/L) Per consumption rate (g/hr)
CJ3P:: hom (G378E)- ilvA (V323A) 0.5 2912 4.92
CJ3P:: gltA (N241T)- hom (G378E)- ilvA (V323A) 1.6 2006 5.13
[169]
As a result of analysis of isoleucine production ability, sugar consumption rate, and concentration of glutamic acid in the culture medium component, it was confirmed that the concentration of isoleucine was significantly increased and the concentration of glutamic acid was decreased at a level similar to the sugar consumption rate in the strain introduced with the variant of gltA (N241T).
[170]
From the above description, those skilled in the art to which the present application belongs will understand that the present application may be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including all changes or modified forms derived from the meaning and scope of the claims to be described later rather than the above detailed description, and equivalent concepts thereof.
[171]

Claims
[Claim 1]
A variant polypeptide having citrate synthase activity in which asparagine at position 241 in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.
[Claim 2]
The variant polypeptide according to claim 1, wherein the 241 asparagine is substituted with an amino acid other than lysine.
[Claim 3]
The variant polypeptide according to claim 1, wherein the other amino acid is an aromatic amino acid or a hydrophilic amino acid.
[Claim 4]
The variant polypeptide of claim 1, wherein the 241 asparagine is substituted with threonine, serine or tyrosine.
[Claim 5]
A polynucleotide encoding the variant polypeptide of claim 1.
[Claim 6]
A microorganism comprising the variant polypeptide of claim 1, Corynebacterium sp .
[Claim 7]
7. The method of claim 6 wherein the microorganism is the genus Corynebacterium to produce L- amino acid, genus Corynebacterium ( Corynebacterium sp.) Microorganisms.
[Claim 8]
The method of claim 6, wherein the microorganism of the genus Corynebacterium produces aspartate-derived L-amino acid, the microorganism of the genus Corynebacterium .
[Claim 9]
The microorganism of the genus Corynebacterium according to claim 6, wherein the microorganism of the genus Corynebacterium produces at least one L-amino acid selected from the group consisting of lysine, threonine, methionine, homoserine or a derivative thereof, and isoleucine. .
[Claim 10]
The microorganism of claim 6, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum .
[Claim 11]
Culturing the microorganism of claim 6 in a medium; And recovering L-amino acid from the cultured microorganism or medium.
[Claim 12]
The method of claim 11, wherein the L-amino acid is an aspartate-derived L-amino acid.
[Claim 13]
The method of claim 11, wherein the L-amino acid is at least one selected from the group consisting of lysine, threonine, methionine, homoserine or derivatives thereof, and isoleucine.

Documents

Application Documents

# Name Date
1 202017025406-STATEMENT OF UNDERTAKING (FORM 3) [17-06-2020(online)].pdf 2020-06-17
2 202017025406-SEQUENCE LISTING(PDF) [17-06-2020(online)].pdf 2020-06-17
3 202017025406-SEQUENCE LISTING [17-06-2020(online)].txt 2020-06-17
4 202017025406-PRIORITY DOCUMENTS [17-06-2020(online)].pdf 2020-06-17
5 202017025406-FORM 1 [17-06-2020(online)].pdf 2020-06-17
6 202017025406-FIGURE OF ABSTRACT [17-06-2020(online)].pdf 2020-06-17
7 202017025406-DRAWINGS [17-06-2020(online)].pdf 2020-06-17
8 202017025406-DECLARATION OF INVENTORSHIP (FORM 5) [17-06-2020(online)].pdf 2020-06-17
9 202017025406-COMPLETE SPECIFICATION [17-06-2020(online)].pdf 2020-06-17
10 202017025406-MARKED COPIES OF AMENDEMENTS [19-06-2020(online)].pdf 2020-06-19
11 202017025406-FORM 13 [19-06-2020(online)].pdf 2020-06-19
12 202017025406-AMMENDED DOCUMENTS [19-06-2020(online)].pdf 2020-06-19
13 202017025406-FORM 18 [20-06-2020(online)].pdf 2020-06-20
14 202017025406-certified copy of translation [09-07-2020(online)].pdf 2020-07-09
15 202017025406-Proof of Right [01-09-2020(online)].pdf 2020-09-01
16 202017025406-FORM-26 [11-09-2020(online)].pdf 2020-09-11
17 202017025406-ENDORSEMENT BY INVENTORS [11-09-2020(online)].pdf 2020-09-11
18 202017025406-FORM 3 [02-11-2020(online)].pdf 2020-11-02
19 202017025406.pdf 2021-10-19
20 202017025406-Power of Attorney-140920.pdf 2021-10-19
21 202017025406-OTHERS-140920.pdf 2021-10-19
22 202017025406-OTHERS-100820.pdf 2021-10-19
23 202017025406-Form 5-140920.pdf 2021-10-19
24 202017025406-Correspondence-140920.pdf 2021-10-19
25 202017025406-Correspondence-100820.pdf 2021-10-19
26 202017025406-FER.pdf 2022-11-18
27 202017025406-PETITION UNDER RULE 137 [18-05-2023(online)].pdf 2023-05-18
28 202017025406-OTHERS [18-05-2023(online)].pdf 2023-05-18
29 202017025406-MARKED COPIES OF AMENDEMENTS [18-05-2023(online)].pdf 2023-05-18
30 202017025406-FORM 3 [18-05-2023(online)].pdf 2023-05-18
31 202017025406-FORM 13 [18-05-2023(online)].pdf 2023-05-18
32 202017025406-FER_SER_REPLY [18-05-2023(online)].pdf 2023-05-18
33 202017025406-COMPLETE SPECIFICATION [18-05-2023(online)].pdf 2023-05-18
34 202017025406-CLAIMS [18-05-2023(online)].pdf 2023-05-18
35 202017025406-AMMENDED DOCUMENTS [18-05-2023(online)].pdf 2023-05-18
36 202017025406-US(14)-HearingNotice-(HearingDate-10-01-2024).pdf 2023-12-07
37 202017025406-Correspondence to notify the Controller [10-01-2024(online)].pdf 2024-01-10
38 202017025406-Written submissions and relevant documents [23-01-2024(online)].pdf 2024-01-23
39 202017025406-PatentCertificate20-02-2024.pdf 2024-02-20
40 202017025406-IntimationOfGrant20-02-2024.pdf 2024-02-20

Search Strategy

1 SearchstrategyE_17-11-2022.pdf
2 PATENTLENSE_17-11-2022.pdf

ERegister / Renewals

3rd: 01 Apr 2024

From 12/02/2021 - To 12/02/2022

4th: 01 Apr 2024

From 12/02/2022 - To 12/02/2023

5th: 01 Apr 2024

From 12/02/2023 - To 12/02/2024

6th: 01 Apr 2024

From 12/02/2024 - To 12/02/2025

7th: 12 Dec 2024

From 12/02/2025 - To 12/02/2026