Sign In to Follow Application
View All Documents & Correspondence

Nanoengineered Vegf C Molecule Formulation For Cirrhosis And Portal Hypertension

Abstract: The proposed disclosure presents an immuno-nano engineered VEGF-C (E-VEGF-C) molecule 100 which comprises a vegfr3 antibody 102 linked with a VEGF-C plasmid 101, a hydrophobic stearyl chloride shell 103 anchored with the vegfr3 102 to trigger a disease site anda stealthing agent 105. The hydrophobic stearoyl chloride acquired is approximately 225 micro liters of coumarin-6 labelled staroyl chlorideis 104 anchored with the vegfr3 ligand. This invention aims to design, develop, and evaluate the effects of nano-engineered vascular endothelial growth factor-c also called E-VEGF-C 100, a lymphangiogenic factor, as a therapy for the decompensated cirrhosis. The size, safety, and specificity of E-VEGF-C 100 are characterized which is done by using experimental studies, cirrhosis with ascites is induced in rats by intraperitoneal injection of CCL4 for 11 weeks. E-VEGF-C 100 is given orally after 11 weeks to the CCL4-V rats. The CCL4-V rats were given lipid nanocarriers alone (vehicle).

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
12 November 2020
Publication Number
02/2022
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
hima@novelpatent.com
Parent Application

Applicants

Institute of liver and biliary sciences
D1, ILBS Road, Vasant kunj, New Delhi, India-110070.
National institute of pharmaceutical education and research
Changsari, Kamrup, Assam, India-781101.

Inventors

1. Dr.Savneet Kaur
D1, ILBS Road, Vasant kunj, New Delhi, India-110070.
2. Dr.Dinesh M Tripathi
D1, ILBS Road, Vasant kunj, New Delhi, India-110070.
3. Dr.VGM Naidu
Changsari, Kamrup, Assam, India-781101.
4. Dr.Subham Banerjee
Changsari, Kamrup, Assam, India-781101.

Claims

1. A method for formulation of an immuno-nano engineered VEGF-C molecule, comprising: encapsulating a VEGF-C plasmid molecule inside a core of hydrophilic soya phosphatidyl choline (SPC); adding the VEGF-C encapsulated SPC core into outersell of a hydrophobic stearoyl chloride under magnetic stirring at 1500 rpm for 15 min to prepare a primary emulsion; transferring the primary emulsion into a secondary cold aqueous phase containing 0.15% w/v of a polyethylene glycol 2000 solution to obtain a VEGF-C engineered stealth lipo-nanocarriers dispersion, and incubating the VEGF-C engineered stealth lipo-nanocarriers dispersion in a vegfr3 antibody ligand for 24 hours at 4°C temperature to obtain the immuno-nano engineered VEGF-C (E-VEGF-C) for a targeted gut lymphatic vessel delivery.

2. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said method for formulation of an immuno-nano engineered VEGF-C molecule is a cold high shear homogenization technique using a digital high sher homogenizer.

3. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said VEGF-C plasmid molecule precisely encapsulated inside the core of soya phosphatidyl choline at weight ratio of 1:6.

4. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said hydrophilic soya phosphatidyl choline is acquired of 2% w/w in tween 80 containing aqueous solution.

5. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said hydrophobic stearoyl chloride acquired is approximately 225 micro liters of coumarin-6 labelled staroyl chloride.

6. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein the primary emulsion is into the secondary cold aqueous phase under ice-bath condition with high shear homogenization technique at 10,000?rpm for 3 to 5?minutes to make the VEGF-C engineered stealth lipo-nanocarriers dispersion.

7. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein the obtained VEGF-C engineered stealth lipo-nanocarriers dispersion is kept at 4°C for further analysis before incubating with the vegfr3 antibody ligand.

8. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein the incubation of the VEGF-C engineered stealth lipo-nanocarriers dispersion in the vegfr3 antibody ligand is carried out in 50 ng/µL.

9. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said nano-engineered VEGF-C is developed as a therapeutic molecule to improve the development of mesenteric lymphatic vessels and reduce portal pressures in liver cirrhosis.

10. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said linking of the vegfr3 ligand to the VEGF-C plasmid molecule is done with improved physical stability of the particles to specifically achieve delivery of VEGFC only in vegfr3-positive gut lymphatic vessels.

Specification

The present disclosure generally relates to molecular compositions of VEGF-C, and in specific relates to nano-engineered VEGF-C drug and potential therapy for decompensated liver cirrhosis and portal hypertension.
Background of the invention
[0002] Portal hypertension is both cause and effect of progressive chronic liver disease (CLD) and systemic inflammation. Reduced blood supply to the liver causes marked liver anatomical changes, micro- and macrovascular remodeling, neoangiogenesis, and nodule formation. The development of portosystemic shunts due to portal hypertension is termed as cirrhosis. Cirrhosis may be further associated with the presence of clinical complications including ascites or presence of abdominal fluid, bleeding from gastroesophageal varices, bacterial infections, etc.

[0003] The changes in gut microbiota increased intestinal permeability, and endotoxemia is known to play a key role in the development of a chronic low-grade systemic inflammatory state in the host that contributes to the progression and severity of portal hypertension and CLD. The gut lymphatic system would be severely impacted by an unhealthy gut, dysbiosis, and permeability and raised portal pressures and hence plays a central role in mediating systemic inflammation, CLD progression, and ascites or edema formation. However, the significance of the intestinal/mesenteric lymphatic system in modulating systemic inflammation, fluid imbalance, and portal pressures in these diseases remains largely unexplored.

[0004] In general, VEGF-C guides gut lymphangiogenesis via binding to its tyrosine kinase receptor. Previous studies have revealed that transgenic or virus-mediated delivery of VEGF-C substantially attenuates chronic skin inflammation, rheumatoid arthritis, and inflammatory bowel disease in experimental mouse models.

[0005] Research conducted till now relates to a fusion protein comprising an antibody molecule, or antigen-binding fragment thereof, and a member of the vascular endothelial growth factor family, such as VEGF-C or VEGF- D. However, this study did not report a nano-engineered approach for a sustained release of VEGF-C as well. Pyrazinamide liposomes caused a significant reduction in bacterial counts (colony-forming unit’s/g lung), 10, 20, and 30 days after the last treatment dose. However, no study has yet reported the liposomal formulation of VEGF-C molecule for lymphatic vessel-specific delivery.

[0006] Currently, no specific treatment exists for treating portal hypertension and end-stage cirrhosis. Medications such as non-selective beta-blockers or nitrates are prescribed to lower the pressure in the portal vein and treat the complications of portal hypertension such as varices and bleeding. The major drawback of using non-selective beta-blockers is that they are not specific to the liver and exert systemic side effects. Other options are surgery-based which has their limitations and risks.

[0007] However, there are no studies done that have explored pro-lymphangiogenic factors as therapeutic molecules for the repair and correction of gut or and mesenteric lymphatic drainage in decompensated liver cirrhosis. Also, the short half-life and systemic side effects of VEGF-C are some of the major hurdles that have limited its applications in the clinical arena.

[0008] Therefore, there exists a need for the VEGF-C molecule formulation that focuses on the gut lymphatic vessels and has maximum efficacy and negligible side effects on the gut lymphatic vessels. There is a need for a VEGF-C molecule formulation that has immense potential to reduce ascites and portal pressures in patients with liver cirrhosis. There is a need for a novel drug therapy in patients with end-stage liver diseases, portal hypertension, and cirrhosis.
Objectives of the invention:
[0009] The primary objective of the invention is to formulate a nano-engineered VEGF-C drug for cirrhosis and portal hypertension.
[0010] The other objective of the invention is to provide a nanoengineered composition of a VEGF-C encapsulated immunolipocarriers for achieving sustained release of VEGF-C molecule only in the lymphatic vessels.

[0011] Another objective of the invention is to provide a nano-engineered composition of VEGF-C linked with a vegfr3 antibody to specifically achieve delivery of VEGF-C only in vegfr3-positive gut lymphatic vessels.

[0012] Another objective of the invention to provide a nano-engineered VEGF-C as novel drug therapy in patients with end-stage liver diseases, portal hypertension, and cirrhosis.

[0013] Another objective of the invention is to have immense potential to reduce ascites and portal pressures in patients with liver cirrhosis.

[0014] Yet another objective of the invention is to target specific to gut lymphatic vessels with maximum efficacy and negligible side effects.
Summary of the invention:
[0015] The present disclosure proposes a nanoengineered VEGF-C molecule formulation for cirrhosis and portal hypertension. The following presents a simplified summary in order to provide a basic understanding of some aspects of the claimed subject matter. This summary is not an extensive overview. It is not intended to identify key/critical elements or to delineate the scope of the claimed subject matter. Its sole purpose is to present some concepts in a simplified form as a prelude to the more detailed description that is presented later.

[0016] In order to overcome the above deficiencies of the prior art, the present disclosure is to solve the problem by providing an immuno-nano engineered VEGF-C molecule. A nano-engineered VEGF-C drug and potential therapy for decompensated liver cirrhosis and portal hypertension.

[0017] According to an aspect of the invention, a method for the formulation of an immuno-nano engineered VEGF-C molecule comprises, a VEGF-C- plasmid molecule is encapsulated inside a core of hydrophilic soya phosphatidyl choline (SPC) at weight ratio of 1:6. Next, the VEGF-C encapsulated SPC core is added into outersell of a hydrophobic stearoyl chloride under magnetic stirring at 1500 rpm for 15 min to prepare a primary emulsion.

[0018] Later, the primary emulsion is transferred into a secondary cold aqueous phase containing 0.15% w/v of a polyethylene glycol 2000 solution to obtain VEGF-C engineered stealth lipo-nanocarrier dispersion. Finally, the VEGF-C engineered stealth lipo-nanocarriers dispersion is incubated in a vegfr-3 antibody ligand for 24 hours at 4°C temperature to obtain the immuno-nano engineered VEGF-C (E-VEGF-C) for a targeted gut lymphatic vessel delivery.

[0019] The method for formulation of an immuno-nano engineered VEGF-C molecule is a cold high shear homogenisation technique using a digital high sher homogenizer. The hydrophilic soya phosphatidyl choline acquired is of 2% w/w in tween 80 containing aqueous solution.

[0020] The hydrophobic stearoyl chloride acquired is of approximately 225 micro liters of coumarin-6 labelled stearoyl chloride. The primary emulsion is transferred into the secondary cold aqueous phase under a ice-bath condition with the high shear homogenization technique at 10,000?rpm for 3 to 5?minutes to make the VEGF-C engineered stealth lipo-nanocarriers dispersion.

[0021] The obtained VEGF-C engineered stealth lipo-nanocarriers dispersion is kept at 4°C for further analysis before incubating the VEGF-C engineered stealth lipo-nanocarriers dispersion with the vegfr3 antibody ligand and this incubation is carried out in 50 ng/µL of a buffer.

[0022] According to another aspect of the invention, the nano-engineered VEGF-C is developed as a therapeutic molecule to improve the development of mesenteric lymphatic vessels and reduce portal pressures in liver cirrhosis.

[0023] Further, objects and advantages of the present invention will be apparent from a study of the following portion of the specification, the claims, and the attached drawings.
Detailed description of drawings:
[0024] The accompanying drawings, which are incorporated in and constitute a part of the specification, illustrate an embodiment of the invention, and, together with the description, explain the principles of the invention.

[0025] FIG. 1 illustrates an immuno-nano engineered VEGF-C (E-VEGF-C) molecule in accordance to an embodiment of the invention.

[0026] FIG. 2 illustrates a design process of proposed E-VEGF-C molecule in accordance to an embodiment of the invention.

[0027] FIG. 3 illustrates chief processing steps of E-VEGF-C application in accordance to an embodiment of the invention.

[0028] FIG. 4 illustrates E- VEGF-C tested in a preclinical model of cirrhosis and portal hypertension in accordance to an embodiment of the invention.

[0029] FIG. 5 illustrates a gut lymphatic restoration in animal models in accordance to an embodiment of the invention.
Detailed invention disclosure:
[0030] Various exemplary embodiments of the present disclosure will be described in reference to the accompanying drawings. Wherever possible, same or similar reference numerals are used in the drawings and the description to refer to the same or like parts or steps.

[0031] Disclosed herein is a nanoengineered composition of VEGF-C linked with a vegfr3 antibody to specifically achieve delivery of VEGF-C only in vegfr3-positive gut lymphatic vessels. A nano-engineered VEGF-C drug and potential therapy for decompensated liver cirrhosis and portal hypertension.

[0032] According to an exemplary embodiment, FIG. 1 illustrates an immuno-nano engineered VEGF-C (E-VEGF-C) molecule 100 which comprises a vegfr3 antibody 102 linked with a VEGF-C plasmid molecule 101, a hydrophobic stearyl chloride shell 103 anchored with the vegfr3 102 to trigger a disease site anda stealthing agent 105. The hydrophobic stearoyl chloride acquired is approximately 225 micro liters of coumarin-6 labelled staroyl chloride 104 anchored with the vegfr3 ligand.

[0033] According to an exemplary embodiment, the E-VEGF-C 100 is encapsulated in immuno lipid carriers for achieving sustained release of VEGF-C only in the lymphatic vessels. The hydrophobic stearyl chloride shell 103 anchored with vegfr3 102 for active triggering to the disease site. The hydrophobic stearoyl chloride acquired is approximately 225 micro liters of coumarin-6 labelled staroyl chloride. The VEGF-C plasmid molecule 101 is encapsulated inside the core of a hydrophilic soya phosphatidyl choline (SPC) at weight ratio of 1:6. This entire assembly is embedded inside the SC shell to form core-shell nano-architectonics.

[0034] According to an exemplary embodiment, FIG. 2 illustrates a design process 200 of the E-VEGF-C molecule 100 which comprises steps from 201 to 204. In step 201, the VEGF-C plasmid molecule is encapsulated inside the core of the hydrophilic soya phosphatidyl choline (SPC) at weight ratio of 1:6. In step 202, the VEGF-C encapsulated SPC core is added into outershell of the hydrophobic stearoyl chloride under the magnetic stirring at 1500 rpm for 15 minutes to prepare a primary emulsion.

[0035] In step 203, the primary emulsion is transferred into a secondary cold aqueous phase containing 0.15% w/v of a polyethylene glycol 2000 solution to obtain VEGF-C engineered stealth lipo-nanocarriers dispersion. In step 204, the VEGF-C engineered stealth lipo-nanocarriers dispersion is incubated in the vegfr3 antibody ligand for 24 hours at 4°C temperature to obtain the E-VEGF-C 100.

[0036] For instance, Table 1 shows the features of the E- VEGF-C molecule 100.

[0037] Table 1:
Engineering parameters Desired optimum values/features
Size <200 nm
Dispersity Mono
Shape Appeared to be Spherical
Compositions Solid lipids
Surface charge Depends on ligand anchoring
Texture Hard and non-porous particles
Solubility Hydrophobic particles
Surface ligand VEGF-R3 Antibody
Nano-Shell Solid, hard and hydrophobic nanostructured lipid shell
Nano-core Soft and porous aqueous shell containing VEGF-C

[0038] According to another exemplary embodiment, FIG. 3 illustrates chief processing steps 300 of the E-VEGF-C 100 application. In step 301, the E-VEGF-C 100 with serum is injected for a half-life of 10 hours in healthy control rats, where the VEGF-C 100 molecule is administered through the oral route at a single dose of 300 µg/kg. In step 302, no sign of toxicity is noticed for one week in the healthy control rats.

[0039] In step 303, the E-VEGF-C 100 is administered in carbon tetrachloride (CCl4) cirrhotic rats, which is achieved after 11 weeks of CCl4 treatment to the rats.

[0040] For instance, Table 2 shows forward primer and reverse primer.

[0041] Table 2:
Gene Forward primer Reverse primer
bFGF CCAGTTGGTATGTGGCATG CAGGGAAGGGTTTGACAAGA
iNOS ACC TAC TTC CTG GAC ATC AC ACC CCA ACA CCA AGG TCA TG
eNOS TGACCCTCACCGATACAACA CGGGTGTCTAGATCCATGC
COX2 CTG TAT CCC GCC CTG CTG GTG ACT TGC GTT GAT GGT GGC TGT CTT
CCL21 GGGACTGAACAGACAGACTCCAAG GGTTGAAGCAGACAAGGGTGTG

[0042] For instance, Table 3 shows an antibody panel.

[0043] Table 3:
Antibody Antibody source Catalogue/clone Fluorochrome Application Dilution
Vegfr3 (host: rabbit) Elabsciences E-AB-14188 Unconjugated Used for human IHC and for rat IF 1:100
Goat Anti-rabbit IgG PE Santa Cruz Sc-3739 PE Used for rat IF with vegfr3 1:500
CD31 Pathnsitu EP78 Unconjugated Used for both human and mouse IHC Ready to use
Ki67 (host mouse) Elabsciences E-AB-22027 Unconjugated Used for rat IF 1:200
Goat Anti-mouse FITC Merck-Millipore AP308F FITC Used for rat IF with Ki67 1:500

[0044] FIG. 4 illustrates the E-VEGF-C 100 tested in a preclinical model (rats) of cirrhosis and portal hypertension, which shows the highest levels in the mesenteric and duodenal tissues in comparison to the healthy controls rats after 2 hours, where the E-VEGF-C 100 molecule is administered at a single dose of 300 µg/kg via the oral route.

[0045] The E-VEGF-C 100 is when administered in CCl4 cirrhotic rats also called as E-VEGF-C rats, show increased numbers of vegfr3+ lymphatic channels in the mesenteric tissues in comparison to the healthy control rats and cirrhotic vehicle rats treated with lipid nano-carriers alone (CCl4-V rats) after 48 hours of the last dose, where the E-VEGF-C 100 molecule is administered at a dose of 300 µg/kg in 3 doses via the oral route.

[0046] The E-VEGF-C 100 is when administered in CCl4 cirrhotic rats causing a significant increase in the number of proliferating vegfr3+ lymphatic vessels in the mesentery in the E-VEGF-C treated rats as compared to that observed in the CCl4-V or control rats as indicated by an increase in the number of dual positive vegfr3+Ki67+ vessels.

[0047] The E-VEGF-C 100 when administered in CCl4 cirrhotic rats leads to a significant increase inflorescence of a lymphatic tracer dye, bodipy as compared to that seen in the vehicle rats. The E-VEGF-C 100 did not lead to an increase in the number of CD31-positive blood vessels in vehicle and E-VEGF-C rats and lead to a considerable reduction in the inflammatory cells in mesenteric tissues in comparison to that present in the CCl4-V rats.

[0048] FIG. 5 shows gut lymphatic restoration in animal models, the E-VEGF-C 100 leads to a marked reduction in the ascites volume of E-VEGF-C treated rats as compared to that observed in CCl4-V treated rats. It was clearly evident in CT scan slices of the two groups and significantly attenuates the portal pressure in E-VEGF-C treated rats as compared to the vehicle-treated rats.

[0049] The E-VEGF-C 100 significantly decreases the portal blood flow and increases the mean arterial pressure of E-VEGF-C treated rats as compared to the vehicle-treated rats.

[0050] The E-VEGF-C 100 did not cause any change in the intrahepatic resistance in the E-VEGF-C treated rats in comparison to that seen in CCl4-V rats. The E-VEGF-C 100 leads to only minimal change in liver fibrosis, where the E-VEGF-C treated rats mostly show Ishak's fibrosis score 4-5/6 which is incomplete cirrhosis. While, vehicle rats show Ishak's fibrosis score 6/6 or severe cirrhosis (thick fibrous septa or many minute nodules).

[0051] The E-VEGF-C 100 leads to a marked increase in the expression of the chemokine, CCL21 in E-VEGF-C treated rats in comparison to that seen in CCl4-V rats. The E-VEGF-C 100 leads to a decrease in the expression of iNOS, eNOS, COX2, and bFGF in E-VEGF-C treated rats in comparison to that seen in CCl4- V rats, where the VEGF-C 100 molecule is administered at a dose of 300 µg/kg (in 3 doses) via the oral route.

[0052] Further, the E-VEGF-C 100 is linked with vegfr3 antibody 102 to specifically achieve delivery of E-VEGF-C 100 only in the vegfr3-positive gut lymphatic vessels. The E-VEGF-C 100 is designed, develops, and evaluates the effects of nano-engineered vascular endothelial growth factor-c (E-VEGF-C) 100, a lymphangiogenic factor, as a therapy for decompensated cirrhosis. Human VEGF-C plasmid was encapsulated with vegfr3 102 antibody-tagged nano-carriers to formulate E-VEGF-C molecule 100.

[0053] The size, safety, and specificity of E-VEGF-C 100 were also characterized. This is done using experimental studies. The cirrhosis with ascites was induced in rats by intraperitoneal injection of CCl4 for 11 weeks. The E-VEGF-C 100 was given orally after 11 weeks. CCL4-V rats were given lipid nano-carriers alone (vehicle). Mesenteric lymphatic vessel number and drainage were studied.

[0054] Abdominal ascites is observed by CT-scans. Hepatic and systemic hemodynamic is measured. The liver, mesentery, and plasma were analyzed by RT-PCRs, immuno (fluoro) histochemistry, and immunoassays. E-VEGF-C 100 exhibited a size of <200nm and zeta potential of 6mV. It is safe, depicted biphasic absorption with the plasma half-life of 10h. In comparison to CCl4-V, E-VEGF-C treated rats showed a marked increase in Ki67+ lymphatic vessels and lymphatic drainage in mesentery as evidenced by decreased fluorescence of the lymphatic tracer, bodipy. Ascitic fluid volume and portal pressures were significantly reduced in E-VEGF-C treated rats as compared to CCl4-V rats.

[0055] In comparison to the CCl4-V treated rats, the E-VEGF-C treated rats show a marked increase in the expression of the chemokine, CCL21. The results show that VEGF r3+ gut lymphatic vessels are dilated in patients with ascites. E-VEGF-C molecule 100 helps in a sustained and targeted gut lymphatic vessel proliferation and may serve as an innovative approach to enhance lymphatic drainage and manage ascites in decompensated cirrhosis.

[0056] Further, the nano-engineered composition of VEGF-C 100 highly target and specific to gut lymphatic vessels, thus having maximum efficacy and negligible side effects and it has immense potential to reduce ascites and portal pressures in patients with liver cirrhosis. The nano-engineered composition of VEGF-C 100 has high applicability as novel drug therapy in patients with end-stage liver diseases, portal hypertension, and cirrhosis.

[0057] It will readily be apparent that numerous modifications and alterations can be made to the processes described in the foregoing examples without departing from the principles underlying the invention, and all such modifications and alterations are intended to be embraced by this application.

CLAIMS:

I / We Claim:

1. A method for formulation of an immuno-nano engineered VEGF-C molecule, comprising:
encapsulating a VEGF-C plasmid molecule inside a core of hydrophilic soya phosphatidyl choline (SPC);
adding the VEGF-C encapsulated SPC core into outersell of a hydrophobic stearoyl chloride under magnetic stirring at 1500 rpm for 15 min to prepare a primary emulsion;
transferring the primary emulsion into a secondary cold aqueous phase containing 0.15% w/v of a polyethylene glycol 2000 solution to obtain a VEGF-C engineered stealth lipo-nanocarriers dispersion, and
incubating the VEGF-C engineered stealth lipo-nanocarriers dispersion in a vegfr3 antibody ligand for 24 hours at 4°C temperature to obtain the immuno-nano engineered VEGF-C (E-VEGF-C) for a targeted gut lymphatic vessel delivery.
2. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said method for formulation of an immuno-nano engineered VEGF-C molecule is a cold high shear homogenization technique using a digital high sher homogenizer.
3. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said VEGF-C plasmid molecule precisely encapsulated inside the core of soya phosphatidyl choline at weight ratio of 1:6.
4. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said hydrophilic soya phosphatidyl choline is acquired of 2% w/w in tween 80 containing aqueous solution.
5. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said hydrophobic stearoyl chloride acquired is approximately 225 micro liters of coumarin-6 labelled staroyl chloride.
6. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein the primary emulsion is into the secondary cold aqueous phase under ice-bath condition with high shear homogenization technique at 10,000?rpm for 3 to 5?minutes to make the VEGF-C engineered stealth lipo-nanocarriers dispersion.
7. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein the obtained VEGF-C engineered stealth lipo-nanocarriers dispersion is kept at 4°C for further analysis before incubating with the vegfr3 antibody ligand.
8. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein the incubation of the VEGF-C engineered stealth lipo-nanocarriers dispersion in the vegfr3 antibody ligand is carried out in 50 ng/µL.
9. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said nano-engineered VEGF-C is developed as a therapeutic molecule to improve the development of mesenteric lymphatic vessels and reduce portal pressures in liver cirrhosis.
10. The method for formulation of an immuno-nano engineered VEGF-C molecule as recited in claim 1, wherein said linking of the vegfr3 ligand to the VEGF-C plasmid molecule is done with improved physical stability of the particles to specifically achieve delivery of VEGFC only in vegfr3-positive gut lymphatic vessels.

Documents

Application Documents

# Name Date
1 202011049544-STATEMENT OF UNDERTAKING (FORM 3) [12-11-2020(online)].pdf 2020-11-12
2 202011049544-POWER OF AUTHORITY [12-11-2020(online)].pdf 2020-11-12
3 202011049544-FORM 1 [12-11-2020(online)].pdf 2020-11-12
4 202011049544-DRAWINGS [12-11-2020(online)].pdf 2020-11-12
5 202011049544-DECLARATION OF INVENTORSHIP (FORM 5) [12-11-2020(online)].pdf 2020-11-12
6 202011049544-COMPLETE SPECIFICATION [12-11-2020(online)].pdf 2020-11-12
7 202011049544-Power of Attorney-011220.pdf 2021-10-19
8 202011049544-OTHERS-011220.pdf 2021-10-19
9 202011049544-Form 5-011220.pdf 2021-10-19
10 202011049544-Form 3-011220.pdf 2021-10-19
11 202011049544-FORM-9 [12-01-2022(online)].pdf 2022-01-12
12 202011049544-FORM 18 [27-06-2022(online)].pdf 2022-06-27
13 202011049544-FER.pdf 2023-08-21
14 202011049544-Proof of Right [06-12-2023(online)].pdf 2023-12-06
15 202011049544-OTHERS [06-12-2023(online)].pdf 2023-12-06
16 202011049544-FORM 3 [06-12-2023(online)].pdf 2023-12-06
17 202011049544-FER_SER_REPLY [06-12-2023(online)].pdf 2023-12-06
18 202011049544-ENDORSEMENT BY INVENTORS [06-12-2023(online)].pdf 2023-12-06
19 202011049544-DRAWING [06-12-2023(online)].pdf 2023-12-06
20 202011049544-COMPLETE SPECIFICATION [06-12-2023(online)].pdf 2023-12-06
21 202011049544-CLAIMS [06-12-2023(online)].pdf 2023-12-06
22 202011049544-ABSTRACT [06-12-2023(online)].pdf 2023-12-06
23 202011049544-US(14)-HearingNotice-(HearingDate-11-11-2025).pdf 2025-10-09
24 202011049544-FORM-26 [07-11-2025(online)].pdf 2025-11-07
25 202011049544-Correspondence to notify the Controller [07-11-2025(online)].pdf 2025-11-07
27 202011049544-Proof of Right [24-11-2025(online)].pdf 2025-11-24
28 202011049544-Information under section 8(2) [25-11-2025(online)].pdf 2025-11-25

Search Strategy

1 SearchHistory(27)E_21-08-2023.pdf
2 202011049544_SearchStrategyAmended_E_VEGFRsearchAE_25-09-2025.pdf