Abstract: The present invention relates to methods of increasing oil content in Jatropha Curcas L. plants. The invention further provides a partial and complete cDNA sequence encoding Jatropha acetyl CoA carboxylase (ACCase) and methods for cloning and expressing the Jatropha ACCase gene to produce transgenic plants with increased oil content.
FORM 2
THE PATENTS ACT, 1970
(39 of 1970)
&
THE PATENT RULES , 2003
PROVISIONAL SPECIFICATION
(See Section 10; rule 13)
"MOLECULAR CLONING AND SEQUENCING OF
ACETYL CoA CARBOXYLASE (ACCase) GENE
FROM JATROPHA CURCAS."
RELIANCE LIFE SCIENCES PVT.LTD
an Indian Company having its Registered Office at
Chitrakoot, 2nd Floor,
Shree Ram Mills Compound,
Ganpath Rao Kadam Marg,
Worli, Mumbai - 400 013,
Maharashtra, India.
The following specification particularly describes and ascertains the nature of this invention and the manner in which it is performed:-
FIELD OF THE INVENTION
The present invention relates to methods of increasing oil content of Jatropha Curcas. In particular, the invention is directed to a complete cDNA sequence and partial DNA sequence encoding Jatropha acetyl CoA carboxylase (ACCase) or otherwise enhance the commercial value of the plant. The invention also provides methods for cloning and expressing the Jatropha ACCase gene to form transgenic plants with increased oil content.
BACKGROUND OF THE INVENTION
Acetyl-CoA carboxylase (ACCase, EC 6.4.1.2) have a very important regulatory role in controlling plant fatty acid biosynthesis and thereby affect lipid biosynthesis. ACCase catalyzes the ATP-dependent carboxylation of acetyl-CoA to produce malonyl-CoA. This reaction occurs in two steps, carboxylation of a biotin prosthetic group using HCO3 as a carboxyl donor, followed by a transfer of the carboxyl group from biotin to acetyl-CoA. The biotin carboxylase, carboxyl transferase, and biotin components of ACCase are each associated with different polypeptides in prokaryotes. Samols, D. et al., J. Biol. Chem. 263:6461-6464 (1988). In contrast, ACCase of non-plant eukaryotes is comprised of multimers of a single multi-functional polypeptide.
In plants both prokaryotic type ACCase and a eukaryotic type have been found. (Kannangara, C. G. et al., Arch. Biochem. Biophys. 152:83-91 (1972); Nikolau, B. J. et al., "The Biochemistry and Molecular Biology of Acetyl-CoA Carboxylase and Other Biotin Enzymes," In N Murata, C Somerville, eds, Biochemistry and Molecular Biology of Membrane and Storage Lipids of Plants, American Society of Plant Physiologists, Rockville, Md. pp. 138-149 (1993) and Sasaki, Y. et al, J. Biol. Chem. 268:25118-25123 (1993)) (Harwood, J. L., Annu. Rev. Plant Physiol. Plant Mol. Biol. 39:101-138 (1988).
The malonyl-CoA produced by ACCase is responsible for the reactions and pathways in plants, including fatty acid synthesis and elongation, flavonoid synthesis and malonation of the ethylene precursor aminocyclopropane-1-carboxylate, and malonation of amino acids and glycosides. (Harwood, J. L., Annu. Rev. Plant Physiol. Plant Mol. Biol. 39:101-138 (1988)) (Ebel, J. et al., Eur. J Biochem. 75:201-209 (1977) Ebel, J. et al., Arch. Biochem. Biophys. 232:240-248 (1984)), (Liu, Y. et al., Planta 158:437-441 (1983); Kionka, C. et al., Planta 162:226-235 (1984))
Malonyl-CoA is available in multiple subcellular locations because some of these reactions such as fatty acid synthesis occur in the plastid while others, such as flavonoid synthesis and fatty acid elongation, occur outside the plastid. For example, very long chain fatty acids are components of plasma membrane lipids (Cahoon, E. B. et al., Plant Physiol. 95:58-68 (1991)) and are also needed for synthesis of cuticular waxes to cover the surface of both aerial and underground tissues. Harwood, J. L., Annu. Rev. Plant Physiol. Plant Mol. Biol. 39:101-138 (1988). These very long chain fatty acids are synthesized outside the plastid by elongation of 16 or 18 carbon fatty acids exported from the plastid. Malonyl-CoA for the elongation reactions is present in the cytosol, and is presumably provided by a cytosolic ACCase.
Malonyl-CoA is available in greatly differing amounts with respect to time and tissue. For example, increased amounts of malonyl-CoA are needed for fatty acid synthesis in developing seeds of species, which store large quantities of triacylglycerols. Post-Beitenmiller, D. et al., "Regulation of Plant Lipid Biosynthesis: An Example of Developmental Regulation Superimposed on a Ubiquitous Pathway," In DPS Verma, ed, Control of Plant Gene Expression, CRC press, Boca Raton, Fla. pp. 157-174 (1993). In floral tissue, malonyl-CoA is used in the chalcone synthase reaction for synthesis of the flavonoid pigments, which constitute up to 15% of the dry weight of this tissue. Goodwin, T. W. et al., "Introduction to Plant Biochemistry," 2nd ed., Pergamon Press New York, p. 545 (1983). In some tissues, ACCase may provide malonyl-CoA constitutively to produce fatty acids for membrane synthesis and maintenance, and for a short period to synthesize flavonoids during exposure to UV light (Ebel, J. et al., Eur J Biochem. 75:201-209 (1977))
or during fungal pathogen attack. Ebel, J. et al., Arch. Biochem. Biophys. 232:240-248 (1984).
Various observations have led to the belief that ACCase is the rate-limiting enzyme for oilseed fatty acid synthesis. Analysis of substrate and product pool sizes has implicated ACCase in the light/dark regulation of fatty acid synthesis in spinach leaves and chloroplasts. Post-Beitenmiller, D. et al., J. Biol. Chem. 266:1858-1865 (1991) and Post-Beitenmiller, D. et al., Plant Physiol. 100:923-930 (1992). Furthermore, ACCase activity increases in association with lipid deposition in developing seeds of oilseed crops. Simcox, P. D. et al., Canada J. Bot. 57:1008-1014 (1979); Turnham, E. et al., Biochem. J. 212:223-229 (1983); Charles et al, Phytochem. 25:55-59 (1986) and Deerburg, S. et al, Planta 180:440-444(1990).
Therefore, it is necessary to provide a gene encoding acetyl-CoA carboxylase (ACCase), which would control the carboxylation of acetyl-CoA to produce fatty acid synthesizer, malonyl-CoA. To gain long term control of fatty acid synthesis and elongation in plants, seeds, cultures, cells and tissues of Jatropha curcas it is desirable to clone and obtain complete sequence of the ACCase gene, and later transform it into plant tissues through either Agrobacterium mediated or biolistic means under the stable plant promoter. This might provide genetically altered Jatropha plants with high oil content.
Roesler (1994) et al., Plant Physiol. 105: 611-617 have characterised an Arabidopsis gene that encodes cytosolic acetyl-CoA carboxylase (ACCase) isozyme. In US patent 6723895, inventors disclosed that seeds of plants containing recombinant nucleic acid construct comprising a cytosolic ACCase operable linked to a promoter exhibit statistically significant increased oil content as compared to seeds produced by a corresponding plant lacking the nucleic acid encoding ACCase in Soya Bean plant.
It is reported that ACCase increases the amount of malonyl-CoA available for synthesis of flavonoids, isoflavonoids, and other secondary metabolites. Conversely, decreasing expression of the ACCase gene may decrease the amount of malonyl-CoA present in a
plant and increase the amount of acetyl-CoA. Thus, altering expression of the ACCase gene could alter the amount of acetyl-CoA or malonyl-CoA available for production of secondary plant products, many of which have value in plant protection against pathogens, or for medicinal or other uses.
Knowing the state of art and knowing the need, which has existed for years to find a sequence that could control fatty acid synthesis, the researchers of the present invention have focused its research in isolating a sequence that may be used to generally increase and decrease the carboxylation of acetyl-CoA to produce malonyl-CoA in plants. In the present invention, the applicants have disclosed a partially sequenced cytosolic ACCase whose expression can control carboxylation of acetyl-CoA to produce malonyl-Co A.
Keeping in mind that malonyl-CoA is required for fatty acid synthesis and elongation in plants and seeds, by overexpressing cytosolic ACCase, the inventors of the present invention have also been successful in developing a method that controls plant and seed fatty acid synthesis and elongation. It is observed in rapeseed, soybean, or other oilseed crops that overexpressing the ACCase gene would increase seed fatty acid synthesis resulting in increased oil content of rapeseed, soybean, or other oilseed crops. It has further been observed that decreasing seed fatty acid synthesis by decreasing ACCase gene expression results in "low-fat" seeds such as low-fat peanuts.
Increasing seed fatty acid elongation by overexpressing the cytosolic ACCase gene is also useful in increasing the content of very long chain fatty acids such as erucic acid in the seed oil of rapeseed, Crambe, and other oilseed plants have been reported in Battey, J. F. et al., Trends in Biotech. 7:122-125 (1989). This is desirable because erucic acid and its derivatives can be used in making lubricants, plasticizers and nylons, and has other industrial uses as well. Although erucic acid has important industrial uses, it may not be healthy for human consumption in food products. Therefore, reducing fatty acid elongation, and thereby reducing erucic acid content, by decreasing the expression of cytosolic ACCase genes through anti-sense RNA methods, is also desirable. This may result in seed oil of rapeseed, mustard, Crambe and other oilseed plants that is suitable for human
consumption because of the reduced content of erucic acid, eicosenoic acid and other very long chain fatty acids.
ACCase is also the target for herbicides of the aryloxyphenoxy propionate and cyclohexanedione families as reported in Burton, J. D. et al., Biochem. Biophys. Res. Commun. 148:1039-1044 (1987). The ACCase of some monocots such as corn is far more susceptible to these herbicides than is the ACCase of dicot species. Therefore, overexpression of the ACCase gene from the dicot Arabidopsis in plastids of susceptible species like corn, may result in herbicide resistance in the desired species. Herbicides would thus be useful in controlling monocot weeds in fields of the genetically engineered plant species.
Studies have shown that, acetyl-CoA and malonyl-CoA are precursors of various plant secondary metabolites. Thus, increasing expression of the ACCase increases the amount of malonyl-CoA available for synthesis of flavonoids, isoflavonoids, plant fatty acid synthesis and other secondary metabolites.
Accordingly, the present invention contemplates the production of transgenic plant by expressing ACCase of Jatropha which can be introduced as constructs of cytosolic ACCase into a plant cell, and growing the cell into a callus and then into a plant; or, alternatively, producing a transgenic plant directly through leaf disc transformation.
OBJECT OF THE INVENTION
It is the object of the present invention to provide complete cDNA sequence and partial DNA sequence encoding Jatropha ACCase enzyme.
It is still an object of the present invention to provide an expression cassette comprising a gene coding for acetyl CoA carboxylase or a functional mutant thereof operably linked to a promoter functional in a plant cell.
It is still an object of the present invention to provide methods for altering the oil content of plants by introducing and expressing Jatropha acetyl CoA carboxylase gene in the plant cells.
It is also an object of the present invention to provide transgenic plant, which has increased oil content of atleast 1.5-2 fold thus enhancing the commercial value of the plant.
SUMMARY OF THE INVENTION
The present invention relates to isolating a sequence that may be used to generally increase and decrease the carboxylation of acetyl-CoA to produce malonyl-CoA in plants. In the present invention, the applicants have disclosed a partially sequenced cytosolic ACCase whose expression can control carboxylation of acetyl-CoA to produce malonyl-CoA. The invention in particular provides a complete cDNA sequence and partial DNA sequence encoding Jatropha acetyl CoA carboxylase.
The present invention further provides a method of increasing oil content of Jatropha Curcas. The invention also provides methods for cloning and expressing the Jatropha ACCase gene to form transgenic plant with increased oil content. Accordingly, the present invention contemplates the production of transgenic plant by expressing ACCase of Jatropha which can be introduced as constructs of cytosolic ACCase into a plant cell, and growing the cell into a callus and then into a plant; or, alternatively, producing a transgenic plant directly through leaf disc transformation.
In one embodiment, the present invention provides an isolated and purified cDNA molecule that comprises a segment of cDNA encoding Jatropha ACCase gene. The cDNA molecule encoding a plant acetyl CoA carboxylase can encode an unaltered plant acetyl CoA carboxylase or an altered plant acetyl CoA carboxylase encoding an antisense cDNA sequence that is substantially complementary to a plant acetyl CoA carboxylase gene or to a portion thereof. A cDNA molecule of the present invention can also further comprise an
amino terminal plant chloroplast transit peptide sequence operably linked to the Jatropha acetyl CoA carboxylase gene.
In another embodiment, the present invention provides methods of producing Jatropha plants with increased or altered oil content. The methods include introducing and expressing a plant ACCase gene in the plant cells. The method further includes the steps of introducing a chimeric cDNA molecule comprising a gene coding for a plant acetyl CoA carboxylase or an altered or a functional mutant thereof operably linked to a promoter functional in a plant cell into the cells of plant tissue and expressing the gene in an amount effective to alter the oil content of the plant cell.
In another embodiment, the present invention provides methods for an alteration in oil content which includes a change in total oil content over that normally present in that type of plant cell or a change in the type of oil present in the cell. An alteration in oil content in the plant cell, according to the method of the invention can be achieved by at least two methods including:
(1) an increase or decrease in expression of an altered plant acetyl CoA carboxylase gene; or (2) by introducing an altered or functional mutant plant acetyl CoA carboxylase gene.
In one of the preferred embodiments, the methods comprises the following steps:
1.Isolation and identification of ACCase gene in Jatropha.
2.Formation of cDNA clones encoding ACCase .
3.Preparation of expression cassettes.
4.Introduction/Transfer of expression cassettes in plant cells
5.Detection of the expression/ activity of encoded gene in transgenic plant.
6.Plant regeneration
In one preferred embodiments, the isolation and identification of gene coding for ACCase in Jatropha involves the a gDNA or cDNA pool isolated and identified by using a degenerate primer strategy using standard methods as described by Sambrook et. Al (1989). The partial ACCase gene is incorporated herein in the detailed description. The presence of
an isolated full-length copy of a plant ACCase gene is verified by partial sequence analysis, or by expression of a plant acetyl CoA carboxylase enzyme.
In another embodiment of the present invention, the DNA fragments encoding portions of 5', middle and 3' ends are obtained which are used to construct expression cassette containing ACCase gene. This method involves the combination of unaltered ACCase with a promoter or by introducing multiple copies of an expression cassette into cells. In the preferred embodiments the isolated unaltered ACCase gene is combined with a promoter functional in a plant cell to form an expression vector.
In one embodiment of the present invention, the promoters used for a high level of gene expression are inducible promoters, which are also known as strong promoters. In the preferred embodiments the strong promoter used is an isolated sequence for heterologous genes expression, which will help in easy detection and selection of transformed cells, while providing a high level of gene expression when desired. In the most preferred embodiment of the present invention, the promoters are specific and functional for over expression of acetyl coA of a plant ACCase gene or functional mutant thereof. Such promoters include but not limited to 35 S cauliflower mosaic virus promoter, nopaline synthase (NOS) promoter and several other endosperm specific promoters such as Beta-phaseolin, napin, and ubiquitin,
In another embodiment of the present invention, the expression cassette can also optionally contain other DNA sequences.
In yet another embodiment of the present invention, the expression cassette further comprises of a chloroplast transit peptide sequence operably linked between a promoter and a plant ACCase gene.
In another embodiment of the present invention, the expression cassette to be introduced into a plant cell, can also contain plant transcriptional termination and polyadenylation signals and translational signals linked to the 3' terminus of a plant ACCase gene.
In another embodiment of the present invention the DNA fragment coding for the transit peptide can be chemically synthesized either wholly or in part from the known sequences of transit peptide.
In another embodiment of the present invention, the expression cassette comprising an ACCase gene is subcloned into a known expression vector. The method comprises introducing an expression vector into a host cell and detecting and/or quantitating expression of a plant ACCase gene. Suitable vectors include plasmids or other binary vectors. The expression vector can be introduced in prokaryotic or eukaryotic cells by protoplast transformation, Agrobacterium mediated transformation, Electroporation, microprojectile or any conventional techniques. The selection of the transformed cells can be done by using selected markers encoded on the expression vector.
In one embodiment of the present invention, the detection of gene expression can be done by PCR techniques or quantitatively detected by Western Blots. A change in the specific enzyme activity is detected by measuring the enzyme activity in transformed cells. The change in oil content is examined by standard methods.
In one embodiment of the present invention, the methods includes generation of transgenic plants and seeds showing a change in oil content on in amount or specific activity of plant ACCase gene using standard methods. In the preferred embodiments the present invention provides seeds with increased oil content of atleast 1.5-2 fold thus enhancing the commercial value of the plant.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, the inventions of which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
Figure 1: illustrates the Amplification of 625 base pairs genomic fragment of ACCase gene from Jatropha Curcas.
Figure 2: illustrates the nucleotide sequence of pGEM:Jl clone containing 597 bp intermediate fragment of ACCase gene from Jatropha curcas. The primer binding sites (ME23 and ME25 ) are underlined.
Figure 3 illustrates the nucleotide sequence of clone no. J-2 Forward (Seq ID No.2) and J-2 Reverse (Seq ID No. 3) containing 1.25kb intermediate fragment of ACCase gene from latropha curcas.
Figure 4 illustrates the confirmation of 1.25kb amplified fragment of ACCase gene from Jatropha curcas
DETAILED DESCRIPTION OF THE INVENTION
Defintions:
As used herein "Gene transfer" refers to incorporation of exogenous DNA into an
organism's cells, usually by a vector.
As used herein, the term "transformed" refers to a cell, tissue, organ, or organism into which has been introduced an exogenous polynucleotide molecule, such as a construct. Preferably, the introduced polynucleotide molecule is integrated into the genomic DNA of the recipient cell, tissue, organ, or organism such that the introduced polynucleotide molecule is inherited by subsequent progeny.
A "transgenic" or "transformed" cell or organism also includes progeny of the cell or organism and progeny produced from a breeding program employing such a transgenic plant as a parent in a cross and exhibiting an altered phenotype resulting from the presence of an exogenous polynucleotide molecule
As used herein "Agrobacterium mediated transformation" is the use of Agrobacterium to transfer DNA to plant cells harnessed for the purposes of plant genetic engineering
As used herein "Increased" or "altered" or "high" "oil content" Jatropha curcas plant is one having seeds with increased oil content. For example, Jatropha curcas having seeds above 30 % oil content is considered to be a "high oil content" plant.
In accordance with the embodiments, the present invention provides isolation and identification of the ACCase gene in Jatropha plant. The gene encoding plant ACCase is identified and isolated from a gDNA or cDNA pool of Jatropha curcas L. using a degenerate primer strategy. Its partial sequence is obtained by standard methods, as described by Sambrook et al., (1989) which is incorporated herein by way of reference in the present invention. The sequence homology has been compared with other known acetyl Co A carboxylase. The DNA fragments encoding portions of the 5', middle and 3' ends obtained are used to construct expression cassette containing ACCase gene. The presence of an isolated full-length copy of a plant ACCase gene are verified by partial sequence analysis, or by expression of a plant acetyl CoA carboxylase enzyme.
The cDNA or partial DNA sequence is then combined with a suitable promoter to form a recombinant expression cassette. This expression cassette is then transferred/ introduced and expressed in a plant cells. The plant cells are then detected for enzyme activity or gene expression and then further regeneration for plants with high oil content.
After the plant ACCase gene is obtained and amplified, it can then combined with a suitable promoter functional in a plant cell to form an expression cassette.
An expression cassette of the invention comprised a gene encoding a plant acetyl CoA carboxylase or functional mutant thereof operably linked to a promoter functional in a plant cell. The gene can code for a plant ACCase that is can alter oil of the plant cell. An expression cassette of the invention also included an antisense DNA sequence that is
complementary to an ACCase gene or a portion thereof operably linked to a promoter. The promoter is selected from constitutive or tissue specific such as endosperm specific.
Most genes have regions of DNA sequences that are known as promoters, which regulate gene expression. Promoter regions are typically found in the flanking DNA sequence upstream from the coding sequence in both prokaryotic and eukaryotic cells. A promoter sequence provides for regulation of transcription of the downstream gene sequence and typically includes from about 50 to about 2000 nucleotide base pairs. Promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of gene expression. Some isolated promoter sequences can provide for gene expression of heterologous genes, that is a gene different from the native or homologous gene. Promoter sequences are also known to be strong or weak or inducible. A strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression. An inducible promoter is a promoter that provides for turning on and off of gene expression in response to an exogenously added agent or to an environmental of developmental stimulus. Promoters can also provide for tissue specific or developmental regulation. An isolated promoter sequence that is a strong promoter for heterologous genes is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells and provides for a high level of gene expression when desired. Specific promoters functional in plant cells include the 35 S cauliflower mosaic virus promoter, nopaline synthase (NOS) promoter and the like. Currently, a preferred promoter for expression is the 35S cauliflower mosaic virus promoter and several endosperm specific promoters such P-phaseolin, napin and ubiquitin, but not limited to.
An ACCase gene can be combined with the promoter by standard methods as described in Sambrook cited above. Briefly, a plasmid containing a promoter such as the 35 S cauliflower mosaic virus promoter can be constructed as described in Jefferson, Plant Molecular Biology Reporte 5: 387 (1987) or obtained from Clonetech Lab in Palo Alto, Calif (e.g. pBI121 or pBI221). Typically these plasmids are constructed to provide for multiple cloning sites having specificity for different restriction enzymes downstream from
the promoter. A gene for plant ACCase can be subcloned downstream from the promoter using restriction enzymes to ensure that the gene is inserted in proper orientation with respect to the promoter so that the gene can be expressed. In a preferred version, a Jatropha ACCase is operably linked to a 35S CaMV, or P-phaseolin or napin or ubiquitin promoter in a plasmid such as pBI121 or pBI221. Once a plant ACCase gene is operably linked to a promoter and the plasmid, the expression cassette so formed can be subcloned into other plasmids or vectors.
The expression cassette can also optionally contain other DNA sequences. The expression cassette can further be comprised of a chloroplast transit peptide sequence operably linked between a promoter and a plant ACCase gene. If the expression cassette is to be introduced into a plant cell, the expression cassette can also contain plant transcriptional termination and polyadenylation signals and translational signals linked to the 3' terminus of a plant ACCase gene. As one site of action for biosynthetic pathways involving plant ACCase is the chloroplast, an expression cassette can be combined with a DNA sequence coding for a chloroplast transit peptide, if necessary. A chloroplast transit peptide is typically 40 to 70 amino acids in length and functions post translationally to direct the protein to the choloroplast. The transit peptide is cleaved either during or just after import into the chloroplast to yield the mature protein. The complete copy of a gene encoding a plant ACCase may contain a chloroplast transit peptide sequence. In that case, it may not be necessary to combine an exogenously contained chloroplast transit peptide sequence into the expression cassette.
Transit peptide sequences are the small subunit of ribulose biphosphate carboxylase, ferridoxin, chlorophyll a/b binding protein, and so on. Alternatively, the DNA fragment coding for the transit peptide may be chemically synthesized either wholly or in part from the known sequences of transit peptide. Regardless of source of transit peptide, it should include a translation initiation codon and an amino acid sequence that is recognised by and will function properly in chloroplasts of the host plant. The amino acid sequence at the junction between the transit peptide and the plant ACCase is an essentially responsible for cleaving, to yield mature enzyme.
The invention also provides for a method of producing plant ACCase in a host cell. The methods include the steps of introducing an expression cassette comprising a gene encoding a plant ACCase. An expression cassette can include a promoter that is functional in either a eukaryotic or a prokaryotic cell. Preferably, the expression cassette is introduced into a prokaryotic cell such as E.coli that is routinely used for production of recombinantly produced proteins. An expression cassette can be introduced into either monocots or dicots by standard methods including protoplast transformation, Agrobacterium mediated transformation, microprojectile, Electroporation and the like. Transformed tissues or cells can be selected for the presence of a selectable marker gene.
A method for screening for expression or overexpression of a plant ACCase gene is also provided by the invention. Once formed, an expression cassette comprising an ACCase gene can be subcloned into a known expression vector. The screening method includes the steps of introducing an expression vector into a host cell and detecting and/or quantitating expression of a plant ACCase gene.
Transient expression of a plant ACCase gene can be detected and quantitated in the transformed cells. Gene expression can be quantitated by a quantitative Western blot using antibodies specific for the cloned ACCase or by detecting an increased specific activity of the enzyme. Expression cassettes providing for overexpression of plant ACCase can be then used to transform monocots /and or dicot tissues to regenerate transformed plant and seeds.
The invention also provide a method of altering the oil content in a plant. The method include the steps of introducing an expression cassette comprising a gene coding for plant ACCase operably linked to a promoter functional in a plant cell into the cells of plant tissue and expressing the gene in an amount effective to alter the oil content of the plant cell. An alteration in the oil content of a plant cell can include a change in the total oil content over that normally present in the plant cell. Expression of the gene in an amount effective to alter the oil content of the gene depends on whether the gene codes for an unaltered
ACCase or a mutant or altered form of the gene. Expression of an unaltered plant ACCase in an effective amount is that amount may provide a change in the oil content of the cell from about 1.2 to 2 fold over that normally present in that plant cell, and preferably increases the amount of ACCase about 2-to 20-fold over that amount of the enzyme normally present in that plant cell. An altered form of the enzyme can be expressed at levels comparable to that of the native enzyme or less if the altered form of the enzyme has higher specific activity.
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1: Isolation and identification of ACCase gene in Jatropha.
The mature seeds of Jatropha curcas are obtained from Andhra Pradesh, South India. The seeds are germinated in natural fileds. Very young leaves are collected from 2-3 month old seedlings. The material is stored at -70°C until use. The genomic DNA from above leaf material is extracted following method provided by Sigma Gen Elute ™ Plant Genomic DNA miniprep kit ( Sigma, USA).
EXAMPLE 2: Formation of cDNA clones encoding ACCase. Designing degenerate oligonucleotide primers:
The amplification of cytosolic ACCase gene from Jatropha curcas L. using degenerate primer strategy by PCR and its partial sequence is presented herein. Multiple primers with low degeneracy rate, particularly at the 3'end, and in the intermediate fragments are designed based on the conserved sequence motifs of ACCase gene family of Zea mays
(gi| 1045304), Oryza sativa (japonica cultivar-group) (gi|3753346), Medicago sativa (gi|495724 ), Arabidopsis thaliana (gi|501151), Brassica napus (gi| 12057068), Triticum aestivum (gi:514305) and Glycine max (clones 513 and 1221) (gi|1066856) aligning the sequence by Clustal W. Twenty three combinations of degenerate oligonucleotide primers both in reverse and forward directions were designed and tested on the genomic DNA of J. curcas.
Amplification of 625 bp conserved domain: In order to characterise the Jatropha ACCase
gene, amplification of the part of the gene with PCR is done using degenerate nucleotide
primers. Using degenerate primers ME23
(5'GAGGTSTAYAGCTTYCASATGC3'forward primer) and ME25
5'CTGAAGDATTCCTTCRAAVAG3' reverse primer), approximately 625 bp intermediate fragment is amplified from genomic DNA of Medicago sativa, Arabidopsis and Jatropha curcas (Fig. 1) suggesting that it is indeed a conserved motif. The amplification is performed in a Eppendorf Gradient Thermal Cycler (96 wells) system for 35 cycles with 45s at 94°C, 45s at 55°C and 1 min at 72°C. Where as first ten cycles is used at Touch Down program of 65°C-55°c by decreasing 1°C every cycle and for remaining 25 cycles 55°C annealing temperature is maintained. After the final cycle the amplification is extended for 7 min at 72°C. Products of degenerate primer PCR reactions are subjected to gel electrophoresis (1% agarose, with TAE as the running buffer) according to Sambrook et al (1989) and DNA fragments of 625 bp in the length are recovered from the gel using QIA quick Gel Extraction kit (Qiagen). This product is then cloned into pGEM-T Easy Vector System I (Promega Corp, USA) and transformed into Escherichia coli DH5a (Gibco BRL) which has been designated as pGEM:Jl clone.
Sequencing of pGEM: Jl clone: Positive recombinant colonies were isolated and plasmid DNA isprepared. Sequencing is carried out against Ml3 forward and reverse universal primers using ABI Prism Automated sequencing. For 597bp sequencing results please see Fig. 2.
Sequence similarity and comparison among various ACCase gene family: The
encoding nucleotide sequence of clone pGEM:Jl containing 625 bp conserved motif of ACCase gene from Jatropha curcas has been subjected to Blastn of GenBank.
A database search with Blastn (National Center for Biotechnology Information databases) showed relatively high similarity with other ACCase gene family. The percentage of similarity with Glycine max (gi|992916) 84%; Medicago sativa (gi|495724) 84%; Phaseolus vulgaris (gi|7839251) 84%; Elaeis guineensis micro satellite (gi|12053787) 100%.
Amplification of 1.25kb intermediate fragment from ACCase gene: With the initial clue and sequence of 597 bp intermediate fragment from conserved sequence motif of J. curcas (Fig.2), we have designed gene specific forward primers at 597bp region and degenerate nucleotide reverse primer from 3'end. Gene specific forward primer ME-50 5' GTCTCAGATGATCTAGAAGGTGTATC 3' and degenerate reverse primer ME-59 5'AGCAAGWCCTTGWGGYAGAGCTTG3' (designed based on conserved domain of Medicago sativa, Arabidopsis and Glycine max at 3' region). The product of ME50 and ME 59 was 1.3 kb fragment has been amplified and gel eluted as described earlier. The PCR product was sequenced and has been designated as J-2. (Fig.3). Based on sequence results of above 1.3 kb fragment gene specific forward (ME-75 5'GTGGACCCATAGTTATGGCAACC3') and reverse primer (ME-76) 5'AGAAAGCTTCATCATTCCCCCAAG3' has been designed to amplify a 1.25kb fragment of ACCase gene towards 3' end. Results are shown in Fig 4. The amplification was performed in a BioRad i-Cylcer Thermal Cycler (96 wells) system for 33 cycles with 45s at 95°C, 45s at 54°C and 6 min at 72°C. Where as first eight cycles was used at Touch Down program of 62°C-54°c by decreasing 1°C every cycle and for remaining 25 cycles 54°C annealing temperature was maintained. After the final cycle the amplification was extended for 20 min at 72°C. Products of PCR reactions were subjected to gel electrophoresis (1% agarose, with TAE as the running buffer) according to Sambrook et al (1989) and DNA fragments of 1.25kb in the length were recovered from the gel using QIA
ABSTRACT
The present invention relates to methods of amplification and complete gene sequence for plant cytosolic ACCase gene from Jatropha curcas L. The present invention in particular relates to providing an expression cassette encoding a plant ACCase gene and methods for altering oil content of plants by introducing and expressing a plant ACCase gene in the plant cells and by increasing the level of gene expression.
All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are chemically or physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention.
Dated this 8th day of May ,2006
For Reliance Life Sciences Pvt. Ltd
K. V. Subramaniam President
| # | Name | Date |
|---|---|---|
| 1 | 720-MUM-2006_EXAMREPORT.pdf | 2018-08-09 |
| 2 | 720-MUM-2006-SPECIFICATION(AMENDED)-(29-4-2011).pdf | 2018-08-09 |
| 3 | 720-MUM-2006-REPLY TO EXAMINATION REPORT(29-4-2011).pdf | 2018-08-09 |
| 4 | 720-MUM-2006-MARKED COPY(29-4-2011).pdf | 2018-08-09 |
| 5 | 720-mum-2006-form-2.pdf | 2018-08-09 |
| 7 | 720-mum-2006-form-1.pdf | 2018-08-09 |
| 8 | 720-mum-2006-form 5(8-5-2007).pdf | 2018-08-09 |
| 9 | 720-mum-2006-form 3(8-5-2007).pdf | 2018-08-09 |
| 10 | 720-mum-2006-form 3(8-5-2006).pdf | 2018-08-09 |
| 11 | 720-MUM-2006-FORM 3(11-2-2009).pdf | 2018-08-09 |
| 12 | 720-mum-2006-form 2(title page)-(provisional)-(9-5-2006).pdf | 2018-08-09 |
| 13 | 720-mum-2006-form 2(title page)-(complete)-(8-5-2007).pdf | 2018-08-09 |
| 14 | 720-MUM-2006-FORM 2(TITLE PAGE)-(29-4-2011).pdf | 2018-08-09 |
| 15 | 720-mum-2006-form 2(provisional)-(9-5-2006).pdf | 2018-08-09 |
| 16 | 720-mum-2006-form 2(complete)-(8-5-2007).pdf | 2018-08-09 |
| 17 | 720-MUM-2006-FORM 18(22-1-2009).pdf | 2018-08-09 |
| 18 | 720-mum-2006-form 13(29-4-2011).pdf | 2018-08-09 |
| 19 | 720-mum-2006-form 1(9-5-2006).pdf | 2018-08-09 |
| 20 | 720-MUM-2006-EXPERIMENTAL DATA FOR FURTHER INFORMATION(29-4-2011).pdf | 2018-08-09 |
| 21 | 720-mum-2006-drawings.pdf | 2018-08-09 |
| 22 | 720-mum-2006-drawing(provisional)-(9-5-2006).pdf | 2018-08-09 |
| 23 | 720-mum-2006-drawing(complete)-(8-5-2007).pdf | 2018-08-09 |
| 24 | 720-mum-2006-description(provisional)-(9-5-2006).pdf | 2018-08-09 |
| 25 | 720-mum-2006-description(complete)-(8-5-2007).pdf | 2018-08-09 |
| 26 | 720-mum-2006-description (provisional).pdf | 2018-08-09 |
| 27 | 720-MUM-2006-CORRESPONDENCE(IPO)-(31-1-2012).pdf | 2018-08-09 |
| 28 | 720-mum-2006-correspondence(8-5-2007).pdf | 2018-08-09 |
| 29 | 720-MUM-2006-CORRESPONDENCE(29-4-2011).pdf | 2018-08-09 |
| 30 | 720-MUM-2006-CORRESPONDENCE(22-1-2009).pdf | 2018-08-09 |
| 31 | 720-MUM-2006-CORRESPONDENCE(11-2-2009).pdf | 2018-08-09 |
| 32 | 720-mum-2006-correspondance-received.pdf | 2018-08-09 |
| 33 | 720-MUM-2006-CLAIMS(COMPLETE)-(8-5-2007).pdf | 2018-08-09 |
| 34 | 720-MUM-2006-CLAIMS(AMENDED)-(29-4-2011).pdf | 2018-08-09 |
| 35 | 720-mum-2006-claims(8-5-2007).pdf | 2018-08-09 |
| 36 | 720-MUM-2006-CANCELLED PAGES(29-4-2011).pdf | 2018-08-09 |
| 37 | 720-mum-2006-abstract.pdf | 2018-08-09 |
| 39 | 720-mum-2006-abstract(provisional)-(9-5-2006).pdf | 2018-08-09 |
| 40 | 720-mum-2006-abstract(complete)-(8-5-2007).pdf | 2018-08-09 |
| 41 | 720-MUM-2006-ABSTRACT(8-5-2007).pdf | 2018-08-09 |