This invention relates to determination of promoter or locus specific DNA adenine methylation levels utilising methylation dependent (DpNI) and sensitive (DpNII) restriction enzymes targeting ‘GATC’ sites and fluorescence based quantitative polymerase chain reaction.
BACKGROUND OF INVENTION
DNA adenine methylation (m6dA) as an epigenetic modification in eukaryotes was initially reported in plants [1-3]. Further the modification was also detected in lower eukaryotes ranging from 0.001 to 0.4 (m6dA/A)[ 4-6]. Reported levels in higher eukaryotes have been shown to be in the range of 0.00001-0.1 (m6dA/A) [7]. DNA adenine methyltransferase 1 (N6AMT1) and AlkB homolog 1, histone H2A dioxygenase (ALKBH1) have been shown to act as writer and eraser of DNA adenine methylation respectively [7]. Functionally m6dA has been shown to regulate gene expression. It was reported that high levels of m6dA in embryonic stem cells leads to gene silencing [8]. Huang and colleagues have reported lower m6dA levels in type 2 diabetes patients possibly due to down regulated expression of Fat mass- and obesity-associated (FTO) gene [9]. Li and colleagues suggested enrichment of m6dA at a downstream site relative to transcription start site on the BDNF-P4 promoter and associated with increased expression [10]. Recently, it was reported that glioblastoma harbours elevated levels of m6dA and targeting m6dA machinery inhibits glioblastoma cells [11]. Moreover identification and determination of m6dA levels at a given locus in eukaryotic DNA is primarily restricted to antibody based enrichment and single restriction enzyme based quantitative PCR assay.
SUMMARY OF INVENTION
This summary is provided to introduce a selection of concepts, in a simplified format, that are further described in the detailed description of the invention.
This summary is neither intended to identify key or essential inventive concepts of the invention and nor is it intended for determining the scope of the invention.
There are two validated hypothesis regarding inheritance, transmittance and site specific inclusion of m6dA. First, multiple authors have suggested that m6dA levels are maintained by N6AMT1 and/or ALKBH1. These levels are maintained within specific sites and play regulatory roles allowing it to be considered as an epigenetic modification [7]. Second according to a new report, the inclusion of m6dA in eukaryotic DNA is due to scavenging and conversion to deoxy-ribose of methylated adenine ribonucleotide by ribonucleotide reductase. Further the report also suggests that the incorporation of these scavenged methylated deoxy-adenine is homogenous and not in specific sites of DNA [12]. Moreover, multiple methods have been reported for identification of genomic m6dA levels such as Dot Blot, single molecule real time sequencing, mass spectrometry and HPLC. However, locus specific determination of m6dA is limited to antibody enrichment and single restriction enzyme supported quantitative PCR which may have limitations in addressing non-specific homogenous incorporation of scavenged m6dA.
Considering both the hypothesis and possible cell to cell variations, we have utilised two restriction enzymes (DpNI and DpNII) which are dependent on status of adenine methylation for their activity. Initially candidate genes such as PDL-1 and CTLA-4 were shortlisted due to presence of restriction sites ‘GATC’ in their promoter region. Experimental design included treatment of MCF-7 and A431 cell line with curcumin (40uM) and hesperidin (167uM) for 48 hrs. Untreated cells served as control. The treated and control cells were harvested for RNA and DNA isolation using Trizol and phenol:choloroform methods respectively. RNA was subjected to cDNA synthesis and subsequent expression analysis of PDL-1 and CTLA-4 gene. The DNA was quantified and equal amount (1ug) was subjected to overnight restriction digestion at 370C each with DpNI and DpNII. Post incubation the digested DNA was purified using phenol:cholorform method. Equal concentration of unrestricted, DpNI and DpNII restricted DNA were utilised in qPCR. The unrestricted DNA served as the normalising control for each treated and untreated sample and fold change were calculated with untreated sample as control/reference/calibrator. Promoter DNA adenine methylation was calculated as the ratio of fold change obtained with DpN II/DpN I. Finally the observed changes in adenine methylation were also found to correlate with changes in PDL-1 and CTLA-4 gene expression.
Discloses herein a kit of determination of promoter or locus specific DNA adenine methylation levels utilising methylation dependent (DpNI) and sensitive (DpNII) restriction enzymes targeting ‘GATC’ sites and fluorescence based quantitative polymerase chain reaction comprises Genomic DNA; which is isolated from MCF-7 and A431 cells post two days treatment with curcumin and hesperidin; and Genomic DNA from untreated MCF-7 and A431 cells served as control; wherein the isolated DNA is quantified using Spectramax microvolume plate in Spectramax iD3 (Molecular Devices) and quality is analysed on 0.8% TAE agarose gel; wherein Programmed death ligand-1 (PDL1) and Cytotoxic T-lymphocyte associated protein 4 (CTLA4) are selected as the candidate genes for investigating the role of DNA promoter adenine methylation in regulation of gene expression; wherein DpNI and DpNII restriction enzyme acts on ‘GATC’ site relative to its adenine methylation status, it is imperative to identify candidate genes harboring these sites in their promoter region so as to enable methylation sensitive restriction-based analysis of DNA methylation in promoter region. PDL-1 and CTLA4 specifically harbors two close GATC sites in promoter region between -2000 to 100 relative to transcription start site (TSS); wherein the locus or promoter or any DNA sequence involves restriction sites ‘GATC’ and both DpNI and DpNII restriction enzymes; and isoschizomers of DpNI and DpNII are involved.
To further clarify advantages and features of the present invention, a more particular description of the invention will be rendered by reference to specific embodiments thereof, which is illustrated in the appended drawings.
It is appreciated that these drawings depict only typical embodiments of the invention and are therefore not to be considered limiting of its scope. The invention will be described and explained with additional specificity and detail with the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
The foregoing detailed description of embodiments is better understood when read in conjunction with the attached drawings. For better understanding, each component is represented by a specific number which is further illustrated as a reference number for the components used with the figures.
Fig 1 (A) Relative quantification and (B) m6dA methylation dependent/sensitive qPCR assay of PDL-1 gene expression and promoter DNA adenine methylation after treatment with curcumin and hesperidin in A431 and MCF-7 cell line. (C) qPCR reaction validation on agarose gel carried out for promoter DNA in PDL-1 gene with input unrestricted DNA and DpNI restricted DNA. (D) qPCR reaction validation on agarose gel carried out for promoter DNA in PDL-1 gene with input unrestricted DNA and DpNII restricted DNA.
Fig 2 (A) Relative quantification and (B) m6dA methylation dependent and sensitive restriction enzyme qPCR assay of CTLA4 gene expression and promoter DNA adenine methylation after treatment with curcumin and hesperidin in A431 and MCF-7 cell line. (C) qPCR reaction validation on agarose gel carried out for promoter DNA in CTLA4 gene with input unrestricted DNA and DpNI restricted DNA. (D) qPCR reaction validation on agarose gel carried out for promoter DNA in CTLA4 gene with input unrestricted DNA and DpNII restricted DNA.
Further, skilled artisans will appreciate that elements in the drawings are illustrated for simplicity and may not have necessarily been drawn to scale. For example, the flow charts illustrate the method in terms of the most prominent steps involved to help to improve understanding of aspects of the present invention. Furthermore, in terms of the construction of the device, one or more components of the device may have been represented in the drawings by conventional symbols, and the drawings may show only those specific details that are pertinent to understanding the embodiments of the present invention so as not to obscure the drawings with details that will be readily apparent to those of ordinary skill in the art having benefit of the description herein.

DETAILED DESCRIPTION OF INVENTION
For the purpose of promoting an understanding of the principles of the invention, reference will now be made to the embodiment illustrated in the drawings and specific language will be used to describe the same.
It will nevertheless be understood that no limitation of the scope of the invention is thereby intended, such alterations and further modifications in the illustrated system, and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skilled in the art to which this invention belongs.
The system, methods, and examples provided herein are illustrative only and not intended to be limiting.
Embodiments of the present invention will be described below in detail with reference to the accompanying drawings.
Treatment of Cell lines
1x106 MCF-7 and A431 cells were treated with curcumin (40 uM) and hesperidin (167uM) for 2 days for promoter adenine methylation and expression analysis through qRT-PCR. Untreated cells were taken as control.
Promoter DNA adenine methylation analysis
Genomic DNA was isolated from MCF-7 and A431 cells post two days treatment with curcumin and hesperidin. Genomic DNA from untreated MCF-7 and A431 cells served as control. The isolated DNA was quantified using Spectramax microvolume plate in Spectramax iD3 (Molecular Devices) and quality was analysed on 0.8% TAE agarose gel.
Candidate gene selection
Programmed death ligand-1 (PDL1) and Cytotoxic T-lymphocyte associated protein 4 (CTLA4) were selected as the candidate genes for investigating the role of DNA promoter adenine methylation in regulation of gene expression. Since DpNI and DpNII restriction enzyme acts on ‘GATC’ site relative to its adenine methylation status, it was imperative to identify candidate genes harboring these sites in their promoter region so as to enable methylation sensitive restriction-based analysis of DNA methylation in promoter region. The ‘GATC’ sites may be located, either proximal or distal to CpG sites. In addition, wherein the minimum number of ‘GATC’ sites under consideration is between one and four. PDL-1 and CTLA4 specifically harbors two close GATC sites in promoter region between -2000 to 100 relative to transcription start site (TSS). Moreover, the sites for PDL-1 are located exclusively upstream to TSS and, in CTLA4 the sites are located downstream to TSS thus providing another difference for analysis between the exclusive promoter (PDL-1) and first exon (CTLA4). The primers for both the gene promoters were designed overlapping their GATC sites (2 in number, for enhanced sensitivity) using Primer 3 and provided in Table 1. In addition to above, wherein the locus or promoter or any DNA sequence involves restriction sites ‘GATC’ and both DpNI and DpNII restriction enzymes or where in isoschizomers of DpNI and DpNII are involved.
Table 1 List of Primers for promoter DNA methylation analysis
S.no Gene Primers Product Size Accession No:
Promoter Region
1 PDL1 Forward:
CCTCAAGAGTCATGATGAACTAGC Reverse:
ACACACACATGTACAACAAGTTTCA 154 bp NM_014143
ENSG00000120217
>FP013056 CD274_1 :+U EU:NC; range
-2000 to 100
2 CTLA4 Forward:
CAAGTGCCTTCTGTGTGTGC Reverse:
AGCGGTGTTCAGGTCTTCAG 151 bp NM_005214
ENSG00000163599
>FP004462 CTLA4_1 :+U EU:NC; range
-499 to 100

Restriction Digestion with DpNI and DpNII
1ug of isolated DNA from each cell line sample and control was subjected to independent DpN I (20units) and DpN II (10units) restriction digestion at 370C overnight incubation. In addition, wherein the source of DNA could be from wild type or recombinant virus, bacteria, plants, animals, human, cell lines, FFPE tissues, in vitro, in vivo and of clinical origin including both invasive or non- invasive procedures. Post incubation the restricted DNA was purified using phenol: chloroform extraction. The purified restricted DNA and input unrestricted DNA was again quantified using Spectramax microvolume plate on SpectraMax ID3 multimode plate reader so as to normalize the DNA concentration to be used in qPCR.
qPCR for estimation of promoter methylation fold change
The relative levels of DNA adenine methylation in the promoter of PDL-1 and CTLA4 gene in genomic DNA isolated from curcumin and hesperidin treated MCF-7 and A431 cells was quantified with respect to their levels in unrestricted input DNA as the endogenous control. Primers information is provided in Table 1. qPCR was carried out using SYBR Green master mix (Roche) with the following thermal cycling conditions: initial denaturation at 950C for 3 min followed with 40 cycles (950C for 15 s, 600C for 40 s followed with acquisition) in Rotor Gene Q thermal cycler (Qiagen). Melting curve analysis was carried out to assess the presence of specific amplicons. Thermal profile included hold at 500C for 1 min, gradient increase of temperature from 50 to 99 0C at an acquisition ramp rate of 0.50C per second. REST 2009 software was used for relative quantification of promoter methylation in fold change with levels of PDL-1 and CTLA4 in unrestricted input DNA as the endogenous control using ??CT method (where relative fold change =2-??CT ) and statistical analysis.
Analysis of promoter DNA adenine methylation
Fold change analysis between DpNI restricted DNA and unrestricted input DNA provides information regarding unmethylated DNA since DpNI shall cleave only the DNA which is methylated at N6 position on adenine within GATC site and not the unmethylated DNA thus the fold change should represent the levels of unmethylated DNA. Similarly fold change analysis between DpN II restricted DNA and unrestricted input DNA provides information regarding methylated DNA due to its preference and sensitivity towards unmethylated DNA. Based on these principles promoter DNA adenine methylation was calculated as the ratio of fold change obtained with DpN II/DpN I. In addition, relative adenine methylation can also be estimated either as methylation ratio or percentage or delta value. Further, absolute quantification is determined or estimated using methylated or unmethylated or internal DNA controls.
Expression analysis at RNA level
Total RNA was isolated from 1x106 untreated, curcumin and hesperidin treated cells of A431 and MCF-7 cell line using TRI reagent (Sigma, USA). cDNA was synthesised using Verso cDNA synthesis kit (Thermo Fischer). The relative mRNA levels of PDL-1 and CTLA-4 gene was quantified with respect to beta actin as the endogenous control. Primers information is provided in Table 2. qRT-PCR was carried out using SYBR Green master mix (Roche) with the following thermal cycling conditions: initial denaturation at 950C for 3 min followed with 40 cycles (950C for 15 s, 600C for 40 s followed with acquisition) in Rotor Gene Q thermal cycler (Qiagen). Melting curve analysis was carried out to assess the presence of specific amplicons and knockout transcript. Thermal profile included hold at 500C for 1 min, gradient increase of temperature from 50 to 99 0C at an acquisition ramp rate of 0.50C per second. REST 2009 software was used for relative quantification of gene transcript abundance using the ??CT method (where relative quantification or RQ=2-??CT) and statistical analysis.
Table 2 List of Primers for expression analysis
S.no Gene Primers Product Size Accession No:
1 ß- actin Forward:
CTTCCAGCAGATGTGGATCA Reverse:
AAAGCCATGCCAATCTCATC 159 bp NM_001101.5
2 PDL1 Forward:
AGCAGATGGAATGAATTTGAAGT Reverse:
TCCAAACTCTGTCCTAGAGCAA 180 bp NM_014143.4
3 CTLA4 Forward:
CAAGTGCCTTCTGTGTGTGC Reverse:
AGCGGTGTTCAGGTCTTCAG 151 bp NM_005214.5

RESULTS
Promoter DNA adenine methylation and expression analysis
PDL1 gene
Effect of treatment with natural compounds such as curcumin and hesperidin on PDL-1 gene promoter DNA adenine methylation was evaluated using m6dA methylation dependent and sensitive restriction enzyme qPCR. In A431 cells DpNII/DpNI methylation ratio of fold change was found to be 0.050 and 43 after treatment with curcumin and hesperidin respectively (Fig 1 B). However in MCF-7 cells the methylation ratio was found to be 0.183 and 0.03 respectively (Fig 1 B). Interestingly, PDL-1 gene expression was observed to be associated with changes in promoter adenine methylation ratio. In A431 cells, curcumin upregulated PDL-1 expression by 2.8 folds and hesperidin treatment led to a downregulation of PDL-1 expression by 0.397 folds (Fig 1 A). Similarly in MCF-7 cells, curcumin downregulated PDL-1 gene expression by 0.5 folds and hesperidin increased expression by 1.9 folds (Fig 1 A) suggesting co-relation between adenine promoter DNA methylation associated gene regulation. Further to establish the robustness and validate the efficiency of this qPCR assay, all the qPCR reaction were checked on agarose gel electrophoresis both for input and restricted DNA with DpNII/DpNI (Fig 1 C and D).
CTLA4 gene
Effect of treatment with natural compounds such as curcumin and hesperidin on CTLA4 gene promoter DNA adenine methylation was evaluated using m6dA methylation dependent and sensitive restriction enzyme qPCR. In A431 cells DpNII/DpNI methylation ratio of fold change was found to be 1.8 and 4.39 after treatment with curcumin and hesperidin respectively (Fig 2 B). However in MCF-7 cells the methylation ratio was found to be 5.85 and 0.01 respectively (Fig 2 B). Interestingly, CTLA4 gene expression was observed to be associated with changes in promoter adenine methylation ratio. In A431 cells, curcumin upregulated expression by 10.9 folds and hesperidin treatment led to a downregulation of CTLA4 expression by 1.9 folds in comparison to curcumin treatment (Fig 2 A). Similarly, in MCF-7 cells, curcumin downregulated CTLA4 gene expression by 0.564 folds and hesperidin did not altered the CTLA4 expression (Fig 2 A) suggesting co-relation between adenine promoter DNA methylation associated gene regulation. Further to establish the robustness and validate the efficiency of this qPCR assay, all the qPCR reaction was checked on agarose gel both for input and restricted DNA with DpNII/DpNI (Fig 2 C and D).
Acknowledgement
Authors/Applicants duly acknowledge the funding support provided by Department of Health Research (DHR), Ministry of Health and Family Welfare, India. Dr. Gaurav Parashar is supported under DHR-YSS scheme (File No.12014/10/2018-HR).
REFERENCES:
1. Ngernprasirtsiri J, Kobayashi H, Akazawa T. DNA methylation as a mechanism of transcriptional regulation in nonphotosynthetic plastids in plant cells. Proc Natl Acad Sci U S A. 1988; 85(13):4750-4.
2. Vanyushin BF, Aleksandrushkina NI, Kirnos MD. N6-methyladenine in mitochondrial DNA of higher plants. FEBS Lett. 1998; 223: 397-399.
3. Kirnos MD, Alexandrushkina NI, Goremykin VV, Kudryashova IB, Vanyushin BF. “Heavy” mitochondrial DNA in higher plants. Biokhimiya Mosc. 1992;57: 1566-1573.
4. Fu Y, Luo GZ, Chen K, Deng X, Yu M, Han D, Hao Z, Liu J, Lu X, Dore LC, Weng X, Ji Q, Mets L, He C. N6-methyldeoxyadenosine marks active transcription start sites in Chlamydomonas. Cell. 2015 ;161(4):879-892.
5. Greer EL, Blanco MA, Gu L, Sendinc E, Liu J, Aristizábal-Corrales D, Hsu CH, Aravind L, He C, Shi Y. DNA Methylation on N6-Adenine in C. elegans. Cell. 2015; 161(4):868-78.
6. Zhang G, Huang H, Liu D, Cheng Y, Liu X, Zhang W, Yin R, Zhang D, Zhang P, Liu J, Li C, Liu B, Luo Y, Zhu Y, Zhang N, He S, He C, Wang H, Chen D. N6-methyladenine DNA modification in Drosophila. Cell. 2015; 161(4):893-906.
7. Parashar NC, Parashar G, Nayyar H, Sandhir R. N6-adenine DNA methylation demystified in eukaryotic genome: From biology to pathology. Biochimie. 2018; 144: 56-62.
8. Wu TP, Wang T, Seetin MG, Lai Y, Zhu S, Lin K, Liu Y, Byrum SD, Mackintosh SG, Zhong M, Tackett A, Wang G, Hon LS, Fang G, Swenberg JA, Xiao AZ. DNA methylation on N(6)-adenine in mammalian embryonic stem cells. Nature. 2016; 532(7599):329-33.
9. Huang W, Xiong J, Yang Y, Liu SM, Yuan BF, Fenga YQ. Determination of DNA adenine methylation in genomes of mammals and plants by liquid chromatography/mass spectrometry. RSC Adv. 2015; 5: 64046.
10. Li X, Zhao Q, Wei W, Lin Q, Magnan C, Emami MR, Wearick-Silva LE, Viola TW, Marshall PR, Yin J, Madugalle SU, Wang Z, Nainar S, Vågbø CB, Leighton LJ, Zajaczkowski EL, Ke K, Grassi-Oliveira R, Bjørås M, Baldi PF, Spitale RC, Bredy TW. The DNA modification N6-methyl-2'-deoxyadenosine (m6dA) drives activity-induced gene expression and is required for fear extinction. Nat Neurosci. 2019; 22(4):534-544.
11. Xie Q, Wu TP, Gimple RC, Li Z, Prager BC, Wu Q, Yu Y, Wang P, Wang Y, Gorkin DU, Zhang C, Dowiak AV, Lin K, Zeng C, Sui Y, Kim LJY, Miller TE, Jiang L, Lee CH, Huang Z, Fang X, Zhai K, Mack SC, Sander M, Bao S, Kerstetter-Fogle AE, Sloan AE, Xiao AZ, Rich JN. N6-methyladenine DNA Modification in Glioblastoma. Cell. 2018; 175(5):1228-1243.
12. Musheev MU, Baumgärtner A, Krebs L, Niehrs C. The origin of genomic N6-methyl-deoxyadenosine in mammalian cells. Nat Chem Biol. 2020; 16(6):630-634.

We Claim:

1. A kit of determination of promoter or locus specific DNA adenine methylation levels utilising methylation dependent (DpNI) and sensitive (DpNII) restriction enzymes targeting ‘GATC’ sites and fluorescence based quantitative polymerase chain reaction comprises Genomic DNA; which is isolated from MCF-7 and A431 cells post two days treatment with curcumin and hesperidin; and Genomic DNA from untreated MCF-7 and A431 cells served as control;
wherein the isolated DNA is quantified using Spectramax microvolume plate in Spectramax iD3 (Molecular Devices) and quality is analysed on 0.8% TAE agarose gel;
wherein Programmed death ligand-1 (PDL1) and Cytotoxic T-lymphocyte associated protein 4 (CTLA4) are selected as the candidate genes for investigating the role of DNA promoter adenine methylation in regulation of gene expression;
wherein DpNI and DpNII restriction enzyme acts on ‘GATC’ site relative to its adenine methylation status, it is imperative to identify candidate genes harboring these sites in their promoter region so as to enable methylation sensitive restriction-based analysis of DNA methylation in promoter region. PDL-1 and CTLA4 specifically harbors two close GATC sites in promoter region between -2000 to 100 relative to transcription start site (TSS);
wherein the locus or promoter or any DNA sequence involves restriction sites ‘GATC’ and both DpNI and DpNII restriction enzymes; and isoschizomers of DpNI and DpNII are involved.

2. The kit as claimed in claim 1, wherein the sites for PDL-1 are located exclusively upstream to TSS and, in CTLA4 the sites are located downstream to TSS thus providing another difference for analysis between the exclusive promoter (PDL-1) and first exon (CTLA4); wherein the primers for both the gene promoters are designed overlapping their GATC sites (2 in number, for enhanced sensitivity) using Primer 3.
3. The kit as claimed in claim 1, wherein 1ug of isolated DNA from each cell line sample and control was subjected to independent DpN I (20units) and DpN II (10units) restriction digestion at 370C overnight incubation; and post incubation the restricted DNA is purified using phenol: chloroform extraction; and the purified restricted DNA and input unrestricted DNA is again quantified using Spectramax microvolume plate on SpectraMax ID3 multimode plate reader so as to normalize the DNA concentration to be used in qPCR.
4. The kit as claimed in claim 1, wherein the relative levels of DNA adenine methylation in the promoter of PDL-1 and CTLA4 gene in genomic DNA isolated from curcumin and hesperidin treated MCF-7 and A431 cells is quantified with respect to their levels in unrestricted input DNA as the endogenous control.
5. The kit as claimed in claim 1, wherein qPCR was carried out using SYBR Green master mix (Roche) with the thermal cycling conditions: initial denaturation at 950C for 3 min followed with 40 cycles (950C for 15 s, 600C for 40 s followed with acquisition) in Rotor Gene Q thermal cycler (Qiagen); and thermal profile included hold at 500C for 1 min, gradient increase of temperature from 50 to 99 0C at an acquisition ramp rate of 0.50C per second; wherein a software is used for relative quantification of promoter methylation in fold change with levels of PDL-1 and CTLA4 in unrestricted input DNA as the endogenous control using ??CT method (where relative fold change =2-??CT ) and statistical analysis.
6. The kit as claimed in claim 1, wherein fold change analysis between DpNI restricted DNA and unrestricted input DNA provides information regarding unmethylated DNA since DpNI shall cleave only the DNA which is methylated at N6 position on adenine within GATC site and not the unmethylated DNA thus the fold change should represent the levels of unmethylated DNA; and fold change analysis between DpN II restricted DNA and unrestricted input DNA provides information regarding methylated DNA due to its preference and sensitivity towards unmethylated DNA; and promoter DNA adenine methylation is calculated as the ratio of fold change obtained with DpN II/DpN I;
wherein relative adenine methylation is estimated either as methylation ratio or percentage or delta value; and absolute quantification is determined or estimated using methylated or unmethylated or internal DNA controls.
7. The kit as claimed in claim 1, wherein total RNA is isolated from 1x106 untreated, curcumin and hesperidin treated cells of A431 and MCF-7 cell line using TRI reagent; and cDNA is synthesised using Verso cDNA synthesis kit; and the relative mRNA levels of PDL-1 and CTLA-4 gene is quantified with respect to beta actin as the endogenous control.
8. The kit as claimed in claim 1, wherein qRT-PCR is carried out using SYBR Green master mix with the following thermal cycling conditions: initial denaturation at 950C for 3 min followed with 40 cycles (950C for 15 s, 600C for 40 s followed with acquisition) in Rotor Gene Q thermal cycler; Melting curve analysis is carried out to assess the presence of specific amplicons and knockout transcript; thermal profile included hold at 500C for 1 min, gradient increase of temperature from 50 to 99 0C at an acquisition ramp rate of 0.50C per second; and a software is used for relative quantification of gene transcript abundance using the ??CT method (where relative quantification or RQ=2-??CT) and statistical analysis.
9. The kit as claimed in claim 1-8, wherein all the primer and/or probe sequences reported in this investigation:
Primers for promoter DNA methylation analysis
PDL1 Forward: 5’-CCTCAAGAGTCATGATGAACTAGC-3’
PDL1 Reverse: 5’- ACACACACATGTACAACAAGTTTCA-3’
CTLA4 Forward: 5’- CAAGTGCCTTCTGTGTGTGC-3’
CTLA4 Reverse: 5’- AGCGGTGTTCAGGTCTTCAG-3’
Primers for expression analysis
ß- actin Forward: 5’-CTTCCAGCAGATGTGGATCA-3’
ß- actin Reverse: 5’-AAAGCCATGCCAATCTCATC-3’
PDL1 Forward: 5’- AGCAGATGGAATGAATTTGAAGT-3’
PDL1 Reverse: 5’- TCCAAACTCTGTCCTAGAGCAA-3’
CTLA4 Forward: 5’- CAAGTGCCTTCTGTGTGTGC-3’
CTLA4 Reverse: 5’-AGCGGTGTTCAGGTCTTCAG-3’
Wherein all above sequences if are used in full or partial, including if labeled with fluorescent, luminescent, nanoparticles, biotin, colorimetric tags or any possible attachment compatible with nucleic acids for theranostics applications; and wherein the ‘GATC’ sites are located, either proximal or distal to CpG sites; wherein the minimum number of ‘GATC’ sites under consideration is between one and four.
10. The kit as claimed in claim 1-9, wherein the source of DNA is from wild type or recombinant virus, bacteria, plants, animals, human, cell lines, FFPE tissues, in vitro, in vivo and of clinical origin including both invasive or non- invasive procedures.