Abstract: ABSTRACT MULTIPLEX ASSAY METHOD FOR SIMULTANEOUSLY DETECTING AND DISCRIMINATING SARS-CoV-2 AND MTB COMPLEX, AND KIT THEREOF The present disclosure relates to a method for simultaneously detecting and discriminating respiratory pathogens from a test sample. Extraction of target sequences is carried out using extraction composition employing paramagnetic particles. Alternatively, a rapid extraction composition is used to carry out extraction of target sequences within 10 minutes in a single container. Real-time RT-PCR based simultaneous detection and discrimination is carried out in a single reaction tube using a detection composition comprising primer and probe sequences that hybridize with the extracted target sequences in a non-overlapping and non-cross-reactive manner. The present disclosure further relates to kits to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample. Additionally, the kit compositions may be wholly or partly lyophilized, and their use may be wholly or partly automated for reducing the overall turnaround time and costs.
1. A multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising: extracting target sequences from the test sample in a single container; and running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences.
2. The method as claimed in claim 1, wherein the respiratory pathogens include at least one of SARS-CoV-2 or Mycobacterium tuberculosis complex.
3. The method as claimed in claim 1, wherein the extraction of target sequences is carried out using extraction composition comprising lysis, wash, and elution compositions in a single container.
4. The method as claimed in claim 1, wherein the extraction of target sequences is optionally carried out using a rapid extraction composition within 10 minutes in a single container.
5. The method as claimed in claim 3 and 4, wherein optionally homogenization of the test sample precedes the extraction of target sequences.
6. The method as claimed in claim 3 and 4, wherein the extraction composition and the rapid extraction composition optionally comprises a lysis enhancer buffer.
7. The method as claimed in claim 4, wherein, the rapid extraction composition comprises a lysis buffer selected from at least one of Chelex 100, polyethylene glycol, alkali, or detergent.
8. The method as claimed in claim 1, wherein the target sequence is at least one of IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex; rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or N gene for the detection and discrimination of SARS-CoV-2.
9. The method as claimed in claim 1, wherein the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12.
10. The method as claimed in claim 9, wherein, the IS6110 sequence is detected and amplified using, forward primer selected from SEQ ID NO: 1, and 4; reverse primer selected from SEQ ID NO: 2, and 5; and probe selected from SEQ ID NO: 3, and 6 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe.
11. The method as claimed in claim 9, wherein, the rrs gene is detected and amplified using, forward primer with SEQ ID NO: 7; reverse primer with SEQ ID NO: 8; and probe with SEQ ID NO: 9 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe.
12. A multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising: Composition for extracting target sequences from the test sample in a single container; and Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube.
13. The kit as claimed in claim 12, wherein the extraction of target sequences is carried out using a Rapid extraction composition within 10 minutes in a single container.
14. The kit as claimed in claim 12, wherein, the Rapid extraction composition comprises a lysis buffer comprising polyethylene glycol, and at least one alkali; further optionally comprising at least one of detergent or lysis enhancer buffer.
15. The kit as claimed in claim 14, wherein the alkali is at least one of potassium hydroxide, sodium hydroxide, ammonium hydroxide or calcium hydroxide.
16. The kit as claimed in claim 14, wherein the detergent is at least one of sodium dodecyl sulphate, sodium lauryl sulphate, Triton-X, or Tween 20.
17. The kit as claimed in claim 12, wherein the target sequence is at least one of IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex; rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or N gene for the detection and discrimination of SARS-CoV-2.
18. The kit as claimed in claim 12, wherein the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12; wherein, the IS6110 sequence is detected and amplified using, forward primer selected from SEQ ID NO: 1, and 4; reverse primer selected from SEQ ID NO: 2, and 5; and probe selected from SEQ ID NO: 3, and 6 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein, the rrs gene is detected and amplified using, forward primer with SEQ ID NO: 7; reverse primer with SEQ ID NO: 8; and probe with SEQ ID NO: 9 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and wherein, the N gene is detected and amplified using, forward primer with SEQ ID NO: 10; reverse primer with SEQ ID NO: 11; and probe with SEQ ID NO: 12 for simultaneously detecting and discriminating SARS-CoV-2 from the test sample; wherein the said probe is a dual labelled probe.
19. The kit as claimed in claim 12, wherein the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 9; wherein, the IS6110 sequence is detected and amplified using, forward primer selected from SEQ ID NO: 1, and 4; reverse primer selected from SEQ ID NO: 2, and 5; and probe selected from SEQ ID NO: 3, and 6 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and wherein, the rrs gene is detected and amplified using, forward primer with SEQ ID NO: 7; reverse primer with SEQ ID NO: 8; and probe with SEQ ID NO: 9 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe.
20. The method as claimed in claim 1, and the kit as claimed in claim 12, wherein the real-time RT-PCR is carried out using PCR buffer components, thermostable Reverse Transcriptase enzyme (RT), and Taq Polymerase, wherein the Hot Start Fast Taq polymerase and thermostable RT enzyme completes the real-time RT-PCR run within 60 minutes.
21. The method as claimed in claim 1, and the kit as claimed in claim 12, wherein the multiplex assay comprising extraction of target sequences using the extraction composition as claimed in claim 3 and real-time RT-PCR is completed within 120 minutes; and wherein, the multiplex assay comprising the extraction of target sequences using the rapid extraction composition as claimed in claim 4 and real-time RT-PCR is completed within 60 minutes.
22. The method as claimed in claim 1, and the kit as claimed in claim 12, wherein, the method and kit compositions, as a whole or in part are lyophilized. Dated this 24th Day of March 2022 Priyank Gupta IN/PA-1454 Agent for the Applicant , Description:FORM 2 THE PATENTS ACT, 1970 (39 of 1970) & THE PATENT RULES, 2003 COMPLETE SPECIFICATION (See Section 10 and Rule 13) Title of invention: MULTIPLEX ASSAY METHOD FOR SIMULTANEOUSLY DETECTING AND DISCRIMINATING SARS-CoV-2 AND MTB COMPLEX, AND KIT THEREOF APPLICANT: MYLAB DISCOVERY SOLUTIONS PRIVATE LIMITED An Indian entity having address: PLOT NO 99-B, LONAVALA INDUSTRIAL CO-OPERATIVE ESTATE LTD, NANGARGAON, LONAVALA, PUNE – 410401 MAHARASHTRA, INDIA. The following specification describes the invention and the manner in which it is to be performed CROSS-REFERENCE TO RELATED APPLICATIONS AND PRIORITY The present application does not claim priority from any other patent application. INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 4,096 Byte .txt (Text) file named "SARS-CoV-2 and MTB sequence.txt," created on March 21, 2022. TECHNICAL FIELD The present subject matter, in general, relates to the field of nucleic acid testing. More particularly, the present subject matter relates to a multiplex assay method for simultaneously detecting and discriminating SARS-CoV-2 and MTB complex from a test sample, as well as kit thereof. BACKGROUND Respiratory tract infections (RTI) are among the most common illnesses and primary causes of life-threating human diseases worldwide. Immuno-compromised individuals, including people with co-morbidities, the elderly, and infants are especially at risk of developing serious complications. These infections are primarily segregated into upper and lower respiratory tract infections depending on the type, localization, and proliferation of the RTI causing pathogens. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a highly transmissible and pathogenic coronavirus that has caused a pandemic of acute respiratory disease, COVID-19, which continues to threaten human health and public safety worldwide. While SARS-CoV-2 continues to proliferate globally, in some tuberculosis (TB) endemic nations like Africa, South America and Southeast Asia, COVID-19 may end up converging with opportunistic infections like TB due to its immunosuppressive ability. In contrast with the novel coronavirus or SARS-CoV-2, TB is a prominent opportunistic infection that has been causing fatalities in patients with massive tuberculosis, respiratory failure haemoptysis, TB with comorbidities, for at least 70,000 years. Although, TB persists as the leading cause of death among infectious diseases, since April 2020 COVID-19 has shown similar numbers of daily deaths worldwide. The convergence between these two deadly diseases raises concern among health authorities, especially in TB endemic countries. From an immunological perspective, the TB/COVID-19 co-infection has the potential to converge in a "perfect storm" since the disorders induced by each pathogen to the immunomodulation tend to induce an unbalanced inflammatory response, which can promote the progression and worsening of both diseases. However, apart from the speculation on what disease comes first, it is evident that the co-existence of TB and COVID-19 poses a challenge in differential diagnosis. Due to the similarities between TB and COVID-19 symptoms, countries with a precarious diagnostic structure suffer to accurately identify these infections; this issue negatively influences in therapeutic decision-making and, therefore, impacts in prognosis of both diseases. Further, although some of the pharmacological strategies proposed to control the damage caused by COVID-19 involve the modulation of immune response with corticosteroids, anti-inflammatory drugs such as TNF-a blockers, can further increase susceptibility to M. tuberculosis. While experience on COVID-19 infection in TB patients remains limited, people ill with both TB and COVID-19 may have poorer treatment outcomes, especially if either of the infections go undetected. Gram staining of smear, culture test, and serodiagnosis are known methods of testing respiratory pathogens causing acute respiratory infection. However, despite their sensitivity and specificity, these methods cannot detect pathogens, especially viruses such as SARS-Cov-2, during their window periods (WP), leading to false negative tests. Furthermore, Mycobacterium tuberculosis takes about 4-6 weeks or longer to grow under laboratory conditions, owing to a prolonged delay in disease diagnosis. Numerous Government organizations, such as MOHFW in India, have already directed bi-directional testing in patients with COVID-19/TB symptoms https://www.mohfw.gov.in/pdf/1TBCOVIDscreeningguidancenote.pdf). Although the convergence of these pathogens has been alarming, TB and COVID 19 testing continue to exist as separate diagnosing components in healthcare. To address this, the present disclosure discloses an economically feasible multiplex NAT, that would not only offer statistically significant advantage over conventionally practised testing methods for respiratory infections but also help in simultaneously detecting and discriminating the presence of SARS-Cov-2 and MTB complex in a single test sample. Owing to the high mutational susceptibility of SARS-Cov-2, the present disclosure further discloses a solution that helps in detecting all the mutated variants of SARS-Cov-2. Also, since most of the bacterial strains in the MTB complex are as virulent as, if not more than, Mycobacterium tuberculosis, the present disclosure further discloses the detection of all the bacterial strains present within the MTB (Mycobacterium tuberculosis) complex. Most commercially available kits for real-time RT-PCR based detection of SARS-Cov-2 or MTB involve liquid reagents that either need a cold supply chain of sub-zero temperatures such as -20°C for transport and storage or may be thermolabile and susceptible to loss of efficacy leading to plausibly false test outcomes. To address this and facilitate feasible testing in varied conditions, the present disclosure discloses method and kit compositions that are, as a whole or in part, in a freeze-dried form. Moreover, the turnaround time for reporting test outcomes is vital, particularly in crowded places that see mass movement of people. To address this, the present disclosure discloses method and kit compositions that complete SARS-Cov-2/MTB screening within less than two hours. Further, automation of the entire process from extraction to detection or even to reporting of results may reduce the manual errors and shorten the time required for end-to-end processing of the samples. To address this, the present disclosure discloses automated use of compositions, as a whole or in part. Further, a kit, preferably a Point of Care (POC) test kit of the present disclosure solves the above problems by providing compositions required for extracting target sequences from a test sample for simultaneously detecting and discriminating SARS-Cov-2 and/or MTB in test samples by real-time RT-PCR based assay. At least some of the kit components are lyophilised, thus imparting thermostability, reducing volumes, and allowing for transport and storage at room temperature, reducing overall detection costs. Further, the use of some of the kit components is automated to facilitate feasible handling of hazardous pathogens like SARS-Cov-2 and MTB. SUMMARY The present invention is directed to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising: extracting target sequences from the test sample in a single container; and running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences. In an exemplary embodiment, the instant invention discloses a multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising: Compositions for extracting target sequences from the test sample in a single container; and Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube. This summary is not intended to identify all the essential features of the claimed subject matter, nor is it intended to use in determining or limiting the scope of the claimed subject matter. BRIEF DESCRIPTION OF DRAWINGS The detailed description of drawings is outlined with reference to the accompanying figures. In the figures, the left-most digit (s) of a reference number identifies the Figure in which the reference number first appears. The same numbers are used throughout the drawings to refer like features and components. Fig. 1 demonstrates Linearity of N target wherein the X axis represents the Log copies/µl, and the Y axis represents Ct value. Fig. 2 demonstrates Linearity of MTB target wherein the X axis represents the Log CFU/mL, and the Y axis represents Ct value. DETAILED DESCRIPTION Reference throughout the specification to “various embodiments,” “some embodiments,” “one embodiment,” “alternate embodiment”, or “an embodiment” means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, appearances of the phrases “in various embodiments,” “in some embodiments,” “in one embodiment,” or “in an embodiment”, “in an alternate embodiment”, or “in a related embodiment” in places throughout the specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner in one or more embodiments. Before the present methods, compositions, and kits are described, it is to be understood that this disclosure is not limited to the particular methods, compositions, and kits as described, as there can be multiple possible embodiments which are not expressly illustrated in the present disclosure but may still be practicable within the scope of the present disclosure. Further, reference throughout the specification “composition”, or “compositions” refers to a specific formulation or dosage form of an active/functional element or components either alone or with essential compatible components and carriers for the intended use or a product comprising the specified ingredients in the specified amounts or any product which results, directly or indirectly, from combination of the specified ingredients in the specified amount. Additionally, reference throughout the specification to “multiplex assay” refers to an assay for simultaneous analysis of pooled samples. Further, for the purpose of the present disclosure, the term “buffer” means a composition of reagents. Also, the technical solutions offered by the present disclosure are clearly and completely described below. Examples in which specific reagents or conditions may not have been specified, have been conducted under conventional conditions or in a manner recommended by the manufacturer. The present disclosure relates to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising: extracting target sequences from the test sample in a single container; and running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences. For the purpose of the instant disclosure, it is clarified that in the present disclosure, target sequences pertain to the nucleic acids (DNA and RNA, including cDNA wherever applicable) of the respiratory viral, bacterial and/or fungal pathogens; particularly, specific regions, wholly or partly within the nucleic acids (DNA and RNA, including cDNA wherever applicable) of the respiratory viral, bacterial and/or fungal pathogens. For the purpose of the current disclosure, the said primer and probe sequences are specifically engineered for hybridising with the target sequences; wherein, the said target sequences may be amplified, detected, or otherwise analysed. The present disclosure further relates to a multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising: Compositions for extracting target sequences from the test sample in a single container; and Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube. The first aspect of the present disclosure is related to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising: extracting target sequences from the test sample in a single container; and running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences. One embodiment of the present disclosure relates to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample. In a related embodiment, the respiratory pathogens include at least one of viral, bacterial, or fungal pathogens, such as, but is not limited to, Aspergillus, Cryptococcus, Pneumocystis, endemic fungi rhinoviruses, respiratory syncytial virus, influenza virus, parainfluenza virus, human metapneumovirus, measles, mumps, adenovirus, coronaviruses, Streptococcus pneumoniae, Tuberculosis, Haemophilus influenzae and Moraxella catarrhalis, etc. In a preferred embodiment, the respiratory viral pathogen is SARS-CoV-2. In a related embodiment, the respiratory viral pathogen is at least one variant of SARS-CoV-2, such as, but is not limited to, (WHO labelled) Alpha (Pango lineage B.1.1.7), Beta (Pango lineage B.1.351), Gamma (Pango lineage P.1), Delta (Pango lineage B.1.617.2), and Omicron variant (B.1.1.529, and including all descendent Pango lineages BA.x, including BA.1, BA.1.1, and BA.2); wherein the term “PANGO” or “pango” means phylogenetic alignment of named global outbreak lineages. In a further embodiment, the respiratory pathogen is bacteria. In a preferred embodiment, the respiratory bacterial pathogen belongs to Mycobacterium tuberculosis complex. In a related embodiment, Mycobacterium tuberculosis complex comprises, but is not limited to, Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium orygis, Mycobacterium bovis, Mycobacterium microti, Mycobacterium canetti, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium suricattae, Mycobacterium mungi, and the Bacillus Calmette-Guerin strain. In a preferred embodiment, the respiratory pathogens include at least one of SARS-CoV-2 or Mycobacterium tuberculosis complex; more preferably, the respiratory pathogens include SARS-CoV-2 and Mycobacterium tuberculosis complex. In an embodiment, the test sample is at least one of human pulmonary or extra pulmonary specimen suspected of carrying the target sequences, such as, but is not limited to, sputum, saliva, oral specimen, nasal swab, etc. The present disclosure may provide flexibility in processing a sample through various volume sizes. Sample size plays an integral role in determining the outcome of extraction method. A large sample size has advantages of providing better and accurate data by reducing sensitivity problems. On the other hand, smaller sample size prevents financial, transportation, storge, and time commitments. In a preferred embodiment the test sample volume is up to 1mL. One embodiment of the present disclosure relates to extracting target sequences from the test sample. In a related embodiment, the extraction of target sequences is carried out using extraction composition comprising lysis, wash, and elution compositions; preferably, in a single container. In an embodiment, the lysis composition may comprise lysis buffer selected from a group of Tris, Tris hydrochloride, Tris chloride, phosphate, carbonate, citrate and others known to a skilled person in the art. In a preferred embodiment, the lysis buffer is Tris hydrochloride. In a further embodiment, the lysis composition may further comprise detergent selected from sodium dodecyl sulphate, Triton-X, and Tween 20; preferably sodium dodecyl sulphate. Additionally, lysis composition may comprise chaotropic salt selected from guanidinium thiocyanate, guanidine hydrochloride, guanidine isothiocyanate, and cyanoguanidine isosulphate. In a preferred embodiment, the lysis composition comprises guanidine thiocyanate at a concentration ranging from 2M to 6M. In an embodiment, the lysis composition may further comprise sodium salt selected from sodium citrate, sodium chloride, sodium acetate or combinations thereof that are known to a skilled person in the art. In another embodiment, the lysis composition may also comprise additives such as stabilizing/reducing agent selected from dithiothreitol (DTT), dithioerythritol (DTE), glycerol and /or chelating agent such as ethylenediaminetetraacetic acid (EDTA), anti-microbials such as sodium azide or combinations thereof that are known to a skilled person in the art. In another embodiment, the lysis composition may be used along with alcohol such as, but not limiting to, ethanol or isopropanol; preferably isopropanol. In an embodiment, sample lysis is carried out at a temperature ranging from 20°C to 70°C, preferably at a temperature ranging from 50°C to 60°C for up to 10 minutes at a pH ranging from 7.0 to 14, preferably at a pH ranging from 7.0 to 10. Extraction of target sequences may be carried out by employing silica gel solid supports such as membranes or columns; or paramagnetic particles as is known to a skilled person in the art. Use of paramagnetic particles eliminates the centrifugation steps normally employed by conventional methods. When magnetic field is applied to the sides of the vessel with sample, the paramagnetic particles aggregate without being denatured or damaged. In addition, extraction methods using paramagnetic particles have become a popular approach due to their high potential for automation. So, in a preferred embodiment, the extraction of the target sequences is carried out using paramagnetic particles due to its above-mentioned advantages as well as its potential for automation and semi-automation. Paramagnetic particles encompassing all its forms such as magnetic beads, paramagnetic nanoparticles, microparticles are constituted of one or several magnetic ores such as magnetite (Fe3O4) or maghemite (gamma Fe2O3), and may be coated with a matrix of polymers, silica, or hydroxyapatite with terminal functionality as is known to a skilled person in the art. In a preferred embodiment, the lysis composition may additionally apply paramagnetic particles selected from magnetic beads, paramagnetic nanoparticles, microparticles that may be uncoated or coated with polymers, silica, or hydroxyapatite with terminal functionality. In addition to sample lysis, in a preferred embodiment of the present invention, the method comprises additional steps of washing and/or eluting. In an embodiment, the lysed sample is washed using a wash composition comprising alcohol such as, but is not limited to, ethanol and isopropanol. Alternatively, lysed sample is washed using a wash composition comprising at least two washes of alcohol such as, but is not limited to, ethanol and isopropanol. In a preferred embodiment, ethanol is used for washing the lysed sample; preferably 60% to 80% ethanol is used for washing the lysed sample. In another embodiment, washed lysed sample is eluted using an elution composition to obtain the target sequences that can be directly applied for further processing or analyses. In an embodiment, elution step involves elution composition comprising acidic solution selected from water having pH less than 7 such as nuclease free water, de-ionized water, DEPC autoclaved water, and acidic buffer, and more preferably nuclease-free water or DEPC treated water. In a preferred embodiment, the extraction of target sequences is carried out using lysis, wash, and elution compositions in a single container. In order to limit the risk of cross-contamination, truncate the overall turnaround time, limit multiple pipetting, reduce material wastage, and requirement of equipment and space associated with the extraction of nucleic acids, in a preferred embodiment, lysis, wash, and elution steps are carried out in a single container. A “container” is any vessel capable of holding the components or compositions of the method for carrying out the present disclosure. The advantage of using a single container lies with its versatility since it can carry out a sequence of processes without the need to break the containment. This is particularly useful when processing toxic, infectious, or highly potent samples. In an alternate embodiment, the extraction of target sequences is optionally carried out using a rapid extraction composition within 10 minutes in a single container; preferably for point of care testing (POC testing). Point of care testing provides feasibility in transport, storage, and usage of compositions by untrained personnel who are unfamiliar with highly specific laboratory equipment, such as pipettes. Further, POC testing provides automation of the entire process from extraction to detection or even to reporting of results, reducing the manual errors and shortening the time required for end-to-end processing of the samples. In an embodiment, the rapid extraction composition comprises a lysis buffer selected from at least one of Chelex 100, polyethylene glycol, alkali, or detergent; the said polyethylene glycol is selected from the group consisting of PEG-100, PEG-200, PEG-300, PEG-400, PEG-500, PEG-1000, PEG-6000 or PEG-8000. In a preferred embodiment, the polyethylene glycol is PEG-200. In a related embodiment, the alkali is at least one of potassium hydroxide, sodium hydroxide, ammonium hydroxide or calcium hydroxide; preferably, sodium hydroxide. In another embodiment, the detergent is at least one of sodium dodecyl sulphate, sodium lauryl sulphate, Triton-X, or Tween 20; preferably, sodium dodecyl sulphate. In an embodiment, optionally stabilization of the test sample precedes the extraction of target sequences. In a related embodiment, a stabilization buffer is prepared using an alkaline buffer saline is used; preferably, phosphate buffer saline or molecular transport medium; particularly at a pH ranging from 7 to 8. In one embodiment, optionally homogenization of the test sample precedes the extraction of target sequences. In a preferred embodiment, homogenization of the test sample is carried out for viscous human pulmonary or extra pulmonary specimen suspected of carrying the MTB target sequences, such as, but is not limited to, sputum, and mucus. In a related embodiment, a homogenization buffer is selected from a group of alkali comprising, but not limiting to, sodium hydroxide, potassium hydroxide, and calcium hydroxide; preferably sodium hydroxide. In another embodiment, the homogenization buffer may optionally comprise detergent selected from sodium dodecyl sulphate, Triton-X, Tween 20 and polysorbate; preferably polysorbate. In a further embodiment, the homogenization buffer may additionally comprise alcohol such as, but is not limited to, ethanol and isopropanol; preferably isopropanol. In one embodiment, the extraction composition and the rapid extraction composition optionally comprises a lysis enhancer buffer. In a related embodiment, the lysis enhancer buffer comprises at least one lysis enzyme selected from proteinase K, DNase, and RNase. Furthermore, the lysis enzyme may be stabilised using additives such as alkaline salts such as sodium, potassium, calcium and/or long-chain alcohols such as glycerol, sorbitol, xylitol. In a preferred embodiment, the lysis enzyme is proteinase K. Optionally, Proteinase K may be stabilised using glycerol and/or calcium salt, preferably calcium chloride. Various modifications to the embodiments will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments. The present disclosure further relates to contacting the extracted target sequences with a detection composition comprising primer and probe sequences; wherein, the said primers and probe sequences hybridize with the extracted target sequences in a non-cross-reactive and non-overlapping manner to enable simultaneous detection and discrimination of respiratory pathogens from a test sample. The said primer sequences refer to nucleic acid sequences capable of acting as a point of initiation of DNA or RNA synthesis under conditions in which synthesis of a primer extension product complementary to a nucleic acid strand is induced, and the said probe sequences refer to nucleic acids of unique sequence capable of hybridizing to a correctly amplified fragment. The term “hybridization” or “hybridize” used herein indicates refers the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. In a preferred embodiment, the target sequence is at least one of IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex; rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or N gene for the detection and discrimination of SARS-CoV-2. In a related embodiment, the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12; wherein, the said primer and probe sequences are specific for target sequences of SARS-CoV-2, and Mycobacterium tuberculosis complex. In an embodiment, the IS6110 sequence is detected and amplified using, forward primer selected from SEQ ID NO: 1, and 4; reverse primer selected from SEQ ID NO: 2, and 5; and probe selected from SEQ ID NO: 3, and 6 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe. In another embodiment, the rrs gene is detected and amplified using, forward primer with SEQ ID NO: 7; reverse primer with SEQ ID NO: 8; and probe with SEQ ID NO: 9 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe. In a preferred embodiment, the primer and probe sequences hybridize with target sequences without cross-reacting or overlapping with any other nucleic acids present in the test sample. The non-cross reactive and non-overlapping nature helps in specifically amplifying the said specific target sequences, without interfering or reacting even with genomic DNA thus ensuring that only the pathogens to be screened are amplified, and eventually detected and discriminated. Furthermore, in some embodiments of the present disclosure, any one or combinations of primer/probe sequences described herein may contain chemically modified bases. Various modifications to the embodiment will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments. In an embodiment, the probe sequences described herein may be, but are not limited to, hydrolysis probes or dual hybridization probes. More preferably, the probe sequences in the present disclosure are hydrolysis probes. In some embodiments of the present disclosure, the probes are dual-labelled probes; preferably labelled with different fluorescent reporter groups at their 5 ‘ends and a fluorescent quencher group at their 3’ ends. In some embodiments, the fluorescent reporter groups are selected from FAM™, HEX™, ROX™, JOE™, CY3®, VIC®, TET™, Texas Red®, NED™, Alexa®, TAMRA™, CY5.5® and CY5®. Further, the fluorescence quencher is selected from BHQ®- 1, BHQ®- 2, BHQ®-3, MGB, DABCYL, and Iowa Black® dark quenchers. It should be noted that, those skilled in the art may select other types of fluorescence reporters and quenchers according to need and are within the scope of the present disclosure. Furthermore, an internal control (IC) containing synthetic fragment may be used to monitor the test sample recovery during extraction, amplification, and detection. An internal control is a nucleic acid sequence, unrelated to the target sequences, and may be selected from a list comprising ICs such as, but not limited to, buffer suspended IC and armored IC. In an embodiment IC may be added during the sample preparation procedure to monitor extraction efficiency and PCR inhibition if any or may be added during PCR in the reaction mix as a RT-PCR inhibition control. In a preferred embodiment, IC is a synthetic internal control (IC); particularly, a synthetic internal control (IC) exogenously added to the test sample prior to the sample lysis. In one embodiment, the real-time RT-PCR is carried out using PCR buffer components, thermostable Reverse Transcriptase enzyme (RT), and Taq Polymerase. In a related embodiment, the real-time RT-PCR is carried out using requisite PCR Mix comprising PCR enzymes comprising reverse transcriptase selected from at least one of M-MLV reverse transcriptase or AMV reverse transcriptase and DNA polymerases selected from Taq, Fast Taq, Hot Start Fast Taq, Tfl, Pfu, or Tth DNA polymerase; preferably Hot Start Fast Taq polymerase and a thermostable RT enzyme; wherein the Hot Start Fast Taq polymerase and thermostable RT enzyme completes the real-time RT-PCR run within 60 minutes. In one embodiment, the multiplex assay comprising extraction of target sequences using the extraction composition as claimed in claim 3 and real-time RT-PCR is completed within 120 minutes; and wherein, the multiplex assay comprising the extraction of target sequences using the rapid extraction composition as claimed in claim 4 and real-time RT-PCR is completed within 60 minutes. The present disclosure further relates to a multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising: Compositions for extracting target sequences from the test sample in a single container; and Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube. In the present disclosure, the term “kit” refers to a consumable or cartridge comprising a set of articles, components, cartridges, or compositions in a packet required for a specific purpose. In an embodiment, the test sample is at least one of human pulmonary or extra pulmonary specimen disclosed in the earlier embodiments. In a preferred embodiment the test sample volume is up to 1mL. One embodiment of the present disclosure relates to extracting target sequences from the test sample. In a related embodiment, the extraction of target sequences is carried out using extraction composition comprising lysis, wash, and elution compositions as disclosed in the earlier embodiments. Extraction of target sequences may be carried out by employing silica gel solid supports such as membranes or columns; or paramagnetic particles as is known to a skilled person in the art. In a preferred embodiment, the extraction of the target sequences is carried out using paramagnetic particles due to its above-mentioned advantages as well as its potential for automation and semi-automation. In a preferred embodiment, the extraction of target sequences is carried out using lysis, wash, and elution compositions in a single container. The advantage of using a single container lies with its versatility since it can carry out a sequence of processes without the need to break the containment. This is particularly useful when processing toxic, infectious, or highly potent samples such as SARS-CoV-2 and Mycobacterium tuberculosis complex. In a preferred embodiment, the extraction of target sequences is carried out using a Rapid extraction composition within 10 minutes in a single container; preferably for point of care testing (POC testing). In an embodiment, the Rapid extraction composition comprises a lysis buffer comprising polyethylene glycol, and at least one alkali; further optionally comprising at least one of detergent or lysis enhancer buffer. In one embodiment, polyethylene glycol is selected from the group consisting of PEG-100, PEG-200, PEG-300, PEG-400, PEG-500, PEG-1000, PEG-6000 or PEG-8000. In a preferred embodiment, the polyethylene glycol is PEG-200. In a related embodiment, the alkali is at least one of potassium hydroxide, sodium hydroxide, ammonium hydroxide or calcium hydroxide; preferably, sodium hydroxide. In another embodiment, the detergent is at least one of sodium dodecyl sulphate, sodium lauryl sulphate, Triton-X, or Tween 20; preferably, sodium dodecyl sulphate. In a further embodiment, the lysis enhancer buffer comprises at least one lysis enzyme selected from proteinase K, DNase, and RNase. Furthermore, the lysis enzyme may be stabilised using additives such as alkaline salts such as sodium, potassium, calcium and/or long-chain alcohols such as glycerol, sorbitol, xylitol. In a preferred embodiment, the lysis enzyme is proteinase K. In a related embodiment, reaction mixture comprising proteinase K is incubated at a temperature ranging from 50°C to 60°C, preferably around 56°C. In an embodiment, optionally stabilization of the test sample precedes the extraction of target sequences. In a related embodiment, a stabilization buffer is prepared using an alkaline buffer saline is used; preferably, phosphate buffer saline or molecular transport medium; particularly at a pH ranging from 7 to 8. In one embodiment, optionally homogenization of the test sample precedes the extraction of target sequences. In a preferred embodiment, homogenization of the test sample is carried out for viscous human pulmonary or extra pulmonary specimen suspected of carrying the MTB target sequences, such as, but is not limited to, sputum, and mucus. In a related embodiment, a homogenization buffer is selected from a group of alkali comprising, but not limiting to, sodium hydroxide, potassium hydroxide, and calcium hydroxide; preferably sodium hydroxide. In another embodiment, the homogenization buffer may optionally comprise detergent selected from sodium dodecyl sulphate, Triton-X, Tween 20 and polysorbate; preferably polysorbate. In a further embodiment, the homogenization buffer may additionally comprise alcohol such as, but is not limited to, ethanol and isopropanol; preferably isopropanol. The present disclosure further relates to contacting the extracted target sequences with a detection composition comprising primer and probe sequences; wherein, the said primers and probe sequences hybridize with the extracted target sequences in a non-cross-reactive and non-overlapping manner to enable simultaneous detection and discrimination of respiratory pathogens from a test sample. In a preferred embodiment, the target sequence is at least one of IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex; rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or N gene for the detection and discrimination of SARS-CoV-2. In a related embodiment, the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12; wherein, the IS6110 sequence is detected and amplified using, forward primer selected from SEQ ID NO: 1, and 4; reverse primer selected from SEQ ID NO: 2, and 5; and probe selected from SEQ ID NO: 3, and 6 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein, the rrs gene is detected and amplified using, forward primer with SEQ ID NO: 7; reverse primer with SEQ ID NO: 8; and probe with SEQ ID NO: 9 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and wherein, the N gene is detected and amplified using, forward primer with SEQ ID NO: 10; reverse primer with SEQ ID NO: 11; and probe with SEQ ID NO: 12 for simultaneously detecting and discriminating SARS-CoV-2 from the test sample; wherein the said probe is a dual labelled probe. In another embodiment, the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 9; wherein, the IS6110 sequence is detected and amplified using, forward primer selected from SEQ ID NO: 1, and 4; reverse primer selected from SEQ ID NO: 2, and 5; and probe selected from SEQ ID NO: 3, and 6 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and wherein, the rrs gene is detected and amplified using, forward primer with SEQ ID NO: 7; reverse primer with SEQ ID NO: 8; and probe with SEQ ID NO: 9 for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe. In a preferred embodiment, the primer and probe sequences hybridize with target sequences without cross-reacting or overlapping with any other nucleic acids present in the test sample. In some embodiments of the present disclosure, the probes are dual-labelled probes; preferably labelled with different fluorescent reporter groups at their 5 ‘ends and a fluorescent quencher group at their 3’ ends. In some embodiments, the fluorescent reporter groups are selected from FAM™, HEX™, ROX™, JOE™, CY3®, VIC®, TET™, Texas Red®, NED™, Alexa®, TAMRA™, CY5.5® and CY5®. Further, the fluorescence quencher is selected from BHQ®- 1, BHQ®- 2, BHQ®-3, MGB, DABCYL, and Iowa Black® dark quenchers. Furthermore, an internal control (IC) containing synthetic fragment may be used to monitor the test sample recovery during extraction, amplification, and detection. In a preferred embodiment, IC is a synthetic internal control (IC) exogenously added to the test sample prior to the sample lysis. In one embodiment, the real-time RT-PCR is carried out using PCR buffer components, thermostable Reverse Transcriptase enzyme (RT), and Taq Polymerase; preferably Hot Start Fast Taq polymerase and a thermostable RT enzyme; wherein the Hot Start Fast Taq polymerase and thermostable RT enzyme completes the real-time RT-PCR run within 60 minutes. In one embodiment, the multiplex assay comprising extraction of target sequences using the extraction composition as claimed in claim 3 and real-time RT-PCR is completed within 120 minutes; and wherein, the multiplex assay comprising the extraction of target sequences using the rapid extraction composition as claimed in claim 4 and real-time RT-PCR is completed within 60 minutes. Alternatively, the method and kit compositions described in previous embodiments, as a whole or in part are lyophilized. Lyophilization or freeze drying is a process in which water is removed from a product after it is frozen and placed under a vacuum, allowing the ice to change directly from solid to vapor without passing through a liquid phase. A rehydration buffer may be applied in order to rehydrate the constitution and resume their application in the process. As known to a skilled person, lyophilization makes room temperature storage feasible with desirable stability, and reduces challenges to transport of the materials, thus maximising applications of the kit and ensuring wider reach. In a preferred embodiment, lyophilized method and kit components exhibit increased shelf life, preferably more than 24 months. In one embodiment, the use of method and kit compositions described in previous embodiments, as a whole or in part is automated. As known to a skilled person, automated systems have been increasingly utilized to minimize the risk of human errors such as failure to follow the exact protocol, measuring mishaps, laboratorial accidents, contamination of materials due to over-handling, and miscalculations of data. Risk of human error could be disastrous, in a routine analytical process such as extraction of nucleic acids that may form the basis of health diagnosis and prognosis discussed hereinabove. Additionally, an automated system also highlights numerous advantages like higher production rates and increased productivity, efficient use of raw materials, better product quality, assurance of high reproducibility, improved safety, and established protocol. It also encourages versatility and reliability to procure better results. In an embodiment, the kit of the present disclosure may be coupled with any PCR machine having at least five channels. In another aspect, the kit packet also carries a user instructions manual. Various modifications to the embodiment will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments. However, one of ordinary skill in the art will readily recognize that the present disclosure is not intended to be limited to the embodiments illustrated but is to be accorded the widest scope consistent with the principles and features described herein. The foregoing description shall be interpreted as illustrative and not in any limiting sense. A person of ordinary skill in the art would understand that certain modifications could come within the scope of this disclosure. The features and properties of the present disclosure are described in further detail below with reference to examples. Table A: List of Sequences for SARS-CoV-2 and Mycobacterium tuberculosis complex detection and discrimination SEQ ID NO Sequences (5’?3’) Bases 1 CCGAGGCAGGCATCC 15 2 ATCGTCTCGGCTAGTGCATT 19 3 TCGGAAGCTCCTATGA 15 4 TAACCGGCTGTGGGTA 15 5 CGTAGGCGTCGGTGACA 17 6 GACCTCACCTAT 12 7 CCTTCGGGTTGTAAACCTCTTT 22 8 GACAACGCTCGCACCC 16 9 AGGTCCGGGTTCTCTCGGAT 20 10 AAA TTT TGG GGA CCA GGA AC* 20 11 TGG CAG CTG TGT AGG TCA AC * 20 12 ATG TCG CGC ATT GGC ATG GA * 20 *As recommended by Centers for Disease Control and Prevention (CDC) Example 1 Extraction of target sequences using extraction composition In this example, target sequences were extracted from up to 500µl of sputum sample using conventional methods known to a skilled person in the art. A negative extraction control was used as a test control. Homogenization composition was prepared in a sample tube by mixing the reagents shown in Table 1. Respiratory specimen (sputum) was inactivated by pre-treating with homogenization composition (up to 500µl) and incubating at around 37°C for up to 10 minutes with continuous shaking at up to 600 rpm followed by aspirating up to 200µl of the homogenate into a sample tube. Table 1: Homogenization composition for 200µl sample Reagent Final Concentration Sodium Hydroxide 1.5-0.5% Isopropanol <65% Polysorbate 20 0.8-1.8% Nuclease free water To make up the final volume For sample lysis, a lysis composition (up to 715µl) prepared by mixing the reagents shown in Table 2 was added to the homogenate (200µl) along with isopropanol and proteinase K (up to 50µl) in a sample tube and incubating at a temperature ranging from 50°C to 60°C for up to 10 minutes with continuous shaking at up to 600 rpm. Further, paramagnetic particles (up to 50µl) were added to the sample tube followed by incubation at around 56°C for up to 2 minutes with continuous shaking at up to 600 rpm. Table 2: Lysis composition for 200µl sample Reagent Stock Concentration pH Tris HCl 1M 7.6-8.0 Guanidine thiocyanate >4 M NA EDTA 0.5 M 8.0 SDS =5% NA Nuclease free water to make up volume NA Following the incubation, magnetic separation of the lysis composition in the sample tube was performed and the supernatant was discarded. The wash composition was prepared by mixing reagents shown in Table 3. Nucleic acids comprising target sequences bound to paramagnetic particles in the sample tube were washed using the wash composition (up to 600µl) with continuous shaking at up to 700 rpm for up to 1 minute. Table 3: Wash composition for 200µl sample Reagent Stock Concentration Absolute Ethanol 100% Nuclease free water for volume make up 20% Final concentration 80% Following the wash, magnetic separation was performed again, and the supernatant was discarded. The wash and the separation steps were carried out twice followed by drying at around 80°C for up to 5 minutes with continuous shaking at up to 500 rpm. Nucleic acids comprising target sequences were eluted from washed and dried nucleic acid bound paramagnetic particles using an elution composition prepared using nuclease free water or DEPC treated autoclaved water. For carrying out the elution step, up to 120µl of elution composition (pH-5-6) was added to the sample tube and the resuspended paramagnetic particles were vortexed at up to 600rpm and incubated for up to 10 minutes at around 80°C. Magnetic separation was performed again and the supernatant containing target sequences was transferred to a new tube for further analysis, or downstream applications or stored at -20°C or -80°C until further use. Thus, all the compositions employed in the extraction of target sequences have been disclosed and described in Table 4. Table 4: Reagents for the extraction of target sequences (for 200µl sample) Sr. No. Reagents for extraction Volume (µl) /Rx 1 Homogenization composition (optionally) 1000 2 Lysis enhancer buffer comprising Proteinase K 50 3 Paramagnetic particles 50 4 Wash composition 600 X 2 5 Lysis composition and isopropanol combo 715 6 Elution composition 120 Example 2 Extraction of target sequences using a rapid extraction composition Target sequences were optionally extracted using a rapid extraction composition. For the rapid extraction, oral specimen was used as the test sample. A negative extraction control was used as a test control. Table 5: Reagents for the rapid extraction of target sequences using rapid extraction composition Sr. No. Reagents
1. Various Lysis buffers tested for rapid extraction a. Polyethylene glycol (PEG) b. Alkali c. Detergent d. Chelex 100
2. Lysis enhancer buffer comprising proteinase K (optionally stabilised with CaCl2 and glycerol) The following table discloses the working combinations tested for performing rapid extraction of target sequences (Table 6). Table 6: Combinations of Lysis buffers tested for rapid extraction Test Sample Lysis buffer Internal control (IC) Lysis enhancer buffer (stabilized proteinase K) Reagents Conditions 1 Oral specimen/sputum /saliva in homogenization buffer (up to 500 µl) Guanidine isothiocyanate (4M), Tris Base (50mM), EDTA (20mM), SDS (0.50%), pH 7.8-8.0 56°C, 5 minutes Added Added 2 Oral specimen / sputum / saliva in stabilization buffer or homogenization buffer (up to 500 µl) Chelex100 and SDS 90°C, 5 minutes Added NA 3 Oral specimen in stabilization buffer (up to 500 µl) PEG 200 and up to 45mM of NaOH 37°C, 5 minutes Added NA 4 Oral specimen in stabilization buffer (up to 300 µl) PEG 200 and up to 45mM of NaOH 37°C, 5 minutes Added NA 5 Oral specimen in stabilization buffer (up to 100 µl) PEG 200 and up to 2M of NaOH 80°C, 10 minutes Added NA 6 Oral specimen in stabilization buffer (up to 200 µl) PEG 200 and up to 2M of NaOH 56°C, 10 minutes Added Added NA: Not applicable For the purpose of the present example, depending on the type of test sample, it was either pre-treated with the homogenization buffer or collected in a stabilization buffer, the protocols for which are given below. Homogenized sample was prepared by mixing the test sample with the homogenization buffer (Table 1) and incubating the mixture at around 37°C for up to 5 minutes. Stabilized sample was prepared by collecting the test sample in a stabilization buffer prepared using phosphate buffer saline or Molecular Transport Medium (pH around 7-8). Out of the tested working combinations disclosed in Table 6, Test combination 6 was standardised for further experimentations. Thus, for carrying out rapid extraction of target sequences as per Test combination 6, an oral specimen was collected in stabilization buffer prepared using phosphate buffer saline /molecular transport medium (pH around 7-8). 200µl of stabilization buffer with sample was transferred to lysis buffer (up to 1800 µl) and mixed as shown in Table 7. To this, lysis enhancer buffer (50µl) comprising proteinase K (up to 20mg/mL) was added and incubated at up to 56°C with vigorous shaking for up to 10 minutes and at 95°C for 3 minutes to inactivate proteinase K (optional) Table 7: Components of lysis buffer for rapid lysate preparation Reagent Final Concentration pH PEG 200 =70% NaOH =2M SDS (optional) =5% Nuclease free water To make up the final volume Final pH 11-14 The lysate obtained as a result was directly used for further analysis, or downstream applications or stored at -20°C or -80°C until further use. Example 3 Simultaneous detection and discrimination of SARS-CoV-2 and MTB complex using real-time RT-PCR The extracted target sequences from Example 1 or Example 2 were used for the simultaneous detection and discrimination of SARS-CoV-2 and MTB complex using real-time RT-PCR. The screening was monitored using SARS-CoV-2 and MTB Positive control Mix and No Template Control (NTC)/nuclease free water or negative control. PCR Mix was prepared using RT enzyme, Taq polymerase and buffer components. Detection composition was prepared using primers and dual probes specific to MTB complex, SARS-CoV-2, and an internal control target. Reaction mixture was prepared by mixing the PCR Mix and the Detection composition. The components used for carrying out the real-time RT-PCR are described in Table 8. Alternatively, one or more of the PCR Mix, the Detection composition or the Reaction mixture were lyophilised and rehydrated using suitable reconstitution buffer prior to use. Furthermore, the lyophilised compositions may be optionally placed in a tube or a container. Most commercially available kits for real-time RT-PCR based detection of SARS-Cov-2 or MTB involve liquid reagents that either require a cold supply chain of sub-zero temperatures for transport and storage. Lack of proper storage conditions causes increased susceptibility to loss of efficacy in the activity of the compositions. To address this and facilitate feasible testing in varied conditions, the present disclosure provides compositions in a lyophilised state, as a whole or in part. PCR plate was set up for real-time RT-PCR system using the extracted target sequences, positive controls, NTC, and the reaction mixture such that the total volume of the composition was up to 50µl per well. Table 8: Components for RT-PCR Contents Description PCR Mix RT enzyme, Taq polymerase and buffer components (Components may be optionally lyophilized) Detection composition Primers and probes specific to SARS-CoV-2, MTB complex, and internal control Nuclease free water RNase/DNase free water Positive control Mix: SARS-CoV-2 and MTB complex In vitro RNA transcript for SARS-CoV-2 and Synthetic DNA template for MTB target Internal Control (IC) Synthetic Internal control template Reconstitution buffer (optional) Buffer components for reconstitution of lyophilized PCR mix The PCR cycling conditions for the performed experiment are set forth in Table 9. Table 9: PCR Run method Parameter Stage Temperature Time RT incubation Hold 50°C Up to 15 minutes Enzyme inactivation Hold 95°C Up to 5 minutes PCR amplification Cycle (=40 cycles) 95°C 60°C Up to 15 sec Up to 45 sec * (*data collection) After performing the PCR run, fluorescence data was collected during 60°C extension step. The PCR plate was analysed using data analysing software and the result was saved. The results were generated as per Table 10. Table 10: Test validation and interpretation MTB SARS-CoV-2 IC Result Interpretation Negative Positive Positive SARS-CoV-2 RNA is detected. Targets specific for SARS-CoV-2 virus detected. Positive Negative Positive MTB DNA is detected. Target specific for MTB is detected Negative Negative Positive SARS-CoV-2 and MTB nucleic acids not detected Targets specific for SARS-CoV-2 virus and MTB are not detected. Negative Negative Negative Inhibition of PCR reaction, repeat the test. Inhibition of PCR reaction, repeat the test. Example 4 A kit to simultaneously detect and discriminate SARS-CoV-2 and MTB complex from a test sample. This example demonstrates a kit to simultaneously amplify, detect, and discriminate SARS-CoV-2 and MTB complex from a test sample in accordance with the present disclosure. For this example, the lysate from Example 1 or Example 2 was directly applied for the simultaneous detection and discrimination of SARS-CoV-2 and MTB using real-time RT-PCR. The present kit comprises RT-PCR components described in Table 6. The present kit may further comprise compositions/buffers described in Example 1 for performing manual, automated, or semi-automated extraction of target sequences from a sample. The present kit may comprise compositions/buffers described in Example 2 for performing rapid manual, automated, or semi-automated extraction of target sequences from a sample. Alternatively, the present kit may be combined with any other lysis and extraction method for performing the extraction of target sequences from a sample. Alternatively, the compositions of the kit, as a whole or in part may be lyophilized. Additionally, the lyophilised compositions may be optionally placed in a tube or a container. Furthermore, a reconstitution buffer may be further utilised for rehydrating the lyophilised compositions. Most commercially available kits for real-time RT-PCR based detection of SARS-Cov-2 or MTB involve liquid reagents that either require a cold supply chain of sub-zero temperatures for transport and storage. Lack of proper storage conditions causes increased susceptibility to loss of efficacy in the activity of the compositions. To address this and facilitate feasible testing in varied conditions, the present disclosure provides compositions in a lyophilised state, as a whole or in part. In this example, oral specimen was used as the sample. For performing real-time RT-PCR, reaction mixture was prepared by mixing the PCR Mix and the detection composition. The components used for carrying out the real-time RT-PCR are described in Table 8. PCR plate was set up for real-time RT-PCR system using the extracted target sequences, positive controls, NTC, and the reaction mixture such that the total volume of the composition was up to 25-50µl per well. The PCR cycling conditions for the performed experiment are set forth in Table 9. After performing the PCR run, fluorescence data was collected during 60°C extension step. The PCR plate was analysed using data analysing software and the result was saved. Performance Characteristics Limit of Detection (LOD or Analytical Sensitivity) The analytical sensitivity is defined as the concentration of target nucleic acids that can be detected with a positivity rate of = 95 %. To determine the sensitivity, the standard positive clinical samples were serially diluted into the negative specimen and tested on the PCR system. LOD studies determine the lowest detectable concentration of SARS-CoV-2 RNA and MTB genomic equivalents at which approximately 95% of all (true positive) replicates tested positive. The LOD of the present kit was determined by limiting dilution studies using NIBSC code 20/190 for SARS-COV-2 and ATCC 25618 for MTB culture. A preliminary run was carried out to predetermine LOD. In order to confirm the LOD serial 2-fold dilutions of total 7 concentrations spanning the predetermined LOD were tested with a total of 20 replicates per concentration in 5 independent runs on the PCR system using the present kit. Limit of Detection was detected 5 CFU/PCR or 30 CFU/mL for Mycobacterium tuberculosis Complex and 500 copies/mL for SARS-CoV-2 Table 11: Analytical sensitivity of SARS-CoV-2 and MTB complex MTB CFU/PCR Hit rate (%) SARS-CoV-2 copies/mL Hit rate (%) 100 100 2000 100 50 100 1000 100 25 100 500 95 5 95 250 94 2.5 67 125 85 1.6 42 62.55 65 0.8 8 31.25 45 Precision Intra-assay, inter-assay variability and repeatability were evaluated to establish the precision performance of the present kit for repeatability and reproducibility on the PCR system. Repeatability and Reproducibility data were obtained by the analysis of high and low concentrations of MTB and SARS-CoV-2 pathogens. The test was performed in five independent runs in triplicates, between two different operators, and using three different lots. The results are within the permissible limit of =20% coefficient of variation. Performance Study on Clinical Samples The diagnostic evaluation was performed by testing known positive and negative samples. Results were 100% concordant between inter-laboratory molecular testing. Cross-reactivity The present kit was evaluated using both- in silico analysis and wet testing against normal and pathogenic organisms found in the respiratory tract. Cross reactivity of the present kit was evaluated by testing with different organisms such as Human coronavirus 229E, Human coronavirus 0C43, Human coronavirus HKU1, Human coronavirus NL63, SARS-coronavirus, MERS-coronavirus, Parainfluenza virus 1-4, Influenza A and B, Enterovirus (e.g. EV68), Streptococcus pneumonia, Streptococcus pyrogenes, Corynebacterium diphtheriae, Mycoplasma pneumonia, Nocardiaasteroides, Pseudomonas aeruginosa, Staphylococcus epidermis, Rhodococcusequi, Streptococcus aureus, Mycobacterium fortuitum, Mycobacterium kansasii, Mycobacterium abscessus, Mycobacterium asiaticum, Mycobacterium shimoidei, Mycobacterium marinum, Mycobacterium trivial, Mycobacterium xenopi, Neisseria gonorrhoeae, Candida albicans, Escherichia coli, Enterobactor faecalis, Klebsiella oxytoca, S. maltophilie, etc. The kit was also evaluated with known negative oral specimens. To estimate the specificity of the present kit, in silico analysis using the Basic Local Alignment Search Tool (BLAST) managed by the National Center for Biotechnology Information (NCBI) was used to assess the designed primer probe for their inclusivity of all different variants and strains of SARS-CoV-2 and Mycobacterium tuberculosis complex Further, the present kit provides an advantage of automation. As known to a skilled person, automated systems have been increasingly utilized to minimize the risk of human errors such as failure to follow the exact protocol, measuring mishaps, laboratorial accidents, contamination of materials due to over-handling, and miscalculations of data. Risk of human error is the combination of the likelihood of occurrence of error and the severity of error, and could be disastrous, especially in a routine analytical process such as extraction of nucleic acids that may form the basis of health diagnosis and prognosis discussed hereinabove. In addition to the advantages enlisted herein, an automated system highlights numerous advantages over semi-automated and manual systems such as higher production rates and increased productivity, efficient use of raw materials, better product quality, assurance of high reproducibility, improved safety, and established protocol. It also encourages versatility and reliability to procure better results. The present kit also provides components in lyophilised form. Lyophilization or freeze drying is a process in which water is removed from a product after it is frozen and placed under a vacuum, allowing the ice to change directly from solid to vapor without passing through a liquid phase. A rehydration buffer may be applied in order to rehydrate the constitution and resume their application in the process. As known to a skilled person, lyophilization may ensure feasible room temperature storage, desirable stability, and unchallenging transport of the materials, ensuring that the kit showcases wider applications. The embodiments, examples and alternatives of the preceding paragraphs or the description and drawings, including any of their various aspects or respective individual features, may be taken independently or in any combination. Features described in connection with one embodiment are applicable to all embodiments, unless such features are incompatible. The preferred embodiments of the present invention are described in detail above. It should be understood that ordinary technologies in the field can make many modifications and changes according to the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by those skilled in the art through logical analysis, reasoning or limited experiments based on the concept of the present invention on the basis of the prior art should fall within the protection scope determined by the claims.
Claims:WE CLAIM:
1. A multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising:
extracting target sequences from the test sample in a single container; and
running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences.
2. The method as claimed in claim 1, wherein the respiratory pathogens include at least one of SARS-CoV-2 or Mycobacterium tuberculosis complex.
3. The method as claimed in claim 1, wherein the extraction of target sequences is carried out using extraction composition comprising lysis, wash, and elution compositions in a single container.
4. The method as claimed in claim 1, wherein the extraction of target sequences is optionally carried out using a rapid extraction composition within 10 minutes in a single container.
5. The method as claimed in claim 3 and 4, wherein optionally homogenization of the test sample precedes the extraction of target sequences.
6. The method as claimed in claim 3 and 4, wherein the extraction composition and the rapid extraction composition optionally comprises a lysis enhancer buffer.
7. The method as claimed in claim 4, wherein, the rapid extraction composition comprises a lysis buffer selected from at least one of Chelex 100, polyethylene glycol, alkali, or detergent.
8. The method as claimed in claim 1, wherein the target sequence is at least one of
IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex;
rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or
N gene for the detection and discrimination of SARS-CoV-2.
9. The method as claimed in claim 1, wherein the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12.
10. The method as claimed in claim 9, wherein, the IS6110 sequence is detected and amplified using,
forward primer selected from SEQ ID NO: 1, and 4;
reverse primer selected from SEQ ID NO: 2, and 5; and
probe selected from SEQ ID NO: 3, and 6
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe.
11. The method as claimed in claim 9, wherein, the rrs gene is detected and amplified using,
forward primer with SEQ ID NO: 7;
reverse primer with SEQ ID NO: 8; and
probe with SEQ ID NO: 9
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe.
12. A multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising:
Composition for extracting target sequences from the test sample in a single container; and
Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube.
13. The kit as claimed in claim 12, wherein the extraction of target sequences is carried out using a Rapid extraction composition within 10 minutes in a single container.
14. The kit as claimed in claim 12, wherein, the Rapid extraction composition comprises a lysis buffer comprising polyethylene glycol, and at least one alkali; further optionally comprising at least one of detergent or lysis enhancer buffer.
15. The kit as claimed in claim 14, wherein the alkali is at least one of potassium hydroxide, sodium hydroxide, ammonium hydroxide or calcium hydroxide.
16. The kit as claimed in claim 14, wherein the detergent is at least one of sodium dodecyl sulphate, sodium lauryl sulphate, Triton-X, or Tween 20.
17. The kit as claimed in claim 12, wherein the target sequence is at least one of
IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex;
rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or
N gene for the detection and discrimination of SARS-CoV-2.
18. The kit as claimed in claim 12, wherein the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12;
wherein, the IS6110 sequence is detected and amplified using,
forward primer selected from SEQ ID NO: 1, and 4;
reverse primer selected from SEQ ID NO: 2, and 5; and
probe selected from SEQ ID NO: 3, and 6
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample;
wherein, the rrs gene is detected and amplified using,
forward primer with SEQ ID NO: 7;
reverse primer with SEQ ID NO: 8; and
probe with SEQ ID NO: 9
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and
wherein, the N gene is detected and amplified using,
forward primer with SEQ ID NO: 10;
reverse primer with SEQ ID NO: 11; and
probe with SEQ ID NO: 12
for simultaneously detecting and discriminating SARS-CoV-2 from the test sample;
wherein the said probe is a dual labelled probe.
19. The kit as claimed in claim 12, wherein the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 9;
wherein, the IS6110 sequence is detected and amplified using,
forward primer selected from SEQ ID NO: 1, and 4;
reverse primer selected from SEQ ID NO: 2, and 5; and
probe selected from SEQ ID NO: 3, and 6
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and
wherein, the rrs gene is detected and amplified using,
forward primer with SEQ ID NO: 7;
reverse primer with SEQ ID NO: 8; and
probe with SEQ ID NO: 9
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample;
wherein the said probe is a dual labelled probe.
20. The method as claimed in claim 1, and the kit as claimed in claim 12, wherein the real-time RT-PCR is carried out using PCR buffer components, thermostable Reverse Transcriptase enzyme (RT), and Taq Polymerase, wherein the Hot Start Fast Taq polymerase and thermostable RT enzyme completes the real-time RT-PCR run within 60 minutes.
21. The method as claimed in claim 1, and the kit as claimed in claim 12, wherein the multiplex assay comprising extraction of target sequences using the extraction composition as claimed in claim 3 and real-time RT-PCR is completed within 120 minutes; and
wherein, the multiplex assay comprising the extraction of target sequences using the rapid extraction composition as claimed in claim 4 and real-time RT-PCR is completed within 60 minutes.
22. The method as claimed in claim 1, and the kit as claimed in claim 12, wherein, the method and kit compositions, as a whole or in part are lyophilized.
Dated this 24th Day of March 2022
Priyank Gupta
IN/PA-1454
Agent for the Applicant , Description:FORM 2
THE PATENTS ACT, 1970
(39 of 1970)
&
THE PATENT RULES, 2003
COMPLETE SPECIFICATION
(See Section 10 and Rule 13)
Title of invention:
MULTIPLEX ASSAY METHOD FOR SIMULTANEOUSLY DETECTING AND DISCRIMINATING SARS-CoV-2 AND MTB COMPLEX, AND KIT THEREOF
APPLICANT:
MYLAB DISCOVERY SOLUTIONS PRIVATE LIMITED
An Indian entity having address:
PLOT NO 99-B, LONAVALA INDUSTRIAL CO-OPERATIVE ESTATE LTD, NANGARGAON, LONAVALA, PUNE – 410401 MAHARASHTRA, INDIA.
The following specification describes the invention and the manner in which it is to be performed
CROSS-REFERENCE TO RELATED APPLICATIONS AND PRIORITY
The present application does not claim priority from any other patent application.
INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY
Incorporated by reference in its entirety herein is a computer-readable nucleotide/amino acid sequence listing submitted concurrently herewith and identified as follows: One 4,096 Byte .txt (Text) file named "SARS-CoV-2 and MTB sequence.txt," created on March 21, 2022.
TECHNICAL FIELD
The present subject matter, in general, relates to the field of nucleic acid testing. More particularly, the present subject matter relates to a multiplex assay method for simultaneously detecting and discriminating SARS-CoV-2 and MTB complex from a test sample, as well as kit thereof.
BACKGROUND
Respiratory tract infections (RTI) are among the most common illnesses and primary causes of life-threating human diseases worldwide. Immuno-compromised individuals, including people with co-morbidities, the elderly, and infants are especially at risk of developing serious complications. These infections are primarily segregated into upper and lower respiratory tract infections depending on the type, localization, and proliferation of the RTI causing pathogens.
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a highly transmissible and pathogenic coronavirus that has caused a pandemic of acute respiratory disease, COVID-19, which continues to threaten human health and public safety worldwide. While SARS-CoV-2 continues to proliferate globally, in some tuberculosis (TB) endemic nations like Africa, South America and Southeast Asia, COVID-19 may end up converging with opportunistic infections like TB due to its immunosuppressive ability.
In contrast with the novel coronavirus or SARS-CoV-2, TB is a prominent opportunistic infection that has been causing fatalities in patients with massive tuberculosis, respiratory failure haemoptysis, TB with comorbidities, for at least 70,000 years. Although, TB persists as the leading cause of death among infectious diseases, since April 2020 COVID-19 has shown similar numbers of daily deaths worldwide. The convergence between these two deadly diseases raises concern among health authorities, especially in TB endemic countries. From an immunological perspective, the TB/COVID-19 co-infection has the potential to converge in a "perfect storm" since the disorders induced by each pathogen to the immunomodulation tend to induce an unbalanced inflammatory response, which can promote the progression and worsening of both diseases. However, apart from the speculation on what disease comes first, it is evident that the co-existence of TB and COVID-19 poses a challenge in differential diagnosis.
Due to the similarities between TB and COVID-19 symptoms, countries with a precarious diagnostic structure suffer to accurately identify these infections; this issue negatively influences in therapeutic decision-making and, therefore, impacts in prognosis of both diseases. Further, although some of the pharmacological strategies proposed to control the damage caused by COVID-19 involve the modulation of immune response with corticosteroids, anti-inflammatory drugs such as TNF-a blockers, can further increase susceptibility to M. tuberculosis. While experience on COVID-19 infection in TB patients remains limited, people ill with both TB and COVID-19 may have poorer treatment outcomes, especially if either of the infections go undetected.
Gram staining of smear, culture test, and serodiagnosis are known methods of testing respiratory pathogens causing acute respiratory infection. However, despite their sensitivity and specificity, these methods cannot detect pathogens, especially viruses such as SARS-Cov-2, during their window periods (WP), leading to false negative tests. Furthermore, Mycobacterium tuberculosis takes about 4-6 weeks or longer to grow under laboratory conditions, owing to a prolonged delay in disease diagnosis.
Numerous Government organizations, such as MOHFW in India, have already directed bi-directional testing in patients with COVID-19/TB symptoms https://www.mohfw.gov.in/pdf/1TBCOVIDscreeningguidancenote.pdf). Although the convergence of these pathogens has been alarming, TB and COVID 19 testing continue to exist as separate diagnosing components in healthcare.
To address this, the present disclosure discloses an economically feasible multiplex NAT, that would not only offer statistically significant advantage over conventionally practised testing methods for respiratory infections but also help in simultaneously detecting and discriminating the presence of SARS-Cov-2 and MTB complex in a single test sample.
Owing to the high mutational susceptibility of SARS-Cov-2, the present disclosure further discloses a solution that helps in detecting all the mutated variants of SARS-Cov-2. Also, since most of the bacterial strains in the MTB complex are as virulent as, if not more than, Mycobacterium tuberculosis, the present disclosure further discloses the detection of all the bacterial strains present within the MTB (Mycobacterium tuberculosis) complex.
Most commercially available kits for real-time RT-PCR based detection of SARS-Cov-2 or MTB involve liquid reagents that either need a cold supply chain of sub-zero temperatures such as -20°C for transport and storage or may be thermolabile and susceptible to loss of efficacy leading to plausibly false test outcomes. To address this and facilitate feasible testing in varied conditions, the present disclosure discloses method and kit compositions that are, as a whole or in part, in a freeze-dried form. Moreover, the turnaround time for reporting test outcomes is vital, particularly in crowded places that see mass movement of people. To address this, the present disclosure discloses method and kit compositions that complete SARS-Cov-2/MTB screening within less than two hours.
Further, automation of the entire process from extraction to detection or even to reporting of results may reduce the manual errors and shorten the time required for end-to-end processing of the samples. To address this, the present disclosure discloses automated use of compositions, as a whole or in part.
Further, a kit, preferably a Point of Care (POC) test kit of the present disclosure solves the above problems by providing compositions required for extracting target sequences from a test sample for simultaneously detecting and discriminating SARS-Cov-2 and/or MTB in test samples by real-time RT-PCR based assay. At least some of the kit components are lyophilised, thus imparting thermostability, reducing volumes, and allowing for transport and storage at room temperature, reducing overall detection costs. Further, the use of some of the kit components is automated to facilitate feasible handling of hazardous pathogens like SARS-Cov-2 and MTB.
SUMMARY
The present invention is directed to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising: extracting target sequences from the test sample in a single container; and running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences.
In an exemplary embodiment, the instant invention discloses a multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising: Compositions for extracting target sequences from the test sample in a single container; and Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube.
This summary is not intended to identify all the essential features of the claimed subject matter, nor is it intended to use in determining or limiting the scope of the claimed subject matter.
BRIEF DESCRIPTION OF DRAWINGS
The detailed description of drawings is outlined with reference to the accompanying figures. In the figures, the left-most digit (s) of a reference number identifies the Figure in which the reference number first appears. The same numbers are used throughout the drawings to refer like features and components.
Fig. 1 demonstrates Linearity of N target wherein the X axis represents the Log copies/µl, and the Y axis represents Ct value.
Fig. 2 demonstrates Linearity of MTB target wherein the X axis represents the Log CFU/mL, and the Y axis represents Ct value.
DETAILED DESCRIPTION
Reference throughout the specification to “various embodiments,” “some embodiments,” “one embodiment,” “alternate embodiment”, or “an embodiment” means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, appearances of the phrases “in various embodiments,” “in some embodiments,” “in one embodiment,” or “in an embodiment”, “in an alternate embodiment”, or “in a related embodiment” in places throughout the specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner in one or more embodiments.
Before the present methods, compositions, and kits are described, it is to be understood that this disclosure is not limited to the particular methods, compositions, and kits as described, as there can be multiple possible embodiments which are not expressly illustrated in the present disclosure but may still be practicable within the scope of the present disclosure.
Further, reference throughout the specification “composition”, or “compositions” refers to a specific formulation or dosage form of an active/functional element or components either alone or with essential compatible components and carriers for the intended use or a product comprising the specified ingredients in the specified amounts or any product which results, directly or indirectly, from combination of the specified ingredients in the specified amount.
Additionally, reference throughout the specification to “multiplex assay” refers to an assay for simultaneous analysis of pooled samples. Further, for the purpose of the present disclosure, the term “buffer” means a composition of reagents.
Also, the technical solutions offered by the present disclosure are clearly and completely described below. Examples in which specific reagents or conditions may not have been specified, have been conducted under conventional conditions or in a manner recommended by the manufacturer.
The present disclosure relates to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising:
extracting target sequences from the test sample in a single container; and
running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences.
For the purpose of the instant disclosure, it is clarified that in the present disclosure, target sequences pertain to the nucleic acids (DNA and RNA, including cDNA wherever applicable) of the respiratory viral, bacterial and/or fungal pathogens; particularly, specific regions, wholly or partly within the nucleic acids (DNA and RNA, including cDNA wherever applicable) of the respiratory viral, bacterial and/or fungal pathogens. For the purpose of the current disclosure, the said primer and probe sequences are specifically engineered for hybridising with the target sequences; wherein, the said target sequences may be amplified, detected, or otherwise analysed.
The present disclosure further relates to a multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising:
Compositions for extracting target sequences from the test sample in a single container; and
Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube.
The first aspect of the present disclosure is related to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample; the said method comprising:
extracting target sequences from the test sample in a single container; and running real-time RT-PCR for carrying out simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube using a detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences.
One embodiment of the present disclosure relates to a multiplex assay method for simultaneously detecting and discriminating one or more respiratory pathogens from a test sample.
In a related embodiment, the respiratory pathogens include at least one of viral, bacterial, or fungal pathogens, such as, but is not limited to, Aspergillus, Cryptococcus, Pneumocystis, endemic fungi rhinoviruses, respiratory syncytial virus, influenza virus, parainfluenza virus, human metapneumovirus, measles, mumps, adenovirus, coronaviruses, Streptococcus pneumoniae, Tuberculosis, Haemophilus influenzae and Moraxella catarrhalis, etc.
In a preferred embodiment, the respiratory viral pathogen is SARS-CoV-2.
In a related embodiment, the respiratory viral pathogen is at least one variant of SARS-CoV-2, such as, but is not limited to, (WHO labelled) Alpha (Pango lineage B.1.1.7), Beta (Pango lineage B.1.351), Gamma (Pango lineage P.1), Delta (Pango lineage B.1.617.2), and Omicron variant (B.1.1.529, and including all descendent Pango lineages BA.x, including BA.1, BA.1.1, and BA.2); wherein the term “PANGO” or “pango” means phylogenetic alignment of named global outbreak lineages.
In a further embodiment, the respiratory pathogen is bacteria. In a preferred embodiment, the respiratory bacterial pathogen belongs to Mycobacterium tuberculosis complex.
In a related embodiment, Mycobacterium tuberculosis complex comprises, but is not limited to, Mycobacterium tuberculosis, Mycobacterium africanum, Mycobacterium orygis, Mycobacterium bovis, Mycobacterium microti, Mycobacterium canetti, Mycobacterium caprae, Mycobacterium pinnipedii, Mycobacterium suricattae, Mycobacterium mungi, and the Bacillus Calmette-Guerin strain.
In a preferred embodiment, the respiratory pathogens include at least one of SARS-CoV-2 or Mycobacterium tuberculosis complex; more preferably, the respiratory pathogens include SARS-CoV-2 and Mycobacterium tuberculosis complex.
In an embodiment, the test sample is at least one of human pulmonary or extra pulmonary specimen suspected of carrying the target sequences, such as, but is not limited to, sputum, saliva, oral specimen, nasal swab, etc.
The present disclosure may provide flexibility in processing a sample through various volume sizes. Sample size plays an integral role in determining the outcome of extraction method. A large sample size has advantages of providing better and accurate data by reducing sensitivity problems. On the other hand, smaller sample size prevents financial, transportation, storge, and time commitments. In a preferred embodiment the test sample volume is up to 1mL.
One embodiment of the present disclosure relates to extracting target sequences from the test sample.
In a related embodiment, the extraction of target sequences is carried out using extraction composition comprising lysis, wash, and elution compositions; preferably, in a single container.
In an embodiment, the lysis composition may comprise lysis buffer selected from a group of Tris, Tris hydrochloride, Tris chloride, phosphate, carbonate, citrate and others known to a skilled person in the art. In a preferred embodiment, the lysis buffer is Tris hydrochloride.
In a further embodiment, the lysis composition may further comprise detergent selected from sodium dodecyl sulphate, Triton-X, and Tween 20; preferably sodium dodecyl sulphate.
Additionally, lysis composition may comprise chaotropic salt selected from guanidinium thiocyanate, guanidine hydrochloride, guanidine isothiocyanate, and cyanoguanidine isosulphate. In a preferred embodiment, the lysis composition comprises guanidine thiocyanate at a concentration ranging from 2M to 6M.
In an embodiment, the lysis composition may further comprise sodium salt selected from sodium citrate, sodium chloride, sodium acetate or combinations thereof that are known to a skilled person in the art.
In another embodiment, the lysis composition may also comprise additives such as stabilizing/reducing agent selected from dithiothreitol (DTT), dithioerythritol (DTE), glycerol and /or chelating agent such as ethylenediaminetetraacetic acid (EDTA), anti-microbials such as sodium azide or combinations thereof that are known to a skilled person in the art.
In another embodiment, the lysis composition may be used along with alcohol such as, but not limiting to, ethanol or isopropanol; preferably isopropanol.
In an embodiment, sample lysis is carried out at a temperature ranging from 20°C to 70°C, preferably at a temperature ranging from 50°C to 60°C for up to 10 minutes at a pH ranging from 7.0 to 14, preferably at a pH ranging from 7.0 to 10.
Extraction of target sequences may be carried out by employing silica gel solid supports such as membranes or columns; or paramagnetic particles as is known to a skilled person in the art. Use of paramagnetic particles eliminates the centrifugation steps normally employed by conventional methods. When magnetic field is applied to the sides of the vessel with sample, the paramagnetic particles aggregate without being denatured or damaged. In addition, extraction methods using paramagnetic particles have become a popular approach due to their high potential for automation. So, in a preferred embodiment, the extraction of the target sequences is carried out using paramagnetic particles due to its above-mentioned advantages as well as its potential for automation and semi-automation.
Paramagnetic particles encompassing all its forms such as magnetic beads, paramagnetic nanoparticles, microparticles are constituted of one or several magnetic ores such as magnetite (Fe3O4) or maghemite (gamma Fe2O3), and may be coated with a matrix of polymers, silica, or hydroxyapatite with terminal functionality as is known to a skilled person in the art.
In a preferred embodiment, the lysis composition may additionally apply paramagnetic particles selected from magnetic beads, paramagnetic nanoparticles, microparticles that may be uncoated or coated with polymers, silica, or hydroxyapatite with terminal functionality.
In addition to sample lysis, in a preferred embodiment of the present invention, the method comprises additional steps of washing and/or eluting.
In an embodiment, the lysed sample is washed using a wash composition comprising alcohol such as, but is not limited to, ethanol and isopropanol. Alternatively, lysed sample is washed using a wash composition comprising at least two washes of alcohol such as, but is not limited to, ethanol and isopropanol. In a preferred embodiment, ethanol is used for washing the lysed sample; preferably 60% to 80% ethanol is used for washing the lysed sample.
In another embodiment, washed lysed sample is eluted using an elution composition to obtain the target sequences that can be directly applied for further processing or analyses.
In an embodiment, elution step involves elution composition comprising acidic solution selected from water having pH less than 7 such as nuclease free water, de-ionized water, DEPC autoclaved water, and acidic buffer, and more preferably nuclease-free water or DEPC treated water.
In a preferred embodiment, the extraction of target sequences is carried out using lysis, wash, and elution compositions in a single container.
In order to limit the risk of cross-contamination, truncate the overall turnaround time, limit multiple pipetting, reduce material wastage, and requirement of equipment and space associated with the extraction of nucleic acids, in a preferred embodiment, lysis, wash, and elution steps are carried out in a single container. A “container” is any vessel capable of holding the components or compositions of the method for carrying out the present disclosure. The advantage of using a single container lies with its versatility since it can carry out a sequence of processes without the need to break the containment. This is particularly useful when processing toxic, infectious, or highly potent samples.
In an alternate embodiment, the extraction of target sequences is optionally carried out using a rapid extraction composition within 10 minutes in a single container; preferably for point of care testing (POC testing).
Point of care testing provides feasibility in transport, storage, and usage of compositions by untrained personnel who are unfamiliar with highly specific laboratory equipment, such as pipettes. Further, POC testing provides automation of the entire process from extraction to detection or even to reporting of results, reducing the manual errors and shortening the time required for end-to-end processing of the samples.
In an embodiment, the rapid extraction composition comprises a lysis buffer selected from at least one of Chelex 100, polyethylene glycol, alkali, or detergent; the said polyethylene glycol is selected from the group consisting of PEG-100, PEG-200, PEG-300, PEG-400, PEG-500, PEG-1000, PEG-6000 or PEG-8000. In a preferred embodiment, the polyethylene glycol is PEG-200.
In a related embodiment, the alkali is at least one of potassium hydroxide, sodium hydroxide, ammonium hydroxide or calcium hydroxide; preferably, sodium hydroxide.
In another embodiment, the detergent is at least one of sodium dodecyl sulphate, sodium lauryl sulphate, Triton-X, or Tween 20; preferably, sodium dodecyl sulphate.
In an embodiment, optionally stabilization of the test sample precedes the extraction of target sequences.
In a related embodiment, a stabilization buffer is prepared using an alkaline buffer saline is used; preferably, phosphate buffer saline or molecular transport medium; particularly at a pH ranging from 7 to 8.
In one embodiment, optionally homogenization of the test sample precedes the extraction of target sequences.
In a preferred embodiment, homogenization of the test sample is carried out for viscous human pulmonary or extra pulmonary specimen suspected of carrying the MTB target sequences, such as, but is not limited to, sputum, and mucus.
In a related embodiment, a homogenization buffer is selected from a group of alkali comprising, but not limiting to, sodium hydroxide, potassium hydroxide, and calcium hydroxide; preferably sodium hydroxide.
In another embodiment, the homogenization buffer may optionally comprise detergent selected from sodium dodecyl sulphate, Triton-X, Tween 20 and polysorbate; preferably polysorbate.
In a further embodiment, the homogenization buffer may additionally comprise alcohol such as, but is not limited to, ethanol and isopropanol; preferably isopropanol.
In one embodiment, the extraction composition and the rapid extraction composition optionally comprises a lysis enhancer buffer.
In a related embodiment, the lysis enhancer buffer comprises at least one lysis enzyme selected from proteinase K, DNase, and RNase. Furthermore, the lysis enzyme may be stabilised using additives such as alkaline salts such as sodium, potassium, calcium and/or long-chain alcohols such as glycerol, sorbitol, xylitol. In a preferred embodiment, the lysis enzyme is proteinase K.
Optionally, Proteinase K may be stabilised using glycerol and/or calcium salt, preferably calcium chloride.
Various modifications to the embodiments will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments.
The present disclosure further relates to contacting the extracted target sequences with a detection composition comprising primer and probe sequences; wherein, the said primers and probe sequences hybridize with the extracted target sequences in a non-cross-reactive and non-overlapping manner to enable simultaneous detection and discrimination of respiratory pathogens from a test sample. The said primer sequences refer to nucleic acid sequences capable of acting as a point of initiation of DNA or RNA synthesis under conditions in which synthesis of a primer extension product complementary to a nucleic acid strand is induced, and the said probe sequences refer to nucleic acids of unique sequence capable of hybridizing to a correctly amplified fragment. The term “hybridization” or “hybridize” used herein indicates refers the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing.
In a preferred embodiment, the target sequence is at least one of
IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex;
rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or
N gene for the detection and discrimination of SARS-CoV-2.
In a related embodiment, the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12; wherein, the said primer and probe sequences are specific for target sequences of SARS-CoV-2, and Mycobacterium tuberculosis complex.
In an embodiment, the IS6110 sequence is detected and amplified using,
forward primer selected from SEQ ID NO: 1, and 4;
reverse primer selected from SEQ ID NO: 2, and 5; and
probe selected from SEQ ID NO: 3, and 6
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe.
In another embodiment, the rrs gene is detected and amplified using,
forward primer with SEQ ID NO: 7;
reverse primer with SEQ ID NO: 8; and
probe with SEQ ID NO: 9
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; wherein the said probe is a dual labelled probe.
In a preferred embodiment, the primer and probe sequences hybridize with target sequences without cross-reacting or overlapping with any other nucleic acids present in the test sample. The non-cross reactive and non-overlapping nature helps in specifically amplifying the said specific target sequences, without interfering or reacting even with genomic DNA thus ensuring that only the pathogens to be screened are amplified, and eventually detected and discriminated.
Furthermore, in some embodiments of the present disclosure, any one or combinations of primer/probe sequences described herein may contain chemically modified bases. Various modifications to the embodiment will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments.
In an embodiment, the probe sequences described herein may be, but are not limited to, hydrolysis probes or dual hybridization probes. More preferably, the probe sequences in the present disclosure are hydrolysis probes. In some embodiments of the present disclosure, the probes are dual-labelled probes; preferably labelled with different fluorescent reporter groups at their 5 ‘ends and a fluorescent quencher group at their 3’ ends.
In some embodiments, the fluorescent reporter groups are selected from FAM™, HEX™, ROX™, JOE™, CY3®, VIC®, TET™, Texas Red®, NED™, Alexa®, TAMRA™, CY5.5® and CY5®. Further, the fluorescence quencher is selected from BHQ®- 1, BHQ®- 2, BHQ®-3, MGB, DABCYL, and Iowa Black® dark quenchers.
It should be noted that, those skilled in the art may select other types of fluorescence reporters and quenchers according to need and are within the scope of the present disclosure.
Furthermore, an internal control (IC) containing synthetic fragment may be used to monitor the test sample recovery during extraction, amplification, and detection. An internal control is a nucleic acid sequence, unrelated to the target sequences, and may be selected from a list comprising ICs such as, but not limited to, buffer suspended IC and armored IC.
In an embodiment IC may be added during the sample preparation procedure to monitor extraction efficiency and PCR inhibition if any or may be added during PCR in the reaction mix as a RT-PCR inhibition control. In a preferred embodiment, IC is a synthetic internal control (IC); particularly, a synthetic internal control (IC) exogenously added to the test sample prior to the sample lysis.
In one embodiment, the real-time RT-PCR is carried out using PCR buffer components, thermostable Reverse Transcriptase enzyme (RT), and Taq Polymerase.
In a related embodiment, the real-time RT-PCR is carried out using requisite PCR Mix comprising PCR enzymes comprising reverse transcriptase selected from at least one of M-MLV reverse transcriptase or AMV reverse transcriptase and DNA polymerases selected from Taq, Fast Taq, Hot Start Fast Taq, Tfl, Pfu, or Tth DNA polymerase; preferably Hot Start Fast Taq polymerase and a thermostable RT enzyme; wherein the Hot Start Fast Taq polymerase and thermostable RT enzyme completes the real-time RT-PCR run within 60 minutes.
In one embodiment, the multiplex assay comprising extraction of target sequences using the extraction composition as claimed in claim 3 and real-time RT-PCR is completed within 120 minutes; and
wherein, the multiplex assay comprising the extraction of target sequences using the rapid extraction composition as claimed in claim 4 and real-time RT-PCR is completed within 60 minutes.
The present disclosure further relates to a multiplex assay kit to simultaneously detect and discriminate SARS-CoV-2 and Mycobacterium tuberculosis complex from a test sample; the said kit comprising:
Compositions for extracting target sequences from the test sample in a single container; and
Detection composition comprising non-overlapping and non-cross-reactive primer and probe sequences for carrying out real-time RT-PCR based simultaneous amplification, detection, and discrimination of the extracted target sequences in a single reaction tube.
In the present disclosure, the term “kit” refers to a consumable or cartridge comprising a set of articles, components, cartridges, or compositions in a packet required for a specific purpose.
In an embodiment, the test sample is at least one of human pulmonary or extra pulmonary specimen disclosed in the earlier embodiments.
In a preferred embodiment the test sample volume is up to 1mL.
One embodiment of the present disclosure relates to extracting target sequences from the test sample.
In a related embodiment, the extraction of target sequences is carried out using extraction composition comprising lysis, wash, and elution compositions as disclosed in the earlier embodiments.
Extraction of target sequences may be carried out by employing silica gel solid supports such as membranes or columns; or paramagnetic particles as is known to a skilled person in the art. In a preferred embodiment, the extraction of the target sequences is carried out using paramagnetic particles due to its above-mentioned advantages as well as its potential for automation and semi-automation.
In a preferred embodiment, the extraction of target sequences is carried out using lysis, wash, and elution compositions in a single container. The advantage of using a single container lies with its versatility since it can carry out a sequence of processes without the need to break the containment. This is particularly useful when processing toxic, infectious, or highly potent samples such as SARS-CoV-2 and Mycobacterium tuberculosis complex.
In a preferred embodiment, the extraction of target sequences is carried out using a Rapid extraction composition within 10 minutes in a single container; preferably for point of care testing (POC testing).
In an embodiment, the Rapid extraction composition comprises a lysis buffer comprising polyethylene glycol, and at least one alkali; further optionally comprising at least one of detergent or lysis enhancer buffer.
In one embodiment, polyethylene glycol is selected from the group consisting of PEG-100, PEG-200, PEG-300, PEG-400, PEG-500, PEG-1000, PEG-6000 or PEG-8000. In a preferred embodiment, the polyethylene glycol is PEG-200.
In a related embodiment, the alkali is at least one of potassium hydroxide, sodium hydroxide, ammonium hydroxide or calcium hydroxide; preferably, sodium hydroxide.
In another embodiment, the detergent is at least one of sodium dodecyl sulphate, sodium lauryl sulphate, Triton-X, or Tween 20; preferably, sodium dodecyl sulphate.
In a further embodiment, the lysis enhancer buffer comprises at least one lysis enzyme selected from proteinase K, DNase, and RNase. Furthermore, the lysis enzyme may be stabilised using additives such as alkaline salts such as sodium, potassium, calcium and/or long-chain alcohols such as glycerol, sorbitol, xylitol. In a preferred embodiment, the lysis enzyme is proteinase K.
In a related embodiment, reaction mixture comprising proteinase K is incubated at a temperature ranging from 50°C to 60°C, preferably around 56°C.
In an embodiment, optionally stabilization of the test sample precedes the extraction of target sequences.
In a related embodiment, a stabilization buffer is prepared using an alkaline buffer saline is used; preferably, phosphate buffer saline or molecular transport medium; particularly at a pH ranging from 7 to 8.
In one embodiment, optionally homogenization of the test sample precedes the extraction of target sequences.
In a preferred embodiment, homogenization of the test sample is carried out for viscous human pulmonary or extra pulmonary specimen suspected of carrying the MTB target sequences, such as, but is not limited to, sputum, and mucus.
In a related embodiment, a homogenization buffer is selected from a group of alkali comprising, but not limiting to, sodium hydroxide, potassium hydroxide, and calcium hydroxide; preferably sodium hydroxide.
In another embodiment, the homogenization buffer may optionally comprise detergent selected from sodium dodecyl sulphate, Triton-X, Tween 20 and polysorbate; preferably polysorbate.
In a further embodiment, the homogenization buffer may additionally comprise alcohol such as, but is not limited to, ethanol and isopropanol; preferably isopropanol.
The present disclosure further relates to contacting the extracted target sequences with a detection composition comprising primer and probe sequences; wherein, the said primers and probe sequences hybridize with the extracted target sequences in a non-cross-reactive and non-overlapping manner to enable simultaneous detection and discrimination of respiratory pathogens from a test sample.
In a preferred embodiment, the target sequence is at least one of
IS6110 sequence for the detection and discrimination of Mycobacterium tuberculosis complex;
rrs gene for the detection and discrimination of Mycobacterium tuberculosis complex; or
N gene for the detection and discrimination of SARS-CoV-2.
In a related embodiment, the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 12;
wherein, the IS6110 sequence is detected and amplified using,
forward primer selected from SEQ ID NO: 1, and 4;
reverse primer selected from SEQ ID NO: 2, and 5; and
probe selected from SEQ ID NO: 3, and 6
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample;
wherein, the rrs gene is detected and amplified using,
forward primer with SEQ ID NO: 7;
reverse primer with SEQ ID NO: 8; and
probe with SEQ ID NO: 9
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and
wherein, the N gene is detected and amplified using,
forward primer with SEQ ID NO: 10;
reverse primer with SEQ ID NO: 11; and
probe with SEQ ID NO: 12
for simultaneously detecting and discriminating SARS-CoV-2 from the test sample;
wherein the said probe is a dual labelled probe.
In another embodiment, the detection composition comprises primer and probe sequences selected from SEQ ID NO: 1 to 9;
wherein, the IS6110 sequence is detected and amplified using,
forward primer selected from SEQ ID NO: 1, and 4;
reverse primer selected from SEQ ID NO: 2, and 5; and
probe selected from SEQ ID NO: 3, and 6
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample; and
wherein, the rrs gene is detected and amplified using,
forward primer with SEQ ID NO: 7;
reverse primer with SEQ ID NO: 8; and
probe with SEQ ID NO: 9
for simultaneously detecting and discriminating Mycobacterium tuberculosis complex from the test sample;
wherein the said probe is a dual labelled probe.
In a preferred embodiment, the primer and probe sequences hybridize with target sequences without cross-reacting or overlapping with any other nucleic acids present in the test sample.
In some embodiments of the present disclosure, the probes are dual-labelled probes; preferably labelled with different fluorescent reporter groups at their 5 ‘ends and a fluorescent quencher group at their 3’ ends.
In some embodiments, the fluorescent reporter groups are selected from FAM™, HEX™, ROX™, JOE™, CY3®, VIC®, TET™, Texas Red®, NED™, Alexa®, TAMRA™, CY5.5® and CY5®. Further, the fluorescence quencher is selected from BHQ®- 1, BHQ®- 2, BHQ®-3, MGB, DABCYL, and Iowa Black® dark quenchers.
Furthermore, an internal control (IC) containing synthetic fragment may be used to monitor the test sample recovery during extraction, amplification, and detection. In a preferred embodiment, IC is a synthetic internal control (IC) exogenously added to the test sample prior to the sample lysis.
In one embodiment, the real-time RT-PCR is carried out using PCR buffer components, thermostable Reverse Transcriptase enzyme (RT), and Taq Polymerase; preferably Hot Start Fast Taq polymerase and a thermostable RT enzyme; wherein the Hot Start Fast Taq polymerase and thermostable RT enzyme completes the real-time RT-PCR run within 60 minutes.
In one embodiment, the multiplex assay comprising extraction of target sequences using the extraction composition as claimed in claim 3 and real-time RT-PCR is completed within 120 minutes; and
wherein, the multiplex assay comprising the extraction of target sequences using the rapid extraction composition as claimed in claim 4 and real-time RT-PCR is completed within 60 minutes.
Alternatively, the method and kit compositions described in previous embodiments, as a whole or in part are lyophilized. Lyophilization or freeze drying is a process in which water is removed from a product after it is frozen and placed under a vacuum, allowing the ice to change directly from solid to vapor without passing through a liquid phase. A rehydration buffer may be applied in order to rehydrate the constitution and resume their application in the process. As known to a skilled person, lyophilization makes room temperature storage feasible with desirable stability, and reduces challenges to transport of the materials, thus maximising applications of the kit and ensuring wider reach. In a preferred embodiment, lyophilized method and kit components exhibit increased shelf life, preferably more than 24 months.
In one embodiment, the use of method and kit compositions described in previous embodiments, as a whole or in part is automated. As known to a skilled person, automated systems have been increasingly utilized to minimize the risk of human errors such as failure to follow the exact protocol, measuring mishaps, laboratorial accidents, contamination of materials due to over-handling, and miscalculations of data. Risk of human error could be disastrous, in a routine analytical process such as extraction of nucleic acids that may form the basis of health diagnosis and prognosis discussed hereinabove. Additionally, an automated system also highlights numerous advantages like higher production rates and increased productivity, efficient use of raw materials, better product quality, assurance of high reproducibility, improved safety, and established protocol. It also encourages versatility and reliability to procure better results.
In an embodiment, the kit of the present disclosure may be coupled with any PCR machine having at least five channels.
In another aspect, the kit packet also carries a user instructions manual.
Various modifications to the embodiment will be readily apparent to those skilled in the art and the generic principles herein may be applied to other embodiments. However, one of ordinary skill in the art will readily recognize that the present disclosure is not intended to be limited to the embodiments illustrated but is to be accorded the widest scope consistent with the principles and features described herein.
The foregoing description shall be interpreted as illustrative and not in any limiting sense. A person of ordinary skill in the art would understand that certain modifications could come within the scope of this disclosure.
The features and properties of the present disclosure are described in further detail below with reference to examples.
Table A: List of Sequences for SARS-CoV-2 and Mycobacterium tuberculosis complex detection and discrimination
SEQ ID NO Sequences (5’?3’) Bases
1 CCGAGGCAGGCATCC 15
2 ATCGTCTCGGCTAGTGCATT 19
3 TCGGAAGCTCCTATGA 15
4 TAACCGGCTGTGGGTA 15
5 CGTAGGCGTCGGTGACA 17
6 GACCTCACCTAT 12
7 CCTTCGGGTTGTAAACCTCTTT 22
8 GACAACGCTCGCACCC 16
9 AGGTCCGGGTTCTCTCGGAT 20
10 AAA TTT TGG GGA CCA GGA AC* 20
11 TGG CAG CTG TGT AGG TCA AC * 20
12 ATG TCG CGC ATT GGC ATG GA * 20
*As recommended by Centers for Disease Control and Prevention (CDC)
Example 1
Extraction of target sequences using extraction composition
In this example, target sequences were extracted from up to 500µl of sputum sample using conventional methods known to a skilled person in the art.
A negative extraction control was used as a test control.
Homogenization composition was prepared in a sample tube by mixing the reagents shown in Table 1.
Respiratory specimen (sputum) was inactivated by pre-treating with homogenization composition (up to 500µl) and incubating at around 37°C for up to 10 minutes with continuous shaking at up to 600 rpm followed by aspirating up to 200µl of the homogenate into a sample tube.
Table 1: Homogenization composition for 200µl sample
Reagent Final Concentration
Sodium Hydroxide 1.5-0.5%
Isopropanol <65%
Polysorbate 20 0.8-1.8%
Nuclease free water To make up the final volume
For sample lysis, a lysis composition (up to 715µl) prepared by mixing the reagents shown in Table 2 was added to the homogenate (200µl) along with isopropanol and proteinase K (up to 50µl) in a sample tube and incubating at a temperature ranging from 50°C to 60°C for up to 10 minutes with continuous shaking at up to 600 rpm. Further, paramagnetic particles (up to 50µl) were added to the sample tube followed by incubation at around 56°C for up to 2 minutes with continuous shaking at up to 600 rpm.
Table 2: Lysis composition for 200µl sample
Reagent Stock Concentration pH
Tris HCl 1M 7.6-8.0
Guanidine thiocyanate >4 M NA
EDTA 0.5 M 8.0
SDS =5% NA
Nuclease free water to make up volume NA
Following the incubation, magnetic separation of the lysis composition in the sample tube was performed and the supernatant was discarded.
The wash composition was prepared by mixing reagents shown in Table 3. Nucleic acids comprising target sequences bound to paramagnetic particles in the sample tube were washed using the wash composition (up to 600µl) with continuous shaking at up to 700 rpm for up to 1 minute.
Table 3: Wash composition for 200µl sample
Reagent Stock Concentration
Absolute Ethanol 100%
Nuclease free water for volume make up 20%
Final concentration 80%
Following the wash, magnetic separation was performed again, and the supernatant was discarded. The wash and the separation steps were carried out twice followed by drying at around 80°C for up to 5 minutes with continuous shaking at up to 500 rpm.
Nucleic acids comprising target sequences were eluted from washed and dried nucleic acid bound paramagnetic particles using an elution composition prepared using nuclease free water or DEPC treated autoclaved water. For carrying out the elution step, up to 120µl of elution composition (pH-5-6) was added to the sample tube and the resuspended paramagnetic particles were vortexed at up to 600rpm and incubated for up to 10 minutes at around 80°C.
Magnetic separation was performed again and the supernatant containing target sequences was transferred to a new tube for further analysis, or downstream applications or stored at -20°C or -80°C until further use.
Thus, all the compositions employed in the extraction of target sequences have been disclosed and described in Table 4.
Table 4: Reagents for the extraction of target sequences (for 200µl sample)
Sr. No. Reagents for extraction Volume (µl) /Rx
1 Homogenization composition (optionally) 1000
2 Lysis enhancer buffer comprising Proteinase K 50
3 Paramagnetic particles 50
4 Wash composition 600 X 2
5 Lysis composition and isopropanol combo 715
6 Elution composition 120
Example 2
Extraction of target sequences using a rapid extraction composition
Target sequences were optionally extracted using a rapid extraction composition.
For the rapid extraction, oral specimen was used as the test sample.
A negative extraction control was used as a test control.
Table 5: Reagents for the rapid extraction of target sequences using rapid extraction composition
Sr. No. Reagents
1. Various Lysis buffers tested for rapid extraction
a. Polyethylene glycol (PEG)
b. Alkali
c. Detergent
d. Chelex 100
2. Lysis enhancer buffer comprising proteinase K (optionally stabilised with CaCl2 and glycerol)
The following table discloses the working combinations tested for performing rapid extraction of target sequences (Table 6).
Table 6: Combinations of Lysis buffers tested for rapid extraction
Test Sample Lysis buffer Internal control (IC) Lysis enhancer buffer (stabilized proteinase K)
Reagents Conditions
1 Oral specimen/sputum /saliva in homogenization buffer (up to 500 µl) Guanidine isothiocyanate (4M), Tris Base (50mM), EDTA (20mM), SDS (0.50%), pH 7.8-8.0 56°C,
5 minutes Added Added
2 Oral specimen / sputum / saliva in stabilization buffer or homogenization buffer (up to 500 µl) Chelex100 and SDS 90°C,
5 minutes Added NA
3 Oral specimen in stabilization buffer (up to 500 µl) PEG 200 and up to 45mM of NaOH 37°C,
5 minutes Added NA
4 Oral specimen in stabilization buffer (up to 300 µl) PEG 200 and up to 45mM of NaOH 37°C,
5 minutes Added NA
5 Oral specimen in stabilization buffer (up to 100 µl) PEG 200 and up to 2M of NaOH 80°C, 10 minutes Added NA
6 Oral specimen in stabilization buffer (up to 200 µl) PEG 200 and up to 2M of NaOH 56°C, 10 minutes Added Added
NA: Not applicable
For the purpose of the present example, depending on the type of test sample, it was either pre-treated with the homogenization buffer or collected in a stabilization buffer, the protocols for which are given below.
Homogenized sample was prepared by mixing the test sample with the homogenization buffer (Table 1) and incubating the mixture at around 37°C for up to 5 minutes.
Stabilized sample was prepared by collecting the test sample in a stabilization buffer prepared using phosphate buffer saline or Molecular Transport Medium (pH around 7-8).
Out of the tested working combinations disclosed in Table 6, Test combination 6 was standardised for further experimentations.
Thus, for carrying out rapid extraction of target sequences as per Test combination 6, an oral specimen was collected in stabilization buffer prepared using phosphate buffer saline /molecular transport medium (pH around 7-8). 200µl of stabilization buffer with sample was transferred to lysis buffer (up to 1800 µl) and mixed as shown in Table 7. To this, lysis enhancer buffer (50µl) comprising proteinase K (up to 20mg/mL) was added and incubated at up to 56°C with vigorous shaking for up to 10 minutes and at 95°C for 3 minutes to inactivate proteinase K (optional)
Table 7: Components of lysis buffer for rapid lysate preparation
Reagent Final Concentration pH
PEG 200 =70%
NaOH =2M
SDS (optional) =5%
Nuclease free water To make up the final volume
Final pH 11-14
The lysate obtained as a result was directly used for further analysis, or downstream applications or stored at -20°C or -80°C until further use.
Example 3
Simultaneous detection and discrimination of SARS-CoV-2 and MTB complex using real-time RT-PCR
The extracted target sequences from Example 1 or Example 2 were used for the simultaneous detection and discrimination of SARS-CoV-2 and MTB complex using real-time RT-PCR.
The screening was monitored using SARS-CoV-2 and MTB Positive control Mix and No Template Control (NTC)/nuclease free water or negative control.
PCR Mix was prepared using RT enzyme, Taq polymerase and buffer components.
Detection composition was prepared using primers and dual probes specific to MTB complex, SARS-CoV-2, and an internal control target.
Reaction mixture was prepared by mixing the PCR Mix and the Detection composition.
The components used for carrying out the real-time RT-PCR are described in Table 8.
Alternatively, one or more of the PCR Mix, the Detection composition or the Reaction mixture were lyophilised and rehydrated using suitable reconstitution buffer prior to use.
Furthermore, the lyophilised compositions may be optionally placed in a tube or a container.
Most commercially available kits for real-time RT-PCR based detection of SARS-Cov-2 or MTB involve liquid reagents that either require a cold supply chain of sub-zero temperatures for transport and storage. Lack of proper storage conditions causes increased susceptibility to loss of efficacy in the activity of the compositions. To address this and facilitate feasible testing in varied conditions, the present disclosure provides compositions in a lyophilised state, as a whole or in part.
PCR plate was set up for real-time RT-PCR system using the extracted target sequences, positive controls, NTC, and the reaction mixture such that the total volume of the composition was up to 50µl per well.
Table 8: Components for RT-PCR
Contents Description
PCR Mix RT enzyme, Taq polymerase and buffer components
(Components may be optionally lyophilized)
Detection composition Primers and probes specific to SARS-CoV-2, MTB complex, and internal control
Nuclease free water RNase/DNase free water
Positive control Mix: SARS-CoV-2 and MTB complex In vitro RNA transcript for SARS-CoV-2 and Synthetic DNA template for MTB target
Internal Control (IC) Synthetic Internal control template
Reconstitution buffer (optional) Buffer components for reconstitution of lyophilized PCR mix
The PCR cycling conditions for the performed experiment are set forth in Table 9.
Table 9: PCR Run method
Parameter Stage Temperature Time
RT incubation Hold 50°C Up to 15 minutes
Enzyme inactivation Hold 95°C Up to 5 minutes
PCR amplification Cycle
(=40 cycles) 95°C
60°C Up to 15 sec
Up to 45 sec *
(*data collection)
After performing the PCR run, fluorescence data was collected during 60°C extension step.
The PCR plate was analysed using data analysing software and the result was saved.
The results were generated as per Table 10.
Table 10: Test validation and interpretation
MTB SARS-CoV-2 IC Result Interpretation
Negative Positive Positive SARS-CoV-2 RNA is detected. Targets specific for SARS-CoV-2 virus detected.
Positive Negative Positive MTB DNA is detected. Target specific for MTB is detected
Negative Negative Positive SARS-CoV-2 and MTB nucleic acids not detected Targets specific for SARS-CoV-2 virus and MTB are not detected.
Negative Negative Negative Inhibition of PCR reaction, repeat the test. Inhibition of PCR reaction, repeat the test.
Example 4
A kit to simultaneously detect and discriminate SARS-CoV-2 and MTB complex from a test sample.
This example demonstrates a kit to simultaneously amplify, detect, and discriminate SARS-CoV-2 and MTB complex from a test sample in accordance with the present disclosure.
For this example, the lysate from Example 1 or Example 2 was directly applied for the simultaneous detection and discrimination of SARS-CoV-2 and MTB using real-time RT-PCR.
The present kit comprises RT-PCR components described in Table 6.
The present kit may further comprise compositions/buffers described in Example 1 for performing manual, automated, or semi-automated extraction of target sequences from a sample. The present kit may comprise compositions/buffers described in Example 2 for performing rapid manual, automated, or semi-automated extraction of target sequences from a sample. Alternatively, the present kit may be combined with any other lysis and extraction method for performing the extraction of target sequences from a sample.
Alternatively, the compositions of the kit, as a whole or in part may be lyophilized. Additionally, the lyophilised compositions may be optionally placed in a tube or a container. Furthermore, a reconstitution buffer may be further utilised for rehydrating the lyophilised compositions.
Most commercially available kits for real-time RT-PCR based detection of SARS-Cov-2 or MTB involve liquid reagents that either require a cold supply chain of sub-zero temperatures for transport and storage. Lack of proper storage conditions causes increased susceptibility to loss of efficacy in the activity of the compositions. To address this and facilitate feasible testing in varied conditions, the present disclosure provides compositions in a lyophilised state, as a whole or in part.
In this example, oral specimen was used as the sample.
For performing real-time RT-PCR, reaction mixture was prepared by mixing the PCR Mix and the detection composition. The components used for carrying out the real-time RT-PCR are described in Table 8.
PCR plate was set up for real-time RT-PCR system using the extracted target sequences, positive controls, NTC, and the reaction mixture such that the total volume of the composition was up to 25-50µl per well. The PCR cycling conditions for the performed experiment are set forth in Table 9.
After performing the PCR run, fluorescence data was collected during 60°C extension step. The PCR plate was analysed using data analysing software and the result was saved.
Performance Characteristics
Limit of Detection (LOD or Analytical Sensitivity)
The analytical sensitivity is defined as the concentration of target nucleic acids that can be detected with a positivity rate of = 95 %. To determine the sensitivity, the standard positive clinical samples were serially diluted into the negative specimen and tested on the PCR system.
LOD studies determine the lowest detectable concentration of SARS-CoV-2 RNA and MTB genomic equivalents at which approximately 95% of all (true positive) replicates tested positive. The LOD of the present kit was determined by limiting dilution studies using NIBSC code 20/190 for SARS-COV-2 and ATCC 25618 for MTB culture.
A preliminary run was carried out to predetermine LOD. In order to confirm the LOD serial 2-fold dilutions of total 7 concentrations spanning the predetermined LOD were tested with a total of 20 replicates per concentration in 5 independent runs on the PCR system using the present kit.
Limit of Detection was detected 5 CFU/PCR or 30 CFU/mL for Mycobacterium tuberculosis Complex and 500 copies/mL for SARS-CoV-2
Table 11: Analytical sensitivity of SARS-CoV-2 and MTB complex
MTB CFU/PCR Hit rate (%) SARS-CoV-2 copies/mL Hit rate (%)
100 100 2000 100
50 100 1000 100
25 100 500 95
5 95 250 94
2.5 67 125 85
1.6 42 62.55 65
0.8 8 31.25 45
Precision
Intra-assay, inter-assay variability and repeatability were evaluated to establish the precision performance of the present kit for repeatability and reproducibility on the PCR system.
Repeatability and Reproducibility data were obtained by the analysis of high and low concentrations of MTB and SARS-CoV-2 pathogens. The test was performed in five independent runs in triplicates, between two different operators, and using three different lots. The results are within the permissible limit of =20% coefficient of variation.
Performance Study on Clinical Samples
The diagnostic evaluation was performed by testing known positive and negative samples. Results were 100% concordant between inter-laboratory molecular testing.
Cross-reactivity
The present kit was evaluated using both- in silico analysis and wet testing against normal and pathogenic organisms found in the respiratory tract.
Cross reactivity of the present kit was evaluated by testing with different organisms such as Human coronavirus 229E, Human coronavirus 0C43, Human coronavirus HKU1, Human coronavirus NL63, SARS-coronavirus, MERS-coronavirus, Parainfluenza virus 1-4, Influenza A and B, Enterovirus (e.g. EV68), Streptococcus pneumonia, Streptococcus pyrogenes, Corynebacterium diphtheriae, Mycoplasma pneumonia, Nocardiaasteroides, Pseudomonas aeruginosa, Staphylococcus epidermis, Rhodococcusequi, Streptococcus aureus, Mycobacterium fortuitum, Mycobacterium kansasii, Mycobacterium abscessus, Mycobacterium asiaticum, Mycobacterium shimoidei, Mycobacterium marinum, Mycobacterium trivial, Mycobacterium xenopi, Neisseria gonorrhoeae, Candida albicans, Escherichia coli, Enterobactor faecalis, Klebsiella oxytoca, S. maltophilie, etc. The kit was also evaluated with known negative oral specimens.
To estimate the specificity of the present kit, in silico analysis using the Basic Local Alignment Search Tool (BLAST) managed by the National Center for Biotechnology Information (NCBI) was used to assess the designed primer probe for their inclusivity of all different variants and strains of SARS-CoV-2 and Mycobacterium tuberculosis complex
Further, the present kit provides an advantage of automation. As known to a skilled person, automated systems have been increasingly utilized to minimize the risk of human errors such as failure to follow the exact protocol, measuring mishaps, laboratorial accidents, contamination of materials due to over-handling, and miscalculations of data. Risk of human error is the combination of the likelihood of occurrence of error and the severity of error, and could be disastrous, especially in a routine analytical process such as extraction of nucleic acids that may form the basis of health diagnosis and prognosis discussed hereinabove. In addition to the advantages enlisted herein, an automated system highlights numerous advantages over semi-automated and manual systems such as higher production rates and increased productivity, efficient use of raw materials, better product quality, assurance of high reproducibility, improved safety, and established protocol. It also encourages versatility and reliability to procure better results.
The present kit also provides components in lyophilised form. Lyophilization or freeze drying is a process in which water is removed from a product after it is frozen and placed under a vacuum, allowing the ice to change directly from solid to vapor without passing through a liquid phase. A rehydration buffer may be applied in order to rehydrate the constitution and resume their application in the process. As known to a skilled person, lyophilization may ensure feasible room temperature storage, desirable stability, and unchallenging transport of the materials, ensuring that the kit showcases wider applications.
The embodiments, examples and alternatives of the preceding paragraphs or the description and drawings, including any of their various aspects or respective individual features, may be taken independently or in any combination. Features described in connection with one embodiment are applicable to all embodiments, unless such features are incompatible.
The preferred embodiments of the present invention are described in detail above. It should be understood that ordinary technologies in the field can make many modifications and changes according to the concept of the present invention without creative work. Therefore, all technical solutions that can be obtained by those skilled in the art through logical analysis, reasoning or limited experiments based on the concept of the present invention on the basis of the prior art should fall within the protection scope determined by the claims.
| # | Name | Date |
|---|---|---|
| 1 | 202221016568-STATEMENT OF UNDERTAKING (FORM 3) [24-03-2022(online)].pdf | 2022-03-24 |
| 2 | 202221016568-SEQUENCE LISTING(PDF) [24-03-2022(online)].pdf | 2022-03-24 |
| 3 | 202221016568-SEQUENCE LISTING [24-03-2022(online)].txt | 2022-03-24 |
| 4 | 202221016568-POWER OF AUTHORITY [24-03-2022(online)].pdf | 2022-03-24 |
| 5 | 202221016568-MSME CERTIFICATE [24-03-2022(online)].pdf | 2022-03-24 |
| 6 | 202221016568-FORM28 [24-03-2022(online)].pdf | 2022-03-24 |
| 7 | 202221016568-FORM-9 [24-03-2022(online)].pdf | 2022-03-24 |
| 8 | 202221016568-FORM FOR SMALL ENTITY(FORM-28) [24-03-2022(online)].pdf | 2022-03-24 |
| 9 | 202221016568-FORM FOR SMALL ENTITY [24-03-2022(online)].pdf | 2022-03-24 |
| 10 | 202221016568-FORM 18A [24-03-2022(online)].pdf | 2022-03-24 |
| 11 | 202221016568-FORM 1 [24-03-2022(online)].pdf | 2022-03-24 |
| 12 | 202221016568-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [24-03-2022(online)].pdf | 2022-03-24 |
| 13 | 202221016568-EVIDENCE FOR REGISTRATION UNDER SSI [24-03-2022(online)].pdf | 2022-03-24 |
| 14 | 202221016568-DRAWINGS [24-03-2022(online)].pdf | 2022-03-24 |
| 15 | 202221016568-COMPLETE SPECIFICATION [24-03-2022(online)].pdf | 2022-03-24 |
| 16 | 202221016568-Proof of Right [30-03-2022(online)].pdf | 2022-03-30 |
| 17 | Abstract.jpg | 2022-04-02 |
| 18 | 202221016568-FER.pdf | 2022-04-25 |
| 19 | 202221016568-FER_SER_REPLY [03-10-2022(online)].pdf | 2022-10-03 |
| 20 | 202221016568-CLAIMS [03-10-2022(online)].pdf | 2022-10-03 |
| 21 | 202221016568-US(14)-HearingNotice-(HearingDate-06-12-2022).pdf | 2022-11-09 |
| 22 | 202221016568-Correspondence to notify the Controller [30-11-2022(online)].pdf | 2022-11-30 |
| 23 | 202221016568-Written submissions and relevant documents [20-12-2022(online)].pdf | 2022-12-20 |
| 24 | 202221016568-Annexure [20-12-2022(online)].pdf | 2022-12-20 |
| 25 | 202221016568-PatentCertificate28-12-2022.pdf | 2022-12-28 |
| 26 | 202221016568-IntimationOfGrant28-12-2022.pdf | 2022-12-28 |
| 27 | 202221016568-FORM FOR SMALL ENTITY [10-01-2025(online)].pdf | 2025-01-10 |
| 1 | SearchHistoryE_20-04-2022.pdf |
| 2 | SearchHistory(1)AE_21-10-2022.pdf |