The present invention relates to the generation and characterization of a single chain variable fragment r-ScFv-EAC 752/862 from the variable region of light and heavy chains of B.anthracis specific therapeutic monoclonal antibody. This r-ScFv-EAC 752/862 is capable of specifically binding with B.anthracis and can be used for specific detection of both vegetative cells and spores without the need of the parent monoclonal antibody.
BACKGROUND
Bacillus anthracis is a Gram positive, spore forming bacteria responsible for the disease anthrax and is found to infect animals and humans. It is considered to be an obligate pathogen whose replication occurs only in the permissible host. The pathogenesis of B. anthracis depends on the two plasmids pXO1 and pXO2, which codes for the toxins and the capsule (poly D-glutamic acid), respectively (Turnbull, 2008).
The spores are highly resistant to many chemical disinfectants, heat and radiation thereby ensuring survival of the pathogen for several years even in harsh environmental conditions (Rao et al., 2004). The ability of easy and efficient aerosolization of the spores coupled to simple/effortless culturing and spore preparation techniques makes the anthrax a potent biological weapon (Spencers, 2003).
B. anthracis spores make entry into the host system by three routes namely, cutaneous, inhalational and gastrointestinal. The cutaneous form is the most common mode of infection where the person gets infected while handling dead animals infected with anthrax spores. Around 20% of patients may develop septicaemia and die when ignored, but with the use of appropriate antibiotics the mortality rate can be reduced to less than 1% (Spencer, 2003).
Undercooked meat from animals infected with B. anthracis is the main source of gastrointestinal form of anthrax. The incubation period varies from one to six days. Due to non-specific symptoms, diagnosis becomes difficult, resulting in a high mortality rate. It is estimated that the case-fatality rate ranges from 25% - 60% (Beatty et al., 2003).
Until 2001 anthrax attacks and its inhalation anthrax had always been associated with industrial exposure to spores in textile or tanning industries. In this form of anthrax, the spores gain access into the host respiratory system through inhalation. The mortality rate for inhalational anthrax was estimated to be more than 95% (Spencer, 2003).
The detection of B. anthracis is difficult due to its non-specific symptomology and high genetic similarity with its close relatives Bacillus cereus and Bacillus thuringiensis (Helgason et al., 2000).
The nucleic acid based detection systems include PCR and RT-PCR targeting specific marker genes of the organism like pag, bclA and cap. Though the PCRs are highly specific and sensitive, the glitch is the purity of the DNA sample which demands additional step of purification. In some cases, the virulence marker carrying plasmids are absent; the detection in such cases is difficult by PCR (Ryu et al., 2010; Irenge & Gala, 2012).
Immunoassays like immunofluorescence, lateral flow and sandwich ELISA are used for the detection of the pathogen (Rao et al.., 2010; Stopa, 2000; Mabry et al., 2006). Toxin components viz. PA, LF and EF are used as target molecules for the detection by the predominantly available immunoassays viz. DOT ELISA (Sastry et al., 2003, Wattiau et al., 2009), indirect hemagglutination assay (IHA) (Vaglenov, 2007, Galiullin et al., 2014), electrophoretic-immunotransblots (EITB) (Whiting et al., 2004, Nagaratna et al., 2012) europium nanoparticle based immunoassay (ENIA) (Tang et al., 2010, Mechaly et al., 2013). The main drawback is that same system cannot be used for the detection of both spores and vegetative cells and requires culturing for the induction of toxin expression. Therefore, there is a pressing need to develop cost-effective, rapid systems capable of detecting both spores and vegetative cells simultaneously.
Antigen specific antibodies form an important component of the immunoassay and the antigen binding happens by the specific binding site in the antibody (paratope) present on the variable region of heavy and light chains of the antibody.
The ScFv is a recombinant protein molecule comprising antigen binding variable heavy chain and light chain regions of an antibody connected by a glycine linker. These recombinant proteins can be manipulated for increase in specificity and sensitivity (Schier et al., 1996).
A ScFv is an engineered protein molecule in which the variable regions from heavy and light chains of the antibody molecule are connected by a short, flexible polypeptide linker (Mechaly, 2008) and retain the same antigen binding property as that of the parent antibody. They lack the constant Fc region found in complete antibody molecules and can also be fused to marker molecules for developing more sensitive detection techniques.
ScFv are generated either by biopanning of phage display library made from spleens of mice immunized with specific antigens or from monoclonal antibodies against the specific antigen (Mechaly et al., 2008)
The ScFv antibodies owing to their ease of mass production in bacterial expression systems, high reproducibility at low cost and ability to be genetically modified for improved specificity and affinity serve as highly efficient candidates for pathogen detection (Schier et al., 1996)
Furthermore, considering the lethality and rapid prognosis of infection, apart from detection efficient therapy is also an eventual requirement for managing anthrax disease.
Presently post exposure therapy for anthrax involves administration of antibiotics like clidamycin, ciprofloxacillin, doxycycline or amoxicillin administered in addition to benzyl penicillin for 7-10 days or 60 days in case of bioterrorist attacks supplemented with vaccination (Spencer, 2003). However it requires minimum 28 days for any vaccine to generate neutralizing antibodies and the combination of antibiotics and vaccine is thus an approved post exposure therapeutic method (Friedlander et al 1993). Delay in definitive identification that could subsequently delay the initiation of appropriate antibiotic treatment would result in rapid multiplication of spores to vegetative cells resulting in severe toxaemia wherein the therapy becomes ineffective (Altboum et al., 2002).
Alternatively employing monoclonal antibody (mAb) therapy to neutralize the B. anthracis toxins PA, LF and EF (Parul and Rakesh Bhatnagar, 2011) can be regarded as a plausible approach to mediate instant therapy in infected individuals.(Schneemann and Manchester, 2009; Winterroth et al., 2010; Chen et al., 2009).
The potency of the toxin neutralizing mAbs in preventing spore germination has not been well established. Moreover, combination therapies employing various concentrations of multiple mAbs against PA, LF and EF often results in hypersensitive reaction among individuals (Cohen et al., 2000).
EA-1 a major S-layer protein of B. anthracis is present not only on the vegetative cells but is also considered as the major spore protein and has been reported to play a major role in clearing spores from the infected organs (William et al 2004).EA1 a surface layer protein is a major immunodominant protein present in both the vegetative cell and in the spores (Mesenge et al 2000). EA1 generally comprises of the total 15-30% of the cell protein (Fouet et al., 1999)
MAbs generated against EA1 protein have been found to bind to both B. anthracis spores and intact vegetative cells with high species-specificity and affinity at high concentrations (Wang et al., 2009). EA1 when immunized has been proven to exhibit both systemic and humoral immune response in mice (Uchida et al 2012). EA1, when immunized, has been proven to exhibit both mucosal and systemic immune responses in mice. Also, anti-EA1 antibodies play a major role in clearing spores from the infected organs (Uchida et al., 2012).
In view of the aforesaid there is need for such method of detecting B. anthracis which not only have high sensitivity but are capable of detecting both vegetative cells and spores of B. anthracis.

SUMMARY OF THE INVENTION
An embodiment of the present invention provides a recombinant bivalent chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13 of 786 bp.
Another embodiment of the present invention provides a recombinant bivalent chimeric gene r-ScFvEAC752/862 that encompasses heavy chain of 390 bp (SEQ ID No. 9) and Light chain of 330 bp (SEQ ID No. 10) from B.anthracis specific monoclonal antibody EAC752/862 and linked together by nucleotides coding for glycine linker of 45bp (SEQ ID No. 17).
Another embodiment of the present invention provides a recombinant bivalent fusion protein r-ScFvEAC752/862 of 31.2 kDa having SEQ ID No. 12 encoded by chimeric gene r-ScFvEAC752/862 of SEQ ID No. 13.
Another embodiment of the present invention provides a recombinant bivalent fusion protein r-ScFvEAC752/862 as herein described for the detection of both vegetative cells and spores of B. anthracis without the need to any antibody molecule.
Another embodiment of the present invention provides a recombinant bivalent fusion protein as herein described wherein the said fusion protein enables detection of 102 of vegetative cell and 103 spores of B. anthracis.
Another embodiment of the present invention provides a recombinant pET 22b r-ScFvEAC752/862 plasmid comprising the chimeric gene having SEQ ID No. 13.
Another embodiment of the present invention provides a recombinant E. coli BL21 (DE3) p.Lys S cell comprising of recombinant pET 22b r-ScFvEAC752/862 plasmid.
Another embodiment of the present invention provides a monoclonal antibody EAC752/862 with heavy chain variable region (SEQ ID No. 9) and light chain variable region (SEQ ID No. 10) exhibiting bacteriostatic, bactericidal and opsonophagocytic properties against B.anthracis.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1: Western Blot analysis confirming the reactivity of the mAb EAC752/862. lane 1: B.anthracis BST, lane 2: BA10 and lanes 3-8: different isolates of B.anthracis .
Figure 2: Indirect ELISA confirming the ability of mAb EAC752/862 to specifically detect B.anthracis in comparison to other closely related Bacillus sp.
Figure 3: Schematic representation of construction of r-ScFvEAC752/862 gene through splicing by overlap extension PCR (OE-PCR). Details were elucidated in examples. Heavy chain of monoclonal antibody is in green and light chain of the monoclonal antibody is in violet. Primers with respective restriction sites are depicted in respective colors and the glycine linker is in red.
Figure 4: (i) Schematic representation of the plasmid gene construct for cloning; (ii) Coomassie blue stained 12% SDS-PAGE of whole cell lysates of uninduced and IPTG induced E. coli cells bearing pET22b –r-ScFvEAC752/862 plasmid. Arrow mark indicates the expressed and purified recombinant protein. M-Marker, UI-Uninduced clone, I-Induced clone, P-Purified Protein.
Figure 5: Dot-ELISA performed to confirm the biotinylation of ScFv molecule. (Upper row) Different Elutions of biotin labeled r-ScFvEAC752/862. (Lower row) Normal r-ScFvEAC752/862. Only labeled antibodies produce color when reacted with streptavidin- HRP conjugate.
Figure 6: Immunization schedule of r-EAN protein in Leg Horn Chicken immunized at different intervals of time with r-EAN
Figure 7: The immunogenicity of r-EAN was assessed by indirect plate ELISA method. (i) IgY titre was checked in egg samples collected from immunized Leg Horn Chicken at different time intervals of immunization. (ii) IgY purification in 12%SDS PAGE.
Figure 8: Sandwich ELISA using IgY as capture antibody and EAC 752/862 molecule as detection antibody where it shows specific detection limit of 103 spores and 102 vegetative cells.
Figure 9: Antimicrobial assay of purified mAb EAC 752/862 against B. anthracis. 100 µl of 5 x 105 CFU/ml of bacteria suspension was incubated with different concentration of antibodies for 24 hours and the antimicrobial effect was determined by the decrease in OD595 value. EAC 752/862 bactericidal concentration at 0.08 mg /ml.
Figure 10: Time kill assay evaluating the time required for mAb EAC 752/862 (0.08mg /ml) to neutralize 5 x 105 CFU/ml of B.anthracis was performed according to CLSI guidelines. The reduction rate of the bacterial growth was reduced to 1.45×103 cfu/ml after 4 h of incubation and 98% reduction rate which corresponds to approximately 5×101 cfu/ml colonies at the end of 8 h of incubation. The 4 log10 CFU/ml reduction which represents to 98% killing of bacteria was recorded after incubation between 7-8 h.
Figure 11: Effect of mAb EAC 752/862 on the opsonization of spores by macrophage cell lines (Raw 264.7). The cell lines were infected with B. anthracis BA10 spores preincubated with increasing concentration (0.2mg/ml- 1.0 mg/ml) of monoclonal antibody. Then the cells were washed and plated on LB agar plates for enumerating the number of cells invaded by the macrophage. Significant difference in opsonization was observed between the naïve sera and increasing concentration of monoclonal antibody.
Figure 12: In vitro germination of antibody-treated spores in 1% (v/v) BHI. Percentage change in OD560 of B.anthracis BA10 spores treated with increasing concentration of EAC 752/862 monoclonal antibody at 30 °C in 1% BHI samples. Samples were removed at intervals to assess the extent of germination by the decline (percentage change) in the OD560. There was significant decrease in the spore germination with the increase in concentration of monoclonal antibody and when compared with the untreated spore.
Figure 13: Membrane permeabilising ability of the mAb EAC 752/862 at its MBC concentration was demonstrated by the leakage of DNA from the monoclonal antibody treated B.anthracis (5×105 cfu/ml) cells. There was a significant increase of the DNA concentration with the gradual increase in the mAb concentration. The maximum DNA concentration was observed at its MBC (Minimum Bactericidal Concentration) of 0.08 mg for the mAb. Cells treated with SDS and lysosyme was used as positive control and cells treated with PBS only was used as negative control. The untreated bacterial cell shows minimum release of DNA in comparison with the treated cells.
Figure 14: Scanning electron microscopy of B. anthracis (A) Control- B.anthracis treated with PBS (Phosphate buffer saline) showed normal inner and outer surface. (B) B.anthracis treated with mAb EAC752/862 showed irregularities with bleb or rough cell surface
Figure 15: Epitope mapping to show the binding region of EAC 752/862 in the eag gene of B.anthracis. MAb EAC 752/862 specifically binds to 752-862 amino acid region of the B. anthracis EA1 protein.
DETAILED DESCRIPTION
While the invention is susceptible to various modifications and/or alternative processes and/or compositions, specific embodiment thereof has been shown by way of example in the drawings, graphs and tables and will be described in detail below. It should be understood, however that it is not intended to limit the invention to the particular processes and/or compositions disclosed, but on the contrary, the invention is to cover all modifications, equivalents, and alternative falling within the spirit and the scope of the invention as defined by the appended claims.
The graphs, tables, figures and protocols have been represented where appropriate by conventional representations in the drawings, showing only those specific details that are pertinent to understanding the embodiments of the present invention so as not to obscure the disclosure with details that will be readily apparent to those of ordinary skill in the art having benefit of the description herein.
The following description is of exemplary embodiments only and is not intended to limit the scope, applicability or configuration of the invention in any way. Rather, the following description provides a convenient illustration for implementing exemplary embodiments of the invention. Various changes to the described embodiments may be made in the function and arrangement of the elements described without departing from the scope of the invention.
The terms “comprises”, “comprising”, or any other variations thereof, are intended to cover a non-exclusive inclusion, such that one or more processes or composition/s or systems or methods proceeded by “comprises... a” does not, without more constraints, preclude the existence of other processes, sub-processes, composition, sub-compositions, minor or major compositions or other elements or other structures or additional processes or compositions or additional elements or additional features or additional characteristics or additional attributes.
The terms, “alone or in combination” or any other variations thereof, are intended to describe and/or cover a non-exclusive inclusion, wherein the molecules or the oligonucleotides exist individually or together with any one or all of the other oligonucleotides.
In this specification and in the claims that follow, reference will be made to a number of terms that shall be defined to have the following meanings:
It must be noted that, as used in the specification/description and the appended claims and examples, the singular forms “a”, “an” and “the” may include plural referents unless the context clearly dictates otherwise.
Ranges may be expressed herein as from “about” one particular value, and or “to about” another particular value. When such a range is expressed, another aspect includes from the one particular value and or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent “about”, it will be understood that the particular value forms another aspect. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint.
Definitions
As used herein the term, “Recombinant bivalent fusion protein r-ScFvEAC752/862” in the context of the present invention means the fusion protein derived from a variable heavy chain (VH) peptide and variable light chain (VL) peptide of monoclonal antibody EAC 752/862 connected with a flexible glycine linker sequence as mentioned in the said disclosure.
As used herein the term, “Recombinant bivalent fusion chimeric gene r-ScFvEAC752/862” in the context of the present invention means a gene construct comprising nucleotides coding for variable heavy (VH) and light (VL) chains of monoclonal antibody EAC752/862 linked together by nucleotides coding for a flexible glycine linker sequence. The Recombinant bivalent fusion chimeric gene r-ScFvEAC752/862 encodes for Recombinant bivalent fusion protein r-ScFvEAC752/862.
As used herein the term, “IgY antibody”, in the context of the present invention means Immunoglobulins produced by birds upon immunization with a specific antigen. Such antibodies, unlike IgG antibodies produced by mammals are non-reactive with protein A in S. aureus and is therefore used in diagnostic assays to avoid cross reactivity with S. aureus.
As used herein the term, “Capture antibody”, in the context of the present invention means the antibody coated in the microtiter well to capture specific antigen. The term specific antigen denotes EA1 from spores or vegetative cells from B. anthracis.
As used herein the term, “Hyper Immune Sera”, in the context of the present invention means the antigen specific high titered immunoglobulins (IgY) produced by the host (Chicken) upon immunization with the specific antigen (EA-N)
As used herein the term, “Recombinant Extractable Antigen N-domain or rEA-N” in the context of the present invention means N terminal region (88-1413) of eag gene coding for EA1 (Extractable antigen) protein which was used for generating the IgY antibody.
As used herein the term, “HC CLN F” in the context of the present invention means Heavy Chain Cloning Primer Forward having sequence SEQ ID No. 3.
As used herein the term, “HC GLY R” in the context of the present invention means Heavy Chain with Glycine Linker Reverse Primer having sequence SEQ ID No. 4.
As used herein the term, “LC-GLY-F” in the context of the present invention means Light chain having Glycine Linker in Forward Primer having sequence SEQ ID No.7.
As used herein the term, “LC CLN R” in the context of the present invention means Light chain cloning Reverse Primer having sequence SEQ ID No.8.
As used herein the term, “sample” in context of the present invention means a sample from human or animal.
The present study was aimed at developing a ScFv against B. anthracis by the mAb based approach. For this initially a mAb EAC 752/862 against EA1 of B. anthracis was developed, characterized for its specificity towards the pathogen and further utilized in the development of an EA1 specific ScFv by overlap extension PCR for efficient detection of the pathogen. This ScFv molecule could be used for the specific detection of vegetative cell and spores of B.anthracis by sandwich ELISA or by any other suitable diagnostic platform and the specific mAb have been characterized for its neutralizing capability. The parent monoclonal antibody on the other hand was screened for its therapeutic application against intact cells and spores of B. anthracis.
The present invention relates to the generation and characterization of a single chain variable fragment (ScFv) from a Bacillus anthracis Extractable Antigen (EA1) specific monoclonal antibody EAC 752/862.
The present invention also relates to a recombinant chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13. The nucleotide sequence coding for variable region from Heavy and Light chains of the monoclonal antibody EAC752/862 were PCR amplified and spliced together with a hydrophilic flexible glycine linker sequence by overlap extension PCR to form chimeric gene r-ScFvEAC752/862 which was cloned by T4 DNA ligase dependent directional cloning into pET22b expression vector. The recombinant plasmid pET22b–r-ScFvEAC752/862 was transformed into E. coli BL21 (DE3) p.LysS expression host and the 26 kDa fusion protein, r-ScFvEAC752/862 was purified by immobilized metal affinity chromatography using Ni-NTA column under native condition.
The present invention also provides a ScFv molecule that is a bivalent fusion protein (r-ScFvEAC752/862) with amino acid sequence as provided in SEQ ID No. 12. The fusion protein encompasses the variable region of Heavy and Light chains from B. anthracis specific monoclonal antibody EAC752/862 and generated by cloning and expression of the recombinant chimeric gene ScFv (r-ScFvEAC752/862). The specific binding of the r-ScFvEAC752/862 fusion protein with B. anthracis was evaluated by indirect plate ELISA. The r-ScFvEAC752/862 fusion protein was made to a concentration of 5 mg/ml and was conjugated with biotin. This fusion protein was used for specific detection of B. anthracis vegetative cells and spores.
The present invention also provides for generation of hyper immune sera from animals/chicken against B.anthracis r-EAN and specifically IgY from chicken. Immunization of chicken with r-EAN, elicited anti r-EAN IgY antibodies. These antibodies react both with r-EAN as well as EA1 protein from B.anthracis in Western blot. A Sandwich ELISA system using IgY as capture antibody and the biotinylated r-ScFvEAC752/862 mAb EAC752/862 as detection molecule was developed and it was found to detect 103 spores and 102 vegetative cells without any cross reactivity with other cultures (Figure 8). The specificity and sensitivity of this assay was at par with the sandwich ELISA with parent mAb as detection molecule.
The present invention relates to the use of monoclonal antibody against B. anthracis as potent therapeutic molecule and the use of ScFv molecule developed from the monoclonal antibody as a specific detection technique for vegetative cell and spores of B. anthracis since the EA1 protein is highly immunogenic.
Also the use of single chain antibody for B. anthracis detection has several advantages viz.low cost, higher reproducibility and capability of bulk production which are not possible for mAb or polyclonal antibody based ELISA detection systems. The Single chain antibody produced here can be used in ELISA IFA, LFA based detection system which are not possible for existing systems.
Accordingly, the main embodiment of the present invention provides a recombinant bivalent chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13 of 786 bp.
Another embodiment of the present invention provides a recombinant bivalent chimeric gene r-ScFvEAC752/862 that encompasses heavy chain of 390 bp (SEQ ID No. 9) and Light chain of 330 bp (SEQ ID No. 10) from B.anthracis specific monoclonal antibody EAC752/862 and linked together by nucleotides coding for glycine linker of 45bp (SEQ ID No. 17).
Another embodiment of the present invention provides a recombinant bivalent fusion protein r-ScFvEAC752/862 of 31.2 kDa having SEQ ID No. 12 encoded by chimeric gene r-ScFvEAC752/862 of SEQ ID No. 13.
Another embodiment of the present invention provides a recombinant bivalent fusion protein r-ScFvEAC752/862 as herein described for the detection of both vegetative cells and spores of B. anthracis without the need to any antibody molecule.
Another embodiment of the present invention provides a recombinant bivalent fusion protein as herein described wherein the said fusion protein enables detection of 102 of vegetative cell and 103 spores of B. anthracis.
Another embodiment of the present invention provides a recombinant pET 22b r-ScFvEAC752/862 plasmid comprising the chimeric gene having SEQ ID No. 13.
Another embodiment of the present invention provides a recombinant E. coli BL21 (DE3) p.LysS cell comprising of recombinant pET 22b r-ScFvEAC752/862 plasmid.
Another embodiment of the present invention provides a method of preparing recombinant bivalent chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13 said method comprising the steps of
(a) amplifying the nucleotide sequence coding for the variable region of Heavy (VH) and light chain(VL) of the monoclonal antibody EAC 752/862 of B.anthracis using novel primers HC-F, HC-R, LC-F and LC-R;
(b) adding (i) Nco I restriction site and nucleotide sequence for glycine linker at 5’ and 3’ end respectively, to variable Heavy chain (VH) using primers HC- CLN-F and HC-GLY-R; and (ii) also adding nucleotide sequence for glycine linker and Xho I restriction site at 5’ and 3’ ends respectively to Variable Light chain amplicon using primers LC-GLY-F and LC-CLN-R;
(c) carrying out single step overlapping extension PCR to join together the two amplicons of step (b);
(d) amplifying fused gene with primers HC-CLN-F and LC-CLN-R; and
(e) obtaining recombinant bivalent chimeric gene r-ScFv having SEQ ID No. 13.
Another embodiment of the present invention provides a process for production of recombinant bivalent fusion protein r-ScFv- EAC 752/862 having SEQ ID No. 12, said process comprising the steps of:
(a) amplifying the chimeric gene r-ScFv- EAC 752/862 having SEQ ID No.13 using the primers HC-CLN-F and LC-CLN-R having Sequence ID Nos. 3 and 8.
(b) cloning chimeric gene r-ScFvEAC752/862 in E. coli BL21DE3 pLysS using Nco I and Xho I restriction enzymes through pET22b vector;
(c) expressing the inserted gene of step (b) using the recombinant E. coli;
(d) obtaining the recombinant bivalent fusion protein r-ScFvEAC752/862 having SEQ ID No.12 through purification of by immobilized metal affinity chromatography from the expressed product of step (c).
Another embodiment of the present invention provides a process for producing a specific IgY antibody, said method comprising the steps of:
(a) primary immunizing the chickens with r-EAN antigen;
(b) giving booster doses of r-EAN-antigen;
(c) isolating IgY from egg using PEG precipitation; and
(d) obtaining purified IgY antibody.
Another embodiment of the present invention provides a process for producing a specific IgY antibody as herein described wherein IgY antibody shows specific binding with native B.anthracis cultures.
Another embodiment of the present invention provides an in vitro method for detecting the vegetative cells and spores of B. anthracis, said method comprising the steps of:
(a) Coating the ELISA plates with IgY antibody followed by blocking with 5% skimmed milk.
(b) Incubating the ELISA plates with the vegetative spores as well as the vegetative cells of B. anthracis;
(c) adding biotin conjugated r-ScFv; and
(d) detecting the vegetative cells and spores of B. anthracis.
Another embodiment of the present invention provides a monoclonal antibody EAC752/862 with heavy chain variable region (SEQ ID No. 9) and light chain variable region (SEQ ID No. 10) exhibiting bacteriostatic and bactericidal properties against B.anthracis.

Another embodiment of the present invention provides a monoclonal antibody EAC752/862 with B.anthracis spore germination inhibition property.

Another embodiment of the present invention provides a monoclonal antibody EAC752/862 that brings about structural changes in cell wall and release nucleic acids from the cells of B. anthracis or related Bacillus species.

Another embodiment of the present invention provides a monoclonal antibody EAC752/862 that promotes opsonophagocytosis of vegetative cells or spores of B. anthracis.

Another embodiment of the present invention provides an in vitro method for detecting the vegetative cells and spores of B. anthracis as herein described wherein the sensitivity of the method is found to detect 102 of vegetative cell and 103 spores of B. anthracis (Figure 8).
Another embodiment of the present invention provides that the in vitro detection method using the ScFv molecule ScFvEAC752/862 has the same sensitivity as that of the invitro method (sandwich ELISA) using the parent mAb EAC752/862 (102 of vegetative cell and 103 spores of B. anthracis).
Another embodiment of the present invention provides the neutralizing capability of the parent mAb EAC 752/862. The minimal inhibitory concentration of the purified mAb was established at 60µg/ml whereas the minimal bactericidal concentration was established at 100µg/ml.
Another embodiment of the present invention was that the mAb EAC752/862 was able to decrease the pathogen load from 5 x 105 to 1.45×103 cfu/ml (15%) decrease at the end of 2 hour and 5×102 cfu/ml (98%) at the end of 6 hours.
Another embodiment of the invention was the ability of the mAb EAC752/862 to opsonize 14×10 3 spores and inhibit the germination of 30% spore to vegetative cell.
The present invention also demonstrates the morphological changes resulting due to interaction of the mAb EAC752/862 with B.anthracis cell.
The present invention also demonstrates a detection method that had been assayed with hyper immune sera against other members of Bacillus genus but were unable to detect B. anthracis. explaining the specificity of the ScFv towards B. anthracis and also demonstrating its workability (Figure 2).

The present invention demonstrates the binding of the mAb to a very specific region of EA1 (Extractable antigen) of B.anthracis. It has been found that the mAb binds to the 752-862 amino acid regions.
EXAMPLES

EXAMPLE 1
Bacterial strains and Media
The Bacillus species used in this study was obtained from National Collection of Industrial Microorganism (NCIM), India and American Type Culture Collection Centre (ATCC), USA. The B. anthracis isolates were from the culture collection of Defence Food Research Laboratory (DFRL), India. Brain heart infusion broth was used to culture the B. anthracis. For molecular biology experiments, the bacteria were cultured in Luria Bertani broth with necessary antibiotics.

EXAMPLE 2
Generation of mAb EAC752/862
rEA1-C protein with 1737 to 2580 aa of EA1 protein was purified from E.coli M15 host cells harboring the recombinant plasmid pQE30UA-EA. BALB/c mice (6 weeks old, male) were immunized with purified rEA1-C subdermally and splenocytes were collected 3 days after the last immunization and immortalized by fusion with mouse myeloma SP2/O-Ag14 cells following the protocol established by Kohler and Milstein (1975). The mAb EAC752/862 was precipitated using saturated ammonium sulfate solution and purified by protein-A chromatography. The purified antibodies were dialyzed in PBS and assessed by 12% SDS-PAGE.

EXAMPLE 3
Reactivity evaluation of mAb EAC752/862 with B.anthracis by Western blot analysis:
The rEA1-C and crude protein preparations of B. anthracis and other bacterial strains were separated by 12% Poly Acrylamide Gel Electrophoresis (PAGE) and transferred onto a nitrocellulose membrane. The free sites on the nitrocellulose membrane were blocked with 5 % defatted milk in PBS. The antigen electroblotted onto the nitrocellulose membranes was incubated with the mAb EAC752/862 as the primary antibody and then with peroxidase-conjugated anti-mouse IgG as secondary antibody (Sigma, India) at a 1:1,000 dilution. The peroxidase-positive bands were detected by immersing the sheet in a developing solution containing 0.3 % diaminobenzidine tetrahydrochloride (Sigma, India) and 0.03 % H2O2 at room temperature for 5 min. The enzyme reaction was terminated by washing the sheet in tap water (Figure 1)

EXAMPLE 4
Indirect ELISA to show the reactivity of monoclonal antibody EAC 752/862
Briefly, the wells of a microtitre plate (Maxisorp, Nunc, India) were coated with 100µl of culture of B. anthracis, B. cereus (ATCC 10876) B. thuringiensis (NCIM 2515) B. subtillis (NCIM 2124) and B. licheniformis (ATCC 14580) in coating buffer (Carbonate- bicarbonate buffer, pH 9.6).
The wells were blocked with 3% BSA in 1X PBS (pH 7.4) at room temperature for 3h.
Each well with 100µl volume of mAb EAC 752/862 were incubated at 37°C for 1h.
The wells were washed thoroughly for 3 times with PBST (PBS+ 0.05%Tween 20) to remove unbound antibodies and incubated with HRP labeled polyvalent anti mouse IgG antibody (Sigma, India) for 1 h at 37°C in dark.
The plate was developed with Ortho-Phenylenediamine dihydrochloride substrate with 0.04% H2O2. Absorbance was measured three times at 492 nm in 1 min intervals (Infinite M200 PRO; Tecan, Grodig, Austria) at 37°C.
End-point titre was determined as the highest antibody dilution whose O.D. was twice the O.D. value of negative sample (Figure 2).

EXAMPLE 5
Construction of Heavy Chain and Light Chain:
VH and VL gene segments were generated from the c-DNA prepared from B. anthracis specific monoclonal antibody EAC752/862 RNA. VH and VL were amplified by polymerase chain reaction (PCR) using the following primer VH, Forward
5'-GAGGTCCAGCTGCAGCAGTC-3' (SEQ ID No.1) and reverse 5'-CCGATTTGGA TAGTCAGATG G-3' (SEQ ID No.2) and VL forward 5'-GATATTGTGA TGACGCAGGC T-3' (SEQ ID No. 5) and reverse 5'- TTTCCAACTTTGTCCCCG-3' (SEQ ID No.6). PCR amplification was performed using a restriction mix containing 1µl cDNA reaction mix, 10pmol each primer, 200 mM dNTP and 2unit of Pfu DNA polymerase in 10× PCR reaction buffer in a final volume of 50µl. The initial PCR denaturation conditions were 94°C for 4 min, followed by 94°C for 30 sec , 35 cycles for 30s at 55°C and extension of 1min at 72°C and final extension of 8min for 72°C. The products were separated by 1.2 % agarose gel and gel purified by using Sigma Gel extraction kit (India, Bangalore). The VH and VL chain of the monoclonal antibody EAC 752/862 were cloned in PTZ vector. Sequencing was done using dideoxy-chain –termination method.

EXAMPLE 6
Construction of Chimeric Gene
Specific primers against the respective genes were designed in–house by Generunner software (www.generunner.net) and custom synthesized (Sigma, Bangalore,India).
Heavy chain (HC) and Light chain (LC) fragments were spliced by overlap extension PCR as depicted in Figure 3. The Figure 3 provides for a schematic representation gene prepared from the heavy and light chains.
Initially, the Heavy chain and Light chain of the monoclonal antibody were amplified individually with HC-CLN- F (SEQ ID No. 3) +HC-GLY-R (SEQ ID No. 4) and LC-GLY-F (SEQ ID No. 7) + LC-CLN-R (SEQ ID No. 8) primers respectively.
Glycine linkers (Glycine linker amino acid sequence-SEQ ID No.11 or Glycine linker nucleotide sequence - SEQ ID No. 17) were incorporated to 3’ of Heavy chain and 5’ of Light chain amplicons and then spliced together in a single primer – free splicing by overlap extension PCR (SOE –PCR) to form r-ScFv EAC 752/862 chimeric gene.
Finally the spliced product was amplified using HC-CLN-F (SEQ ID No. 3) and LC-CLN-R (SEQ ID No. 8) primers (extreme most primers).
Except the OE-PCR all other PCRs (Mastercycler Pro,Eppenndorf , Germany) were performed in 20µl reaction volume comprising 1X pfu PCR buffer (with 2.5 mmol l-1 MgSO4),0.2 mmol dNTP mix, primers 10 pmol l-1 and 1 unit pfu polymerase (Fermentas, New Delhi India).
For each set of primers the PCR programs consisted of 30 repetitive cycles with strand separation step at 94°C for 1 min, annealing at 54°C for 1 min and extension step at 72°C for 1 min. The DNA was denatured for 4 min in the beginning and finally extended for 8 min at 72°C.
The SOE- PCR was carried out in 30 µl reaction volumes containing 100 ng of Heavy chain and Light Chain amplicons flanked with glycine linkers at the 3’ end and 5’ end respectively, 1X pfu PCR buffer (with 2.5 mmol l-1 MgSO4),0.2 mmol dNTP mix, primers 10pmol l-1 and 1 unit pfu polymerase (Fermentas, New Delhi India).
The PCR conditions were as follows; denaturation at 94°C for 5 mins, annealing at 56 °C for 1 min and extension at 72 °C for 20 min.
PCR products were analysed in 1 % Agarose gel with ethidium bromide staining and visualized under UV – transillumination.

EXAMPLE 7
Cloning, Expression and Purification
The recombinant gene r-ScFvEAC752/862 was amplified using the forward primer Heavy chain F (CATGCCATGGATGAGGTCCAGCTGCAGCAGTC) (SEQ ID No.3) and reverse primer Light Chain ClonR (CCGCTCGAGTTTCCAACTTTGTCCCCG) (SEQ ID No.8) designed to incorporate Nco and Xho I restriction sites at the 5’ and 3’ ends of the chimeric gene respectively.
The purified PCR product (Sigma Bangalore) and pET 22b plasmid (Invitrogen, Bangalore India) were digested with the respective restriction enzymes and ligated together to form recombinant pET 22b–r-ScFvEAC752/862 plasmid which was transformed into E.coli BL21 (DE3) p.LysS (Figure 4).
The transformation was screened by PCR (using T7 forward and reverse primers) and overnight cultures harboring the recombinant plasmid were re-inoculated into fresh LB broth (1% inoculums) and incubated at 37°C with shaking till the O.D. reached 0.6.
The cultures were induced with 1mM IPTG (Sigma Bangalore, India) and harvested after 5h by centrifugation at 7800 rpm for 15 minutes (Centrifuge 5430R, Eppendorf, Bangalore, India).
The bacterial cells were resuspended with 1/10 volume of 1X PBS (pH 7.4) and examined by SDS PAGE to analyse expression (Sambrook et.al. 1989).
The recombinant protein r-ScFvEAC752/862 was purified from 200ml culture broth under native conditions by Immobilized Metal Affinity Chromatography using Ni-NTA Agarose column (Qiagen, Bangalore, India).
The concentration of recombinant protein r-ScFvEAC752/862 was quantified by Lowry’s method using known BSA standards and stored at -20°C for further applications.

EXAMPLE 8
Generation of Biotinylated r-ScFvEAC752/862:
r-ScFvEAC752/862 molecule was concentrated to a concentration of 5mg/ml and labeled with biotin using commercially available biotinylation kit (Bangalore Genei, Bangalore, India) as per manufactures protocol.
Biotinylation was confirmed using dot-ELISA by coating 10µl of different elutions of biotinylated r-ScFv-EAC752/862 in carbonate –bicarbonate buffer along with normal r-ScFvEAC752/862 as control on nitrocellulose membrane (Millipore Corp., Billerica, MA, USA). The membrane was then air dried, blocked with 1% BSA and probed using Streptavidin –HRP (Invitrogen, Carlsbad, CA, USA) for chromogenic identification (Figure 5).

EXAMPLE 9
Immunization to generate IgY antibodies:
Specific Pathogen Free Leg-Horn Chicken 18 months old was used for this experiment.
All animal handling procedures were performed in accordance with the terms of Animal Ethical Committee at DFRL, Mysore, India.
The chicken was provided with food and water ad libitum and immunized with r-EAN antigen through the intra – muscular route.
The primary vaccine formulation consisted of 100 µg of r-EAN emulsified with Freund’s complete adjuvant (Sigma Bangalore, India) in 1:1 ratio (Figure 6).
Boosters consisting of equivalent protein concentration in Freund’s incomplete adjuvant (Sigma Bangalore, India) were administered on 14th, 28 th and 42 nd day of the immunization schedule.
Eggs were collected and IgY was extracted by PEG precipitation. The purified IgY was extracted and stored in -20°C until further use.

EXAMPLE 10
Serum antibody titre:
Recombinant-EAN specific immunoglobulin levels in the sera of r-EAN immunized and control chicken were assayed by ELISA.
Briefly, the wells of a microtitre plate (Maxisorp, Nunc, India) were coated with 100µl of 10µg/ml of r-EAN in coating buffer (Carbonate- bicarbonate buffer, pH 9.6).
The wells were blocked with 3% BSA in 1X PBS (pH 7.4) at room temperature for 3h.
Each well with 100µl volume of two – fold serially diluted IgY in PBS were incubated at 37°C for 1h.
The wells were washed thoroughly for 3 times with PBST (PBS+ 0.05%Tween 20) to remove unbound antibodies and incubated with HRP labelled polyvalent anti chicken IgY antibody (Dako, Glostrup, Denmark) for 1 h at 37°C in dark.
The plate was developed with ortho-Phenylenediamine dihydrochloride substrate with 0.04% H2O2. Absorbance was measured three times at 492 nm in 1 min intervals (Infinite M200 PRO; Tecan, Grodig, Austria) at 37°C.
End-point titre was determined as the highest antibody dilution whose O.D. was twice the O.D. value of negative sample (Figure 7).

EXAMPLE 11
Western Blotting to evaluate specific binding of anti EAN IgY
The reactivity of anti EAN IgY with whole cell lysates of B.anthracis isolates was evaluated by Western blot as mentioned in Example 4 using anti EAN IgY as the primary antibody and HRP conjugated polyvalent anti chicken IgY antibody (Dako;1:1000 dilution) as secondary antibody (Figure 8).

EXAMPLE 12
Sandwich ELISA:
ELISA plates were coated with 1:1000 dilution of IgY as capture antibody diluted in carbonate-bicarbonate buffer. After an overnight incubation (4°C), both the ELISA plates were blocked with 5% skimmed milk for 1 hour.
The plates were washed with PBS supplemented with 0.05% Tween 20. B.anthracis spores and vegetative cells were serially diluted and loaded in different dilutions in both the plates and incubated at room temperature for 1 hour.
Post incubation, individual plates were coated with parent mAb EAC752/862 and biotin conjugated r-ScFvEAC752/862 respectively in 1:1000 dilution in separate plates followed by incubation of both the plates at room temperature for 1 hour.
Subsequently the plates were washed with PBS supplemented with 0.05% Tween 20 and further incubated for 1 hour with anti mouse HRP conjugated secondary antibody (1:1000 dilution) and with Streptavidin HRP (1:3000 dilution) conjugate for 1 hour. Post incubation both the plates were developed with O-phenylenediamine dihydrochloride (OPD) substrate with 0.04% H2O2. Absorbance as measured three times at wavelength of 470nm in 1 min intervals (Infinite M200 PRO; Tecan Grodig,Austria). End point titre was determined as the maximum antibody dilution whose O.D. was twice more or equal to the O.D. value of negative sample.
B.subtillis (NCIM 2124), B. thuringiensis (NCIM 2515, ATCC 10872), B.cereus (ATCC 10876, ATCC14579) were used as negative control to check the specificity of binding. A signal was considered positive if the chromogenic value was found twice the value of the blank. (Figure 2)

EXAMPLE 13
Purification of Monoclonal antibody:
The monoclonal antibody EAC752/862 was purified by ammonium sulphate precipitation where 30ml of the culture supernatant was centrifuged at 7000 rpm for 30 min, 3 ml of Tris chloride was added in the supernatant followed by the addition of super saturated ammonium chloride in 4°C until precipitation and kept in shaking condition for 1 hour. The solution is centrifuged at 7000 rpm for 1hour and 5ml of ammonium sulphate was added to the pellet followed by centrifugation at 7000 rpm for 30 min. 10ml of 1X PBS was added to the pellet and kept for overnight dialysis. The purity of the monoclonal antibody was checked in SDS PAGE and the reactivity was confirmed by Western blot analysis.

EXAMPLE 14
Antibody Susceptibility Test:
Briefly, 5 × 105 CFU/ml of B. anthracis BA10 was added to the wells of a microtitre plate containing two fold serially diluted mAb EAC752/862 followed by incubation at 37°C for 18 h with shaking at 250 rpm. The initial absorbance was measured at the 0th h. Post incubation the decrease in absorbance due to reduction of bacterial proliferation was measured and 100 µl volume from each well was plated onto Muller Hilton (MH) agar to count the number of colonies. The concentration of mAb resulting in maximum change in O.D. but however producing least number of colonies on agar upon plating was considered as the Minimal Inhibitory Concentration (MIC). Alternatively, the concentration of mAb that killed =99.9% bacteria resulting in maximum decrease in O.D. and resulted in no colonies upon plating was considered as the Minimal Bactericidal Concentration (MBC).

EXAMPLE 15
Kinetics of bacteriostatic activity:
The kinetics of bacteristatic assay was performed by micro titre plate based method. Briefly, 100 µl of 5 × 105 CFU/ml of B. anthracis BA10 was added to the wells of a microtitre plate containing 0.02- 0.1mg/ml of mAb and incubated at 37°C for 18 h with shaking at 250 rpm. The initial absorbance of each well was measured at the 0th h at 595 nm followed by O.D. measurements at every 1 h intervals in ELISA reader (Infinite M200, Tecan, Austria). Wells containing Muller Hilton Broth (MHB) and similar concentration of B. anthracis BA10 and 200 µl of MHB were considered as positive control while those containing MHB only was considered as negative control (Figure 9).

EXAMPLE 16
Time Kill curve experiment:
Time kill curve assay depicts the dynamics of antimicrobial action and interaction over time and was performed as per CLSI guidelines (NCCLS 2006). A starting inoculum of 5 x 105 CFU/ml (B. anthracis BA10) was used against antibody concentrations of 0.1mg/ml in a total volume of 200 µL in microtitre plates. Wells containing 100 µl of MHB with 5 x 105 CFU/ml of B.anthracis BA10 and no mAb was considered as the positive control while wells with only MHB broth was considered as the negative control. Samples were drawn at 0, 2,4,6,8 and 24 h intervals and plated in MH agar. The bacterial colonies were counted in cfu/ml (Figure 10).

EXAMPLE 17
Opsonophagocytic assay:
The opsonophagocytic assay was performed on Raw 264.7 (ATCC® TIB-71 TM) macrophage cell line procured from National Centre for Cell Science (NCCS Pune). B. anthracis BA10/ spores were opsonized initially by treating them with mAb EAC752/862 at concentration ranging from 0.2 mg/ml to 1.0 mg/ml with an incubation period of 30 min in 4°C followed by washing to remove unopsonised spores. RAW 264.7 cells (1×105 cells/ well) were infected with 1-10 cfu/ml opsonised B. anthracis spores and incubated for 1 h at 37 °C with 5% CO2. Spores treated with preimmune sera were used as negative control. Post incubation cells were lysed with 100µl of 0.1% Triton X (Sigma, India) diluted in sterile PBS and plated in BHI agar plates (Figure 11).

EXAMPLE 18
Germination Inhibition Assay:
Heat activated ungerminated spores (3×108) of B. anthracis BA10 were treated with the mAb EAC752/862 concentrations ranging from 0.2 -0.6 mg/ml and incubated 4°C for 30 min. The antibody treated spores were added to 1% BHI (v/v) in water and incubated in shaking condition at 30°C in Tecan Plate reader. Absorbance was taken at 560nm at every 2.5 min of interval for 30 min. The percentage of germination inhibition was analyzed by the decline in OD560 (Figure 12).

EXAMPLE 19
Nucleic Acid Release Assay:
The structural changes in the bacterial cell wall after exposing to the mAb EAC752/862 was analyzed by nucleic acid leakage assay where bacteria was treated at different concentration (0.02 – 0.1mg/ml) of mAb for different time interval (0, 2, 4, 6, 8 h) and the DNA concentration in the supernatant after centrifugation was determined by using Nano Drop (Thermo Scientific). Bacterial cells treated with SDS and lysosyme was used as positive control (Figure 13).

EXAMPLE 20
Determination of bimolecular nature of Epitope of monoclonal antibody
Identification of binding domain:
The 94 kDa EA1 protein was divided in to 6 (EAA, EAB, EAC, EAD, EAE, and EAF) overlapping fragments of 21 kDa. Nucleotide fragments coding for all the fragments were amplified with respective oligonucleotide primers having Xho1 and EcoRI restriction sites as 5’ and 3’overhangs respectively and cloned in pRSET A vector following ligase mediated cloning protocol (Sambrook et al 2001) The overnight cultures of the positive clones were induced for 5 h with 1mM IPTG and were harvested by centrifugation at 7800 rpm for 15min (Eppendorf, Germany). The recombinant protein was purified by Immobilized Metal Affinity Chromatography using Ni-NTA as per manufacturers (Qiagen) instruction. The concentration of the recombinant proteins were quantified by Lowry’s Method using BSA as standard and was stored at -20°C for further application.

EXAMPLE 21
Reactivity of mAb’s:
Reactivity of the mAb with the truncated recombinant EA1 proteins expression lysates was measured by Western blot analysis as described above.

References:

1. Mechaly, A., Zahavy, E., & Fisher, M. (2008). Development and implementation of a single-chain Fv antibody for specific detection of Bacillus anthracis spores. Applied and environmental microbiology, 74(3), 818-822.
2. Schier, R., McCall, A., Adams, G. P., Marshall, K. W., Merritt, H., Yim, M., Crawford, R.S, Weiner, L.M., Marks, C., & Marks, J. D. (1996). Isolation of picomolar affinity anti-c-erbB-2 single-chain Fv by molecular evolution of the complementarity determining regions in the center of the antibody binding site. Journal of molecular biology, 263(4), 551-567.
3. Merritt, H., Yim, M., & Marks, J. D. (1996). Isolation of picomolar affinity anti-c-erbB-2 single-chain Fv by molecular evolution of the complementarity determining regions in the centre of the antibody binding site. Journal of molecular biology, 263(4), 551-567.
4. Williams, D. D., & Turnbough, C. L. (2004). Surface layer protein EA1 is not a component of Bacillus anthracis spores but is a persistent contaminant in spore preparations. Journal of bacteriology, 186(2), 566-569.
5. Klimka, A., Matthey, B., Roovers, R. C., Barth, S., Arends, J. W., Engert, A., & Hoogenboom, H. R. (2000). Human anti-CD30 recombinant antibodies by guided phage antibody selection using cell panning. British journal of cancer,83(2), 252.
6. Watkins, N. A., & Ouwehand, W. H. (2000). Introduction to antibody engineering and phage display. Vox sanguinis, 78(2), 72-79.
7. O'Connor, S. J., Forsyth, P. D., Dalal, S., Evans, P. A., Short, M. A., Shiach, C, Jack, A.S & Morgan, G. J. (1997). The rapid diagnosis of acute promyelocytic leukaemia using PML (5E10) monoclonal antibody. British journal of haematology, 99(3), 597-604.
8. Nagarathna, S., Chandramuki, A., & Veenakumari, H. B. (2012). Laboratory Diagnosis of Meningitis. INTECH Open Access Publisher.
9. Mechaly, A., Cohen, N., Weiss, S., & Zahavy, E. (2013). A novel homogeneous immunoassay for anthrax detection based on the AlphaLISA method: detection of B. anthracis spores and protective antigen (PA) in complex samples. Analytical and bioanalytical chemistry, 405(12), 3965-3972.
10. Mesnage, S., Fontaine, T., Mignot, T., Delepierre, M., Mock, M., & Fouet, A. (2000). Bacterial SLH domain proteins are non-covalently anchored to the cell surface via a conserved mechanism involving wall polysaccharide pyruvylation. The EMBO Journal, 19(17), 4473-4484.
11. Wattiau, P., Govaerts, M., Frangoulidis, D., Fretin, D., Kissling, E., Van Hessche, M.. China, B., Poncin, M., Pirenne, Y., . Hanquet, G. (2009). Immunologic response of unvaccinated workers exposed to anthrax, Belgium. Emerging infectious diseases, 15(10), 1637.
12. Galiullin, A. K., Semenova, S. A., Volkov, A. H., Gosmanov, R. G., & Yusupova, G. R. (2014). Post-Vaccination Immunity in Cows in the Area of Technogenic Pollution. Eastern European Scientific Journal, (3).
13. Friedlander, A. M., Welkos, S. L., Pitt, M. L., Ezzell, J. W., Worsham, P. L., Rose, K. J., & Lawrence, W. B. (1993). Postexposure prophylaxis against experimental inhalation anthrax. Journal of Infectious Diseases, 167(5), 1239-1242.
14. Turnbull, P.C., 2008. Anthrax in humans and animals. 4th ed. Geneva, Switzerland: World Health Organization.
15. Spencer, R.C., 2003. Bacillus anthracis. J. Clin. Pathol. 56,182–187.
16. Rao, R., Visuri, S., McBride, M., Albala, J., Matthews, D., Coleman, M., 2004. Comparison of Multiplexed Techniques for Detection of Bacterial and Viral Proteins. J. Proteome. Res. 3, 736–742.
17. Beatty, M.E., Ashford, D.A., Griffin, P.M., Tuxe, R.V., Sobel, J., 2003. Gastrointestinal anthrax: review of the literature. Arch. Intern. Med. 163, 2527–2531.
18. Helgason, E., Økstad, O. A., Caugant, D. A., Johansen, H. A., Fouet, A., Mock, M, Hegna, I. & Kolstø, A. B. (2000). Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis—one species on the basis of genetic evidence. Applied and environmental microbiology, 66(6), 2627-2630.
19. Irenge, L. M., & Gala, J. L. (2012). Rapid detection methods for Bacillus anthracis in environmental samples: a review. Applied microbiology and biotechnology, 93(4), 1411-1422.
20. Ryu, K., Haes, A. J., Park, H. Y., Nah, S., Kim, J., Chung, H, Yoon, M.Y. & Han, S. H. (2010). Use of peptide for selective and sensitive detection of an Anthrax biomarker via peptide recognition and surface-enhanced Raman scattering. Journal of Raman Spectroscopy, 41(2), 121-124.
21. Sastry, K. S. R., Tuteja, U., Santhosh, P. K., Lalitha, M. K., & Batra, H. V. (2003). Identification of Bacillus anthracis by a simple protective antigen-specific mAb dot-ELISA. Journal of medical microbiology, 52(1), 47-49.
22. Vaglenov, K. (2007). Development and Study of Phage-Based Microarray and Dot-Blot (Doctoral dissertation).
23. Whiting, P., Rutjes, A. W., Reitsma, J. B., Glas, A. S., Bossuyt, P. M., & Kleijnen, J. (2004). Sources of variation and bias in studies of diagnostic accuracy: a systematic review. Annals of Internal Medicine, 140(3), 189-202.
24. Tang, D., Su, B., Tang, J., Ren, J., & Chen, G. (2010). Nanoparticle-based sandwich electrochemical immunoassay for carbohydrate antigen 125 with signal enhancement using enzyme-coated nanometer-sized enzyme-doped silica beads.Analytical chemistry, 82(4), 1527-1534.
25. Altboum, Z., Gozes, Y., Barnea, A., Pass, A., White, M. & Kobiler D. (2002). Postexposure prophylaxis against anthrax: evaluation of various treatment regimens in intranasally infected guinea pigs. Infection & Immunity. 70:6231–6241.
26. Schneemann, A., & Manchester, M. (2009). Anti-toxin antibodies in prophylaxis and treatment of inhalation anthrax. Future Microbiology. 4(1): 35-43.
27. Winterroth, L., Rivera, J., Nakouzi, A.S., Dadachova, E., Casadevall, A. (2010). Neutralizing monoclonal antibody to edema toxin and its effect on murine anthrax. Infection & Immunity 78, 2890–2898.
28. Chen, Z., Moayeri, M., Zhao, H., Crown, D., Leppla, S.H., Purcell, R.H. (2009). Potent neutralization of anthrax edema toxin by a humanized monoclonal antibody that competes with calmodulin for edema factor binding. Proceeding of National. Academy of Science, U.S.A. 106(32), 13487–13492.
29. Williams, D. D., & Turnbough, C. L. (2004). Surface layer protein EA1 is not a component of Bacillus anthracis spores but is a persistent contaminant in spore preparations. Journal of bacteriology, 186(2), 566-569.
30. Uchida, M., Harada, T., Enkhutuya, J., Kusumoto,A., Kobayashi, Y., Chiba, S. & Kawamoto, K. (2012). Protective effect of Bacillus anthracis surface protein EA1 against anthrax in mice model. Biochemical and biophysical research communication, 421(2), 323-328.
31. Wang, D. B., Yang, R., Zhang, Z. P., Bi, L. J., You, X. Y., Wei, H. P., Zhou, Y.F., Yu, Z. & Zhang, X. E. (2009). Detection of B. anthracis spores and vegetative cells with the same monoclonal antibodies. PloS one, 4(11), e7810.
32. Fouet, A., Mesnage, S., Tosi-Couture, E., Gounon, P., & Mock, M. (1999). Bacillus anthracis surface: capsule and S-layer. Journal of applied microbiology, 87(2), 251-255.
33. Köhler, G., and Milstein, C.(1975). Continuous cultures of fused cells secreting antibody of predefined specificity. Nature. 256:495.
34. Rao, S. S., Mohan, K. V., & Atreya, C. D. (2010). Detection technologies for Bacillus anthracis: prospects and challenges. Journal of microbiological methods, 82(1), 1-10.
35. Stopa, P. J. (2000). The flow cytometry of Bacillus anthracis spores revisited.Cytometry, 41(4), 237-244.
36. Mabry, R., Brasky, K., Geiger, R., Carrion, R., Hubbard, G. B., Leppla, S, Patterson, J.L., Georgiou G, & Iverson, B. L. (2006). Detection of anthrax toxin in the serum of animals infected with Bacillus anthracis by using engineered immunoassays. Clinical and Vaccine Immunology, 13(6), 671-677.
37. Kulshreshtha, P., & Bhatnagar, R. (2011). Inhibition of anthrax toxins with a bispecific monoclonal antibody that cross reacts with edema factor as well as lethal factor of Bacillus anthracis. Molecular immunology, 48(15), 1958-1965.
38. Cohen, S., Mendelson, I., Altboum, Z., Kobiler, D., Elhanany, E., Bino, T.,Leitner, M, Inbar , I, Rosenberg, H, Gozes, Y, Barak, R, Fisher, M, Kronman, C, Velan, B & Shafferman, A. (2000). Attenuated nontoxinogenic and nonencapsulated recombinant Bacillus anthracis spore vaccines protect against anthrax.Infection and immunity, 68(8), 4549-4558.

We Claim:
1. A recombinant bivalent chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13 of 765 bp.

2. A recombinant bivalent chimeric gene r-ScFvEAC752/862, wherein the said molecule is a chimera of nucleotide sequence coding for the variable region of heavy chain that has a size of 390 bp (SEQ ID No. 9) and light chain having a size of 330 bp (SEQ ID No. 10) from B.anthracis specific monoclonal antibody EAC752/862, and are linked by a glycine linker of 45 bp (SEQ ID No. 17).

3. A recombinant bivalent fusion protein r-ScFvEAC752/862 of 31.2 kDa having SEQ ID No. 12 and encoded by SEQ ID No. 13 as claimed in claims 1 and 2

4. The recombinant bivalent fusion protein as claimed in claims 1-3, which may form part of a protein or peptide or a monoclonal antibody.

5. The bivalent fusion protein as claimed in claims 1-3 that binds to 752 to 862 region of B. anthracis EA1 protein.

6. The recombinant bivalent fusion protein as claimed in claims 1-3, for the detection of both vegetative cells and spores of B. anthracis.

7. The bivalent fusion protein or any protein or peptide or monoclonal antibody moiety as claimed in claims 3-5, wherein the said molecules enable detection of 102 vegetative cells and 103 spores of B. anthracis.

8. A recombinant pET 22b r-ScFvEAC752/862 plasmid comprising the chimeric gene having SEQ ID No. 14.

9. A recombinant E. coli BL21 (DE3) p.LysS comprising of the recombinant pET 22b r-ScFvEAC752/862 plasmid mentioned in claim 8.

10. A method of preparing recombinant bivalent chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13 said method comprising the steps of.

(a) amplifying the variable region of heavy and light chain from the of B.anthracis specific mAb EAC752/862 using novel primers HC-F (SEQ ID No. 1), HC-R (SEQ ID No. 2), LC-F (SEQ ID No. 5) and LC-R (SEQ ID No. 6);
(b) adding (i) Nco I restriction site and nucleotide sequence for glycine linker at 5’ and 3’ ends, respectively to Heavy chain amplicon using primers HC-CLN-F (SEQ ID No. 3) and HC-GLY-R (SEQ ID No. 4); and (ii) also adding nucleotide sequence for glycine linker and XhoI restriction site at 5’ and 3’ ends respectively to Light chain amplicon of step (a) using primers LC-GLY-F(SEQ ID No. 7) and LC-CLN-R (SEQ ID No. 8) carrying out single step overlap extension PCR to join together the two amplicons;
(c) amplifying fused gene with extreme primers HC-CLN-F (SEQ ID No. 3) and LC-CLN-R (SEQ ID No. 8); and
(d) obtaining recombinant bivalent chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13

11. A process for production of recombinant bivalent fusion protein r-ScFvEAC752/862 having SEQ ID No: 12, said process comprising the steps of :
(a) amplifying the chimeric gene r-ScFvEAC752/862 having SEQ ID No. 13 using the primers HC-CLN-F (SEQ ID No. 3) and LC-CLN-R (SEQ ID No. 8);
(b) cloning chimeric gene r-ScFvEAC752/862 in E. coli BL21DE3 pLysS using Nco1 and XhoI restriction enzymes through pET22b vector;
(c) expressing the inserted gene of step (b) using the recombinant E. coli;
(d) obtaining the recombinant bivalent fusion protein r-ScFvEAC752/862 having SEQ ID No. 12 through purification by immobilized metal affinity chromatography from the expressed product of step (c).

12. A process for producing a specific IgY antibody, said method comprising the steps of:
(a) injecting chickens with r-EAN antigen;
(b) giving booster doses of r-EAN-antigen;
(c) isolating IgY using PEG precipitation and
(d) obtaining purified IgY antibody.

13. The process for producing a specific IgY antibody as claimed in claim 12, wherein IgY antibody shows specific binding with B.anthracis.

14. An in vitro method for detecting the vegetative cells and spores of Bacillus anthracis, said method comprising the steps of:
(a) coating the ELISA plates with IgY antibody followed by blocking (skim milk) and washing (PBST);
(b) incubating the ELISA plates with the vegetative spores or the vegetative cells of B. anthracis in separate assays followed by washing (PBST);
(c) adding biotin conjugated r-ScFvEAC752/862 followed by washing (PBST); and
(d) chromogenic detection of the vegetative cells and spores of Bacillus anthracis.

15. The in-vitro method as claimed in claim 14, wherein parent monoclonal antibody EAC752/862 is used with or without biotin conjugation instead of r-ScFvEAC752/862.

16. The methods as claimed in claims 14 -15, wherein the B. anthracis vegetative cells are detected as low as 102 and spores are detected as low as 103 spores.

17. The method as claimed in any one of claims 14-15, wherein the said method can detect the B. anthracis from any sample.

18. The bivalent fusion protein as claimed in claim 5 that inhibits the germination of B. anthracis spores to vegetative cell.

19. The monoclonal antibody EAC752/862 with heavy chain variable region (SEQ ID No. 9) and light chain variable region (SEQ ID No. 10) exhibiting bacteriostatic and bactericidal properties against B.anthracis.

20 The monoclonal antibody EAC752/862 as claimed in claim 19 with B.anthracis spore germination inhibition property.

21 The monoclonal antibody EAC752/862 as claimed in claim 19 that brings about structural changes in cell wall and release nucleic acids from the cells of B. anthracis or related Bacillus species.

22. The monoclonal antibody EAC752/862 as claimed in claim 19 that promotes opsonophagocytosis of vegetative cells or spores of B. anthracis.