Abstract: Disclosed herein is a process for detecting Mycobacterium tuberculosis complex using a multiplex PCR assay anchored on a non-gel based detection format using Gyrase B gene (gyr B) in a given sample, and a kit thereof.
FORM 2
THE PATENT ACT 1970
(39 of 1970)
&
THE PATENT (AMENDMENT) RULES, 2006
PROVISIONAL SPECIFICATION
(See section 10 and rule 13)
1. TITLE OF THE INVENTION
Multiplex PCR Assay anchored on a non-gel based detection format for Mycobacterium tuberculosis complex using Gyrase B gene as species specific
Target
2. APPLICANT
(a) NAME
(b) NATIONALITY
(c) ADDRESS
Span Diagnostics Ltd.
IN
173-B, New Industrial Estate, Udhna, Surat - 394210, India
\. PREAMBLE TO THE DESCRIPTION
PROVISIONAL
The following specification describes the nature of this invention.
Field of Invention
This invention, in general relates to a process for detecting Mycobacterium tuberculosis complex in a given sample. In particular the present invention provides a novel method to detect M. tuberculosis complex using a multiplex PCR assay anchored on a non-gel based detection format using Gyrase B gene (gyr B) in a given sample.
Background of the Invention
Mycobacterium is a genus of Actinobacteria, given its own family, the Mycobacteriaceae. The genus includes pathogens known to cause serious diseases in mammals, including tuberculosis and leprosy. Mycobacteria can be classified into several major groups for purpose of diagnosis and treatment: M. tuberculosis complex which can cause tuberculosis: M. tuberculosis, M. bovis, M africanum, and M. microti, M. leprae which causes Hansen's disease or leprosy; Nontuberculous mycobacteria (NTM) are all the other mycobacteria which can cause pulmonary disease resembling tuberculosis, lymphadenitis, skin disease, or disseminated disease.
An accurate and early detection of the M. tuberculosis complex and their differentiation from non-tubercular bacteria is crucial for effective patient management and disease control. There are several methods available for detection of tubercular bacteria such as direct smear examination, various serological assays, tuberculin skin test and culture method however; they are not suitable for rapid detection of M. tuberculosis complex for one or other reasons. At present, most laboratories are dependent on direct smear examination by Acid-Fast Bacilli-staining (AFB-staining), and the conventional culture based techniques for detection of M. tuberculosis complex. While for the same day detction, AFB-staining is best and cheapest and within the budget of most of the laboratories: it is incapable in differentiating non-tuberculosis mycobacteria from M. tuberculosis complex. Usually patients at early stage of infection are missed. The immunological assays such as tuberculin skin test and serological tests are more useful in detecting latent infection and paucibacillary pulmonary as well as extrapulmonary tuberculosis. These tests are not very specific and they lack the sensitivity as well. Currently, the culture technique is the best as it is highly sensitive and specific and remains the gold standard in confirming the presence of M. tuberculosis complex. However, it is extremely time consuming process and requires biochemical analysis as well to confirm the tuberculosis.
2
There is an urgent need for more accurate and cost-effective detection technologies for M. tuberculosis complex. The assays should be less time consuming and more accurate for rapid detection of mycobacteria of M. tuberculosis complex for effective management and control of the disease. Recent advances in molecular biology techniques for amplification of DNA have revolutionized tuberculosis diagnosis and are being applied for rapid diagnosis. The sensitivity and specificity of many of these tests are very high and have been Reported equivalent to culture method and importantly can detect the infection within a much shorter time. The most mature of these technologies, PCR, is in one variant or another now common. in research laboratories and is used increasingly in routine diagnostic laboratory settings. However, use of PCR is limited by cost and sometimes the availability of adequate test sample volume. Multiplex PCR is an essential cost-saving technique for large-scale genotyping with significant scientific, clinical, and commercial applications including gene expression1, whole-genome sequencing 2'3, forensic analysis, including human identification and paternity testing4 and to facilitate the diagnosis of infectious diseases3.
Multiplex PCR technology has been in use for almost two decades as a tool in molecular detection of mycobacteria of M tuberculosis complex. Several commercial and in-house developed molecular diagnostic assays are available tor identifying disease causing mycobacterial species in recent years however; these assays have shown variability in results possibly due to different genetic targets used in development of assays. The DNA targets reported for such usage are 16S rRNA gene, rpoB, gyrB, hsp65, IS6110 element and 16S-23S Internal Transcribed Spacer (ITS). Line probe assays (LiPA), which are multiplex assay based on monoplex PCR or multiplex PCR, have widely been used for identifying M. tuberculosis and the gene/s responsible for the drug resistance. LiPA is also used for genotyping to identifying M. tuberculosis complex.
• The INNO-LiPA Mycobacterium system (developed by Innogenetics, Belgium) 6 is based on line probe hybridization and is available for the identification of Mycobacterium species. The system targets the 16S-23S rRNA gene spacer regions and identifies 16 Mycobacterium species.
• The INNO-LiPA Rif TB kit (developed by Innogeneti.es, Belgium) 7 is a line probe assay (LiPA) that identifies the M. tuberculosis complex and simultaneously detects genetic mutations in the rpoB gene region related to Rifampicin_resistance.
• The Genotype Mycobacterium CM/AS system (developed by Hain Life Science, Nehren, Germany) 8, is also based on line probe hybridization however, it targets the 23S rRNA gene and identifies 13 species.
• Hain's Genotype-MTBC assay9 is a multiplex PCR genotyping system to genetically differentiate the species belonging to the M. tuberculosis complex group: M. africanum
3
subtype I, M. bovis BCG, M. bovis subspecies bovis (now a days M. bovis), M. bovis subspecies caprae (nowadays M. caprae), M. microti and M. tuberculosis!M. africanum II/M canetii. The system is based on the detection of polymorphic sequencing of the gyrB gene and on RD1 deletion of M. bovis BCG.
• Ham's Genotype-MTBDR plus assay10 is also a Multiplex PCR for detecting Rifampicin
(RIF) and isoniazid (INH) resistance. The assay detects mutations in the rpoB gene for RiF
resistance, the katG gene for high-level INH resistance, and the inhA gene for low-level
INH resistance directly from smear positive sputum.
While these Multiplex-PCR assays are highly sensitive and specific, they are mainly made for identifying M. tuberculosis and drug resistant genes and genotyping to differentiate M. tuberculosis complex. In these assays, the DNA required for PCR is extracted from culture isolates i.e. from bacteria that are isolated from samples and grown on suitable medium. This makes the whole exercise quite cumbersome and much more time consuming. Multiplex PCR involving two to three targets have also been developed for diagnosis of tuberculosis and differentiating the tuberculosis complex from other opportunistic nontuberculous mycobacteria. The 16S rRNA and IS6110 genes have widely been used as targets by researchers in multiplex PCR to differentiate M. tuberculosis complex.
• Feng et al (2000) '' have used 16S rRNA gene in multiplex PCR by targeting two fragments of different size, one specific for genus and other as species specific. The study used cultured bacterial isolates for analyzing the usefulness of this multiplex PCR.
• Tanaka et al (2003) l2 have used IS6110 along with IS1245 for differentiation of M. tuberculosis complex from M. avium. The study also used cultured bacterial isolates for analyzing the usefulness of this multiplex PCR.
• Zhang et al (2007) l3 have used a pair of genus-specific primers and a set of genus- and species-specific probes were designed according to the conserved and polymorphic regions of the 16S rRNA gene, internal transcribed spacer (ITS) sequence, and 23S rRNA gene of mycobacteria in their multiplex PCR to differentiate tuberculosis causing mycobacteria from other nontuberculous mycobacteria. The assay was evaluated using clinical mycobacterial culture isolates and the sensitivity was found to be 100% and 82.7% in identifying M. tuberculosis and nontuberculous mycobacteria respectively. The 16S-23S ITS .is found 100% identical in M. tuberculosis Complex (includes M. tuberculosis, M. bovis, M. africanum, and M. microti).
• Kox et al (1997) M have used 16S rRNA gene along with IS6110 in their multiplex PCR system and detected it sequence specifically using various probes on reverse cross-blot
4
hybridization. In this study 16S rRNA was used as universal gene for detecting ail Mycobacteria, whereas IS6110 was used as a target to identify tuberculosis complex. The sensitivity and specificity of the PCR assay was 97.9% and 96.9% respectively and useful in direct diagnosis of tuberculosis from samples and isolation and culture of bacteria was not required. The positive predictive value of the assay was 95.0%, whereas the negative predictive value was 98.7%. • Portillo et al (1996) I5 have used alpha gene along with IS6110 and MTP-40 gene to differentiate M. bovis and other nontuberculous mycobacteria form M. tuberculosis complex. In the study, IS6110 and MTP-40 were used as species-specific target. The study used cultured bacterial isolates for analyzing the usefulness of this multiplex PCR. The assay was also found useful in direct diagnosis of tuberculosis from samples.
Feng et al (2000) ll, Tanaka et al (2003) 12 and Zhang et al (2007) 13 have successfully used 16S rRNA, Insertion sequence IS6110 and IS1245, and 16S rRNA, ITS 23S rRNA genes respectively in their multiplex PCR-based assay. However, these assays were optimized against DNA, isolated from culture isolates, which is time consuming process and delay the diagnosis considerably. The assay, developed by Kox et al (1997) l4 was found very sensitive and specific and useful in direct diagnosis of tuberculosis. The study had demonstrated that the assay is compatible with various clinical specimens, consisting of samples of sputum, tissue obtained by biopsy, lymph node obtained by biopsy, feces, urine, blood, cerebrospinal fluid (CSF), ascitic fluid, pleural fluid, pericardial fluid, bronchoalveolar lavage and gastric lavage fluid. The assay however, requires a cross-blotter to perform hybridization with various specific probes simultaneously in a cross format. It has not been optimized for some more simple and user-friendly format such as ELISA. In addition, it is argued that 16S rRNA gene evolves slowly and the specificity of probes based on rRNA sequences may not always be high enough to distinguish closely related strains. The IS6110 is species specific for tuberculosis complex, however; the target may not be ideal for all tuberculosis strains as it is not present in many strains (almost 10% of strains). MTP-40 also has its limitations in differentiating tuberculosis infection and has been shown to have lower sensitivity in diagnosing tuberculosis infection. l5
Prior Use OF svr B as a Detection Marker
DNA sequence polymorphism in the gyrB gene represents a unique marker that can be used as
genetic target for differentiating tuberculosis infection from other non-tuberculous mycobacterial
infections. The Gyrase B {gyrB) gene rarely transmits horizontally and its molecular evolution rate
is higher than that of 16S rRNA thereby increasing the differential potential. The gene has been
studied by many researchers as elaborated below:
5
\. Yamamoto and Harayama 16, 17 have proposed that gyrB could be a suitable phylogenetic marker for the identification and classification of bacteria.
2. It has been shown that the sequence of gyrB in bacteria of M. tuberculosis Complex is not 100% identical. They have four synonymous base substitutions and facilitate the differentiation of the M. tuberculosis Complex by DNA sequencing or by a simple PCR-RFLP analysis.
3. Using a PCR-restriction fragment length polymorphism (RFLP) assay, Niemann et al (2000) have shown that DNA single-nucleotide polymorphisms in the gyrB gene allows rapid differentiation of M. bovis subsp. bovis, M. bovis subsp. caprae, and M. microti, as well as clear identification of M. qfricanum subtype I strains.
4. Hain's Genotype-MTBC assay (as discussed above), is also based on the detection of polymorphic sequencing of the gyrB gene and on RD1 deletion of M. bovis BCG. The assay showed sensitivity between 98-99.9% in identifying the mycobacterial strains ' ' thereby confirming the differential potential of the gene. However, the assay is more suitable for genotyping of various members of M. tuberculosis complex and is performed on bacterial cultures isolates.
5. In a recent study, Iwamoto and colleagues (2003)24 at the Kobe Institute of Health, Japan have reported the use of gyrB as target in their "Loop-mediated isothermal amplification (LAMP)" assay, which is a rapid amplification assay and provides fast detection of a variety of mycobacterial pathogens. The assay has been shown to be highly sensitive however; due to the use of 6 primers in the assay, it is complex process and needs to be evaluated.
In view of the aforesaid limitations there is a requirement of a simple, sensitive and easy format method in a simple multiplex PCR system for detection of M tuberculosis complex. The current invention addresses the needs of the prior art and proposes the use of gyrB gene for detection of M. tuberculosis complex in a simple multiplex PCR system.
Description Of Present Invention
The present invention describes a method for detection of M. tuberculosis complex in a given sample comprising a Multiplex PCR Assay employing the Gyrase B (gyrB) gene wherein the multiplex PCR Assay is anchored on a non-gel based detection format.
According to the present invention gyrB gene (208 bp sequence) is used as M. tuberculosis complex specific target along with 16S rRNA gene as universal marker for mycobacteria in a
6
multiplex PCR system, which amplifies both the targets simultaneously during PCR. Further according to the present invention gyrg in the invention provides an alternative tuberculosis complex specific target gene to the IS61 lo insertion element.
According to present invention non-gel based detection format is ELISA format, which has been used for sequence specific detection of amplified products, based on the reverse hybridization technology.
PRIMER SETS: In the present invention, the sets of specific primers used for PCR-based
amplification of two target genes i.e. gyrB and 16S rRNA, have been designed on the basis of the published sequences utilized previously by other researchers in development of Loop mediated
amplification (TAMP) assay and* monopiex PCR respectively for diagnosis of tuberculosis 2< 2J.
The present invention uses the same synthetic specific primers wherein 5'-end of the forward
primer of each set has been modified and labeled with biotin. The details of the primers used in the
current invention are as follows:
Target: GyrB gene (208 bp)
F - Biotinylated 5'-GCGATATCTGGTGGTCTGC-3' (19 mer) R - 5!-CCGTGGTTTCGAAAACAGC-3' (19 mer)
Target: 16S rRNA (480 bp)
F - Biotinylated S'ATAAGCCTGQGAAACTGGGT 3' (20 mer) R- 5'-CACGCTCACAGTTAAGCCGT-3' (20 mer)
PROBES FOR SEQUENCE SPECIFIC DETECTION OF TARGETS: The present invention uses probes for sequence specific detection of targets. The specific probe for detection of gyrB has | been designed here by the inventors to use it for sequence specific detection of amplified gyrB gene.
Probe A for gyrB (Specific for A/, tuberculosis Complex)
5'CCTGAGACCACTCGTACCCGTCGCCTGAGACCACTCGTACCCGTCGCCTGAGA
CCACTCGTACCCGTCG-3 (69 mer)
The specific probe for mycobacteria genuS) which targets 16S rRNA gene has been designed on the basis of the published probe sequence, utilized previously. 14'25 However, to achieve more efficient immobilization and hybridization, the length of this probe has been modified and increased in length by three times to original one (18 nier only) by repeating the sequence at 3' end.
7
Probe B for 16S rRNA (Specific for Mycobacteria genus)
S'GGGCTCATCCCACACCGCGGGCTCATCCCACACCGCGGGCTCATCCCACACCGC-3' (54 mer) (modified for more efficient immobilization and hybridization)
The current invention eliminates prior art methods in the terms that the detection of amplified products in Multiplex PCR assay of the invention is done in user-friendly ELISA format to achieve higher sensitivity and specificity. The length of the probe has been modified by repeating the sequence to greatly increase the binding of probe to ELISA plates/strips and hybridization between probes and specific targets. Further the sequence specific detection on ELISA format makes the system much more specific and user-friendly as most of the laboratories are well familiar with ELISA format usually doing serodiagnosis. The method is further made easier by employing user-friendly formats such as Vertical flow through, Lateral flow through, Flow through and Dot-blot hybridization on Nylon membranes for detection of amplified products in Multiplex PCR assay unlike complex methods of the prior arts.
APPLICATIONS
1. The assay of the current invention is attuned with various clinical specimens from patients with pulmonary and extrapulmonary infections for detection of M. tuberculosis complex. This includes specimens consisting of samples of sputum, tissue obtained by biopsy, lymph node obtained by biopsy, urine, blood, cerebrospinal fluid (CSF), ascitic fluid, pleural fluid, pericardial fluid, bronchoalveolar lavage and gastric lavage fluid.
2. The assay is also useful in identification of different opportunist mycobacterial species such as M. avium and M. kansasii if desired however; it requires use of specific probes.
Overall advantages of the present invention are elaborated below:
1. Present invention provides an alternative target gene to the most widely used IS6110 insertion element and 16S-23S internal transcribed spacer (ITS).
2. The invention is also useful to identify tuberculous and opportunistic nontuberculous mycobacteria in co-infected immuno-compromised individuals.
3. The present invention provides cost effective rapid molecular diagnostics for diagnosis of tuberculosis in tuberculosis suspected samples and can be performed directly on samples.
8
4. The present invention uses a non-gel based reverse hybridization format, which is simpler and does not require agarose gel electrophoresis apparatus for analysis of amplicon/s.
5. In the present invention, ELISA format has been used to perform hybridization with various specific probes for simultaneous sequence specific detection, which makes the assay much more specific and user-friendly.
6. This assay is quick and reliable and may be used for early detection of M. tuberculosis complex to establish the tuberculosis infection in clinically suspected patients.
7. The sensitivity of the assay is very high and specificity has been comparable to culture technology.
METHODOLOGY
A. Decontamination of sputum specimen
Clinical specimens are decontaminated by the Petroff s method 26[the N-acetyl -L-cysteine -NaOH (NALC-NaOH)] with slight modification. This is one of the simplest method in which solution containing 4% NaOH and 1% NALC is mixed with equal volume of the specimen for digestion & the mixture were allowed to stand for 15 minute at room temperature. The reaction is neutralized with three volumes of 0.067M phosphate buffer (pH-6.8) and centrifuged at 10.000 rpm for 15 minute at 4°C. The resulting pellet is suspended in 100 uL of TE buffer (pH-8), and used for assays.
B. Extraction and purification of DNA
• The present invention utilizes an in-house protocol, indigenously developed at laboratory of Span Diagnostics Limited, Surat for DNA extraction and its purification.
• The protocol uses borosihcate glass microfiber membrane muJtiJayer column for purification of nucleic acid from Cell lysate. The protocol is specially optimized for isolation of DNA from mycobacteria. Mycobacterium possesses waxy cell wall, which provide greater strength to the bacilli and makes it difficult to lyse the cells to obtain genomic DNA.
• The protocol is based on physical (includes treatment with lysozyme and proteinase K) and chemical approaches (includes treatment with Triton X-100) to achieve maximum lysis (94-96%) of Cell wall of mycobacteria whereas efficient protein denaturation is achieved by use of high chaotropic salt treatment and heat. DNA binds to the borosilicate glass microfiber membrane, which is then eluted in buffer.
9
• The solutions used in the protocol are lysozyme solution, Proteinase K solution, Denaturing solution containing chaotropic salt, column-washing buffer, chilled ethanol, washing ethanol and elution buffer.
• Procedure: The lysis is carried out by adding 200 uL of lysis buffer (1% Triton X-100 in TE buffer (pH-8) and 2 mg/mL of lysozyme) in the pellet and incubating the suspension tube at 37°C for 30 min. After 30 min. of incubation 44 \iL of proteinase K (2 mg/mL) is added in the suspension and reincubated the suspension tube at 37°C for 20 min. This is followed by addition of 200 uL of denaturing solution (containing 1.2% Triton X-100. 4M Guanidium thiocyanate, 25mM of sodium citrate and 0.1 M 2-mercaptoethanol) and incubation at 37°C for 10 min. The content is heated at 90°C for 10 min. Cell lysate was applied on column and centrifuged. The Column is washed once with 500 uL of chilled absolute alcohol, and three times with 500 uL of 70 % ethanol. The column was dried at room temperature for 5 min and elution was done three times by using 50 uL of TE buffer (pH 9.0).
C. Amplification: The present invention simultaneously detects 16SrRNA gene; a universal
marker for mycobacteria and gyrB gene; a marker specific for M. tuberculosis complex. The
invention requires dNTPs (each at a concentration of 0.1 mM to 0.15 mM), 1.5X PCR buffers;
two sets of specific primers (forward primer biotinylated at 5'-end and reverse primer) for
amplification of desired targets, templates and Taq DNA polymerase enzyme (1 U/50 jil
reaction). Initially, before starting the PCR cycles the mixture of components is denatured at
94°C for 5 minutes. The PCR assay has been optimized for 35 cycles and each cycle consists of
one denaturation step (1 minute at 94°C), one annealing step (30 seconds at 60°C) and one
extension step (1 minute at 72°C). A final step involves additional extension for 7 min to allow
complete strand synthesis. The amplicons are stored refrigerated for further analysis.
D. Detection of amplified products
• Detection on 2% Agarose gel: The detection of amplified products is done by simply running the samples on 2% Agarose gel and then analyzing specific size amplified product bands (480 bp and 208 bp) by ethidium bromide staining.
• Non-gel based sequence specific detection: An alternatively non-gel based sequence specific detection assay has been developed, which is simpler and user-friendly for detection purposes and detects sequence specific amplicons. The assay is anchored on ELISA format and based on reverse hybridization technology. The invention utilizes
10
polystyrene activated ELISA plate/strips and immobilizes the probe/s using cationic detergent cetyltrimethyl ammonium bromide (CTAB) solution as described by Nikiforov and Knapp (US Patent 5610287, 1997). 27 In brief, Micro-titer wells are coated with specific Probe (50ul of 50nM concentration) overnight at 37°C and blocked with blocking solution. Biotinylated PCR Amplicon samples are denatured by adding equal amount of Denaturing Solution and incubating at RT for 10 min. The mixtures are neutralized by adding hybridization Solution and made the final dilution of PCR products to 1:50 or 1:100. Diluted PCR amplified products are added in wells and incubated at 37°C or at 55°C for 30 min. to 1 hour. Wells are washed five times with TNTw at 55°C (2x5 min.) and SA-HRP conjugate is added (1:2000) to wells and incubated for 30 min. at 37°C. (Alternatively, mixture of diluted PCR products and SA-HRP conjugate is added in one step and incubated at 37°C or at 55°C for 30 min. to 1 hour. The final dilutions of PCR products and SA-HRP are kept same as above.) The wells are washed again five times with TNTw at 55°C (2x5 min.) and Substrate is added to wells for color development. Reaction is stopped after 20 minutes and absorbance is measured at 450 nm.
runSOLUTIONS AND REAGENTS
Sets of specific Primers & probes: used Synthesized primes & probes
dNTPs: available in the market
PCR buffers: available in the market
Taq DNA polymerase: available in the market
Agarose: available in the market
Probe: Probes (Concentration-10 nM to 50 nM)
Microtiter Plate: High Binding Microtiter plate
Solution for Coating: 0.03mM CTAB
Blocking Solution: SXDenhart's Solution (50X solution containing 1% Ficoll, 1% PVP,
I%BSA)
Washing Solution: TNTw (lOmM Tris-HCl pH-7.5, l50mM NaCl, 0.5 % Tween 20)
Denaturing Solution: 0.5M NaOH and 1.5 M NaCl
Solution: 5X SSC, 0.1%N-Lauroyl Sarcosine, 0.02% SDS, 1% Blocking Sol.
Enzyme Conjugate: SA-HRP
Substrate: TMB (HRP- Substrate-Blue)
While this provisional patent application contains the description of the principal inventive concepts. The complete patent application pursuant here to, will fiilly and particularly describe the preferred embodiments of the present invention.
11
1. Ding C. and Cantor C.R., (2003) A high-throughput gene expression analysis technique using competitive PCR and MALDI-TOF mass spectrometry. Proc. Natl. Acad. Sci. U.S.A. 100,3059-64.
2. Beigei R, A.N., Apaydin S.M, Fortnow L, and Kasif S. 2001. An Optimal Multiplex PCR Protocol for Cfosing Gaps in Whole Genomes (RECOMB 01).
3. Tettelin, H., Radune, D, Kasif, S, Khouri, H. & Salzberg, S.L. 1999. Optimized multiplex PCR: efficiently closing a whole-genome shotgun sequencing project. Genomics 62,500-7.
4. S.Inagaki, Y.Yamamoto, Y.Doi, T.Takata, T.Ishikawa, K.Imabayashi, K.Yoshitome, S.Miyaishi, H.Ishizu (2004) new 39-plex analysis method for SNPs including 15 blood group loci Forensic Science International, 144, (1), 45-57.
5. Elnifro, E.M, AshshL A.M., Cooper, R.J. & Klapper, P.E. 2000. Multiplex PCR: optimization and application in diagnostic virology. Clin Microbiol Rev 13,559-70.
6. The INNO-LiPA Mycobacterium system developed by Innogenetics, Belgium for identification of species.
7. The INNO-LiPA Rif TB kit developed by Innogenetics, Belgium for detection of genetic mutations in the rpoB gene region related to Rifampicin-resistance.
8. The Genotype Mycobacterium CM/AS system developed by Hain Life Science, Nehren, Germany for identification of species.
9. The Genotype-MTBC assay developed by Hain Life Science, Nehren, Germany for genotyping system to genetically differentiate the species belonging to the M. tuberculosis complex group.
10. The Genotype-MTBDR plus assay developed by Hain Life Science, Nehren, Germany for detecting Rifampicin (RIF) and isoniazid (INH) resistance.
11. Feng F , Zhidan X and Ru C (2000) Establishment of a multiplex PCR system to diagnose
23 APR 2009.
tuberculosis and other bacterial infections. 20(4), 324-326.
12. Tanaka I, Anno I, Leite S, Cooksey R, and Leite C (2003) Comparison of a Multiplex-PCR Assay with mycolic analysis and conventional methods for the identification of mycobacteria. Microbio.Imunol. 47 95), 3007-312.
13. Zhang S, Shen J, Shen G, Sun Z, Xu P, Peng Y, Yang Z, and Sun Q. (2007). Use of a novel multiplex probe array for rapid identification of Mycobacterium species from clinical isolates. World J Microbiol Biotechnol. 23:1779-1788.
14. Kox L, Jansen HM, Kuijper S and Kolk A (1997). Multiplex PCR Assay for Immediate identification of the Infecting Species in Patients with Mycobacterial Disease. J Clin Microbiol. 35 (6) 1492-1498.
15. Portillo P, Carmen T M, Martinez E, Maranon C, Valladares B, Patarroya ME, and Carloslopezi M. (1996) Multiprimer PCR System for Differential Identification of Mycobacteria in Clinical Samples. J. Clin. Microbiol. 34 (2) 324-328.
16. Yamamoto S and Harayama S (1995). PCR Amplifica4ion and Direct Sequencing of gyrB Genes with Universal Primers and Their Application to the Detection and Taxonomic Analysis of Pseudomonas putida Strains. Applied and Environmental Microbiology. 1104-1109.
17. Yamamoto S and Harayama S (1996). Phylogenetic Analysis of Acinetobacter Strains Based on the Nucleotide Sequences of gyrB Genes and on the Amino Acid Sequences of Their Products. International Journal of systematic Bacteriology. 506-511.
18. Kasai H, Watanabe K, Gasteiger E, Bairoch A, Isono K, Yamamoto S and Harayama S. (1998). Construction of the gyrB database for the identification and classification of bacteria. Genome Inform. Seb. Workshop Genome Inform. 13-21.
19. Niemann S, Harmsen D, SCH-Gerdes S, and Richter E (2000) Differentiation of Clinical Mycobacterium tuberculosis Complex Isolates by gyrB DNA Sequence Polymorphism Analysis. J. Clin. Microbiol. 38. (9) 3231-3234.
20. Richter E, Weizenegger M, Riisch-Gerdes S, Niemann S (2003) Evaluation of Genotype
13
MTBC assay for differentiation of clinical Mycobacterium tuberculosis complex isolates. J Clin Microbiol 41:2672-2675.
21.Makinen J, Sarkola A, Marjamaki M, Viljanen MK, Soini H (2002) Evaluation of GenoType and LiPA MYCOBACTERIA assays for identification of Finnish mycobacterial isolates. J Clin Microbiol 40:3478-3481.
22. Richter E, Weizenegger M. Fahr AM. Rusch-Gerdes S (2004) Usefulness of the GenoType MTBC assay for differentiating species of the Mycobacterium tuberculosis complex in cultures obtained from clinical specimens. J Clin Microbiol 42:4303^1306.
23. Padilla E, Gonzalez V, Manterota JM, Perez A, Quesada MD, Gordillo S, Vilaplana C, Pallares MA, Molinos S, Sanchez MD, Ausina V (2004) Comparative evaluation of the new version of the INNO-LIPA mycobacteria and GenoType Mycobacterium assays for identification of Mycobacterium species from MB/BacT liquid cultures artificially inoculated with mycobacterial strains. J Clin Microbiol 42:3083-3088.
24. Iwamoto T, Sonobe T, and Hayashi K (2003). Loop-Mediated Isothermal Amplification for Direct Detection of Mycobacterium tuberculosis Complex, M avium, and M. intracellulare in Sputum Samples. J. Clin. Microbiol. 41 (6) 2616-2622.
25. Rossi MC* Gori A, Zehender G, Marchetti G, Ferrario G, Maddalena C, Catozzi L, Bandera A, Esposti AD, and Franzetti F (2000). A PCR-Colorimetric Microwell Plate Hybridization Assay for Detection of Mycobacterium tuberculosis and M. avium from Culture Samples and Ziehl-Neelsen-Positive Smears. J. Clin. Microbiol. 38 (5) 1772-1776.
26. Kent, PT and Kubica GP (1985). Public Health Mycobacteriology. A guide for level 111 laboratory. Center for Disease Control, Atlanta, Ga.
27. Nikiforov and Knapp (US Patent 5610287, 1997).
| # | Name | Date |
|---|---|---|
| 1 | 1080-MUM-2009-FORM 1(19-10-2009).pdf | 2009-10-19 |
| 2 | 1080-MUM-2009-CORRESPONDENCE(19-10-2009).pdf | 2009-10-19 |
| 3 | 1080-MUM-2009-FORM 26(16-11-2009).pdf | 2009-11-16 |
| 4 | 1080-MUM-2009-CORRESPONDENCE-(16-11-2009).pdf | 2009-11-16 |
| 5 | 1080-MUM-2009_EXAMREPORT.pdf | 2018-08-10 |
| 6 | 1080-MUM-2009-OTHER DOCUMENT(13-4-2015).pdf | 2018-08-10 |
| 7 | 1080-mum-2009-form 5.pdf | 2018-08-10 |
| 8 | 1080-MUM-2009-FORM 5(23-4-2010).pdf | 2018-08-10 |
| 9 | 1080-mum-2009-form 3.pdf | 2018-08-10 |
| 10 | 1080-MUM-2009-FORM 3(23-4-2010).pdf | 2018-08-10 |
| 11 | 1080-mum-2009-form 2.pdf | 2018-08-10 |
| 13 | 1080-mum-2009-form 2(title page).pdf | 2018-08-10 |
| 14 | 1080-MUM-2009-FORM 2(TITLE PAGE)-(23-4-2010).pdf | 2018-08-10 |
| 15 | 1080-mum-2009-form 2(23-4-2010).pdf | 2018-08-10 |
| 16 | 1080-MUM-2009-FORM 18(2-12-2011).pdf | 2018-08-10 |
| 17 | 1080-MUM-2009-FORM 13(13-4-2015).pdf | 2018-08-10 |
| 18 | 1080-mum-2009-form 1.pdf | 2018-08-10 |
| 19 | 1080-MUM-2009-FORM 1(23-4-2010).pdf | 2018-08-10 |
| 20 | 1080-MUM-2009-DRAWING(23-4-2010).pdf | 2018-08-10 |
| 21 | 1080-mum-2009-description(provisional).pdf | 2018-08-10 |
| 23 | 1080-MUM-2009-DESCRIPTION(COMPLETE)-(23-4-2010).pdf | 2018-08-10 |
| 24 | 1080-mum-2009-correspondence.pdf | 2018-08-10 |
| 25 | 1080-MUM-2009-CORRESPONDENCE(IPO)-(FER)-(30-6-2015).pdf | 2018-08-10 |
| 26 | 1080-MUM-2009-CORRESPONDENCE(IPO)-(AB21)-(29-7-2016).pdf | 2018-08-10 |
| 27 | 1080-MUM-2009-CORRESPONDENCE(IPO)-(15-9-2009).pdf | 2018-08-10 |
| 28 | 1080-MUM-2009-CORRESPONDENCE(27-7-2009).pdf | 2018-08-10 |
| 29 | 1080-MUM-2009-CORRESPONDENCE(23-4-2010).pdf | 2018-08-10 |
| 30 | 1080-MUM-2009-CORRESPONDENCE(2-12-2011).pdf | 2018-08-10 |
| 31 | 1080-MUM-2009-CLAIMS(23-4-2010).pdf | 2018-08-10 |
| 32 | 1080-MUM-2009-ABSTRACT(23-4-2010).pdf | 2018-08-10 |
| 33 | 1080-MUM-2009- OTHER DOCUMENTS.pdf | 2022-11-03 |
| 34 | 1080-MUM-2009- AFR.pdf | 2022-11-03 |