Sign In to Follow Application
View All Documents & Correspondence

Mutant Of Inner Membrane Protein, And Method For Producing Target Product By Using Same

Abstract: The present application relates to: a mutant of YjeH, which is an inner membrane protein, a microorganism comprising same; and a method for producing a target product by using same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
01 July 2022
Publication Number
45/2022
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
maria@lexipcare.com
Parent Application

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro Jung-gu Seoul 04560

Inventors

1. KIM, Seo Yun
330, Dongho-ro Jung-gu Seoul 04560
2. CHO, Seung Hyun
330, Dongho-ro Jung-gu Seoul 04560
3. LEE, Jae Min
330, Dongho-ro Jung-gu Seoul 04560
4. BAEK, Min Ji
330, Dongho-ro Jung-gu Seoul 04560

Specification

Title of Invention: Variant of inner membrane protein and method for producing target product using same
technical field
[One]
The present application relates to a variant of YjeH, an inner membrane protein, and a method for producing a target product using the same.
[2]
background
[3]
O-acetyl homoserine acts as a precursor of methionine, one of the essential amino acids in the body. Homoserine is also a precursor of methionine and threonine, and it is known that it becomes threonine through phosphohomoserine and is also converted into methionine through acetylhomoserine.
[4]
Methionine is used as a synthetic raw material for infusions and pharmaceuticals as well as feed and food additives, and is produced through chemical and biological synthesis. A two-step method for producing L-methionine by enzymatic conversion from an L-methionine precursor produced through fermentation (international published application WO2008/013432) is known.
[5]
In the above two-step method, O-succinyl homoserine or O-acetyl homoserine is used as a methionine precursor, and O-acetyl homoserine is produced in high yield for economical mass production of methionine. it is very important
[6]
DETAILED DESCRIPTION OF THE INVENTION
technical challenge
[7]
As a result of earnest efforts to increase the production of O-acetyl homoserine or homoserine, the present inventors have completed the present application by discovering a variant of an inner membrane protein having improved O-acetyl homoserine or homoserine excretion activity.
[8]
means of solving the problem
[9]
In the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acids of i) and ii) Provided is a variant of the inner membrane protein YjeH comprising a substitution and having at least 95% or more and less than 100% homology to SEQ ID NO: 1.
[10]
The present application provides a polynucleotide encoding the variant.
[11]
The present application provides a vector comprising the polynucleotide.
[12]
In the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acids of i) and ii) a variant of the inner membrane protein YjeH comprising a substitution and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; And it provides a microorganism comprising any one or more of the vector containing the polynucleotide.
[13]
In the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acids of i) and ii) a variant of the inner membrane protein YjeH comprising a substitution and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; And it provides a method for producing a target product, comprising the step of culturing a microorganism in a medium, comprising any one or more of the vector containing the polynucleotide.
[14]
In the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acids of i) and ii) a variant of the inner membrane protein YjeH comprising a substitution and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; and culturing a microorganism in a medium comprising any one or more of a vector including the polynucleotide to produce O-acetyl homoserine; and converting O-acetyl homoserine into methionine by reacting the O-acetyl homoserine with sulfide.
[15]
In the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acids of i) and ii) a variant of the inner membrane protein YjeH comprising a substitution and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; and culturing a microorganism in a medium comprising any one or more of a vector containing the polynucleotide to produce O-acetyl homoserine or homoserine; and converting the O-acetyl homoserine or homoserine into glufosinate.
[16]
The present application provides a composition for producing homoserine, including the microorganism or a culture of the microorganism.
[17]
The present application provides a composition for producing O-acetyl homoserine, including the microorganism or a culture of the microorganism.
[18]
The present application provides for the use of said inner membrane protein YjeH variant for the production of O-acetyl homoserine or homoserine.
[19]
The present application provides for the use of said microorganism for the production of O-acetyl homoserine or homoserine.
[20]
Effects of the Invention
[21]
In the case of culturing a microorganism having the ability to produce O-acetyl homoserine or homoserine using the variant of the inner membrane protein YjeH of the present application, it is possible to produce O-acetyl homoserine or homoserine in a higher yield than the existing unmodified protein do.
[22]
Brief description of the drawing
[23]
1 is a schematic diagram of a pDCM2 plasmid.
[24]
Best mode for carrying out the invention
[25]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.
[26]
[27]
In one aspect of the present application for achieving the above object, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) comprising the amino acid substitutions of i) and ii), and having at least 95% or more and less than 100% homology to SEQ ID NO: 1, to provide a variant of the inner membrane protein YjeH.
[28]
The variant of the inner membrane protein YjeH may have O-acetyl homoserine or homoserine excretion ability, that is, O-acetyl homoserine or homoserine excretion activity.
[29]
As used herein, the term “homoserine” is one of α-amino acids having a hydroxyl group in a side chain. The homoserine is an intermediate of threonine and methionine biosynthesis in microorganisms or plants, is produced from aspartic acid-4-semialdehyde, and is known to have a chemical formula of C 4 H 9 NO 3 . The homoserine may be converted to O-acetyl homoserine by homoserine acetyl transferase in the presence of acetyl-coA.
[30]
As used herein, the term "O-acetyl homoserine" is a specific intermediate material on the methionine biosynthesis pathway of microorganisms, and refers to an acetyl derivative of L-homoserine. The O-acetyl homoserine is produced by catalyzing a reaction between homoserine and acetyl-CoA by homoserine acetyl transferase, and is known to have a chemical formula of C 6 H 11 NO 4 . The O-acetyl homoserine may also be referred to as O-acetyl-L-homoserine.
[31]
[32]
Specifically, in the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at the position corresponding to position 92 is substituted with another amino acid, ii) the amino acid at the position corresponding to position 351 is substituted with another amino acid, or iii) at position 92 And the amino acid at the position corresponding to position 351 is substituted with another amino acid, but may be a variant of the protein, but is not limited thereto. The amino acid substitution may be i) the amino acid at position 92 is substituted with asparagine, or ii) the amino acid at position 351 is substituted with leucine, and more specifically, the variant of the protein is SEQ ID NO: In the amino acid sequence of 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, iii) the amino acid at position 92 is substituted with asparagine, , may be a variant of the inner membrane protein YjeH, in which the amino acid at the position corresponding to position 351 is substituted with leucine, but is not limited thereto.
[33]
[34]
As used herein, the term "inner membrane protein" refers to the amino acid-polyamine-organism (APC) superfamily of amino acid-polyamine-organisms of the transporter amino acid excretion protein (Amino Acid Efflux, AAE) As one of the proteins, it mediates the release of O-acetyl homoserine and/or homoserine out of cells. It is predicted to contain 12 transmembrane α helices, of which 10 can form inverted repeat folds characteristic of the APC superfamily. The inner membrane protein may be, for example, a protein comprising the amino acid sequence of SEQ ID NO: 1. The protein comprising the amino acid sequence of SEQ ID NO: 1 may be used in combination with the protein having the amino acid sequence of SEQ ID NO: 1 and the protein consisting of the amino acid sequence of SEQ ID NO: 1. In the present application, the inner membrane protein is an O-acetyl homoserine or homoserine excretion protein, a protein having O-acetyl homoserine or homoserine excretion activity, a protein having O-acetyl homoserine or homoserine excretion activity, YjeH protein, or It can be used in combination with YjeH.
[35]
In the present application, SEQ ID NO: 1 may refer to the amino acid sequence of the inner membrane protein YjeH. Specifically, SEQ ID NO: 1 may be an amino acid sequence of an inner membrane protein having O-acetyl homoserine or homoserine excretion activity encoded by the yjeH gene. The amino acid sequence of SEQ ID NO: 1 can be obtained from GenBank of NCBI, which is a known database. For example, Escherichia coli , E. coli), but is not limited thereto, and sequences having the same activity as the amino acid may be included without limitation. In addition, although the inner membrane protein in the present application is defined as a protein comprising the amino acid of SEQ ID NO: 1, insignificant sequence addition before and after the amino acid sequence of SEQ ID NO: 1 or a naturally occurring mutation, or a latent mutation thereof ) is not excluded, and if the protein including the amino acid sequence of SEQ ID NO: 1 has the same or corresponding activity to each other, it may be apparent to those skilled in the art that it corresponds to the inner membrane protein of the present application. As a specific example, the inner membrane protein of the present application contains the amino acid sequence of SEQ ID NO: 1 or 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.7% or more thereof. It may be a protein composed of an amino acid sequence having homology or identity. In addition, as long as it is an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the protein, a protein having an amino acid sequence in which some sequence is deleted, modified, substituted or added is also included within the scope of the protein subject to mutation of the present application. can be self-evident.
[36]
That is, even if described in the present application as "a protein or polypeptide having an amino acid sequence set forth in a specific SEQ ID NO:" or "a protein or polypeptide comprising an amino acid sequence set forth in a specific SEQ ID NO:" in the present application, a polypeptide consisting of the amino acid sequence of the SEQ ID NO: It may be apparent that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added may also be used in the present application, provided that it has the same or corresponding activity to . For example, "a protein consisting of the amino acid sequence of SEQ ID NO: 1" or "polypeptide consisting of the amino acid sequence of SEQ ID NO: 1" is a "protein consisting of the amino acid sequence of SEQ ID NO: 1" if it has the same or corresponding activity. Or it may be apparent that it may belong to "a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1".
[37]
[38]
As used herein, the term "variant" means that one or more amino acids differ from the recited sequence in conservative substitution and/or modification, but the function of the protein ( functions) or properties (properties) are maintained. A variant may differ from the identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the native protein. In addition, some variants may include variants in which one or more portions such as an N-terminal leader sequence or a transmembrane domain have been removed. Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein. The term "variant" may include terms such as variant, modified, mutated protein, mutant polypeptide, and mutant (in English, modified, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.) may be used, As long as it is a term used in a mutated sense, it is not limited thereto. For the purposes of this application,
[39]
As used herein, the term “conservative substitution” means substituting one amino acid for another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues. For example, among amino acids with electrically charged amino acids, positively charged (basic) amino acids are arginine, lysine, and histidine, and negatively charged (acidic) amino acids are glutamic acid and arpartate. acid; Among amino acids having an uncharged amino acid, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan and proline, and polar or hydrophilic ( hydrophilic) amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine, and among the non-polar amino acids, aromatic amino acids may include phenylalanine and tryptophan.
[40]
In addition, variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of the protein that is involved in the transfer of the protein either co-translationally or post-translationally. The polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
[41]
[42]
The "substitution with another amino acid" is not limited as long as it is an amino acid different from the amino acid before the substitution.
[43]
In the present application, "substitution with another amino acid" is not limited as long as it is substituted with an amino acid different from the amino acid before the substitution. Specifically, any of the amino acids before substitution among lysine, histidine, glutamic acid, arpartic acid, glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine and glutamine It may be substituted with one amino acid.
[44]
Specifically, phenylalanine at the position corresponding to position 92 of the amino acid sequence of SEQ ID NO: 1 may be substituted with asparagine, or phenylalanine at the position corresponding to position 351 may be substituted with leucine. On the other hand, when it is expressed in the present application that "a specific amino acid is substituted", it may be obvious that the amino acid is substituted with an amino acid different from the amino acid before the substitution, even if it is not separately indicated that it is substituted with another amino acid.
[45]
In addition, the substituted amino acid residue may include a natural amino acid as well as a non-natural amino acid. The unnatural amino acid can be, for example, a D-amino acid, a homo-amino acid, a beta-homo-amino acid, an N-methyl amino acid, an alpha-methyl amino acid, an unconventional amino acid (such as citrulline or naph thylalanine, etc.), but is not limited thereto. On the other hand, when it is expressed that "a specific amino acid is substituted" in the present application, it is obvious that the amino acid is substituted with an amino acid different from the amino acid before the substitution, even if it is not separately indicated that it is substituted with another amino acid.
[46]
The variant may be one in which any one or more amino acids of the amino acids at positions corresponding to the 92nd or 351th position in the amino acid sequence of SEQ ID NO: 1 are substituted with an amino acid different from the amino acid before the substitution. Alternatively, the variant may be a variant having an uncharged amino acid and substituted with an amino acid different from the amino acid before the substitution, but is not limited thereto.
[47]
Specifically, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with another amino acid, ii) the amino acid at position 351 is substituted with another amino acid, or iii) 92 And the amino acid at the position corresponding to position 351 is substituted with another amino acid, but may be a variant of the protein, but is not limited thereto. The amino acid substitution may be i) the 92nd amino acid is substituted with asparagine, or ii) the 351th amino acid is substituted with leucine, and more specifically, the variant of the protein is i) the 92nd amino acid in the amino acid sequence of SEQ ID NO: 1 This asparagine may be substituted, ii) the 351th amino acid is substituted with leucine, iii) the 92nd amino acid is substituted with asparagine, and the 351th amino acid is substituted with leucine, and may be a variant of the inner membrane protein YjeH, but is not limited thereto.
[48]
As used herein, the term "corresponding to" refers to an amino acid residue at a position listed in a protein or peptide, or an amino acid residue similar to, identical to, or homologous to a residue listed in a protein or peptide. As used herein, “corresponding region” generally refers to a similar position in a related protein or reference protein.
[49]
In the present application, specific numbering may be used for amino acid residue positions in proteins used in this application. For example, by aligning the polypeptide sequence of the protein of the present application with the target protein to be compared, it is possible to renumber the position corresponding to the amino acid residue position of the protein of the present application.
[50]
In the variant of the inner membrane protein YjeH provided in the present application, amino acids at a specific position are substituted in the inner membrane protein having the above-described O-acetyl homoserine or homoserine excretion ability, and the O-acetyl homoserine or homoserine excretion ability is mutated. It may mean an increased mutant compared to the whole protein.
[51]
[52]
In the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acid substitutions of i) and ii) are The variant of the inner membrane protein YjeH, including, may include the amino acid sequence of any one of SEQ ID NOs: 35 to 36, and specifically consist essentially of ), and more specifically, it may consist of the amino acid sequence of any one of SEQ ID NOs: 35 to 36, but is not limited thereto.
[53]
In addition, the variant is the amino acid sequence of any one of SEQ ID NOs: 35 to 36 or in the amino acid sequence, at least one amino acid selected from the 92nd or 351th amino acid is fixed, and an amino acid sequence having at least 80% homology or identity therewith It may include, but is not limited to. Specifically, the variant of the present application comprises a polypeptide having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity to the amino acid sequence of any one of SEQ ID NOs: 35 to 36. may include In addition, if an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the protein, a protein having an amino acid sequence in which some sequences are deleted, modified, substituted or added in addition to the 92nd or 351th amino acid position is also within the scope of the present application. Included within may be obvious.
[54]
[55]
As used herein, the term "homology" or "identity" refers to the degree to which two given amino acid sequences or base sequences are related, and may be expressed as a percentage. The terms homology and identity can often be used interchangeably.
[56]
Sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, with default gap penalties established by the program used may be used. Substantially, homologous or identical sequences generally have moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
[57]
Whether any two polynucleotide or polypeptide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using a known computer algorithm such as the "FASTA" program. or, as performed in the Needleman program (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) of the EMBOSS package, Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine (GCG program package (Devereux, J., et al, Nucleic Acids) Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop , [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073).For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW can be used to determine homology, similarity or identity.
[58]
Homology, similarity or identity of polynucleotides or polypeptides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. can be determined by comparing sequence information using a GAP computer program such as 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). Default parameters for the GAP program are: (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps.
[59]
In addition, whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be confirmed by comparing the sequences by Southern hybridization experiments under defined stringent conditions, and the defined appropriate hybridization conditions are within the scope of the art. , methods well known to those skilled in the art (eg, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York).
[60]
[61]
As used herein, the term "mutant of the inner membrane protein" or "mutant of the inner membrane protein YjeH" may be one having the ability to excrete O-acetyl homoserine or homoserine, and a variant having the ability to produce O-acetyl homoserine or homoserine Polypeptide, O-acetyl homoserine or homoserine-producing mutant polypeptide, O-acetyl homoserine or homoserine-producing mutant polypeptide, O-acetyl homoserine or homoserine-releasing activity mutant polypeptide, O-acetyl Homoserine or homoserine excreting active variant, O-acetyl homoserine or homoserine excreting variant, mutant homoserine excreting protein, mutant O-acetyl homoserine excreting protein, mutant YjeH, mutant YjeH, YjeH variant or YjeH variant It can be used interchangeably with others.
[62]
In addition, the protein is Escherichia sp ., Erwinia sp ., Serratia sp ., Providencia sp ., Corynebacterium . sp .), Pseudomonas sp ., Leptospira sp. , Salmonella sp ., Brevibacterium sp ., Hypomononas sp ., Chromo Bacteria genus ( Chromobacterium sp. ) and Norcardia sp..), or may be derived from microbial strains belonging to fungi or yeast, specifically, Escherichia genus, Corynebacterium genus, Leptospira genus microbial strains and yeast. And, more specifically, it may be derived from a microbial strain of the genus Escherichia, and a specific example thereof may be derived from Escherichia coli , E. coli , but is not limited thereto.
[63]
The variant of the inner membrane protein YjeH may include a mutation at the 92nd and/or 351th position in the amino acid sequence of SEQ ID NO: 1, and even if it is an amino acid sequence in which an amino acid is added or deleted in SEQ ID NO: 1, N- of SEQ ID NO: 1 A variant in which the amino acid at the position corresponding to amino acid 92 and/or 351 from the terminal is substituted may be included in the scope of the present application. The variant of the inner membrane protein YjeH includes an amino acid sequence in which amino acids at positions 92 and/or 351 are substituted with other amino acids in the amino acid sequence of SEQ ID NO: 1, and the inner membrane includes the amino acid sequence of SEQ ID NO: 1 or does not include the mutation Compared to the protein, it may be a mutant inner membrane protein with enhanced activity. Such variants of the inner membrane protein YjeH are at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, or 99.7% and less than 100% of SEQ ID NO: 1 may have homology or identity.
[64]
The 92th or 351th amino acid mutation may be that the 92nd amino acid is substituted with asparagine, or the 351th amino acid is substituted with leucine.
[65]
Specifically, the variant of the inner membrane protein YjeH includes i) a substitution of asparagine for the 92nd amino acid in the amino acid sequence of SEQ ID NO: 1, ii) a substitution of the 351st amino acid with leucine, or iii) an amino acid substitution of i) and ii) and may have enhanced activity compared to the protein comprising the amino acid sequence of SEQ ID NO: 1 or the inner membrane protein before mutation derived from a wild-type microorganism.
[66]
[67]
Another aspect of the present application provides a polynucleotide encoding a variant of the inner membrane protein YjeH.
[68]
The inner membrane protein YjeH and its variants are as described above.
[69]
As used herein, the term "polynucleotide" refers to a DNA or RNA strand of a certain length or longer as a polymer of nucleotides in which nucleotide monomers are linked in a long chain by covalent bonds, and more specifically, encoding the variant. polynucleotide fragments.
[70]
The polynucleotide may be included without limitation as long as it is a polynucleotide sequence encoding a variant of the inner membrane protein YjeH of the present application. In the present application, the gene encoding the amino acid sequence of the inner membrane protein YjeH is the yjeH gene, and the gene may be derived from Escherichia coli , E. coli , but is not limited thereto.
[71]
Specifically, the polynucleotide of the present application may contain a variety of coding regions within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or considering codons preferred in the organism to express the polypeptide. Deformation can be made. Specifically, any polynucleotide sequence encoding a variant of the inner membrane protein YjeH in which the 92nd or 351th amino acid in the amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid may be included without limitation.
[72]
In addition, the 92th or 351th amino acid in the amino acid sequence of SEQ ID NO: 1 is obtained by hydridation under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a sequence complementary to all or part of the nucleotide sequence. Any sequence encoding an inner membrane protein substituted with another amino acid may be included without limitation. The "stringent condition" may refer to a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., supra). For example, 40% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more homology between genes with high homology or identity, or Genes with the same identity are hybridized, and genes with less homology or identity do not hybridize, or wash conditions of normal Southern hybridization at 60° C., 1XSSC, 0.1% SDS, specifically At a salt concentration and temperature equivalent to 60° C., 0.1XSSC, 0.1% SDS, more specifically 68° C., 0.1XSSC, 0.1% SDS, conditions for washing once, specifically 2 to 3 times, can be listed. have.
[73]
Hybridization may require that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization. The term "complementary" may be used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenine may be complementary to thymine and cytosine may be complementary to guanine. Accordingly, the present application may also include isolated nucleic acid fragments that are complementary to substantially similar nucleic acid sequences as well as the entire sequence.
[74]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. In addition, the Tm value may be 60° C., 63° C. or 65° C., but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.
[75]
The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[76]
[77]
Another aspect of the present application provides a vector comprising a polynucleotide encoding a variant of the inner membrane protein YjeH.
[78]
The inner membrane protein YjeH, variants and polynucleotides thereof are as described above.
[79]
The vector of the present application may be a DNA preparation containing the base sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) so that the target polypeptide can be expressed in a suitable host. . The expression control sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After transformation into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
[80]
As used herein, the term "expression" includes, but is not limited to, any step involved in the production of a polypeptide, such as transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[81]
As used herein, the term "expression vector" refers to a linear or circular nucleic acid molecule comprising a coding sequence and a regulatory sequence operably linked for its expression.
[82]
As used herein, the term “operably linked” refers to a configuration in which regulatory sequences are placed in appropriate positions such that the regulatory sequences direct expression of a coding sequence. Thus, "operably linked" means that a regulatory region of a functional domain having a known or desired activity, such as a promoter, terminator, signal sequence or enhancer region, modulates the expression, secretion or function of a target (gene or polypeptide) with the known or described above. attached to or linked to the target so that it can be modulated according to the desired activity.
[83]
The vector used in the present application is not particularly limited, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses and bacteriophages in a natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors may be used as plasmid vectors. , pGEM-based, pTZ-based, pCL-based and pET-based and the like can be used. Specifically, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used. More specifically, the vector used in the present application may be pDCM2 (FIG. 1, SEQ ID NO: 37) prepared for insertion and replacement of genes in the Corynebacterium chromosome, but is not particularly limited thereto, and a known expression vector may be used. Can be used.
[84]
For example, a polynucleotide encoding a target polypeptide may be inserted into a chromosome through a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted. The selection marker is used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule is inserted, and to confer a selectable phenotype such as drug resistance, auxotrophicity, resistance to cytotoxic agents, or expression of a surface polypeptide. markers may be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected.
[85]
[86]
In another aspect of the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) i) and a variant of the inner membrane protein YjeH, comprising the amino acid substitution of ii) and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; And it provides a microorganism comprising any one or more of the vector containing the polynucleotide.
[87]
SEQ ID NO: 1, the inner membrane protein YjeH, a variant thereof, a polynucleotide encoding the variant, and a vector including the polynucleotide are the same as described above.
[88]
In the present application, the term "microorganism comprising a mutant of the inner membrane protein YjeH" means that a mutant of the inner membrane protein YjeH is introduced into a microorganism having a naturally weak O-acetyl homoserine or homoserine excretion ability, and thus O-acetyl homoserine or homoserine It refers to microorganisms with increased serine excretion ability. Specifically, the microorganism is a microorganism expressing a variant of the inner membrane protein YjeH comprising one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 1, wherein the amino acid mutation is the 92nd or 351th amino acid from the N-terminus is substituted with another amino acid may include
[89]
For the purposes of the present application, a variant of the inner membrane protein YjeH; a polynucleotide encoding the variant; And in the case of a microorganism comprising any one or more of the vector containing the polynucleotide, the extracellular output of O-acetyl homoserine or homoserine is increased compared to the wild-type or unmodified microorganism, and thus O-acetyl homoserine or homoserine It may be characterized by an increase in the production capacity of This is a mutant of the inner membrane protein YjeH of the present application, whereas wild-type or unmodified microorganisms cannot excrete O-acetyl homoserine or homoserine, or can produce trace amounts even if they excrete O-acetyl homoserine or homoserine; a polynucleotide encoding the variant; And by introducing any one or more of the vector containing the polynucleotide by increasing the output of O- acetyl homoserine or homoserine of microorganisms, it is meaningful that it is possible to increase the production capacity of O- acetyl homoserine or homoserine can
[90]
In the present application, the term "unmodified microorganism" does not exclude a strain containing a mutation that may occur naturally in a microorganism, and it is a native strain itself or refers to a microorganism that does not include a mutant of the inner membrane protein YjeH. The term "unmodified microorganism" may be used interchangeably with "strain before modification", "microbe before modification", "unmutated strain", "unmodified microorganism", "unmodified strain" or "reference microorganism".
[91]
[92]
As used herein, the term "to be/are expressed" refers to a state in which a target protein is introduced into a microorganism or modified to be expressed in a microorganism. When the target protein is a protein present in a microorganism, it may mean a state in which its activity is enhanced compared to before intrinsic or modification. For the purposes of the present application, the "target protein" may be a variant of the aforementioned inner membrane protein YjeH.
[93]
Specifically, "introduction of protein" means that the activity of a specific protein that the microorganism did not originally have or exhibited improved activity compared to the intrinsic activity or activity before modification of the protein. For example, a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into the microorganism to exhibit its activity. In addition, "enhancement of activity" means that the activity is improved compared to the intrinsic activity of a specific protein of the microorganism or the activity before modification. The "intrinsic activity" refers to the activity of a specific protein originally possessed by the parent strain before the transformation when the trait of a microorganism is changed due to genetic variation caused by natural or artificial factors.
[94]
Specifically, the enhancement of the activity of the present application includes increasing the intracellular copy number of the gene encoding the protein variant, a method of introducing a mutation into the expression control sequence of the gene encoding the protein variant, and gene expression regulation encoding the protein variant A method of replacing a sequence with a sequence with strong activity, a method of replacing a gene encoding a native inner membrane protein on a chromosome with a gene encoding the protein variant, a gene encoding the protein variant to enhance the activity of the protein variant It may consist of any one or more methods selected from the group consisting of a method for introducing additional mutations and a method for introducing protein variants into microorganisms, but is not limited thereto.
[95]
In the above, the increase in the copy number of the gene is not particularly limited thereto, but may be performed in a form operably linked to a vector or inserted into a chromosome in a host cell. Specifically, a vector capable of replicating and functioning independently of a host to which the polynucleotide encoding the protein variant of the present application is operably linked may be introduced into a host cell. Alternatively, a vector capable of inserting the polynucleotide into a chromosome in the host cell, to which the polynucleotide is operably linked, may be introduced into the chromosome of the host cell. Insertion of the polynucleotide into a chromosome may be accomplished by any method known in the art, for example, by homologous recombination.
[96]
Next, modifying the expression control sequence to increase the expression of the polynucleotide, but is not particularly limited thereto, to further enhance the activity of the expression control sequence, deletion, insertion, non-conservative or conservative substitution of the nucleic acid sequence, or their It can be carried out by inducing a mutation in the sequence in combination, or by replacing it with a nucleic acid sequence having a stronger activity. The expression control sequence is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence controlling the termination of transcription and translation, and the like.
[97]
A strong promoter may be linked to the upper portion of the polynucleotide expression unit instead of the original promoter, but is not limited thereto. Examples of known strong promoters include CJ1 to CJ7 promoter (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US 10584338 B2), O2 promoter (US 10273491 B2), tkt promoter, and yccA promoter, but are not limited thereto.
[98]
In addition, the modification of the polynucleotide sequence on the chromosome is not particularly limited thereto, but a mutation in the expression control sequence by deletion, insertion, non-conservative or conservative substitution of a nucleic acid sequence or a combination thereof to further enhance the activity of the polynucleotide sequence. It can be carried out by inducing and replacing the polynucleotide sequence with an improved polynucleotide sequence to have stronger activity.
[99]
The introduction and enhancement of the activity of the protein may be one in which the activity or concentration of the corresponding protein is increased than the activity or concentration of the protein in the wild-type or unmodified microbial strain, but is not limited thereto.
[100]
[101]
In the present application, the microorganism containing the mutant of the inner membrane protein YjeH may be a recombinant microorganism prepared by transformation with a vector containing a polynucleotide encoding the mutant of the inner membrane protein YjeH, but is not limited thereto.
[102]
As used herein, the term “transformation” refers to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding a target protein. The polynucleotide may be introduced in any form as long as it can be introduced and expressed into a host cell. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression. The expression cassette may include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[103]
[104]
The type of microorganism having the homoserine-producing ability is not particularly limited as long as it can produce O-acetyl homoserine or homoserine, but specifically, Corynebacterium genus, Escherichia genus, Entero It may be a microorganism belonging to the genus Enterbacter , Erwinia , Serratia , Providencia, and Brevibacterium , and more specifically, Corynebacterium. ( Corynebacterium ) It may be a microorganism of the genus.
[105]
More specifically, Corynebacterium ( Corynebacterium ) The genus microorganism is Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Corynebacterium crudilactis ( Corynebacterium crudilactis ) , Corynebacterium deserti ( Corynebacterium deserti ), Corynebacterium efficiens ( Corynebacterium efficiens ), Corynebacterium callunae ( Corynebacterium callunae ), Corynebacterium station nis ( Corynebacterium stationis ), Coryne Bacterium singulare ( Corynebacterium singulare ), Corynebacterium halotolerans ( Corynebacterium halotolerans ), Corynebacterium striatum ( Corynebacterium striatum ), Corynebacterium plutisoli ( Corynebacterium pollutisoli ), Corynebacterium imitans Cxorynebacterium imitans ), Corynebacterium testudinoris ( Corynebacterium testudinoris ) or Corynebacterium flavescens ) It may be, and the microorganism belonging to the genus Corynebacterium may be included without limitation.
[106]
In the present application, the parent strain of the microorganism inactivates a gene that further weakens the biosynthetic pathway of O-acetyl homoserine or homoserine in order to increase the production of O-acetyl homoserine or homoserine, or O-acetyl homoserine Or it may be a microorganism that enhances the biosynthetic pathway of homoserine, but is not limited thereto.
[107]
Specifically, in order to inactivate the gene that weakens the O-acetyl homoserine or the biosynthetic pathway of homoserine, for example, cystathionine gamma-synthase of the O-acetyl homoserine degradation pathway is used. Expression of the metB gene (SEQ ID NO: 17) encoding the metY gene (SEQ ID NO: 22) encoding O-acetyl homoserine (thiol)-lyase of the O-acetyl homoserine degradation pathway may be attenuated or inactivated in
[108]
In order to enhance the O-acetyl homoserine or the biosynthetic pathway of homoserine, for example, a genetic mutation is introduced in the lysC gene (SEQ ID NO: 27) encoding aspartokinase, or O-acetyl homoserine transferase is used. The expression of the encoding metX gene (SEQ ID NO: 32) can be amplified.
[109]
However, it is not limited to the above, and it is possible to enhance the production ability of O-acetyl homoserine or homoserine by a gene expression control method known in the art.
[110]
In the present application, the term "enhancement/increase" is a concept that includes all of the activities increased compared to the intrinsic activity.
[111]
This enhancement or increase in gene activity can be achieved by application of various methods well known in the art. Examples of the method include increasing the intracellular copy number of a gene; a method of introducing a mutation into an expression control sequence of a gene; a method of replacing a gene expression control sequence with a sequence with strong activity; a method of additionally introducing a mutation into the gene to enhance the activity of the gene; and any one or more methods selected from the group consisting of a method of introducing a foreign gene into a microorganism, and may be achieved by a combination thereof, but is not limited thereto.
[112]
In the present application, the term "inactivation" is a concept that includes all of the activity is weakened or no activity compared to the intrinsic activity.
[113]
Inactivation of such gene activity can be achieved by application of various methods well known in the art. Examples of the method include a method of deleting all or part of a gene on a chromosome, including when the activity of the gene is removed; a method of replacing a gene encoding the protein on a chromosome with a gene mutated to reduce the activity of the protein; a method of introducing a mutation into an expression control sequence of a gene on a chromosome encoding the protein; a method of replacing the expression control sequence of the gene encoding the protein with a sequence with weak or no activity (eg, a method of replacing the promoter of the gene with a promoter weaker than the endogenous promoter); a method of deleting all or part of a gene on a chromosome encoding the protein; a method of introducing an antisense oligonucleotide (eg, antisense RNA) that complementarily binds to the transcriptome of a gene on the chromosome and inhibits translation from the mRNA into a protein; A method of making the attachment of ribosomes impossible by artificially adding a sequence complementary to the SD sequence to the front end of the SD sequence of the gene encoding the protein to prevent attachment of the ribosome and ORF of the sequence There is a reverse transcription engineering (RTE) method of adding a promoter so as to be reverse transcribed at the 3' end, and it can also be achieved by a combination thereof, but is not limited thereto.
[114]
[115]
In another aspect of the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) i) and ii) a variant of the inner membrane protein YjeH, comprising the amino acid substitution of SEQ ID NO: 1 and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; And it provides a method for producing a target product, comprising the step of culturing a microorganism in a medium, comprising any one or more of the vector containing the polynucleotide.
[116]
SEQ ID NO: 1, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors including the polynucleotides, and microorganisms including the same are as described above.
[117]
The target product may be O-acetyl homoserine or homoserine, but is not limited thereto.
[118]
As used herein, the term "cultivation" means growing the microorganism in an appropriately controlled environmental condition. The culture process of the present application may be made according to a suitable medium and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art according to the selected strain. Specifically, the culture may be batch, continuous, and fed-batch, but is not limited thereto.
[119]
As used herein, the term "medium" refers to a material in which nutrients required for culturing the microorganism are mixed as a main component, and supplies nutrients and growth factors, including water, which are essential for survival and growth. Specifically, any medium and other culture conditions used for culturing the microorganism of the present application may be used without any particular limitation as long as it is a medium used for culturing conventional microorganisms, but a suitable carbon source, nitrogen source, personnel, inorganic It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing compounds, amino acids and/or vitamins.
[120]
As the carbon source in the present application, carbohydrates such as glucose, fructose, sucrose, maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; amino acids such as glutamic acid, methionine, lysine, and the like may be included. In addition, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugar cane offal and corn steep liquor can be used, specifically glucose and sterilized pre-treated molasses (i.e., converted to reducing sugar). molasses) may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more, but is not limited thereto.
[121]
Examples of the nitrogen source include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine, and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation products, defatted soybean cake or its degradation products, etc. can be used These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
[122]
The phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. may be used, and in addition, amino acids, vitamins and/or suitable precursors may be included. These components or precursors may be added to the medium in a batch or continuous manner, but is not limited thereto.
[123]
In the present application, a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid and the like may be added to the medium in an appropriate manner to adjust the pH of the medium during culturing of the microorganism. In addition, during culturing, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the medium, oxygen or oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen or carbon dioxide gas may be injected without or without gas to maintain anaerobic and microaerobic conditions, but is not limited thereto. does not
[124]
The temperature of the medium may be 20 °C to 50 °C, specifically 30 °C to 37 °C, but is not limited thereto. The incubation period may be continued until a desired production amount of a useful substance is obtained, and specifically, it may be 10 hours to 100 hours, but is not limited thereto.
[125]
The target product produced by the culture may be discharged into the medium or may remain in the cell without being discharged.
[126]
The method may include recovering the target product from the cultured medium or microorganism.
[127]
The method for recovering the target product produced in the culturing step of the present application may be to collect the target product from the culture solution using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization, HPLC, etc. may be used, and a desired product may be recovered from the medium or microorganism using a suitable method known in the art. The culture solution may also be referred to as a fermentation broth.
[128]
In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art. Accordingly, the recovered target product may be in a purified form or a microbial fermentation broth containing the target product (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008).
[129]
[130]
In another aspect of the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) i) and ii) a variant of the inner membrane protein YjeH, comprising the amino acid substitution of SEQ ID NO: 1 and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; and culturing a microorganism in a medium comprising any one or more of a vector including the polynucleotide to produce O-acetyl homoserine; and converting O-acetyl homoserine into methionine by reacting the O-acetyl homoserine with sulfide.
[131]
SEQ ID NO: 1, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors including the polynucleotides, microorganisms including the same, and O-acetyl homoserine are as described above.
[132]
In the present application, O-acetyl homoserine is a methionine precursor, and may be converted to methionine by reaction with sulfide.
[133]
The step of reacting with the sulfide means producing L-methionine from O-acetyl homoserine using any known method. For example, L-methionine can be produced by reacting methyl mercaptan, which is a sulfide, with O-acetyl homoserine. In addition, in order to improve the speed and yield of the reaction, a catalyst or an enzyme may be added, or the reaction may be performed in a microorganism containing the enzyme.
[134]
The "sulfide" may be, for example, methyl mercaptan, and the methyl mercaptan is liquid sodium methyl mercaptan (CH 3 S-Na, Na-methyl mercaptan) form, gas or liquid state. Methyl mercaptan containing a form capable of providing a sulfur atom such as methyl mercaptan (CH 3 SH) as well as methyl mercaptan including dimethyl sulfide (DMS, Dimethylsulfide) in the form mentioned in International Patent Publication WO2010/098629 It can mean all derivatives.
[135]
As the enzyme used in the methionine conversion reaction, a known cystathionine-γ-synthase or O-acetyl homoserine sulfhydrylase or O-succinyl homoserine sulfhydrylase may be used.
[136]
The methionine conversion reaction process of the present application may be represented by the following scheme:
[137]
O-acetyl-L-homoserine + CH 3 SH ↔ L-methionine + acetate
[138]
In this reaction, the CH 3 S- residue of methyl mercaptan may be substituted with the acetate residue of O-acetyl homoserine to produce L-methionine.
[139]
The reaction may be carried out under the condition that the pH of the reaction medium is maintained at 6 to 7 at a temperature of 20° C. to 45° C., and pyridoxal-5′-phosphate may be added as a coenzyme.
[140]
The reaction of converting an L-methionine precursor to L-methionine in the presence of methyl mercaptan is an enzymatic reaction, and may be disclosed, for example, in WO2008/013432. WO2008/013432 provides details on the preparation and properties of methionine converting enzymes that can be used, which have a suitable activity to convert the L-methionine precursor to L-methionine in the presence of methyl mercaptan. Such suitable methionine converting enzymes can be prepared using, for example, gene expression according to biotechnological methods.
[141]
As a non-limiting example, the sequence of the gene encoding the enzyme having the methionine conversion activity can be obtained from databases of NCBI (USA), and DNA Data Bank (KEGG) (Japan). For a biological conversion reaction, a gene may be cloned from the obtained gene sequence and then introduced into an expression vector. Specifically, the gene is expressed in an active form from the pCL-CJI vector (CJ, Korea), which is an expression vector for E. coli in the recombinant strain, and the expressed protein is sonicated and the cell is lysed from the enzyme solution. can be obtained. Both the strain expressing the methionine converting enzyme and the expressed methionine converting enzyme can be used directly in the methionine converting reaction.
[142]
The methionine converting enzyme expressed from the gene or the microorganism strain expressing the same may be directly, partially or entirely mixed with the fermentation supernatant or fermentation broth in which the L-methionine precursor has accumulated to initiate the reaction. That is, a methionine converting enzyme or a microorganism strain expressing the same is added to the fermentation broth in which O-acetyl homoserine is accumulated, and methyl mercaptan is also added thereto to initiate a reaction.
[143]
Specifically, O-acetyl homoserine accumulated in the fermentation broth can be converted to L-methionine by cystathionine-γ-synthase or O-acetyl homoserine sulfhydrylase or O-succinyl homoserine sulfhydrylase. can
[144]
The methionine conversion reaction can be confirmed using DTNB [5,5-dithiobis(2-nitro-benzoic acid, Sigma, USA), and the reaction product can be analyzed by HPLC. In the course of the methionine conversion reaction, acetic acid and The same by-product can be additionally obtained by reaction of methyl mercaptan with O-acetyl homoserine without a separate production process.
[145]
The enzymatic reaction of L-methionine precursor and methyl mercaptan can be represented by the following scheme:
[146]

[147]
[148]
The method for producing the methionine can be easily determined by those skilled in the art under optimized culture conditions and enzyme activity conditions known in the art. Specific culture method and medium are the same as described above.
[149]
[150]
In another aspect of the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) i) and a variant of the inner membrane protein YjeH, comprising the amino acid substitution of ii) and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; and culturing a microorganism in a medium comprising any one or more of a vector containing the polynucleotide to produce O-acetyl homoserine or homoserine; and converting the O-acetyl homoserine or homoserine into glufosinate.
[151]
SEQ ID NO: 1, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors including the polynucleotides, microorganisms including the same, and homoserine are as described above.
[152]
As used herein, the term "glufosinate" refers to a broad range of naturally occurring herbicides produced by several species of Streptomyces soil bacteria, also known as phosphinothricin. .
[153]
In the present application, O-acetyl homoserine or homoserine may be converted to glufosinate through a plurality of steps including a halogenation reaction.
[154]
The glufosinate conversion reaction may be disclosed, for example, in CN 108516991 A. Specifically, the glufosinate conversion reaction comprises the steps of (1) performing azeotropic dehydration of homoserine (Formula II) using an organic solvent in the presence of an acidic catalyst; A halogenating agent was added to the azeotropically dehydrated homoserine and a halogenation reaction was performed to conduct a halogenation reaction to L-3,6-bis(2-haloethyl)-2,5-dione piperazine [L-3,6-bis obtaining (2-haloethyl)-2,5-dione piperazin (Formula III)]; (2) methylphosphinic acid diester or methyl phosphite diester was added to L-3,6-bis(2-haloethyl)-2,5-dione piperazine, and a high boiling solvent ( performing an Abbov reaction using a high boiling solvent) to obtain a compound of Formula IV; (3) After dissolving the compound of Formula IV in acid and heating to perform a hydrolysis reaction, after completion of the reaction, the solvent is removed and dissolved by adding alcohol, followed by conversion reaction by adding an alkylene oxide to the glue It may include; obtaining a fosinate (Formula I).
[155]
The glufosinate conversion reaction using homoserine as a precursor can be represented by the following scheme:
[156]

[157]
[158]
The glufosinate production method can be performed using homoserine prepared by biological fermentation according to the present application as a precursor, and as described above, by reacting with methylphosphonium by azeotropic dehydration, halogenation, etc., L After preparing -3,6-bis(2-haloethyl)-2,5-dione piperazine, it may be subjected to an Avov reaction, followed by hydrolysis to produce glufosinate.
[159]
[160]
In another aspect of the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) i) and a variant of the inner membrane protein YjeH, comprising the amino acid substitution of ii) and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; And it provides a composition for producing homoserine, including a microorganism or a culture of the microorganism, comprising any one or more of the vector containing the polynucleotide.
[161]
[162]
In another aspect of the present application, in the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) i) and ii) a variant of the inner membrane protein YjeH, comprising the amino acid substitution of SEQ ID NO: 1 and having at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; And it provides a composition for producing O-acetyl homoserine, including a microorganism or a culture of the microorganism, comprising any one or more of the vector containing the polynucleotide.
[163]
SEQ ID NO: 1, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors including the polynucleotides, microorganisms including the same, homoserine, and O-acetyl homoserine are as described above.
[164]
The composition for producing O-acetyl homoserine or homoserine may refer to a composition capable of producing O-acetyl homoserine or homoserine by the mutant of the inner membrane protein YjeH of the present application. The composition may include, without limitation, a variant of the inner membrane protein YjeH or a composition capable of operating a variant of the inner membrane protein YjeH. The variant of the inner membrane protein YjeH may be included in a vector so that the operably linked gene can be expressed in the introduced host cell.
[165]
The composition may further comprise a cryoprotectant or an excipient. The cryoprotectant or excipient may be a non-naturally occurring material or a naturally occurring material, but is not limited thereto. In another embodiment, the cryoprotectant or excipient may be a material that the microorganism does not naturally contact, or a material that is not naturally included with the microorganism at the same time, but is not limited thereto.
[166]
[167]
Another aspect of the present application provides the use of an inner membrane protein YjeH variant for the production of O-acetyl homoserine or homoserine.
[168]
[169]
Another aspect of the present application is for the production of O-acetyl homoserine or homoserine, i) in the amino acid sequence of SEQ ID NO: 1, the amino acid at the position corresponding to position 92 is substituted with asparagine, ii) the position corresponding to position 351 a variant of the inner membrane protein YjeH, wherein the amino acid is substituted with leucine, or iii) comprises the amino acid substitution of i) and ii) and has at least 95% or more and less than 100% homology to SEQ ID NO: 1; a polynucleotide encoding the variant; And it provides a use of a microorganism comprising any one or more of the vector comprising the polynucleotide.
[170]
The homoserine, O-acetyl homoserine, inner membrane protein YjeH, variants thereof, polynucleotides encoding the variants, vectors including the polynucleotides, and microorganisms including the same are as described above.
[171]
Modes for carrying out the invention
[172]
Hereinafter, the present application will be described in more detail by way of Examples. However, these examples are for illustrative purposes of the present application, and the scope of the present application is not limited by these examples, and will be apparent to those of ordinary skill in the art to which the present application belongs.
[173]
[174]
Example 1: Construction of Plasmids
[175]
A plasmid (pDCM2, FIG. 1, SEQ ID NO: 37) was designed for insertion and replacement of genes in the Corynebacterium chromosome, and the plasmid was synthesized using the Gene-synthesis service of Binix Co., Ltd. A plasmid was designed to include a restriction enzyme that is easy to use for cloning by referring to the generally known sacB system related paper [Gene, 145 (1994) 69-73]. The thus synthesized pDCM2 plasmid has the following characteristics.
[176]
1) Since it has a replication origin that works only in E. coli, self-replication is possible in E. coli, but self-replication is impossible in Corynebacterium.
[177]
2) It has a kanamycin resistance gene as a selectable marker.
[178]
3) It has a Levan sucrose gene (sacB) as a secondary positive-selection marker.
[179]
4) No genetic information derived from the pDCM2 plasmid is left in the finally constructed strain.
[180]
[181]
Example 2: Production of mutant foreign membrane protein (YjeH) introduced strain and evaluation of O-acetyl homoserine and homoserine production ability
[182]
[183]
2-1. Preparation of foreign membrane protein (YjeH) and mutant YjeH-introduced strain
[184]
Corynebacterium glutamicum ( Corynebacterium glutamicum ) In order to determine the effectiveness of YjeH, an exogenous membrane protein and O-acetyl homoserine excretion protein, introduced into ATCC13032, the yjeH gene (SEQ ID NO: 2) encoding E. coli-derived YjeH A chromosomal introduction vector containing a was prepared.
[185]
Specifically, in order to construct a transposase-deleted vector, a pair of primers (SEQ ID NO: 4 and 5) and a pair of primers (SEQ ID NOs: 6 and 7) for amplifying the 3' bottom region were designed. The primers of SEQ ID NOs: 5 and 6 were designed to cross each other, and the restriction enzyme SmaI sequence was placed at this site. Primer sequences were shown in Table 1 below.
[186]
[187]
[Table 1]
SEQ ID NO: sequence name order
SEQ ID NO: 4 Tn_5 F tgaattcgagctcggtacccCACCGACGCGCATCTGCCT
SEQ ID NO: 5 Tn_5 R GGTGTGGTGACTTTCAGCAGTTCCCGGGGGGGAGGAGGCATGTGGTGTTG
SEQ ID NO: 6 Tn_3 F CAACACCACATGCCTCCTCCCCCCCGGGAACTGCTGAAAGTCACCACACC
SEQ ID NO: 7 Tn_3 R gtcgactctagaggatccccCTCCCAAACCATTGAGGAATGG
[188]
[189]
PCR was performed using the primers of SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 using the ATCC13032 wild-type (WT) chromosome as a template. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 30 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, an 851 bp DNA fragment at the 5' upper end and an 847 bp DNA fragment at the 3' lower end were obtained centering on the deletion site of the NCgl2335 gene.
[190]
Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 4 and SEQ ID NO: 7. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 90 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, a 1648 bp DNA fragment including a region capable of deletion of a gene encoding a transposase (SEQ ID NO: 3, gene number NCgl2335) was amplified.
[191]
The obtained PCR product was fusion cloned using the SmaI restriction enzyme-treated pDCM2 vector and In-Fusion® HD Cloning Kit (Clontech). The cloned vector was transformed into E. coli DH5α, and the transformed E. coli was plated on LB solid medium containing 25 mg/L of kanamycin. After selecting colonies transformed with the plasmid into which the desired gene was inserted through PCR, the plasmid was obtained using the plasmid extraction method, and finally a pDCM2-ΔNCgl2335 recombinant vector in which the NCgl2335 deletion cassette was cloned was prepared.
[192]
To determine the effectiveness of the O-acetyl homoserine excretion protein, a chromosome introduction vector containing a gene (SEQ ID NO: 2) encoding YjeH derived from E. coli was constructed. To this end, a vector expressing the yjeH gene was prepared using the CJ7 promoter (SEQ ID NO: 8, US 7662943 B2). A pair of primers (SEQ ID NOs: 9 and 10) for amplifying the CJ7 promoter region and a pair of primers (SEQ ID NOs: 11 and 12) for amplifying the yjeH region of E. coli were designed. The primer sequences were shown in Table 2 below.
[193]
[194]
[Table 2]
SEQ ID NO: sequence name order
SEQ ID NO: 9 CJ7_yjeH F ACACCACATGCCTCCTCcccAGAAACATCCCAGCGCCTAC
SEQ ID NO: 10 CJ7_yjeH R AGTTCTTGTTTGAGTCCACTCATAGTGTTTCCTTTCGTTGGGT
SEQ ID NO: 11 yjeH F ACCCAACGAAAGGAAACACTATGAGTGGACTCAAAACAAGAACTG
SEQ ID NO: 12 yjeH R GACTTTCAGCAGTTcccgggTTATGTGGTTATGCCATTTTCCGG
[195]
[196]
Using pECCG117-PCJ7-gfp (US 7662943 B2) as a template, SEQ ID NO: 9 and SEQ ID NO: 10, using the wild-type E. coli chromosome as a template, PCR was performed using primers of SEQ ID NO: 11 and SEQ ID NO: 12, respectively. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 90 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, a 360 bp DNA fragment of the CJ7 promoter region and a 1297 bp DNA fragment of the yjeH gene region of E. coli were obtained.
[197]
Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 9 and SEQ ID NO: 12. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 90 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, a 1614 bp DNA fragment including the CJ7 promoter and the site into which the yjeH gene was introduced was amplified.
[198]
The gene-deleted DNA fragment obtained through PCR was cloned into pDCM2-ΔNCgl2335 vector treated with restriction enzyme SmaI through In-Fusion® HD Cloning Kit (Clontech), and finally pDCM2-ΔNCgl2335::PCJ7-yjeH (eco,WT) A recombinant vector was constructed.
[199]
Specifically, using the pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,WT) plasmid as a template and using the primers of SEQ ID NOs: 13 and 14, phenylalanine (Phe), the 92nd amino acid of the YjeH amino acid sequence, was converted to asparagine (Asn). substituted (F92N). The plasmid containing the gene encoding the constructed mutant YjeH(F92N) was named pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,F92N).
[200]
In addition, using the pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,WT) plasmid as a template and primers of SEQ ID NOs: 15 and 16, phenylalanine, the 351th amino acid of the YjeH amino acid sequence, was substituted with leucine (F351L). The plasmid containing the gene encoding the constructed mutant YjeH (F351L) was named pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,F351L). The primer sequences were shown in Table 3 below.
[201]
[202]
[Table 3]
SEQ ID NO: sequence name order
SEQ ID NO: 13 F92N F CGGCTGGCTGAATTTATCGGTCA
SEQ ID NO: 14 F92N R TGACCGATAAATTCAGCCAGCCG
SEQ ID NO: 15 F351L F CAATGGCATCCTTATTATGATTT
SEQ ID NO: 16 F351L R AAATCATAATAAGGATGCCATTG
[203]
[204]
The prepared pDCM2-ΔNCgl2335, pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,WT), pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,F92N), pDCM2-ΔNCgl2335::PCJ7-yjeH (eco,F351L) strain was added to the ATCC13032 strain. was transformed by the electric pulse method, and the NCgl2335 gene was deleted on the chromosome through a secondary crossover process. ATCC13032 ΔNCgl2335, ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,WT), ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N) , ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) was obtained. The insertion of the inactivated NCgl2335 gene and the newly introduced Escherichia coli yjeH gene was finally confirmed by comparison with ATCC13032 in which the NCgl2335 gene was not inactivated after PCR using the primers of SEQ ID NOs: 4 and 7.
[205]
[206]
2-2. O-acetyl homoserine production capacity evaluation
[207]
ATCC13032 ΔNCgl2335, ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,WT), ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N), ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N) prepared in Example 2-1 and ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F) In order to compare the production ability of O-acetyl homoserine (O-AH; O-Acetyl Homoserine) of the wild-type strain ATCC13032, O-acetyl homoserine was analyzed in the culture medium by culturing as follows.
[208]
The strain was inoculated with 1 platinum in a 250 ml corner-baffle flask containing 25 ml of the following medium, and cultured with shaking at 33 degrees for 20 hours at 200 rpm. The concentration of O-acetyl homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 4.
[209]
[210]
O-acetyl homoserine production medium (pH 7.2)
[211]
Glucose 30 g, KH 2 PO 4 2 g, Urea 3 g, (NH 4 ) 2 SO 4 40 g, Peptone 2.5 g, CSL (Corn steep liquor, Sigma) 5 g (10 ml), MgSO 4 .7H 2 O 0.5 g, CaCO 3 20 g (based on 1 liter of distilled water)
[212]
[213]
[Table 4]
strain name O-acetyl homoserine (g/L)
ATCC13032 0.3
ATCC13032 ΔNCgl2335 0.3
ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,WT) 0.7
ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N) 1.2
ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) 1.0
[214]
[215]
As a result, as shown in Table 4 above, when the control strain ATCC13032 was cultured, O-acetyl-L-homoserine was accumulated at 0.3 g/L, and O-acetyl-L-homoserine was produced even when the NCgl2335 gene, a translocation enzyme, was deleted. was confirmed to have no effect. In particular, it was confirmed that when the wild-type yjeH gene was expressed, O-acetyl-L-homoserine was accumulated at a level of 0.7 g/L, and when the mutant yjeH gene was expressed, it was confirmed that it was accumulated at a level of 1.2 and 1.0 g/L, respectively.
[216]
Therefore, from the above results, it was confirmed that the wild-type and mutant yjeH genes of the present application could significantly improve the production of target amino acids by releasing O-acetyl-L-homoserine from ATCC13032.
[217]
The ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N), ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) strains were named Corynebacterium glutamicum CM04-0651 and Corynebacterium glutamicum CM04-0652, a trust institution under the Korea Treaty of Budapest, respectively. It was deposited with the Microbial Conservation Center on December 04, 2019 and was given accession numbers KCCM12633P and KCCM12634P.
[218]
[219]
2-3. Evaluation of homoserine production capacity
[220]
ATCC13032 ΔNCgl2335, ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,WT), ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N), ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N) prepared in Example 2-1 and ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F) In order to compare the homoserine production ability of ATCC13032, a wild-type strain, it was cultured in the following manner and homoserine was analyzed in the culture medium.
[221]
The strain was inoculated with 1 platinum in a 250 ml corner-baffle flask containing 25 ml of the following medium, and cultured with shaking at 33 degrees for 20 hours at 200 rpm. The homoserine concentration was analyzed using HPLC, and the analyzed concentrations are shown in Table 5.
[222]
[223]
Homoserine production medium (pH 7.2)
[224]
Glucose 30 g, KH 2 PO 4 2 g, Urea 3 g, (NH 4 ) 2 SO 4 40 g, Peptone 2.5 g, CSL (Corn steep liquor, Sigma) 5 g (10 ml), MgSO 4 .7H 2 O 0.5 g, CaCO 3 20 g (based on 1 liter of distilled water)
[225]
[226]
[Table 5]
strain name Homoserine (g/L)
ATCC13032 0.0
ATCC13032 ΔNCgl2335 0.0
ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,WT) 0.0
ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F92N) 0.2
ATCC13032 ΔNCgl2335::PCJ7-yjeH(eco,F351L) 0.2
[227]
[228]
As a result, as shown in Table 5 above, it was confirmed that homoserine did not accumulate at 0.0 g/L when culturing ATCC13032, a control strain, and that homoserine production was not affected even if the translocation enzyme NCgl2335 gene was deleted. In particular, it was confirmed that homoserine did not accumulate at a level of 0.0 g/L even when the wild-type yjeH gene was expressed, and it was confirmed that when the mutant yjeH gene was expressed, it was accumulated at a level of 0.2 and 0.2 g/L, respectively.
[229]
Therefore, from the above results, it was confirmed that the mutant yjeH gene of the present application can improve the production of target amino acids by excreting homoserine from ATCC13032.
[230]
[231]
Example 3: Production of strains having improved O-acetyl homoserine-producing ability and evaluation of O-acetyl homoserine and homoserine-producing ability
[232]
[233]
3-1. Cystathionine gamma synthase (MetB) inactivation
[234]
Through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, the metB gene encoding O-acetyl homoserine degradation pathway cystathionine gamma synthase (cystathionine gamma(γ)-synthase) was obtained. . The nucleotide sequence information of the metB gene (NCBI registration number Ncgl2360, SEQ ID NO: 17) was obtained from the National Institutes of Health's GenBank (NIH GenBank), and based on this, a primer comprising the N-terminal portion and the linker portion of the metB gene (sequence) Nos. 18 and 19), primers (SEQ ID NOs: 20 and 21) comprising a C-terminal portion and a linker portion were synthesized. The primer sequences were shown in Table 6 below.
[235]
[236]
[Table 6]
SEQ ID NO: sequence name order
SEQ ID NO: 18 metB_N_del F TCTAGACGCCCGCATACTGGCTTC
SEQ ID NO: 19 metB_N_del R CCCATCCACTAAACTTAAACAGATGTGATCGCCCGGC
SEQ ID NO: 20 metB_C_del F TGTTTAAGTTTAGTGGATGGGGAAGAACCACCCAGGCC
SEQ ID NO: 21 metB_C_del R GTCGACCAATCGTCCAGAGGGCG
[237]
[238]
Using the chromosomal DNA of ATCC13032 as a template, PCR was performed using the primers of SEQ ID NOs: 18 and 19 and SEQ ID NOs: 20 and 21. Polymerase PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were repeated 30 times of denaturation at 96° C. for 30 seconds, annealing at 53° C. for 30 seconds, and polymerization at 72° C. for 1 minute. As a result, a 558 bp amplified gene including the N-terminal portion and linker portion of the metB gene and 527 bp amplified gene including the C-terminal portion and linker portion of the metB gene were obtained, respectively.
[239]
PCR was performed using the two amplified genes obtained above as a template, and the PCR conditions were SEQ ID NO: 18 and 21 was added and the polymerization was repeated 20 more times. As a result, an inactivation cassette of 1064 bp including the N-terminus-linker-C-terminus of the metB gene was obtained. Treatment with restriction enzymes XbaI and SalI contained at the end of the PCR fragment obtained through the PCR, and ligation (ligation) to the pDCM2 vector treated with restriction enzymes XbaI and SalI. Finally, the metB inactivation cassette was cloned pDCM2- A ΔmetB recombinant vector was constructed.
[240]
The prepared pDCM2-ΔmetB vector was transformed into ATCC13032 by an electric pulse method, and through a secondary crossover process, ATCC13032 ΔmetB in which the metB gene was inactivated was obtained on the chromosome. The inactivated metB gene was finally confirmed by comparison with ATCC13032 in which the metB gene was not inactivated after PCR using the primers of SEQ ID NOs: 18 and 21.
[241]
[242]
3-2. O-acetyl homoserine thiolase (MetY) inactive
[243]
Through PCR using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template, the metY gene encoding O-acetylhomoserine (thiol)-lyase of the O-acetyl homoserine degradation pathway was identified. secured. The nucleotide sequence information of the metY gene (NCBI registration number Ncgl0625, SEQ ID NO: 22) was obtained from the National Institutes of Health's GenBank (NIH GenBank), and based on this, a primer comprising the N-terminal portion and the linker portion of the metY gene (sequence) Nos. 23 and 24), primers (SEQ ID NOs: 25 and 26) comprising a C-terminal portion and a linker portion were synthesized. Primer sequences were shown in Table 7 below.
[244]
[245]
[Table 7]
SEQ ID NO: sequence name order
SEQ ID NO: 23 metY_N_del F TCTAGACCATCCTGCACCATTTAG
SEQ ID NO: 24 metY_N_del R CCCATCCACTAAACTTAAACACGCTCCTGCCAGGTTC
SEQ ID NO: 25 metY_C_del F TGTTTAAGTTTAGTGGATGGGCTTGGTACGCAACCAAGG
SEQ ID NO: 26 metY_C_del R GTCGACGATTGCTCCGGCTTCGG
[246]
[247]
Using the chromosomal DNA of ATCC13032 as a template, PCR was performed using the primers of SEQ ID NOs: 23 and 24 and SEQ ID NOs: 25 and 26. Polymerase PfuUltraTM high-confidence DNA polymerase (Stratagene) was used, and PCR conditions were repeated 30 times: denaturation at 96°C for 30 seconds, annealing at 53°C for 30 seconds, and polymerization at 72°C for 1 minute. As a result, a 548 bp amplified gene including the N-terminal portion and linker portion of the metY gene and a 550 bp amplified gene including the C-terminal portion and linker portion of the metY gene were obtained. PCR was performed using the two amplified genes obtained above as a template, and PCR conditions were SEQ ID NOs: 23 and 26 after repeating 10 times of denaturation at 96°C for 60 seconds, annealing at 50°C for 60 seconds, and polymerization at 72°C for 1 minute. was added and the polymerization reaction was repeated 20 more times. As a result, an inactivation cassette of 1077 bp including the N-terminal-linker-C-terminus of the metY gene was obtained. Treatment with restriction enzymes XbaI and SalI contained at the end of the PCR fragment obtained through the PCR, and ligation to pDCM2 vector treated with restriction enzymes XbaI and SalI and cloning, finally pDCM2- cloned with the metY inactivation cassette A ΔmetY recombinant vector was constructed.
[248]
The prepared pDCM2-ΔmetY vector was transformed into ATCC13032 ΔmetB strain by an electric pulse method, and through a secondary crossover process, ATCC13032 ΔmetB ΔmetY in which the metY gene was inactivated was obtained on the chromosome. The inactivated metY gene was finally confirmed by comparison with ATCC13032 in which the metY gene was not inactivated after PCR using the primers of SEQ ID NOs: 23 and 26.
[249]
[250]
3-3. Introduction of mutant aspartokinase (LysC)
[251]
In order to maximize the production of O-acetyl homoserine, the expression of the lysC gene in the lysC gene (SEQ ID NO: 27) encoding the aspartokinase derived from Corynebacterium glutamicum ATCC13032 was enhanced and L-lysine (L-Lysine) and L- In order to introduce a mutation (L377K) (US 10662450 B2) for canceling feedback inhibition for L-Threonine, and construct a vector containing the mutant lysC gene, 5' upper end around the mutation site A pair of primers for amplifying the site (SEQ ID NOs: 28 and 29) and a pair of primers for amplifying the 3' bottom region (SEQ ID NOs: 30 and 31) were designed. The primers of SEQ ID NOs: 28 and 31 inserted XbaI and SalI restriction enzyme sites at each end, and the primers of SEQ ID NOs: 29 and 30 were designed to cross each other and nucleotide substitution mutations were located at these sites. Primer sequences were shown in Table 8 below.
[252]
[253]
[Table 8]
SEQ ID NO: sequence name order
SEQ ID NO: 28 lysC_L377K_5 F TCCTCTAGAGCTGCGCAGTGTTGAATACG
SEQ ID NO: 29 lysC_L377K_5 R AGGTGGAAATCTTTTCGATGTTC
SEQ ID NO: 30 lysC_L377K_3 F GAACATCGAAAAGATTTCCACCT
SEQ ID NO: 31 lysC_L377K_3 R GACTCTAGAGTTCACCTCAGGACGATTA
[254]
[255]
PCR was performed using the primers of SEQ ID NO: 28 and SEQ ID NO: 29, SEQ ID NO: 30 and SEQ ID NO: 31 using the ATCC13032 chromosome as a template. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 30 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, a 512 bp DNA fragment at the 5' upper end and a 522 bp DNA fragment at the 3' lower end were obtained centering on the mutation of the lysC gene.
[256]
Using the two amplified DNA fragments as templates, PCR was performed with primers of SEQ ID NO: 28 and SEQ ID NO: 31. PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 60 seconds, followed by polymerization at 72°C for 7 minutes. As a result, a 1011 bp DNA fragment containing a mutated lysC (L377K) gene encoding an aspartokinase variant in which leucine at position 377 was substituted with lysine was amplified.
[257]
Restriction enzymes XbaI and SalI contained at the end of the lysC (L377K) PCR fragment obtained through the PCR were treated, and the restriction enzymes XbaI and SalI were ligated and cloned into the pDCM2 vector, finally lysC (L377K) substitution A pDCM2-lysC (L377K) recombinant vector into which the cassette was cloned was constructed.
[258]
The prepared pDCM2-lysC (L377K) vector was transformed into ATCC13032 △metB △metY strain by electric pulse method, and Corynebacterium glutamicum ATCC13032 △ metB ΔmetY lysC (L377K) was obtained. The gene into which the nucleotide mutation was introduced was finally confirmed by comparison with the sequence of the wild-type lysC gene through PCR using the primers of SEQ ID NOs: 28 and 31, followed by sequencing.
[259]
[260]
3-4. O-acetyl homoserine transferase (MetX) introduction plasmid construction
[261]
In order to amplify the gene encoding O-acetyl homoserine transferase (MetX), the nucleotide sequence information (NCBI registration number NCgl0624, SEQ ID NO: 32) of the metX gene was obtained from the National Institutes of Health (NIH GenBank) in the United States, and in this Based on this, it was designed by inserting BamHI restriction enzyme sites at both ends of the primers (SEQ ID NOs: 33 and 34) for amplification from the promoter site (about 300 bp at the top of the start codon) to the terminator site (about 100 bp at the bottom of the stop codon). PCR conditions were repeated 30 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization for 90 seconds at 72°C, followed by polymerization at 72°C for 7 minutes. As a result, a DNA fragment of 1546 bp of the coding region of the metX gene was obtained. The pECCG117 (KR 10-0057684 B1) vector and the metX DNA fragment were treated with restriction enzyme BamHI, ligated using a DNA conjugation enzyme, and then cloned to obtain a plasmid, which was named pECCG117-metX WT. Primer sequences were shown in Table 9 below.
[262]
[263]
[Table 9]
SEQ ID NO: sequence name order
SEQ ID NO: 33 metX F GGATCCCCTCGTTGTTCACCCAGCAACC
SEQ ID NO: 34 metX R GGATCCAAAGTCACAACTACTTATGTTAG
[264]
[265]
3-5. Production of O-acetyl homoserine-producing strain and evaluation of O-acetyl homoserine-producing ability
[266]
After introducing the pECCG117-metX WT vector prepared in Example 3-4 into Corynebacterium glutamicum ATCC13032 △metB △metY lysC (L377K) prepared in Example 3-3 by electric pulse method, kanamycin Each transformant was obtained by plating on selective medium containing 25 mg/L.
[267]
In order to compare the production ability of O-acetyl homoserine of the strains prepared above, O-acetyl homoserine in the culture medium was analyzed by culturing in the following manner.
[268]
The strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the following medium (inoculation loop), and cultured with shaking at 37° C. for 20 hours at 200 rpm. The concentration of O-acetyl homoserine was analyzed using HPLC, and the analyzed concentrations were shown in Table 10.
[269]
[270]
O-acetyl homoserine production medium (pH 7.2)
[271]
Glucose 30 g, KH 2 PO 4 2 g, urea 3 g, (NH 4 ) 2 SO 4 40 g, peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO 4.7H 2 O 0.5 g, methionine 400 mg, CaCO 3 20 g (based on 1 liter of distilled water)
[272]
[273]
[Table 10]
strains O-AH (g/L)
ATCC13032 △metB △metY lysC(L377K) 0.7
ATCC13032 △metB △metY lysC(L377K) /pECCG117-metX WT 1.3
[274]
[275]
As a result, as shown in Table 10, when the control strain ATCC13032 ΔmetB ΔmetY lysC (L377K) was cultured, 0.7 g/L of O-acetyl-L-homoserine was accumulated and ATCC13032 ΔmetB ΔmetY lysC (L377K) /pECCG117- When the metX WT strain was cultured, it was confirmed that 1.3 g/L of O-acetyl-L-homoserine was accumulated.
[276]
Therefore, it was confirmed from the above results that it is possible to improve the production of O-acetyl-L-homoserine in the ATCC13032 ΔmetB ΔmetY lysC(L377K) /pECCG117-metX WT strain.
[277]
[278]
3-6. Evaluation of homoserine production capacity
[279]
After introducing the pECCG117-metX WT vector prepared in Example 3-4 into Corynebacterium glutamicum ATCC13032 △metB △metY lysC (L377K) prepared in Example 3-3 by electric pulse method, kanamycin Each transformant was obtained by plating on selective medium containing 25 mg/L.
[280]
In order to compare the homoserine-producing ability of the strains prepared above, homoserine was analyzed in the culture medium by culturing in the following manner.
[281]
The strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of the following medium (inoculation loop), and cultured with shaking at 37° C. for 20 hours at 200 rpm. The concentration of homoserine was analyzed using HPLC, and the analyzed concentrations are shown in Table 11.
[282]
[283]
Homoserine production medium (pH 7.2)
[284]
Glucose 30 g, KH 2 PO 4 2 g, urea 3 g, (NH 4 ) 2 SO 4 40 g, peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO 4.7H 2 O 0.5 g, methionine 400 mg, CaCO 3 20 g (based on 1 liter of distilled water)
[285]
[286]
[Table 11]
strains Homoserine production (g/L)
ATCC13032 △metB △metY lysC(L377K) 0.2
ATCC13032 △metB △metY lysC(L377K) /pECCG117-metX WT 0.2
[287]
[288]
As a result, as shown in Table 11 above, when the control strain ATCC13032 △metB △metY lysC (L377K) was cultured, 0.2 g/L of homoserine was accumulated, and ATCC13032 △metB △metY lysC (L377K) /pECCG117-metX WT strain was cultured. In this case, it was confirmed that 0.2 g/L of homoserine was accumulated.
[289]
Therefore, from the above results, it was confirmed that the homoserine production was equivalent to ATCC13032 ΔmetB ΔmetY lysC(L377K) /pECCG117-metX WT strain.
[290]
[291]
Example 4: Production of a mutant foreign membrane protein (YjeH) introduced strain having improved O-acetyl homoserine-producing ability and evaluation of O-acetyl homoserine-producing ability
[292]
[293]
4-1. Introduction of mutant foreign membrane protein (YjeH)
[294]
Vector pDCM2-ΔNCgl2335, pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,WT), pDCM2-ΔNCgl2335::PCJ7-yjeH(eco,F92N), pDCM2-ΔNCgl2335 prepared in Example 2-1: : PCJ7-yjeH (eco, F351L) was transformed into the Corynebacterium glutamicum ATCC13032 △metB △metY lysC (L377K) strain prepared in Example 3-3, and then passed through the secondary crossover process to translocate the gene on the chromosome ATCC13032 △metB △metY lysC(L377K) △NCgl2335, ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH(eco,WT), ATCC13032 △metB △metYlysC(L377K) ΔNCgl2335::PCJ7-yjeH(eco,F92N), ATCC13032 ΔmetB ΔmetY lysC(L377K) ΔNCgl2335::PCJ7-yjeH(eco,F351L) were obtained. The insertion of the inactivated NCgl2335 gene and the newly introduced E. coli yjeH gene was confirmed by performing PCR using the primers of SEQ ID NOs: 4 and 7 and comparing the NCgl2335 gene with ATCC13032 in which the gene was not inactivated.
[295]
[296]
4-2. Production of O-acetyl homoserine-producing strain and evaluation of O-acetyl homoserine-producing ability
[297]
ATCC13032 △metB △metY lysC(L377K) △NCgl2335, ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH prepared in Example 4-1 with the pECCG117-metX WT vector constructed in Example 3-4 (eco,WT), ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH(eco,F92N), ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH(eco,F351L) After introduction by the electric pulse method, each transformant was obtained by plating on a selective medium containing 25 mg/L of kanamycin.
[298]
In order to compare the production ability of O-acetyl homoserine of the strains prepared above, O-acetyl homoserine in the culture medium was analyzed by culturing in the following manner.
[299]
Platinum was inoculated into a 250 ml corner-baffle flask containing 25 ml of the O-acetyl homoserine production medium (pH 7.2) of Example 3-5, and cultured with shaking at 33° C. for 20 hours at 200 rpm. . The concentration of O-acetyl homoserine was analyzed using HPLC, and the analyzed concentrations were shown in Table 12.
[300]
[301]
[Table 12]
strains O-AH (g/L)
ATCC13032 △metB △metY lysC(L377K) /pECCG117-metX WT - 1.3
△NCgl2335 1.3
ΔNCgl2335::PCJ7-yjeH(eco,WT) 2.1
ΔNCgl2335::PCJ7-yjeH(eco,F92N) 2.7
△NCgl2335::PCJ7-yjeH(eco,F351L) 2.3
[302]
[303]
As a result, as shown in Table 12 above, when the control strain, Corynebacterium glutamicum ATCC13032 ΔmetB ΔmetY lysC (L377K) was cultured, 1.3 g/L of O-acetyl-L-homoserine was accumulated and the translocation enzyme NCgl2335 It was confirmed that even if the gene is deleted, there is no effect on the production of O-acetyl-L-homoserine. In particular, when the wild-type yjeH gene was expressed, it was confirmed that 2.1 g/L of O-acetyl-L-homoserine was accumulated, respectively, and when the mutant yjeH gene was expressed, it was confirmed that they were accumulated at 2.7 and 2.3 g/L, respectively.
[304]
Therefore, from the above results, it was confirmed that the wild-type and mutant yjeH genes of the present application can significantly improve the production of target amino acids by excreting O-acetyl-L-homoserine from Corynebacterium glutamicum ATCC13032.
[305]
[306]
4-3. Evaluation of homoserine production capacity
[307]
ATCC13032 △metB △metY lysC(L377K) △NCgl2335, ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH prepared in Example 4-1 with the pECCG117-metX WT vector constructed in Example 3-4 (eco,WT), ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH(eco,F92N), ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH(eco,F351L) After introduction by the electric pulse method, each transformant was obtained by plating on a selective medium containing 25 mg/L of kanamycin.
[308]
In order to compare the homoserine-producing ability of the strains prepared above, homoserine was analyzed in the culture medium by culturing in the following manner.
[309]
The strain was inoculated with 1 platinum in a 250 ml corner-baffle flask containing 25 ml of the following medium, and cultured with shaking at 33° C. for 20 hours at 200 rpm. The concentration of homoserine was analyzed using HPLC, and the analyzed concentrations were shown in Table 13.
[310]
[311]
Homoserine production medium (pH 7.2)
[312]
Glucose 30 g, KH 2 PO 4 2 g, urea 3 g, (NH 4 ) 2 SO 4 40 g, peptone 2.5 g, CSL(Sigma) 5 g (10 ml), MgSO 4.7H 2 O 0.5 g, methionine 400 mg, CaCO 3 20 g (based on 1 liter of distilled water)
[313]
[314]
[Table 13]
strains Homoserine (g/L)
ATCC13032 △metB △metY lysC(L377K) /pECCG117-metX WT - 0.2
△NCgl2335 0.2
ΔNCgl2335::PCJ7-yjeH(eco,WT) 0.2
ΔNCgl2335::PCJ7-yjeH(eco,F92N) 1.2
△NCgl2335::PCJ7-yjeH(eco,F351L) 0.7
[315]
[316]
As a result, as shown in Table 13, when the control strain, Corynebacterium glutamicum ATCC13032 ΔmetB ΔmetY lysC (L377K) was cultured, 0.2 g/L of homoserine was accumulated, and even if the translocation enzyme NCgl2335 gene was deleted, homo It was confirmed that there was no influence on serine production. In particular, it was confirmed that 0.2 g/L of O-acetyl-L-homoserine was accumulated when the wild-type yjeH gene was expressed.
[317]
Therefore, from the above results, it was confirmed that the wild-type and mutant yjeH genes of the present application can significantly improve the production of target amino acids by releasing homoserine from Corynebacterium glutamicum ATCC13032.
[318]
[319]
Example 5: Methionine (MET) production using a conversion reaction for O-acetyl homoserine produced from a strain
[320]
ATCC13032 ΔmetB ΔmetY lysC(L377K) ΔNCgl2335, ATCC13032 ΔmetB ΔmetY lysC(L377K) ΔNCgl2335::PCJ7-yjeH ( eco,WT), ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH(eco,F92N), ATCC13032 △metB △metY lysC(L377K) △NCgl2335::PCJ7-yjeH(eco,F351L) After introduction by the pulse method, each transformant was obtained by plating on a selective medium containing 25 mg/L of kanamycin.
[321]
[322]
In addition, according to the method disclosed in the previously applied patent (WO2008/013432 ) , Pseudomonas aeruginosa and Pseudomonas putida to be used as enzymes to convert O-acetyl homoserine to methionine The metZ gene encoding O-succinyl homoserine sulfidylase was cloned. Using the chromosome of each strain as a template, and using the primers for the metZ genes of Pseudomonas aeruginosa and Pseudomonas putida, the denaturation step was performed at 94°C for 30 seconds, the annealing step was performed at 55°C for 30 seconds, and the extension step was performed at 72°C. was carried out for 2 minutes, and a PCR reaction was performed to perform this 30 times to obtain a DNA fragment. The obtained DNA fragment was digested with NdeI/PacI, and cloned into the same digested vector of pCL-CJ1 vector (CJ, Korea). Cloned vector to E.coliW3110 cells were transformed, and colonies were selected after culturing in LB plate medium containing 50 μg/L spectinomycin. The selected colonies were inoculated into 3 ml of LB medium containing 50 μg/L spectinomycin and cultured at 37° C. overnight. The cultured cells were recovered again, washed with 0.1M potassium phosphate buffer (pH 7.5), suspended again in 200 μl of potassium phosphate buffer, and sonicated 5 times at 30 second intervals to disrupt the cells. After centrifuging the lysed cell extract at 12,000 rpm for 10 minutes, the supernatant was taken and the total amount of protein was quantified using Bio-Rad protein assay solution (BIO-Rad, USA). In addition, the expression of the protein was confirmed using the SDS-PAGE method. The supernatant of the recovered cell extract was used for the enzymatic conversion reaction.
[323]
In addition, the metZ gene encoding O-succinyl homoserine sulfidylase derived from Hyphomonas Neptunium was cloned. A DNA fragment was obtained by performing the same PCR reaction as above using a chromosome of Chromobacterium biorasium as a template and using primers. The obtained DNA fragment was digested with NdeI/AvrII, and cloned into the same digested pCL-CJ1 vector (CJ, Korea) vector. The cloned vector was recovered using the same method as above, and the supernatant of the cell extract was used for the enzymatic conversion reaction.
[324]
In a plate LB medium containing the antibiotic spectinomycin, strains transformed with W3110 with a Pseudomonas-derived metZ expression vector or with a Hypomonas-derived metZ expression vector were inoculated, and cultured overnight at 30-40°C, followed by single colonies. After inoculation in 40 ml LB medium containing spectinomycin, it was cultured at 30-40 ° C for 5 hours. The cultured Pseudomonas-derived metZ-expressing strain and Hypomonas-derived metZ-expressing strain were cultured in a 1L fermenter at 600~900rpm, 30~40℃, 15~30 hours to obtain a fermentation broth. The composition of the medium used for culture was as follows. The obtained fermented solution was disrupted by ultrasonic transmission to prepare an enzyme solution.
[325]
[326]
2XYT Badge
[327]
10 g yeast extract, 16 g tryptophan, 40 g glucose and 50 g spectinomycin (based on 1 liter of distilled water)
[328]
[329]
A methionine conversion reaction was performed by adding the O-succinyl homoserine sulfidylase enzyme solution derived from Pseudomonas and Hypomonas to the transformant culture medium producing the O-acetyl homoserine. After adding 0.1 L of enzyme solution to 2.0 L of O-acetyl homoserine culture without removing cells, 0.3 L of 15% Na-methyl mercaptan was added to initiate the reaction, and 2 hours later, fermentation broth was recovered and cells were removed. The concentration of methionine produced was confirmed through HPLC. The analyzed concentrations are shown in Table 14.
[330]
[331]
[Table 14]
strains Met (g/L)
ATCC13032 △metB △metY lysC(L377K) /pECCG117-metX WT - 1.2
△NCgl2335 1.2
ΔNCgl2335::PCJ7-yjeH(eco,WT) 1.9
ΔNCgl2335::PCJ7-yjeH(eco,F92N) 2.5
△NCgl2335::PCJ7-yjeH(eco,F351L) 2.1
[332]
[333]
From the above description, those skilled in the art to which the present application pertains will understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims described below, rather than the above detailed description, and equivalent concepts thereof, to be included in the scope of the present application.
[334]

[335]

Claims
[Claim 1]
In the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acid substitution of i) and ii) is included. And, having at least 95% or more and less than 100% homology to SEQ ID NO: 1, a variant of the inner membrane protein YjeH.
[Claim 2]
The variant according to claim 1, wherein the variant has O-acetyl homoserine or homoserine excretion ability.
[Claim 3]
A polynucleotide encoding the variant of claim 1 .
[Claim 4]
A vector comprising the polynucleotide of claim 3.
[Claim 5]
In the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acid substitutions of i) and ii) are included. and having at least 95% or more and less than 100% homology to SEQ ID NO: 1, a variant of the inner membrane protein YjeH; And a microorganism comprising any one or more of the polynucleotide encoding the variant.
[Claim 6]
The microorganism according to claim 5, wherein the microorganism has an increased O-acetyl homoserine or homoserine-producing ability compared to an unmodified microorganism.
[Claim 7]
The microorganism according to claim 5, wherein the microorganism is a Corynebacterium sp.
[Claim 8]
In the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acid substitution of i) and ii) is included. and having at least 95% or more and less than 100% homology to SEQ ID NO: 1, a variant of the inner membrane protein YjeH; and culturing a microorganism in a medium, comprising any one or more of the polynucleotide encoding the variant.
[Claim 9]
According to claim 8, wherein the method further comprises the step of recovering the target product from the cultured medium or microorganism, the target product production method.
[Claim 10]
The method according to claim 8, wherein the target product is O-acetyl homoserine or homoserine.
[Claim 11]
In the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acid substitution of i) and ii) is included. and having at least 95% or more and less than 100% homology to SEQ ID NO: 1, a variant of the inner membrane protein YjeH; And culturing a microorganism comprising any one or more of the polynucleotide encoding the variant in a medium to produce O-acetyl homoserine; and converting O-acetyl homoserine to methionine by reacting the O-acetyl homoserine with sulfide.
[Claim 12]
In the amino acid sequence of SEQ ID NO: 1, i) the amino acid at position 92 is substituted with asparagine, ii) the amino acid at position 351 is substituted with leucine, or iii) the amino acid substitution of i) and ii) is included. and having at least 95% or more and less than 100% homology to SEQ ID NO: 1, a variant of the inner membrane protein YjeH; And culturing a microorganism comprising any one or more of the polynucleotide encoding the variant in a medium to produce O-acetyl homoserine or homoserine; and converting the O-acetyl homoserine or homoserine into glufosinate.
[Claim 13]
A composition for producing homoserine, comprising the microorganism of claim 5 or a culture of the microorganism.
[Claim 14]
A composition for producing O-acetyl homoserine, comprising the microorganism of claim 5 or a culture of the microorganism.
[Claim 15]
Use of the inner membrane protein YjeH variant of claim 1 for the production of O-acetyl homoserine or homoserine.
[Claim 16]
Use of the microorganism of claim 5 for the production of O-acetyl homoserine or homoserine.

Documents

Application Documents

# Name Date
1 202217038052.pdf 2022-07-01
2 202217038052-STATEMENT OF UNDERTAKING (FORM 3) [01-07-2022(online)].pdf 2022-07-01
3 202217038052-SEQUENCE LISTING(PDF) [01-07-2022(online)].pdf 2022-07-01
4 202217038052-SEQUENCE LISTING [01-07-2022(online)].txt 2022-07-01
5 202217038052-REQUEST FOR EXAMINATION (FORM-18) [01-07-2022(online)].pdf 2022-07-01
6 202217038052-FORM 18 [01-07-2022(online)].pdf 2022-07-01
7 202217038052-FORM 1 [01-07-2022(online)].pdf 2022-07-01
8 202217038052-DRAWINGS [01-07-2022(online)].pdf 2022-07-01
9 202217038052-DECLARATION OF INVENTORSHIP (FORM 5) [01-07-2022(online)].pdf 2022-07-01
10 202217038052-COMPLETE SPECIFICATION [01-07-2022(online)].pdf 2022-07-01
11 202217038052-Proof of Right [05-07-2022(online)].pdf 2022-07-05
12 202217038052-FORM-26 [05-07-2022(online)].pdf 2022-07-05
13 202217038052-certified copy of translation [05-07-2022(online)].pdf 2022-07-05
14 202217038052-certified copy of translation [08-07-2022(online)].pdf 2022-07-08
15 202217038052-FORM 3 [08-11-2022(online)].pdf 2022-11-08