Abstract: The present invention provides a mutant yeast strain that is capable of alcohol fermentation, preferably high gravity fermentation (HGF) or very high gravity fermentation (VHGF). Particularly, the mutant yeast strain is oi Meyer ozyma caribbica species. The invention also provides a method of producing alcohol with high fermentation efficiency using said mutant yeast strain under high stress conditions.
1. A mutant yeast strain wherein the mutant yeast is Meyer ozyma caribbica deposited under accession number MTCC 25437.
2. The mutant yeast as claimed in claim 1, wherein the strain can convert agricultural biomass into ethanol at very high gravity fermentation conditions and high stress conditions.
3. The mutant yeast as claimed in claim 1, wherein the high stress conditions may be selected from a group consisting of high sucrose osmotic stress, elevated temperatures (30°C to 37°C), pH range of 3-6, sulphate, sulphite, acetic acid and ethanol (more than 13%).
4. A method of producing mutant yeast oi Meyer ozyma caribbica spp., wherein the mutant yeast is generated by chemical mutagenesis or recombinant DNA technology.
5. The method as claimed in claim 4, wherein the method comprises: i. collecting a soil sample and inoculating into Yeast Nitrogen Base (YNB) and 0.02 g/mL chloramphenicol; ii. incubating the inoculate of step (i) for 4 days at a temperature of 28°C, followed by serial dilution; iii. plating of the culture onto a suitable media followed by incubation at 28°C for 72 hrs; iv. selection of said colonies based upon the morphology and further selection based on fermentation efficiency on suitable medium; v. final selection of best performing strain from step (iv) and identification through ITS sequence homology to obtain wild strain of M. caribbica; and vi. performing chemical mutagenesis of the wildM caribbica with a chemical mutagen selected from N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) N-methyl-N'-nitro-N- nitrosoguanidine (MNNG) or Diethylsulfate (DES)/ Ethyl Methane Sulfonate (EMS) to obtain a mutant strain; wherein, said mutant strain is capable of high gravity fermentation for ethanol production.
6. The method as claimed in claim 5, wherein the chemical mutagenesis comprises the following steps: a. inoculating the culture of purified isolated yeast strain grown in MGYP agar followed by incubation; b. centrifugating the cultured broth for 10 minutes at 5000 rpm followed by washing of cells with sterile pH 6.0 phosphate buffer twice; c. forming a suspension of cells by dilution with pH 6.0 phosphate buffer to obtain 107/mL of cell count; d. adding 1 ml of MNNG from 10 mg/mL MNNG stock solution to 10 ml cell suspension of step (c) to obtain 75-150 ug/mL final concentration followed by addition of 2 drops of acetone for dissolution of MNNG; e. incubating for 30 minutes with shaking at 150 rpm at 30°C followed by centrifugation at 5000 rpm for 10 minutes to collect the cells followed by washing three-five times with sterile normal saline to stop the reaction; f serial dilution of cells and plating of 0.1 mL of each dilution on Petri plates containing MGYP agar having KC1 at concentration of 200 g/L followed by incubation at 30°C for 2-3 days; and g. selection and screening of colonies for its suitability for fermentation.
7. The method as claimed in claim 5, wherein said fermentation medium comprises of 1% peptone, 2% yeast extract and 2% sugar xylose or glucose.
8. A method of fermentation for production of ethanol comprising: i. culturing the mutant yeast strain of Meyerozyma caribbica in a suitable culturing media; and ii. fermenting the biomass/sugar source with the said mutant yeast strain under appropriate stress conditions.
9. The method as claimed in claim 8, wherein the fermentation efficiency is greater than 85%.
10. The method as claimed in claim 8 wherein the ethanol yield is between 11-15%.
11. The method as claimed in claim 8, wherein the biomass or sugar source is selected from, but not limited to the group, consisting of wood, rice straw, wheat straw, bagasse, bamboo, stalks, leaves, and cobs of corn, pulp, wastes resulting therefrom for example wastepaper, cane juice/syrup, sugar /molasses/ sources of starch, including rice, corn, wheat, grain, sorghum, barley, and potatoes, sweet sorghum, beet molasses.
12. The mutant yeast strain as claimed in claim 1, as and when used for ethanol production using fermentation under high stress conditions.
The invention relates to fermentation technology and more specifically to production of alcohol using mutant yeast strain capable of alcohol production under high stress conditions. Particularly, the mutant strain is Meyerozyma caribbica yeast strain. Preferably, the fermentation technology is high gravity fermentation technology.
BACKGROUND OF THE INVENTION
With the rapid development of urban estates, the demand for fuel has been continually increasing leading to dependency on fossil resources. The high gravity fermentation is a process which offers less operational cost with low waste generation and higher alcohol yield (more than 12%). Fermentation at higher ethanol level can reduce the distillation cost as compared to the traditional fermentation, where maximum 10-11% ethanol is produced. High gravity fermentation process based on utilization of substrate medium contains sugar concentration higher than 250 g L_1 to produce high ethanol yield (>15% (v/v)). The high sugar load in high gravity fermentation generates stress to yeast strain for the enhanced production of ethanol. Several osmotic stresses encountered by yeast cells during fermentation affects the viability of yeast cells that impacts ethanol production. The availability of a yeast strain that can adopt to the high gravity fermentation technology is highly demanded and the current marketed strains are lagging in the same.
Indian patent application 201647008142 discloses an ethanol fermentation method with surfactant improvement comprising a fermentable carbohydrate used as a carbon source, a surfactant-water mixture used as a fermentation medium, a pH adjusting agent added to adjust the pH value of the fermentation medium and the Saccharomyces cerevisiae cells are inoculated to perform very high gravity ethanol fermentation. Therein, the fermentation efficiency of the process is upto 80%.
Chinese patent CN1289685C discloses a method of increasing alcohol fermentation using koji as an accelerator. The reference discloses the method of production of alcohol using starch based raw materials such as corn, dried potato, cassava, sorghum, rice or wheat in the presence of a-amylase and CaCb at high temperature to gelatinize and liquify and culture distiller's yeast or active dry yeast that is added several times for producing high concentration of alcohol in the mash. The high concentration of alcohol is expected to be between 14% (V) to 18% (V) and the use of accelerator reduces the toxic effect of high concentration alcohol on the yeast cells.
Therefore, fermentation of ethanol under high gravity (HG) and very high gravity (VHG) conditions with high ethanol production and high fermentation efficiency is need of the hour. The research in this industry has witnessed significant progress over the last three decades owing to economic and environmental benefits. Research efforts have been directed towards comprehensive development of the technologies, possibilities of using unconventional and cost-effective substrates, nitrogen supplements, selecting industrial strains, construction of novel strains that exhibit both osmo-tolerance and high alcohol or ethanol yielding capabilities under VHG conditions. The present invention has overcome the drawbacks of the prior art and provides a novel mutant yeast strain capable of alcohol production under high stress conditions with good yield and fermentation efficiency of >85%.
This mutant yeast strain of the present invention can grow and initiate the fermentation of agriculture biomass and on its byproducts (like molasses), with high gravity (HG) and very high gravity (VHG) (GO = 20-30° Bx) and finds significant application in the ethanol production.
OBJECTS OF THE INVENTION
An object of the present invention is to provide a mutant yeast strain capable of alcohol
production at very high gravity.
Another object of the invention is to provide a mutant yeast strain under high stress conditions.
Another object of the present invention is to provide a mutant yeast strain of Meyerozyma
caribbica species.
Another object of the present invention is to provide a method of producing alcohol using said
mutant yeast strain.
Another object of the invention is to provide high gravity fermentation (HGF) technology.
Yet another object of the invention is to provide a very high gravity (VHG) fermentation
technology.
SUMMARY OF INVENTION
The present invention is described hereinafter by various embodiments to solve the above-mentioned drawbacks of the prior arts. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, the embodiments are provided with the intent of imparting clarity pertaining to the scope of the invention to those skilled in the art.
Embodiments of the present invention relate to a mutant yeast strain, preferably, Meyer ozyma caribbica (herein after referred to as CBTPL/HGY007) yeast strain, capable of performing alcohol fermentation, preferably very high gravity (VHG) fermentation for high yield production of ethanol.
Another embodiment of the present invention is to provide a method of producing yeast using evolutionary engineering process.
Another embodiment of the present invention is to provide a method of producing ethanol using said mutant yeast strain for fermentation of biomass containing wide range of sugars.
The said yeast strain is capable of producing alcohol from different raw materials like molasses, sugar syrup, rice, maize etc.
BRIEF DESCRIPTION OF DRAWINGS
The accompanying figures illustrate some of the embodiments of the present invention and, together with the descriptions, serve to explain the invention. These figures have been provided by way of illustration and not by way of limitation.
Figure 1 provides a summary of isolation and strain improvement, and an overview of the overall isolation procedure, characterization, and deposition of the mutant yeast (CBTPL/HGY007).
Figure 2 shows sample collection and isolation and illustrates the process of strain isolation.
Figure 3 depicts screening flow chart of isolates and illustrates the selection of 7 of 42 isolates from soil sample.
Figure 4 shows selected isolates from soil sample and illustrates the images of selected 7 isolates on YPD plate.
Figure 5 shows ITS sequencing of sample isolates and illustrates ITS sequence details of the selected 7 isolates.
Figure 6 provides evolutionary engineering and illustrates the methodology of mutant generation from CBTPL/HGYwl strain.
Figure 7 shows mutant variant screening by HPLC in artificial sugar media (20% Sucrose) and illustrates the selection of mutants based on high ethanol fermentation ability among the mutants.
Figure 8 provides fermentation potential of wild yeast vs selected mutant variants by HPLC in artificial sugar media (20% Sucrose) and illustrates comparison of best mutants against wild strain.
Figure 9 shows temperature tolerance of HGY wild vs HGY007 and illustrates the temperature tolerance of HGY007 against wild strain.
Figure 10 shows pH tolerance of HGY wild vs HGY007 and illustrates the pH tolerance of HGY007 against wild strain.
Figure 11 shows strain viability of Fali, ER and HGY007 at different Brix and illustrates the influence of enhanced brix of molasses on viable cell count of HGY007 strain against other commercial strains.
Figure 12 shows tolerance of HGY007 against toxic compounds and illustrates influence of toxic compounds- Acetic acid, sulphate and sulphite on viable growth of HGY007.
Figures 13 shows ethanol tolerance comparison of HGY007 Vs HGYwl and illustrates the tolerance of HGY wild Vs HGY007 strains at 10%, 12% & 14% alcohol stress.
Figure 14 shows the effect of lyophilization media on growth survival of lyophilized HGY007 and illustrates the effect of lyophilization on revival of HGY007.
Figure 15(a-c) illustrates molecular characterization of genes responsible for handling stress conditions and polymerase chain reaction product for stress responsive gene expression of ATH-1, SSU-1, HSF-1, SOD & TPS-1 gene regions.
Figure 16 shows strain viability comparison of Fali, ER and HGY007 at different Brix and illustrates the viability comparison of HGY007 against different commercial strains at enhanced brix of the molasses.
Figure 17 shows comparison of fermentation efficiency of HGY007 with commercial strains @14% alcohol with/without nutrients and illustrates the performance of HGY007 strain against commercial strains in presence and absence of nutrients like urea/DAP at 14% theoretical alcohol.
Figure 18 illustrates comparison of fermentation efficiency and alcohol yield of HGY007 against commercial strains @ 13.2% theoretical alcohol.
Figure 19(A-L) illustrates the mutant yeast (HGY007) fermentation efficiency and ethanol yield under varying specific gravity, temperature and pH conditions with substrates from different regions of India.
Figure 20 illustrates comparative fermentation results of HGY007 vs ER on B&C molasses from North and West regions of India at different temperature, pH and theoretical alcohol %.
Figure 21 illustrates comparative fermentation results of HGY007 vs ER on cane syrup from India at different theoretical alcohol (12.9%, 13.86% and 14.55%).
Figure 22 illustrates comparative fermentation results of HGY007 vs ER on grain (rice) fermentation at 15.09%> theoretical alcohol.
DETAILED DESCRIPTION OF INVENTION
The foregoing broadly outlines the features and technical advantages of the present disclosure in order that the detailed description of the disclosure that follows may be better understood. It should be appreciated by those skilled in the art that the conception and specific embodiment disclosed may be readily utilized as a basis for modifying the disclosed methods or for carrying out the same purposes of the present disclosure.
The present invention discloses a mutant M. caribbica yeast strain capable of alcohol fermentation. Preferably, the yeast strain is capable of producing ethanol under high stress conditions. Also disclosed herein is a method to develop said mutant M. caribbica yeast strain capable of high gravity fermentation under high stress conditions. Said stress conditions include, but are not limited to high sucrose osmotic stress, high tolerance to elevated temperatures (30°C to 40°C), pH range of 3-6, high levels of sulphate, sulphite, acetic acid and ethanol (more than 12%).
In another embodiment, the present invention relates to ethanol production using the mutant M. caribbica yeast strain that is the yield is greater than 12%.
In an embodiment, the present invention relates to tolerance of mutant yeast to sulphate toxicity at concentration < 10000 ppm, sulphite < 2500 ppm and acetic acid < 5000.
Also, disclosed is a method of high gravity and very high gravity fermentation of biomass for producing alcohol using said mutant M. caribbica yeast strain. The strain is capable of tolerating VHG conditions resulting in high yield of alcohol/ethanol.
In an embodiment, substrate used for said high gravity and very high gravity fermentation may be selected from, but not limited to the group, consisting of wood, rice straw, wheat straw, bagasse, bamboo, stalks, leaves, and cobs of corn, pulp, wastes resulting therefrom for example wastepaper, cane juice/syrup, sugar /molasses/ sources of starch, including rice, corn, wheat, grain, sorghum, barley, and potatoes, sweet sorghum, beet molasses etc.
The present invention also relates to the isolation, characterization, and evolutionary engineering of novel yeast strain of Meyerozyma caribbica, from high sucrose content soil, designated as CBTPL/HGY007 and deposited with Microbial Type Culture Collection (EVITECH), Chandigarh under accession number MTCC 25437.
In yet another embodiment, the present invention provides a method of alcohol production using said mutant yeast strain.
The method of the present invention comprises production of the mutant of Meyerozyma caribbica spp., comprising:
i. collecting soil sample in a tightly capped sterile container; ii. enrichment of sample and culturing in enrichment media; iii. selection and purification of various strains based upon morphology; iv. selection of few strains based upon fermentation capability of biomass or sugar
source; v. identification of strain performing based upon fermentation efficiency and ITS
sequencing; and vi. isolation of wild strain and mutant colonies of M. caribbica and treating with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), DES/EMS. The present invention also provides a method of production of ethanol using the mutant yeast strain obtained by the aforesaid process comprising:
i. culturing the mutant strain of Meyerozyma caribbica in a suitable culture media;
and ii. fermenting a sugar substrate with the said mutant yeast strain under appropriate stress conditions. In the principal embodiment, the present invention provides a mutant yeast strain wherein the mutant yeast is Meyerozyma caribbica deposited under accession number MTCC 25437.
In another embodiment, the mutant yeast strain of the present invention can convert agricultural biomass into ethanol at very high gravity fermentation conditions and high stress conditions.
In another embodiment, the high stress conditions may be selected from a group consisting of high sucrose osmotic stress, elevated temperatures (30°C to 37°C), pH range of 3-6, sulphate, sulphite, acetic acid and ethanol (more than 13%).
In another important embodiment, the present invention provides a method of producing mutant yeast oiMeyerozyma caribbica spp., wherein the mutant yeast is generated by chemical mutagenesis or recombinant DNA technology.
In a further embodiment, the present invention provides a method of producing mutant yeast oiMeyerozyma caribbica spp., wherein the method comprises:
i. collecting a soil sample and inoculating into Yeast Nitrogen Base (YNB) and 0.02
g/mL chloramphenicol; ii. incubating the inoculate of step (i) for 4 days at a temperature of 28°C, followed by
serial dilution; iii. plating of the culture onto a suitable media followed by incubation at 28°C for 72 hrs; iv. selection of said colonies based upon the morphology and further selection based on
fermentation efficiency on suitable medium; v. final selection of best performing strain from step (iv) and identification through ITS
sequence homology to obtain wild strain of M. caribbica; and vi. performing chemical mutagenesis of the wildM caribbica with a chemical mutagen
selected from N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) N-methyl-N'-nitro-N-
nitrosoguanidine (MNNG) or Diethylsulfate (DES)/ Ethyl Methane Sulfonate (EMS)
to obtain a mutant strain; wherein, said mutant strain is capable of high gravity
fermentation for ethanol production.
In another embodiment, the chemical mutagenesis comprises the following steps:
a. inoculating the culture of purified isolated yeast strain grown in MGYP agar
followed by incubation;
b. centrifugating the cultured broth for 10 minutes at 5000 rpm followed by
washing of cells with sterile pH 6.0 phosphate buffer twice;
c. forming a suspension of cells by dilution with pH 6.0 phosphate buffer to obtain
107/mL of cell count;
d. adding 1 ml of MNNG from 10 mg/mL MNNG stock solution to 10 ml cell
suspension of step (c) to obtain 75-150 ug/mL final concentration followed by
addition of 2 drops of acetone for dissolution of MNNG;
e. incubating for 30 minutes with shaking at 150 rpm at 30°C followed by
centrifugation at 5000 rpm for 10 minutes to collect the cells followed by
washing three-five times with sterile normal saline to stop the reaction;
f serial dilution of cells and plating of 0.1 mL of each dilution on Petri plates containing MGYP agar having KC1 at concentration of 200 g/L followed by incubation at 30°C for 2-3 days; and
g. selection and screening of colonies for its suitability for fermentation.
In still another embodiment, the fermentation medium comprises of 1% peptone, 2% yeast extract and 2% sugar xylose or glucose.
In another embodiment, the present invention provides a method of fermentation for production of ethanol comprising:
i. culturing the mutant yeast strain of Meyerozyma caribbica in a suitable
culturing media; and ii. fermenting the biomass/sugar source with the said mutant yeast strain under appropriate stress conditions.
In an embodiment, the fermentation efficiency of the mutant yeast for ethanol production is greater than 85%.
In a further embodiment, the ethanol yield in the method of the present invention is between 11-15%.
In another embodiment, the mutant yeast strain can be used for ethanol production using fermentation under high stress conditions.
EXAMPLES
Without limiting the scope of the present invention as described above in any way, the present invention has been further explained through the examples provided below.
Example 1: Isolation, screening, and identification of microorganisms
A soil sample was collected in a tightly capped sterile container from Rohana Kalau, Kathauli village region of Muzaffamagar, Uttar Pradesh (U.P.), India. Sample were initially inoculated in Yeast Nitrogen Base (YNB) broth without amino acid by addition of 2% xylose sugar, 0.02 g/mL chloramphenicol and then incubated for 4 days at a temperature of 28°C. Followed by incubation, growth culture was serially diluted with sterile 9 mL normal saline tubes ranging from 10"1 to 10"6 of dilutions and it was plated onto media comprising of 2% Xylose, 1% peptone, 2% yeast extract, 2% agar, and chloramphenicol (0.02 g/L)). The plates were incubated at 28°C for 72 hrs. Plates were inspected for variety of colony morphotypes of grown culture and purified on same fresh media plates. Suspected 62 yeast resembling colonies were examined for the fermentation medium 1% peptone, 2% yeast extract and 2% sugar Xylose or Glucose and selected 7 isolates based on maximum fermentation of sugars and ethanol concentration The molecular identification of these strains was done based on ITS gene sequencing
7 yeast isolates were further screened based on the fermentation of maximum sugars and ethanol recovery from them. Among the seven isolates, one strain, CBTPL/UT/PY004 was selected due to its suitability in molasses fermentation, based on quantitative analysis of fermentation of molasses and identified as M. caribbica by ITS sequence homology and designated as CBTPL/HGYwl.
Table 1: Molecular identification of Yeast based on ITS gene sequencing data. Based on sequence analysis the strain was showing closest similarity as follows:
S.No Strain designation Closest similarity with Percent Similarity
(%)
1 CBTPL/UT/PY004 Meyerozyma caribbica 100
2 CBTPL/UT/PY011 Kluyveromyces marxianus 98
3 CBTPL/UT/PY015 Candida intermedia 97.7
4 CBTPL/UT/PY022 Candida tropicalis 100
5 CBTPL/UT/PY037 Candida intermedia 96
6 CBTPL/UT/PY047 Pichia kudriavzevii 97.6
7 CBTPL/UT/PY053 Meyerozyma caribbica 93.8
CBTPL/UT/PY004 ITS region Sequence:
GCCACACCATTCAACGAGTTGGATAAACCTAATACATTGAGAGGTCGACAGCAC
TATCCAGTACTACCCATGCCAATACTTTTCAAGCAAACGCCTAGTTCGACTAAGA
GTATCACTCAATACCAAACCCGGGGGTTTGAGAGAGAAATGACGCTCAAACAGG
CATGCCCTCTGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCA
CGAAAATCTGCAATTCATATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCG
AGAACCAAGAGATCCGTTGTTGAAAGTTTTGAAGATTAATTCAAAATTTGACTAT
CAATAAAAATAATTAAATTGTGTTTTGTTAAACCTCTGGCCCAACCTATCTCTAG
GCCAAACCAAAGCAAGAGTTCTGTATCAAAAAGACA
Detailed isolation procedure and experimental design is described in Figure 1.
The procedure for yeast isolation and selection is as illustrated in figures 2 and 3.
Example 2: Generation of Mutants by Chemical Mutagenesis
The isolated and selected CBTPL/HGYwl yeast strain was subjected to treatment with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) or Diethylsulfate (DES)/ Ethyl Methane Sulfonate (EMS) to generate mutants. Culture of purified isolated yeast strain from 24 hr grown MGYP agar plates was inoculated in 250 mL flask containing 50 mL MGYP broth and incubated at 30°C and 150 rpm for 10 hrs to allow cells to be in an early-log growth phase. 5 mL of the culture broth from step (i) was taken and centrifuged for 10 minutes at 5000 rpm and supernatant was discarded. Cells were then washed twice with sterile pH 6.0 phosphate buffer. The cell suspension was made by dilution with a pH 6.0 phosphate buffer to obtain 107/mL of cell count. Then 10 mL of the cell suspension was transferred to a 125 mL conical flask followed by addition of 1 ml of MNNG from 10 mg/mL MNNG stock solution to make lOOug/mL final concentration. 2 drops of acetone were then added therein to favor the dissolution of MNNG. Flask was incubated for 30 minutes with shaking at 150 rpm and 30°C after incubation mixture was centrifuged at 5000 rpm for 10 minutes to collect the cells, and the cells were washed 3-6 times with sterile normal saline to stop the reaction. In case of
Diethyl sulfate (DES) the final concentration of DES was maintained at 1% (v/v) and the reaction was stopped by addition of 25% Na2S203
Cells were serially diluted, and 0.1 mL of each dilution was plated on Petri plates containing MGYP agar prepared with addition of potassium chloride (KCl) at concentration of 200 g/L and then plates were incubated at 30°C for 2-3 days and several colonies were picked out and screened for its suitability for fermentation and selected 20 colonies.
Example 3: Screening of Mutants
The mutagen treated selected colonies were inoculated in 50 mL of MGYP broth and incubated at 30° C for 10 h in incubator shaker. These mutants were screened further for fermentation efficiency with variable concentration of glucose as well as xylose. Changes in sugar concentration and ethanol concentration at every 3hrs of intervals were determined by HPLC. Comparison of the sugar consumption, final residual sugar concentration and ethanol concentration contents were compared among the 20 mutants and 8 mutant variants with higher glucose consumption rates, lower final residual sugar concentrations and higher ethanol concentrations were selected and designated as Y-l, Y-2, Y-3, Y-4, Y5, Y-10, Y-12 and Y-15.
Example 4: Evolutionary Engineering study with various parameters
4.1 Sugar fermentation and Ethanol recovery analysis of mutant variants
A composite sugar media comprising 2% of Peptone, 1% of Yeast Extract, 20% of Sucrose was used for the fermentation analysis. Cell suspensions of Y-l, Y-2, Y-3, Y-4, Y5, Y-10, Y-12 and Y-15 mutants were prepared by addition of freshly grown culture from YPD agar medium to sterile normal saline and turbidity of suspensions was adjusted equivalent to 0.5 MacFarland. Then aseptically 1 mL of cell suspension of each test strain was transferred to 100 mL of sucrose broth and incubated at 25°C for 48 hrs. Approximately, 2 mL of sample was withdrawn from each of the flask after every 3 hours of interval up to a period of 48 hrs. HPLC (Agilent) defaulted with Agilent Hyplex-H Column (Stationary Phase) and RID Detector with Ezcrome elite analysis software and 0.005 M H2SO4 solution was used as mobile phase, the concentration of sugars and alcohol from HPLC data were used for comparison of ethanol yield and the best variant Y-12 was selected. The resultant recovery of ethanol was illustrated in figure 7 for different variants of the mutant yeast (listed above).
4.2 Hereditary Stability Test
High ethanol producing mutant variant Y-12 was selected and passaged 10 times serially on slants, and fermentation efficiency of strain was evaluated after each passage in YPD medium as well as in molasses wort. Experiments showed that, after 10 serial passages on the slants, the strain had no evident changes in traits thereof, and each performance index was normal, indicating that the strain has strong hereditary stability. Thus, after passing passage challenge mutant variant was assigned as CBTPL/HGY007 by the applicant. The same was deposited with Microbial Type Culture Collection (EVITECH), Chandigarh under accession number MTCC 25437.
4.3 Temperature tolerance screening of CBTPL/HGY007 in comparison to CBTPL/HGYwl
The time versus growth assay was performed to analyse the survival ability of strain at different temperatures. Wild-typeM. caribbica isolate as well as for CBTPL/HGY007 strain were grown at different growth temperatures i.e., 30°C, 35°C, 40°C, 42°C, 45°C along with one control at 28°C. An experiment was performed in 50 mL of sterile YPD broth for each individual temperature in duplicates. The tubes were aseptically inoculated with 0.5mL of cell suspension equivalent to 0.5 MacFarland standard of each test yeast strain. Five sets of each test yeast strain were prepared for incubation at 5 different temperatures (30°C, 35°C, 40°C, 42°C, 45°C) with a control temperature (28°C). Each set of a test strain was analysed for growth at 0 hr, 24 hrs and 48 hrs time interval, Optical Density (OD) values were checked at 570 nm in UV spectrophotometer in order to get yeast cell growth in the above-mentioned time intervals. After the OD comparisons of wild and mutant strains was complete, it was concluded that the mutant strain (CBTPL/HGY007) has increased temperature tolerance. The figure 9 illustrates influence of temperature for survival of CBTPL/HGY007strain in comparison to wild-type M. caribbica isolate after 48 hours of incubation time.
4.4 pH tolerance screening of CBTPL/HGY007strain in comparison to CBTPL/HGYwl
The wild and mutant yeast strain CBTPL/HGY007 was assayed for pH tolerance. To perform the assay, 50 mL of YPD broth was made and distributed in 12 conical flasks in order to prepare three different pH media in four replicates of flasks. Media in four flasks was adjusted with pH
4.5 (acidic), four flasks with pH 5.6 (optimum), and four flasks with pH 6.5 (alkaline). 0.5 mL
of cell suspension equivalent to 0.5 MacFarland standard of each yeast strain was transferred
aseptically to 50 mL flasks containing media of different pH values. After the aseptic
inoculation was done, all the flasks were kept for incubation at 28°C for 48 hrs. The OD was
measured at time intervals of 0 hr, 24 hrs and 48 hrs from the flask having different pH values at 570 nm in an UV spectrophotometer to obtain yeast cell growth measurement. The results showed that the mutant strain CBTPL/HGY007 growth rate was faster, and the survival rate was higher than the wild type at different pH levels. The same has been illustrated in the figure 10.
4.5 Tolerance against toxic compounds of CBTPL/HGY007strain in comparison to
CBTPL/HGYwl
Yeast Nitrogen Base (YNB) medium tubes (pH=6.5) were prepared after filter sterilization and 10 mL of YNB was distributed to 30 mL screw cap tubes. Acetic acid, copper sulphate, sodium sulphite (INfeSCb) ranging from 100-20000 ppm were added to test the individual compound toxicity on yeast. One set of media with the test organism was also kept as control without any compounds (acetic acid, copper sulphate, sodium sulphite (Na2S03)). Each treatment was repeated in triplicate. 0.1 mL cell suspension of CBTPL/HGY007 and wild strain was inoculated to each individual tube and subsequently these tubes were incubated at 28°C. After incubation, Optical Density (OD) was measured at 570 nm. The growth survival of the strains was evaluated by comparing the OD values obtained from variable concentrations of the compound along with control. The mutant strain CBTPL/HGY007 was able to tolerate the toxic of sulphite and sulphite up to 2500 ppm concentration while acetic acid toxicity was up to 3000 ppm concentration, however gradually above these limits the tolerance levels were gradually decreased and at 5000ppm the viability was not observed. The same is illustrated in figure 12.
4.6 Ethanol tolerance comparison of CBTPL/HGY007strain to CBTPL/HGYwl
The tolerance of mutant yeast strain and wild strain towards ethanol was evaluated. 50 mL of SDB agar media was prepared in 12 flasks (3 flasks per test strain) and sterilized by autoclaving at 121°C for 15 minutes. Then ethanol was added to sterile media in the following manner:
a. 0% Ethanol Concentration - Control without ethanol;
b. 10% Ethanol Concentration- 5mL Ethanol + 45mL media;
c. 12% Ethanol Concentration- 6 mL Ethanol + 44mL media; and
d. 14% Ethanol Concentration- 7 mL Ethanol + 43mL media.
Plates were poured in duplicate manner from each of ethanol variable concentrations of media and point inoculation of each test strain was done on agar plates with different concentrations. Plates were incubated at 28°C for up to 48 hrs. Growth of yeast by means of opacity and colour
intensity of the inoculated area on the agar surface was compared (Illustrated in figure 13). The HGY007 showed growth up to 103, while no growth for HGYwl.
4.7 High Gravity fermentation efficiency: Comparison of yeast strains
The efficiency for high gravity fermentation was evaluated using different strains of yeast. A fermentation wort was made at Molasses Factor (MF=0.57) for dilution with the use of 83°Bx and 43.05% fermentable sugar containing molasses. Molasses wort was divided into 2 Parts (Part A and Part B) in separate beakers. Part A molasses wort was supplemented with 0.1% in Diammonium hydrogen phosphate (DAP) and 0.17 % of urea for the purpose of fermentation analysis in presence of Nutrient. Part B wort was used directly without addition of external nutrient Urea and DAP. Part A wort was distributed equally in 4 round bottom flasks and Part B wort was also divided in the same manner. 3 flasks of Part A molasses wort were inoculated with different yeast strains (FALI, Ethanol Red, CBTPL/HGY007 strain) at a cell count of 40 million cell/ml of molasses wort. Similarly, 3 flasks of Part B molasses wort were inoculated with different yeast strains (FALI, Ethanol Red, CBTPL/HGY007 at a cell count of 40 million cell/ ml of molasses wort. Then, the flasks were kept for fermentation for 46 hrs at 30°C and ethanol was collected after distillation. The fermentation efficiency of each strain was calculated from the obtained ethanol yield as illustrated in the table 2 below and figure 17.
Table 2: High gravity ethanol fermentations of molasses using 80-85°Brix range and 50-60%
TRS range and fermentation by CBTPL/HGY007 strain
Fermentation Efficiency @14% Theoretical Alcohol with/without Nutrition
Without DAP+ Urea With DAP+Urea
HGY007 83.85 90.05
Ethanol Red 63.57 80.71
FALI 73.57 83.07
A comparative graph of CBTPL/HGY007 viable cell count against enhanced molasses °Brix at 40X microscopic magnification aptitude is illustrated in Figure 16. Ratio of degree brix is directly proportional to the sugar ratio and thus, this experiment proves tolerance of CBTPL/HGY007 strain on osmotic stresses generated due to the higher levels of sugars.
Example 5: Molecular characterization of genes responsible for handling stress conditions using gene amplification by polymerase chain reaction of CBTPL/HGY007 and other commercial strains
The SOD-1, ATH-1, TPS-1, SSU-1 and HSF-1 genes are responsible for handling cellular responses to oxidative stress, heat and desiccation. The expression strength of these genes was analysed for CBTPL/HGY007, and other commercial yeast strains.
The method primarily comprises the following steps:
a) Genomic DNA extraction: Genomic DNA extraction of CBTPLHGY007 and other commercial yeast such as Ethanol Red, ADY Pro, ADY M, and a wild yeast was performed using the conventional Phenol: Chloroform: Isopropanol (PCI) method.
b) Reconstitution of primers: Reconstitution of forward and reverse primers using nuclease free (NF) water into the vials of SOD-1, SSU-1, ATH-1, HSF-1 and TPS-1 gene was performed. Centrifugation at 8000 rpm for 30 sec was performed and lOuM of working solution of all the forward and reverse primers was prepared and stored at -
20 °C.
c) Optimization of Annealing temperature using Gradient polymerase chain reaction
(PCR):
A set up of closed 2 mL sterile microcentrifuge tubes (met) for the master mix cocktail and the labelled PCR tubes with the sample ID number was done. The thermal cycler was switched on before setting up the PCR reaction. The master mix cocktail was prepared by using the quantities calculated for the reaction. Reaction mixture for one run was as follows (calculated accordingly for multiple set of reaction): 2.5 ul of 10X buffer, 0.5 ul of 10mm of each dNTP, 0.625 ul of 10 uM forward primer and reverse primer each, 1.5 ul of 25mM MgCb, 0.5 ul of 5U/ ul of Taq DNA Pol and volume makeup 24 ul with nuclease free water. For 25 uL reaction, 24 uL of master cocktail mix was divided into each of the 0.2 mL PCR reaction tubes. 1.0 uL of each sample was transferred into the appropriate tube and in negative control, nuclease free water was added instead of DNA while in positive control, appropriate standard DNA was added. The labelled PCR reaction tubes were kept in the wells of the thermal cycler and the lid of thermal cycler was closed. Saved Gradient PCR for ITS region program was run with the following parameters: Pre-heating at 94°C for 4 minutes, denaturation at
94°C for 30 seconds, annealing at 52-56°C for 30 seconds, extension at 72°C for 60 seconds and repeating the same for 30 cycles. Then, final extension was done at 72°C for 4 minutes and hold at 4°C for infinity. Once the process finished, the DNA sample was run along with negative control, positive control and molecular size standard ladder using agarose gel electrophoresis.
Gene amplification of different regions such as ATH-1, SOD-1, TPS-1, SSU-1 and
HSF-1 in genomic DNA of HGY007, ER, ADY Pro and Fali.
Gene amplification of different regions of the genomic DNA of the mutant strain and
few other strains was performed.
Reaction of a closed 2 mL sterile microcentrifuge tubes (met) for the master mix
cocktail and the labelled PCR tubes with the sample ID number was setup. The thermal
cycler was turned on before setting up the PCR reaction.
The master mix cocktail was prepared by using the quantities calculated for the reaction
as follows: 2.5 ul of 10X buffer, 0.5 ul of lOmM of each dNTP, .625 ul of 10 uM
forward primer (ITS1) and reverse primer (ITS4) each, 1.5 ul of 25mM MgCh, 0.5 ul
of 5U/ ul of Taq DNA Pol and volume makeup 24 ul with nuclease free water.
For 25 uL reaction, 24 uL of master cocktail mix was divided into each of the 0.2 mL
PCR reaction tubes. 1.0 uL of each sample was transferred into the appropriate tube
and in negative control, nuclease free water was added while in positive control,
appropriate standard DNA was added.
The labelled PCR reaction tubes were kept in the wells of the thermal cycler and the lid
of thermal cycler was closed. PCR was run across optimized annealing temperature at
54°C using different reaction mixtures for Super oxidase dismutase-1 (SOD), Trehalose
6 protein-1 (TPS), Acid Trehalose-1 (ATH), Sulphite tolerance-1 (SSU) and Heat shock
transcription factor-1 (HSF) region program: Pre 94°C for 4 minutes, denaturation at
94°C for 30 seconds, annealing at 54°C for 30 seconds, extension at 72°C for 60
seconds. Repeated the same for 30 cycles. Finally, the extension was done at 72°C for
4 minutes and hold at 12°C for infinity. Once the process ended, the DNA sample was
run along with negative control, positive control and molecular size standard ladder
using agarose gel electrophoresis.
The results of said molecular characterisation of the above-mentioned genes in different
yeasts is illustrated in figure 15(a-c).
Example 6: Conversion of yeast mutant CBTPLHGY007 to active dry yeast using Lyophilization
The mutant yeast was converted into an active dry yeast by lyophilization. Freshly grown cell culture (Stationary phase of CBTPLHGY007 achieved with incubation for 9 hrs at 30°C in YPD media) was centrifuged at 8000 rpm for 5 min to harvest cells. The cells were rinsed with 0.85% NaCl twice and the cell harvest was obtained. The initial cell mass was weighed and suspended into 60 mL of molasses media (UV sterilized). The initial yeast cell count was observed. The cells were suspended into prepared 25mL of protectant medium comprising a) 2 % glucose suspension, b) in YEPD suspension, c) in Sucrose (20g/L) suspension. The solution was freezed at 0°C for 3-4 hrs and then started with the freeze-dried method. The cell mass was weighed and mixed with 1.5% of Silicon-dioxide Carbosil (anti-caking Agent). The percentage viability and final yeast cell count (YCC) was observed. The lyophilized HGY yeast was plated onto Nutrient agar (NA) plate to observe the bacterial contamination, if any and plated on YPD for yeast colony identification. The shelf-life of the lyophilized HGY yeast was studied at different point of time interval (0, 2, 7, 15, 30 and 60 days). The lyophilized medium consists of 2% sucrose, founds to be suitable with 100% viability and cell count of 1.7 * 10A10 cells/gm.
Example 7: Characterisation of mutant yeast in comparison to other commercially available yeasts
The mutant yeast strain (CBTPLHGY007) was compared with the commercially available yeast strain (Ethanol Red, ADY M/Fali, ADY Pro) to identify the effect of varying temperature and pH on ethanol production and fermentation efficiency.
The comparison of fermentation efficiency and alcohol yield of HGY007 against commercial strains @13.2% theoretical alcohol at 33°C, pH 4.5 showed substantially higher fermentation efficiency compared to the commercially available strains with >90% FE (Figure 18).
The mutant yeast strain (CBTPLHGY007) was also compared with the commercially available yeast strain (Ethanol Red) to identify the effect of varying temperature and pH on ethanol production and fermentation efficiency.
Application studies with High Gravity Yeast (HGY007) were done using various molasses from different regions. HGY was also compared with commercially available yeasts. As per
the industry standard, the major constraint was to achieve more that 90% fermentation efficiency in the presence of inhibitory components.
Based on the above, the present inventors found that the mutant strain of the present invention is better in every aspect than Ethanol Red. Particularly, the optimum temperature for HGY strain was found to be 33°C & no major change was observed during the pH variations. Further, the highest fermentation efficiency 94% was observed with West region C molasses at 13%) theoretical EtOH, whereas in case of North region C molasses, 84% fermentation efficiency was observed at 12.4% & 13.3 % theoretical EtOH. In case of B molasses from West & North region, 90% fermentation efficiency was observed at 12.5% theoretical EtOH. Thus, the study demonstrated that generated HGY strain can be a potential candidate for both B & C molasses of various regions in comparison to Ethanol red strain.
HGY007 showed substantially higher fermentation efficiency compared to ethanol red (ER) at different temperature, pH and specific gravity conditions. Data in figures 19 (A-L) illustrates that the mutant yeast (HGY007) has great fermentation efficiency and good theoretical alcohol yield under varying stress conditions, compared to commercially available ethanol red yeast.
ADVANTAGES
The present invention offers the following advantages:
1. Mutant yeast strain of the present invention shows tolerance against various types of stresses including but not limited to high sucrose osmotic stress, high tolerance to elevated temperatures, pH, sulphate, sulphite, acetic acid and ethanol (more than 12%).
2. The mutant yeast strain of the present invention has a fermentation efficiency of more than 85%.
3. Mutant yeast strain of the present invention owing to its fermentation efficiency reduces labour cost, water consumption, distillation cost, time and results in high yield of ethanol.
We Claim:
1. A mutant yeast strain wherein the mutant yeast is Meyer ozyma caribbica deposited under accession number MTCC 25437.
2. The mutant yeast as claimed in claim 1, wherein the strain can convert agricultural biomass into ethanol at very high gravity fermentation conditions and high stress conditions.
3. The mutant yeast as claimed in claim 1, wherein the high stress conditions may be selected from a group consisting of high sucrose osmotic stress, elevated temperatures (30°C to 37°C), pH range of 3-6, sulphate, sulphite, acetic acid and ethanol (more than 13%).
4. A method of producing mutant yeast oi Meyer ozyma caribbica spp., wherein the mutant yeast is generated by chemical mutagenesis or recombinant DNA technology.
5. The method as claimed in claim 4, wherein the method comprises:
i. collecting a soil sample and inoculating into Yeast Nitrogen Base (YNB) and 0.02
g/mL chloramphenicol; ii. incubating the inoculate of step (i) for 4 days at a temperature of 28°C, followed by
serial dilution; iii. plating of the culture onto a suitable media followed by incubation at 28°C for 72 hrs; iv. selection of said colonies based upon the morphology and further selection based on
fermentation efficiency on suitable medium; v. final selection of best performing strain from step (iv) and identification through ITS
sequence homology to obtain wild strain of M. caribbica; and vi. performing chemical mutagenesis of the wildM caribbica with a chemical mutagen
selected from N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) N-methyl-N'-nitro-N-
nitrosoguanidine (MNNG) or Diethylsulfate (DES)/ Ethyl Methane Sulfonate (EMS)
to obtain a mutant strain; wherein, said mutant strain is capable of high gravity
fermentation for ethanol production.
6. The method as claimed in claim 5, wherein the chemical mutagenesis comprises the
following steps:
a. inoculating the culture of purified isolated yeast strain grown in MGYP agar
followed by incubation;
b. centrifugating the cultured broth for 10 minutes at 5000 rpm followed by
washing of cells with sterile pH 6.0 phosphate buffer twice;
c. forming a suspension of cells by dilution with pH 6.0 phosphate buffer to obtain
107/mL of cell count;
d. adding 1 ml of MNNG from 10 mg/mL MNNG stock solution to 10 ml cell
suspension of step (c) to obtain 75-150 ug/mL final concentration followed by
addition of 2 drops of acetone for dissolution of MNNG;
e. incubating for 30 minutes with shaking at 150 rpm at 30°C followed by
centrifugation at 5000 rpm for 10 minutes to collect the cells followed by
washing three-five times with sterile normal saline to stop the reaction;
f serial dilution of cells and plating of 0.1 mL of each dilution on Petri plates containing MGYP agar having KC1 at concentration of 200 g/L followed by incubation at 30°C for 2-3 days; and
g. selection and screening of colonies for its suitability for fermentation.
7. The method as claimed in claim 5, wherein said fermentation medium comprises of 1% peptone, 2% yeast extract and 2% sugar xylose or glucose.
8. A method of fermentation for production of ethanol comprising:
i. culturing the mutant yeast strain of Meyerozyma caribbica in a suitable culturing
media; and ii. fermenting the biomass/sugar source with the said mutant yeast strain under
appropriate stress conditions.
9. The method as claimed in claim 8, wherein the fermentation efficiency is greater than 85%.
10. The method as claimed in claim 8 wherein the ethanol yield is between 11-15%.
11. The method as claimed in claim 8, wherein the biomass or sugar source is selected from, but not limited to the group, consisting of wood, rice straw, wheat straw, bagasse, bamboo, stalks, leaves, and cobs of corn, pulp, wastes resulting therefrom for example wastepaper, cane juice/syrup, sugar /molasses/ sources of starch, including rice, corn, wheat, grain, sorghum, barley, and potatoes, sweet sorghum, beet molasses.
12. The mutant yeast strain as claimed in claim 1, as and when used for ethanol production using fermentation under high stress conditions.
| # | Name | Date |
|---|---|---|
| 1 | 202111012972-STATEMENT OF UNDERTAKING (FORM 3) [25-03-2021(online)].pdf | 2021-03-25 |
| 2 | 202111012972-PROVISIONAL SPECIFICATION [25-03-2021(online)].pdf | 2021-03-25 |
| 3 | 202111012972-FORM FOR SMALL ENTITY(FORM-28) [25-03-2021(online)].pdf | 2021-03-25 |
| 4 | 202111012972-FORM FOR SMALL ENTITY [25-03-2021(online)].pdf | 2021-03-25 |
| 5 | 202111012972-FORM 1 [25-03-2021(online)].pdf | 2021-03-25 |
| 6 | 202111012972-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [25-03-2021(online)].pdf | 2021-03-25 |
| 7 | 202111012972-EVIDENCE FOR REGISTRATION UNDER SSI [25-03-2021(online)].pdf | 2021-03-25 |
| 8 | 202111012972-DECLARATION OF INVENTORSHIP (FORM 5) [25-03-2021(online)].pdf | 2021-03-25 |
| 9 | 202111012972-Proof of Right [14-06-2021(online)].pdf | 2021-06-14 |
| 10 | 202111012972-FORM-26 [14-06-2021(online)].pdf | 2021-06-14 |
| 11 | 202111012972-DRAWING [23-03-2022(online)].pdf | 2022-03-23 |
| 12 | 202111012972-CORRESPONDENCE-OTHERS [23-03-2022(online)].pdf | 2022-03-23 |
| 13 | 202111012972-COMPLETE SPECIFICATION [23-03-2022(online)].pdf | 2022-03-23 |
| 14 | 202111012972-Request Letter-Correspondence [22-04-2022(online)].pdf | 2022-04-22 |
| 15 | 202111012972-Covering Letter [22-04-2022(online)].pdf | 2022-04-22 |
| 16 | 202111012972-CERTIFIED COPIES TRANSMISSION TO IB [22-04-2022(online)].pdf | 2022-04-22 |
| 17 | 202111012972-MSME CERTIFICATE [30-03-2023(online)].pdf | 2023-03-30 |
| 18 | 202111012972-FORM28 [30-03-2023(online)].pdf | 2023-03-30 |
| 19 | 202111012972-FORM 18A [30-03-2023(online)].pdf | 2023-03-30 |
| 20 | 202111012972-FER.pdf | 2023-08-01 |
| 21 | 202111012972-FER_SER_REPLY [19-09-2023(online)].pdf | 2023-09-19 |
| 22 | 202111012972-CLAIMS [19-09-2023(online)].pdf | 2023-09-19 |
| 23 | 202111012972-US(14)-HearingNotice-(HearingDate-16-10-2023).pdf | 2023-10-04 |
| 24 | 202111012972-Correspondence to notify the Controller [12-10-2023(online)].pdf | 2023-10-12 |
| 25 | 202111012972-Written submissions and relevant documents [27-10-2023(online)].pdf | 2023-10-27 |
| 26 | 202111012972-PatentCertificate30-10-2023.pdf | 2023-10-30 |
| 27 | 202111012972-IntimationOfGrant30-10-2023.pdf | 2023-10-30 |
| 29 | 202111012972-RELEVANT DOCUMENTS [27-03-2025(online)].pdf | 2025-03-27 |
| 30 | 202111012972-MARKED COPIES OF AMENDEMENTS [27-03-2025(online)].pdf | 2025-03-27 |
| 31 | 202111012972-FORM 13 [27-03-2025(online)].pdf | 2025-03-27 |
| 32 | 202111012972-AMENDED DOCUMENTS [27-03-2025(online)].pdf | 2025-03-27 |
| 1 | PATSEERE_01-08-2023.pdf |