Sign In to Follow Application
View All Documents & Correspondence

"New Biopesticide Using Gene From Erwinia Pyrifoliaewt #3, Novel Pathogen That Affects Asian Pear Trees"

Abstract: The present invention relates to a biopesticide using a plant pathogen, and more particularly, to a biopesticide having an improved resistance against plant pathogens and an improved plant growth effect, which is superior to that of HrpN, a plant-senstive protein isolated from Erwinia amylovora ATCC 15580, by using a gene isolated from WT#3 (Erwinia pyrifoliae WT#3)[KCCM 10283] thus enabling to be used as a fertilizer as well a biopesticide.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
03 February 2004
Publication Number
42/2009
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

PIONEER CO.,LTD
2-321 NONGSAENGDAE, KANGWON UNIVERSITY, 192-1 HYOJA-DONG, 200-701 CHUNCHEON, KANGWON-DO, REPUBLIC OF KOREA

Inventors

1. LIM, CHUN, KEUN
1 ANBO-RI, SEO-MYEON, 200-832 CHUNCHEON, KANGWON-DO, REPUBLIC OF KOREA
2. HUR, JANG, HYUN
105-701 DONGA APT.,HYOJA 3-DANG, 200-093 CHUNCHEON, KANGWON-DO, REPUBLIC OF KOREA
3. PARK, DUCK, HWAN
747-3 SEOKSA-DONG, 200-936 CHUNCHEON, KANGWON-DO, REPUBLIC OF KOREA
4. BAE, HU, NAM
4-202 HYEOPDONG APT.,DOKYE-EUP, 235-900 SAMCHEOK, KANGWON-DO, REPUBLIC OF KOREA
5. CHO, JUN, MO
206-1002 JOOGONG 2-CHA APT.,TOIKYE-DONG, 200-760 CHUNCHEON, KANGWON-DO, REPUBLIC OF KOREA
6. BAEK, SU, JIN
223-8 MAEGOK-RI, NAM-MYEON, 482-872 YANGJU-KUN, KYUNGKI-DO, REPUBLIC OF KOREA
7. JEONG, CHEON, SOON
301-602 JOOGONG APT.,SEOKSA-DONG, 200-180 CHUNCHEON, KANGWON-DO, REPUBLIC OF KOREA
8. CHOI, SHIN, GEON
142 KYO-DONG, 200-060 CHUNCHEON, KANGWON, REPUBLIC OF KOREA

Specification

NEW BIOPESTICIDE USING GENE FROM ERWINIA PYRIFOLIAE WT#3, NOVEL PATHOGEN THAT AFFECTS ASIAN PEAR TREES
TECHNICAL FIELD
This invention relates to a novel biopesticide using a gene derived from a novel plant pathogen, Erwinia pynfohae WT#3 (KCCM 10283), isolated from Chunchon, Kangwon Province, Korea Korea. This pathogen is endemic to Korea. This novel biopesticide has more effective properties, such as improved resistance to plant disease, promotion of plant growth, and insect repellency as compared to those of HrpN, a hypersensitive response inducing protein, isolated from Erwinia amylovora (ATCC15580), which does not exist in Korea. Thus, it can be utilized as a biopesticide effective to prevent plant diseases caused by pathogens and insects and to enhance plant growth as well as a fertilizer.
BACKGOUND ART
The food shortage has been emerged as one of the most serious problems that the people are suffering around the world at present. However, the yields of crop production have been greatly decreasing due to the outbreak of harmful pests, such as pathogens and insects. Currently, chemical pesticides have been mostly used to prevent or control the spread of harmful pests. But their excessive and continued applications become responsible for inducing resistance to those chemical pesticides in pests, although rapid pesticidal effects can be demonstrated by killing the pests directly by using an easier spraying method. In addition, most effective pesticides, which are strongly toxic, have caused social problems due to serious soil and water pollution. Therefore, it is very urgent for the development of an environmently-friendly biopesticides which do not induce any resistance to pests while having effective pesticidal activities.
The general purpose of using a biopesticide is to control pests through a direct application of antagonistic microorganism itself to plants but this is not considered very effective in controlling of the pests. Therefore, recent researches
have been progressing to control harmful pests by stimulating the self-defensive system of plants using products of antagonistic microorganisms instead of using microorganisms themselves. In other words, an essential aim of biological control is to decrease or prevent of pests by activating the self-immunological function of a plant via treatment of microorganism-derived materials to plants.
The plant disease resistance is primarily conducted by the defense system of a plant by via structural barriers such as cutin in epidermal cells, a wax layer and types of porosity. When plant pathogens infiltrate into plant cells, chemicals, such as saponin or lectin, secreted by the plant can prevent the increase of pathogens population [Agrios, G. N. 1997 Plant Pathology.4th ed. Academic Press, New York; Dong, X 1998. SA. JA, ethylene, and disease resistance in plants. Curr. Opin. Plant Biol.l.316-323; Feys, B. J. & Parker, J. E. 2000. Interplay of signaling pathways m plant disease resistance. Trends Genet. 16:339-455].
More essential plant disease resistance refers to a hypersensitive response (HR), is a rapid, localized necrosis for preventing spread of pathogens that is associated with the active defense of plants against many pathogens to stimulate their self-defensive system using some microorganism-derived materials. [Richberg, ' M. H., Aviv, D. H. & Dangl, J. L. 1998. Dead cells do tell tales. Curr. Poin. PlantBiol. 1:480-485]. The first method for plant disease resistance associated with HR induction is that plants mobilize their early alert system to adjacent cells infected with bacterial pathogens so that these adjacent cells can increase the resistance to pathogens This defense system is called as 'LAR' (local acquired resistance).
The second method is that through the activation of defense system in non-infected parts of a plant, more potent defense system is activated against the secondary infection. Consequently, the wliole plant May exert a more strongly defense system against pathogens. This defense system is called as "SAR" (systemic acquired resistance). The SAR may be sustained for several weeks or more and the plants exhibit some resistance to a variety of other unrelated pathogens [Hunt, M. D., Neuenschwander, U. H., Delaney, T. P., Weymann, K. B., Friedrich, L. B., Lawton, K. A., Steiner, H. Y. and Ryals, J A. 1996. Recent advances in systemic acquired
resistance research a review. Gene 179:89-95].
In addition, ISR (induced systemic resistance) and wound response to harmful insects were reported as the types of another plant resistance [Pieterse, C M., van Wees, 5. C, van Pelt, J. A., Knoester, M, Laan, R, Gerrits, H., Weisbeek, P. J. and van Loon, L. C. 1998. A novel signaling pathway controlling induced systemic resistance in Arabidopsis. Plant Cell 10:1571-1580; Ryan, C A. and Pearce, G 1998. SYSTEMIN: a polypeptide signal for plant defensive genes. Annu. Rev. Cell Dev. Biol. 14:1-17]
The mechanism of the plant disease resistance is triggered by elicitors that induce the plant defense system [Kessmann, H., Staub, T., Hofmann, C, Maetzke, T., Herzog, J., Ward, E., Uknes, S. and Ryals, J. 1994. Induction of systemic acquired disease resistance in plants by chemicals. Annu. Rev. Phytopathol. 32:439-459]. The typical elicitors of SAR include a phenolic signaling compound SA (salicylic acid) produced by plants, elicitin and harpin that are isolated from pathogens [Ponchet, M., Panabieres. F., Milat, M. L., Mikes, V., Montillet, J. L., Suty, L., Triantaphylides, C, Tirilly, Y. and Blein, J. P. 1999. Are elicitins cryptograms in plant-oomycete communications. Cell Mol. Life Sci. 56:1020-1047].
Harpin is a common name for proteins produced from hrp gene island of plant pathogenic bacteria and one of Harpins, called HrpN, is a protein produced from hrpN gene located at hrp gene island of about 40kb of Erwinia amylovom which is not existing in Korea. When the HrpN is inoculated to host plants, such as an apple, it acts as a pathogenic factor. In contrast, when HrpN is given to non-host plants, it is recognized as a foreign compound in plants and HR is elicited.
HrpN is an acidic, heat-stable (100 °C) protein with a molecular weight of 44 kDa [The molecular weigh4- was measured in ? manner such that after electrophoresis on acrylamide gel, the protein was stained with 0.025% Coomassie Blue R-250 and compared with Molecular Weight Standard of Bio-Rad Co. (Catalog* 161-0305, Bio-Rad Laboratories, 2000 Alfred Nobel Drive Hercules, CA 94547, USA)] with glycme-rich but without cysteine [Zhong-Min, W., Laby, R. J., Zumoff, C. H., Bauer, D. W., He, S. Y., Collmer, A. and Beer, S. V. 1992. harpin, elicitor of the
hypersensitive response produced by the plant pathogen Erwinia amylovora. Science 257 85-88, US Pat. Nos. 6,001,959, 5,850,015, 6,172,184-B1, 6,174,717-Bl, 5,849,868, 6,977,060, 5,859,324, and5,776,889; Korea Examined Pat. Appl. Nos. 1999-022577, 2000-075771,2000-070495, and 2000-057395].
These plant defense elicitors have been sold in a variety of formulations. Since SA (Salicylic acid) has been reported as SAR elicitor, INA (2,6-dichloroisonicotinic acid) and BTH (benzothiadiazole) having a similar structure to SA were found to induce SAR and successfully registered as plant activators. Currently, Actigard™ and BION®, have been sold in US and Europe for the protection of diseases of foliage plants, tomato and tobacco. In Japan, PBZ (probenazole) under the trade name Oryzemate® has been also marketed for controlling rice blight and bacterial leaf blight [Yoshioka, K., Nakashita, H., Klessig, D. F. and yamaguchi, I. 2001. Probenazole induces systemic acquired resistance in Arabidopsis with a novel type of action. Plant J. 25:149-157].
HrpN, a non-chemical protein, was first discovered in Envinia amylovora, a gram-negative bacteria that cause fire blight of rosaceous plants. When it is directly sprayed to plants, it acts as the SAR elicitor which controls a variety of a plant diseases, several insects, mites and nematodes and exhibits a plant growth prompting effect by enhancing photosynthesis and nutritional absorption [Dong, H. S., Delaney, T. P., Bauer, D. W. and Beer, S. V. 1999. HrpN induces disease resistance in Arabidopsis through the systemic acquired resistance pathway mediated by salicylic acid and the NIM1 gene. Plant J. 20:207-215] Also, HrpN has little toxicity and it does not cause in-any environmental pollution as it is biologically degradable and it is easy to formulate due to heat-resistance even after boiling at 100°C [Zhong-Min, W., Laby, R. J., Zurroff, G H„ Prrer, D. W., He, S. Y., Collmer, A. and Beer, S. V. 1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Envinia amylovora. Science 257:85-88].
Therefore, HrpN derived from Envinia amylovora was successfully commercialized in 2000 by Eden Bioscience in the trade marker Messenger® in USA for controlling the diseases of crops, such as cotton, tomato, tobacco, pepper,
ucumber strawberry, and wheat. It has been effectively utilized as fungicide, bactericide, pesticide, and plant growth facilitator [US Pat. Nos. 6,174,717 Bl, 5,849,868, 6,977,060, 5,859,324, and 5,776,889; Korea Examined Pat Appl. Nos. 1999-022577,2000-075771,2000-070495, and 2000-C57395]
DISCLOSURE OF INVENTION
The inventor et al. isolated and identified some bacterial pathogens from the infected lesions of a plant showing necrosis in pear growing orchards in Chunchon, Korea and found novel species, Envima pynfohae WT#3 (KCCM 10283) which is morphologically different from recently reported Envinia pyrifoliae by German researchers: that is, Enoinia pyrifoliae WT#3 (KCCM 10283) does not have flagella, while Erunnia pyrifoliae, which was reported by a German research team has pentrichous flagella. Also, it was different from the well-known Enoinia amylovora causing fire blight.
After isolating a gene and a protein which induce a hypersensitive response in non-host plants from novel species, Enoinia pynfoliae WT#3 (KCCM 10283), it was noted that the protein was proven to be more effective in imparting plant disease resistance against pathogens and insects, and in enhancing plant growth than HrpN from Enoinia amylovora causing fire blight. Thus, the present invention was completed.
Therefore, an object of the present invention is to provide a novel species Enoinia pyrifoliae WT#3 (KCCM 10283) and a protein derived from the pathogen as an effective biopesticide, a plant growth activator, a seed-treating agent, an insect repllent, and a fertilizer.
A further aspect of the present invention is to provide a gene (KCCM 10282) encoding a protein or polypeptide of Enoinia pyrifoliae in a non-infectious form to plants, which induces a hypersensitive reaction to non-hosts or resistance to pathogens in plants when plant cells are in contact with or treated with the gene.
A further aspect of the present invention is to provide transformants containing a gene (KCCM 10282) encoding a protein or polypeptide in a
non-infectious form to plants from Enuinia pynfohae WT#3 (KCCM10283)
A further aspect of the present invention is to provide a biopesticidal composition containing the protein or polypeptide and a carrier.
A further aspect of the present invention is to provide the composition which can be applied to plants as a pesticide, a plant growth activator, a seed-treating agent, insect repellent, and a fertilizer.
A further aspect of the present invention is to provide a method for producing a protein or polypeptide that induces a hypersensitive response or resistance on a mass-scale by isolating and purifying a protein or a polypeptide from a cultures of Erwinia pynfohae WT#3 (KCCM 10283) and transformants containing a plant HR-inducing gene of the strain (KCCM 10282) from Enuinia pyrifoliae WT#3 (KCCM 10283).
The novel Erunnia pyrifoliae WT#3 (KCCM 10283) of the present invention was isolated from the affected stem of a plant showing necrosis of pears orchard in Chunchon (Kangwon Province, Korea). The strain was identified as the genus Erwinia, the same genus of the causal pathogen of fire blight, Erunnia amylovom and necrotic disease, Erunnia pyrifoliae (necrotic disease of Asian pears; Erwinia pyrifoliae reported by a German research team in 1999). Erwinia amylovora and Erunnia pyrifoliae are peritrichous flagella, while our pathogen Erwinia pyrifoliae WT#3 (KCCM 10283) is non-flagellated, showing a great morphological difference from Erunnia pyrifoliae which is only found in Korea. We designated the novel strain as Erunnia pyrifoliae WT#3 (KCCM 10283) and deposited it to the Korean Culture Center of Microorganisms on June 11, 2001 and was assigned with Accession No. KCCM 10283.
Especially, an isolated gene encoding a protein which induces a hypersensitive response in non-host plants from Erwinia pyrifoliae WT#3 was compared with a hrpN gene encoding a HrpN protein, which was discovered by Cornell University of the US and sold by Eden Bioscience co. As a result, our novel gene showed less similarity to hrpN gene encoding a HrpN. Notably, several
mbertions of nucleotide sequences fragments were found in the gene encoding a protein which induces a hypersensitive response in non-host plants from Erwinia pynfohae WT#3 which are not present in hrpN gene from E. amylovora. More specifically, those nucleotide sequences fragments were inserted at the sites of 222-230 bp, 249-263 bp, 348-371 bp and 397-411 bp. Therefore, the protein or polypeptide produced by the gene has a different ammo acid sequence and molecular weight from those of HrpN peptide.
A recombinant pKEP3 for higher expression containing the gene derived from the Eriuima pyrifoliae WT#3 was constructed and transformed to Esclwrichia coh. This transformant was deposited to the Korean Culture Center of Microorganisms on June 11, 2001, and was assigned with Accession No. KCCM10282.
The high yield of a protein or a polypeptide to elicit hypersensitive response and disease resistance can be produced by mass cultivation of the E. coli transformant containing the expression vector having more effective properties, such as improved resistance to plant disease, promotion of a plant growth, and repellence of insect in compared to that of HrpN from E. amylovora.
As a result, evaluation of biological activities of the protein or polypeptide inducing hypersensitive response or plant disease resistance proved its improved effectiveness than those of HrpN in the powdery mildew of cucumber, anthracnose on pepper, blight of pepper, downy mildew of oriental melon, blight of sweet pepper, leaf blight of rice. Further, yield of harvesting showed higher cucumber, pepper, sweet pepper, and strawberry than HrpN protein. Also, the protein or polypeptide which induces a hypersensitive response in non-host plants from Erwinia pyrifoliae WT#3 showed an excellent in increasing the photosynthesis and the content of chlorophylls in cucumbers and peppers. Therefore, the protein or polypeptide from Enoinia pyrifoliae WT#3 can be applied to plants as a pesticide, a plant growth activator, and a fertilizer.
In addition, the protein or polypeptide of this invention can be applied to plants as an insect repellent (e.g., aphid) in a conventional procedure to treat stems and leaves of a plant. Further, the seeds of rice treated with a protein or a
polypeptide of this invention showed fast growth during the seeding culture period Thus, the protein or polypeptide of this invention can be applied to plants as an insect repellent and seed-treating agent in a conventional procedure.
BRIEF DESCRIPTIO OF DRAWINGS
Fig 1 shows TEM (Transmitted Electro Microscope) photographs of novel Erunnia pynfolme WT#3 (KCCM 10283) according to the present invention, Enuinia pijrifohae Epl6T and Enoinia amylovora ATCC15580T .
Fig 2 shows the growth curves of Enuinia pyrifohae WT#3 and Erwinia amylovora ATCC155801 according to temperature.
Fig. 3 shows the growth curves of Erwinia pyrifoliae WT#3 and Enoinia amylovora ATCC15580 according to pH
Fig. 4 shows the numerical analysis of Enoinia pyrifohae WT#3 (KCCM 10283) according to the Biolog system.
Fig. 5 shows a phylogenetic analysis based on 16S rRNA gene of Enoinia pyrifoliae WT#3 (KCCM 10283) of this invention.
Fig 6 shows the results of phylogenetic analysis of the region encoding tRNAAIa in ITS region of Enoinia pyrifohae WT#3 (KCCM 10283) of this invention.
Fig. 7 shows the results of phylogenetic analysis of the region encoding tRN AGlu in ITS region of Erwinia pyrifoliae WT#3 (KCCM 10283) of this invention.
Fig. 8 shows a plasmid profile analysis of Enoinia pyrifoliae having five plasmids (WT#3, Epl, Epl6) and Enoinia amylovora having one plasmid (ATCC15580 T, LMG1877, LMG1946) [Lanes 1: lkb ladder, 2: Enuinia pyrifoliae Epl, 3: Envima pyrifohae Epl6T, 4: Enoinia pyrifoliae WT#3, 5: Enoinia amylovora ATCC155801, 6: Enoinia amylovora LMG1877,7: Enoinia amylovora LMG1946].
Fig. 9 shows a hypersensitive response observed 24 hours after inoculation of the genomic library clone constructed from Enoinia pyrifoliae WT#3 (KCCM 10283) on the leaf of tobacco [B: MES buffer, C: a plant HR-inducing protein (HrpN) from Enoinia amylovora ATCC 15580T, 1: a plant HR-inducing protein from clonel, 2: a plant HR-inducing protein from clone2,3: a plant HR-inducing protein from pCEP33,
4: a plant HR-inducing protein from done4, and NC: protein from pLAFR3 vector].
Fig. 10 shows a physical map encoding the plant HR-inducing gene from the genomic library clone (pCEP33) from Erwinia pynfoliae WT#3.
Fig. 11 shows a comparison of genes between a gene (KCCM10282) encoding the plant HR-inducing protein from Envinia pynfoliae WT#3(KCCM 10283) of the . present invention and the HR-inducing gene (hrpN) from Envima amylovora ATCC155801 [A: a plant HR-inducing gene from Erwinia pynfoliae vVT#3, B. a plant HR-mducmg gene QirpN) from Erwinia amylovora ATCC15580 T].
Fig 12 shows a plant HR-inducing protein (hereinafter referred to as "Pioneer") from the gene from Erwinia pynfoliae WT#3 which is expressed in plasmid vector pKEP3 from the gene from [M: protein size marker, 1: Pioneer with 41.1 kD, 2: HrpN with 39.7 kD, 3: pET15b vector].
Fig. 13 shows a comparison between the amino acid sequences of Pioneer and a plant HR-inducing protein (HrpN) from Erwinia amylovora ATCC15580T [A: Pioneer, B: HrpN].
Fig. 14 shows HR on tobacco leaves treated with the Pioneer from Erwinia pynfoliae WT#3 and HrpN from Erwinia amylovora ATCC155801 (a control) at different concentrations.
Fig 15 shows the disease symptoms on the surface of immature pear fruit 4 days after inoculation of the Pioneer and a buffer (control).
The following examples are intended to be illustrative of the present invention and should not be construed as limiting the scope of the invention as defined by compounds or examples herein.
EXAMPLES
Example 1: Isolation and identification of novel strain
1) Physiological/biochemical tests based on Schaad's Laboratory guide and Bergey's manual
In order to identify the pathogenic bacteria from the affected lesions by necrotic disease on pears from orchards of Chunchon (Kangwon Province, Korea),
different physiological and biochemical tests were performed based on Schaad's laboratory guide [Schaad, N W 1988 Initial identification of common genera. In Laboratory Guide for Identification of a plant Pathogenic Bacteria, ed. by N. W Schaad American Phytopathoiogical Society, Mmnesot. pp. 44-59] and Bergey's manual[Lelliott, R A. and Dickey, R. S. 1984. Genus Enoinia In: Bergey's Manual of Systemic Bacteriology vol 1, pp. 469-476, Williams and Willkms Co, Baltimore/London], as shown in the following table 1.
Table 1
(Table Removed) Overall, the analytical results showed that the physiological tests on the strain (e.g., liquefaction of gelatin, motility in 3% agar, and decomposition of pectate) were close to those of type strain Bpl6T of Envinia pyrifoliae. In contrast, the biochemical tests for the utilization of carbon source revealed different results, especially trehalose and L-arabinose, suggesting that the physiological and biochemical properties of the isolated strain according to the present invention were different
from these of type strain Erwinia pynfohae Epl6Tand Enuinm amijlovora ATCC15580T.
2) Morphological property of strain WT#3
The morphological property of the strain WT#3 was observed by TEM (Transmitted Electro Microscope), was different from that of recently reported Erunnia pynfohae EP16T causing necrotic disease in Asian pear trees and Envinia amylovcm ATCC 15580T causing fire blight on apples and pears [Fig. 1].
As a result, Envvnia spp. including Erwinia pynfohae EP16T and Erunnia amylovcra ATCC 15580T were rod shaped with peritrichous flagella whereas the novel strain Envinia pyrifoliae WT#3 was a slight oval rod shaped "without flagella".
3) Growth of the strain WT#3 at different temperatures
To investigate the physiological and biological properties, growth curve of Ermni.i pynfohae WT#3 at different temperatures was performed and the growth was measured by turbidity using Bioscreen C.
The temperatures ranging from 12 °C to 39 °C were measured at intervals of 3 °C and doubling time and specific growth rate at different temperatures of Envinia pyrifohie WT#3 and Envinia amylovora ATCC 15580T were calculated [Fig. 2].
The results showed Envinia pyrifoliae WT#3 has higher growth rate (27-30'C) with short doubling time than that of Envinia amylovora. The optimal temperature was 271 for the strain WT#3.
At lower temperatures below 20°C/ Envinia pyrifoliae WT#3 also showed a better growth compared to Erwinia amylovora ATCC155801, suggesting that Envinia pynfohae WT#3 is a cold tolerant because this pathogen is well adapted in the vicinity of Chunchon. Chunchon is a relatively cold area in the winter season and has different environmental conditions from that of Envinia amylovora ATCC155807.
4) Growth of the strain WT#3 at different pH levels
To investigate the effects of pH on the growth of Envinia pyrifoliae WT#3 the
growth at different pH levels was measured by turbidity using Bioscreen C. The pH
ranging from pH 5.5 to 9.5 was measured at intervals of 0.5 at a constant temperature of 28 °C and doubling time and specific growth rate at different pH levels of Erwinia pynfoliae WT#3 and Erwinia amylovora ATCC15580T were calculated [Fig. 3].
The results showed that the optimal pH range for the growth of Erwinia pyrMiae WT#3 was between pH 7.0 and 8.0 and its rapid growth was observed in an alkaline condition of pH 7.5 which was different from that of Erwinia amylovora ATCC15580T
5) Property of strain WT#3 usmg Biolog system
Biolog system [BIOLOG, Hayward, CA 94545, USA] designed to monitor the utilization of 96 different carbon and nitrogen sources was applied to investigate the biochemical property of strain WT#3 in detail.
After incubation in TSA (triptic soy agar) at 28 °C for 24 hours, the isolated sham was suspended to the turbidity of 63% in a solution containing 0.4% sodium chloride, 0.03% pluronic F-68, and 0.01% gellan gum and inoculated to the wells containing 96 different carbon and nitrogen sources.
Then, the strain WT#3 was further cultivated in an incubator at 35-37 °C. The violet-turned as utilization of carbon and nitrogen sources were recorded using a reader and their values were numerically divided
As shown in Fig. 4, strains ATCC15580, LMG2068, LMG1877, LMG1946 and ea246 strains (USA), which belong to Erwinia amylovora, were showed to be in the same group. In contrast, the strain WT#3 was in the group as Erwinia pyrifoliae (Ep4, Ep8, Ep16. Therefore, it was clear that the strain WT#3 is different from the source of fire blight pathogen, E. amylovora.
6) Analysis of 16S rRNA gene from strain WT#3
To investigate the phylogenetic analysis of the strain WT#3, the nucleotide sequence of its 16S rRNA gene was analyzed considering the fact that it is an essential component to manage a life where its nucleotide sequence is well conserved and can be readily placed for phylogenetic analysis.
The 16S rRNA gene was amplified by PCR using fDl primer (SEQ. ID. No 1) and rP2 primer (SEQ. ID. No. 2) and then cloned into pGEM-T vector to analyze its nucleotide sequence.
Fig 5 shows a phylogenic tree prepared by a mega program [Kumar, S., Tamura, K. and Nei, M. 1993. MEGA, molecular evolutionary genetics analysis, version 1 0 The Pennsylvania State University, University Park] based on the 16S rRNA nucleotide sequence.
The strain WT#3 had similarities to Erzoinia pyr/ohae Epl6T and Eninnia amylovora 15580T with 98.9% and 97.5% sequence identity, respectively, being more closer to Erunnia pyrifoliae than to Erwima amylovora. Table 2 shows the similarity of 16S rRNA gene of each strain. Table 2
(Table Removed)
Also, the analysis of 16s rRNA gene revealed that the strain WT#3 belongs to the group as Envinia pyrifblia but was different from that of Erzoinia amylovora ATCC 1558CF, and Enterobacter pyrinus, which was previously reported to infect apples and pears in Korea several years ago.
7) Anah sis for 16S-23S ITS (Intergenic Transcribed Spacer) region of strain \VT#3
To analyze the ITS of the Korea-originated pathogens Erunnia pynfohae and foreign-originated Erunnia amylovora, 16S-23S ITS region was amplified by PCR using R16-1F primer (SEQ ID No. 3) and R23-1R prime. (SEQ. ID No 4), and then cloned into pGEM-T vector to analyze the nucleotide sequence of 16S-23S ITS region
As a result, 16S-23S ITS region was divided into rwo groups, Envinia amylovora had three band patterns with about 1215, 970 and 720 bp in size, whereas domestic pathogen, Erunnia pynfohae had two band patterns with 970 and 720 bp in size
Cuirently, all strains were showed two groups; the band pattern of 970 bp had about 70 bp region of tRNA, whereas the band pattern of 720bp had a region of tRNAGlu, respectively.
Fig 6 shows a phylogemc tree prepared by analvzing the nucleotide sequences of 16S-23S ITS region of both the strain Envinia pynfohae WT#3 and Ei unnia amylovora ATCC155801
As a result of analyzing the nucleotide sequences of a 970 bp band encoding 70bp legions of tRNA3, it was revealed that the strain WT#3 is different from Ei zinnia amylovora group and had a similarity of 47.4% to Envinia amylovora However, we could not compare with tRNA region of Envinia pynfohae, which was designated by German researchers because it was not registered in GenBank
The analysis of the nucleotide sequences of a 720 bp band encoding tRNAG!u region showed that the strain Erunnia pynfoliae WT#3 has 85 2%- 92 7% of sequence identity to that of Envinia pynfohae reported by a German researchers, thus being suggested as the same group [Fig. 7].
8) Analysis of Envinia pijrifohae WT#3 according to plasmid profiles
The Korea-originated Enmma pynfohae and foreign-originated Envinia amylovora were divided into the following two groups [Fig 8]
Group I Ei zinnia amylovora (ATCC155S0, LMG1877, 10296) (a plasmid > 29 kb)
Gioup II Erunnia pynfohae (WT#3, Epl, Epl6) (a plasmid > 29 kb, a plasmici 5 kb, and throe plasrruds 2-4 kb in size)
Thar is, the recrotic disease pathogens, Erunma pynfohae, or Asian pear trees including the strain MT#3 have five plasrruds, whereas fire blight pathogens, Em una amylovora, have only one plasmid, respectively
9) Anah sis for DNA relatedness according to DXA-DNA hybridization
The relatedness in whole genome between the Korea-originated Erunma pynfohae and foreign-originated Erunma amylovora were was investigated
The purely isolated total DNA was dissolved in 100/. TE buffer to a concentration lng/', added with ION NaOH, and then denatured by boiling at 80°C for 10 min Denatured DNA was applied to Hybond-N+ nylon membrane using a slot-blot apparatus Native DNA to be used as a probe was labeled with DIG 11-dUTP bv Dig-High Prime [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany], prehybridized at 49 °C for 3 hours in the presence of DNA already fixed to a nylon membrane, and then hybridized for 16 hours at the same temperature Development of the membranes was conducted by DIG Luminescent Detection Kit [Roche Molecular Biochemicals, Sandhofer Strasse 116, Germany].
The result showed that the foreign-originated Erwinia amylovora (ATCC155801, LMG1877, LMG1946, LMG2068) belong to group I while Korea-originated Erwinia pynfohae (WT#3, Epl6T) belong to group II.
More specifically, the foreign-originated pathogens, Erwinia amylovora belonged to group I but the Korea-originated pathogens, Erunnia pynfohae belonged to group II. This result clearly indicates that the Korean pathogens, Erwinia pynfohae including strain WT#3 and the foreign pathogens, Erwinia amyhvora were distinct, suggesting that Erunnia pyrifoliae is native to Korea The following table 3 shows the similarities of related strains.
Table 3
(Table Removed)
From the above physiological, biochemical and genetic properties of the strain WT#3, it was noted that, in terms of physiological and biochemical properties based on Schaad's laboratory guide and Bergey's manual, temperature and pH level-related properties, Biolog system, 16S rRNA gene, 16S-23S ITS, plasmid profiles, and relatedness by DNA-DNA hybridization, the strain WT#3 was in the group of Erwima pynfoliae, which was present only in Korea in 1999, although there were a few other different properties between Erwinia pynfoliae WT#3 and Epl6T.
However, since the strain WT#3 does not have flagella in morphology which is first reported in genus Enoinia, it appears to be different from those of pathogen, Erunnw pynfoliae, which was reported by German researchers and Enoinia amylovora.
We designated the strain WT#3 as Erwima pynfoliae WT#3 (KCCM10283) and deposited to the Korean Culture Center of Microorganisms on jane 11, 2001 The accession number is KCCM 10283. Also, a recombinant pKEP3 for higher expression containing the gene derived from the Enoinia pynfoliae WT#3 was constructed and transformed to Eschenchia coli. This transformant was deposited to the Korean Culture Center of Microorganisms on June 11, 2001, and was assigned with Accession No KCCM 10282
Example 2: Properties of specific protein triggering a plant hypersensitive reaction from Etioima pyrifoliae WT#3 and a gene encoding it
11 Anal; sis of a plant HR-inducing gene from Erwima vynfoliae WT#3
To analyze a gene encoding specific protein eliciting a plant hypersensitive response, total DNA of Enoinia pyrifoliae WT#3 was incubated at 37°C to ensure that it was partially digested with Sau3Al. The DNA (1 µl) was then examined for appropriate digestion on an electrophoresis at the intervals of 1 hr, and the result revealed that about 6 hours of digestion was most appropriate Total DNA, so manipulated, was prepared as an insertion DNA and ligated into the BamHl polyhnker site of cloning vector pLAFR3 using DNA ligase by incubating at 14°C for
12 hours. A complete plasmid DNA ligated with the insertion DNA and a vector was
transformed to E. coh (HB101) via CaCl2 transformation. Then, E.coh strains were
cultivated on Luria agar medium containing tetracycline (30 µg/mℓ) at 37°C for 24
hours and 2,000 genomic library clones were generated.
To select clones encoding the specific protein eliciting a plant hypersensitive reaction from the 2,000 genomic DNA library clones of Erwinia pyrifoliae WT#3, total protein was extracted from each clone as follows. The solution, so cultured in LB medium for 12 hours, was centrifuged to obtain a pellet and after suspending the pellet in the mixture containing 5 mM MES buffer and 0.1 mM PMSF, the mixture was lysed by sonication and boiled at 100 °C for 10 min. Then, the supernatant only, so centrifuged, was collected and injected to the reverse sides of tobacco leaves (Nicotumn tnbacum L Samsun) using a syringe, which were grown with more than four tiue leaves with each leaf having a diameter of more than 15 cm. The necroois cf tobacco leaves 24 hours after injection was regarded as the HR and then genomic DNA library clones showing HR were selected [Fig. 9].
From the selected clone pCEP33, an 8.5 kb DNA fragment containing the HR-mducing gene was cloned to pUC19 vector and a physical map was constructed using a restriction endonuclease [Fig. 10]
J lg 11 compares a gene (KCCM 10282) encoding the plant HR-mducing protein from Erunnm pyrijbliae WT#3 (KCCM 10283) of the present invention with the HR-mducmg gene (hrpN) from Envinia amylovora ATCC15580T by analyzing the nucleotide sequences from the selected gene
From Erunnia pyrifoliae WT#3 of this invention, a 1287 bp gene encoding a protein of plant hypersensitive response can be obtained The 1287 bp gene was designated as "a plant HR-mducmg gene from WT#3' and its similarity to hrpN gene of Envinia amylovora ATCC15580T (1212 bp) was investigated
As a result it was shown that five novel nucleotide sequences fragments were inserted to the plant HR-mducmg gene of WT#3 at the sites of 222-230 bp (TITAACGGG), 249-263 bp (TGGCGGCGGTCTGCT), 327-333 bp (TCTGGGT), 348-371 bp (CGGCATTGGCGGCGGCATTGGTGG), and 397-411 bp (ACCGTGGGGACCTCT), thus resulting in the increase in the molecular weight of the gene The plant HR-inducing gene from WT#3 had a low sequences similarity of 83 2% homology to hrpN gene of Enuinia amylovora.
Therefore, it demonstrated that the gene encoding the plant HR-inducing protein of Enuinia pyrifoliae WT#3 has a different nucleotide sequences from hrpN gene of Envinia amylovora and also has the insertions of novel nucleotide sequences fragments, thus showing that the plant HR-inducing gene from WT#3 has a novel gene structure which is not found in hrpN gene of Erwima amylovora.
The nucleotide sequence of the gene encoding the plant HR-inducing protein of Erunnia pynfohae WT#3 was denoted as SEQ. ID. No. 5.
2) Construction of expression vector of a plant HR-inducing protein from Erwima pynfclme WT#3
To extract and purify a plant hypersensitive response eliciting protein on a large scale from the plant HR inducing gene of Erwima pyrifoliae WT#3, an expression vector pKEP3 containing the gene was constructed as follows:
Recombinant protein expression system in E.coh (Novagen, Inc. Madison, WI53711 USA) was employed so as to construct the expression vector pKEP3. This
system was derived from pBR322 plasmid, where T7 promoter and operator can bind to lac repressor before the insertion site of a foreign gene. This structure can easily facilitate the expression of an inserted gene in a larger volume by T7 RNA polymerase produced m a host E.coh genome Notably, when a substrate IPTG 3 hours after incubation is added, the combination of both lac repressor produced from lad gene and IPTG does not repress the expression of T7 RNA polymerase and thus, a larger amount of protein is synthesized For the selection of complete transformants, pKEP3 was constructed to contain an ampicillin-resistance gene and ampicillm can be used to the medium as a selective marker.
The gene encoding a plant HR-inducing protein from Erwinia jjynfohae WT#3 and the plasmid of recombinant protein expression system were digested at 37 "C for 12 hrs in the presence of the restriction enzymes Ndel and Bamlil to generate the same 5'- and 3'-end. They were then ligated into the restriction sites using DNA Iigase at 14 °C for 16 hrs and transferred into E.coh via CaCb transformation.
pKEP3 has many advantages that (1) ampicillin-resistant gene can be used as a selected marker, (2) its possession with His tag may make an easier purification, and (3) its possession of a strong T7 lac promoter may ensures a larger volume of protein production from ligated insertion DNA.
The E. coli transformant containing the expression vector pKEP3 was deposited to the Korean Culture Center of Microorganisms on June 11,2001 and was assigned with the Accession No. KCCM 10282
In the present invention, hnpN gene of Erwinia amylovora ATCC15580T was cloned by using the same recombinant protein expression system (Novagen, Inc., Madison, WI 53711, USA) and used as a control for the biological test of pKEP3, which contains novel plant HR-inducing gene from Envima pyrifohae WT#3. 3) Expression of a plant HR-mducing protein
To produce a large-scale protein from £. coli transformants containing pKEP3 (KCCM 10282) bacterial cells were inoculated to a LB broth by adding ampicillin (50 µg/mℓ) as a selective marker and chloramphenicol (33 µg/mℓ) for inhibiting the
synthesis of other proteins produced from E.coli genome, and subcultured at 37*0
for 12 hours Then, the bacterial transformant (KCCM 10282) of the present invention was cultured at 30°C for 7 hours using the same medium When the OD. of the transformant (KCCM 10282) reached 0 6 about 3 hours after the cultivation, the culture was added with 0 4 mM IPTG and cooled down to 30°C and then cultured again for 4 hours After a total of 7 hours cultivation, the mixture was centrifuged at 6,000 rpm for 15 min Then, the supernatant was discarded and a pellet was suspended in a solution containing 5 mM MES buffer and 0.1 mM PMSF. The suspension of transformant (KCCM 10282) was lysed by sonication until the suspension became transparent and then boiled for 10 mm at 100 =C Then, the mixture was centrifuged at 15,000 rpm for 10 min and the supernatant was discarded. After adding a protein inhibitory cocktail at the ratio of 1/1,000, the mixture was filtrated by using a 0.45 µm filter and weighed the extract amount of protein.
Through the above-mentioned process, the plant HR-inducing protein producing from transformant encoding the plant HR-inducing gene (KCCM 10282) of Ei unma pynfohae WT#3 was named as 'Pioneer'
According to the present invention, hrpN gene of Erwinia amylovora ATCC155807 was cloned by the same recombinant protein expression system (Novagen, Inc. Madison, WI53711 USA) and used as a control for the biological test of Pioneer
As shown in Fig. 12, it was demonstrated that both genes of Erwinia pyrifoliae WT#3 and Erzvima amylovora ATCC15580T encoding plant HR-inducing protein were successfully expressed by the recombinant protein expression system and were synthesized a large volume of a plant HR-inducing proteins.
4) Analysis for the similarity of plant HR-inducing protein (Pioneer)
The similarity of Pioneer was compared with the HR-inducing protein of
Erwmia amylovora ATCC15580T by analyzing the amino acid sequence of purified
Pioneer [Fig 13]
As a result, it was noted that novel protein domains of Pioneer were
produced from the N-terminal at the sites of 76-79 (Thr-Gly-Leu-Leu),
8 8 - 9 2 ( L e u - G 1 y - G 1 y G 1 y - S e r ) ; 102-113 (Gly-Leu-Gly-Gly-Leu-Gly-Gly-Asp-Leu-Gly-Ser-Thr), and 131-137 ( G 1 y - A 1 a - T h r - V a 1 - G 1 y - T h r - S e r )
The Pioneer had a low amino acid sequence identity of 85.9% homology to that of HipN The molecular weight of Pioneer was 411 kD as compared with 39.7 kD of HrpN. The molecular weight of both Pioneer and HrpN was not compared \/ith the molecular weight standards on an acrylarrude gel but a molecular weight of each ammo acid deduced from the nucleotide sequence of gene using Winstar preogram
Therefore, Pioneer has a novel type of a protein by the insertion oi novel peptide domains and such difference is expected to bring about much improved biological activity, which cannot be found m that of HipN.
5) Hypersensitive response of a plant HR-mducing protein (Pioneer)
Until recently, the plant HR-inducing protein is known as a pathogenic factor in host plants but induces the HR in non-host plants
Pioneer from Erwinia pyrifohae WT#3 and HrpN from Erwinia amylovora ATCC15580T were inoculated onto tobacco (non-host plants) leaves using a syringe, together with MES buffer (protein lysis buffer) as a control [Fig. 14].
As shown in Fig. 14, it was noted that Pioneer and HrpN exhibited a clear HR in the front tobacco leaf at the dose of 10 µg/mℓ and 20 µg/mℓ respectively; in the same reverse tobacco leaf, Pioneer and HrpN exhibited a clear HR at the dose of 5 µg/mℓ and 10 µg/mℓ respectively. This reflected that Pioneer induces HR at a relatively lower concentration than that of HrpN
As shown in the following table 4, it revealed that when Pioneer was
inoculated at the dose of 5 µg/mℓ and 10 µg/mℓ a clear HR was observed at 24 hours
and 14 hours after inoculation, respectively, whereas HrpN induced a clear HR at 48
hours and 18 hours after inoculation at same concentration, respectively. This
demonstrates that Pioneer exhibited more rapid HR than HrpN by 24 hours at of 5
µg/mℓ while Pioneer exhibited more rapid HR than HrpN by 4 hours at 10 µg/mℓ
respectively
This test was repeatedly performed three times and the result suggests that Pioneer induces the immune system of a plant at a lower dose and faster than HrpN. Table 4
(Table Removed)
6) Pathogenicity test on pear of plant HR-mduced protein (Pioneer)
Purified Pioneer at a dose of 500 µg/mℓ was inoculated to the surface of an
immature fruit by punching it a hole (0.5 mm in diameter and 10 mm in depth).
As shown in Fig. 15, the surface of the immature fruit turned black as a
progiessive symptom 4 days after treatment, compared with that of a control.
Therefore, Pioneer might have a potent pathogenicity on pears although it needs a
further investigation.
As mentioned above, the properties of Pioneer and a gene encoding it can be summarized as follows.
(1) The gene encoding Pioneer showed that several novel nucleotide
sequences fragments are inserted to the several sites of Pioneer gene, which are not
found in hrpN gene; the size of Pioneer gene was 1,287 bp as compared with that of
the gene of hrpN (1,212 bp).
(2) In the protein structure, the molecular weight of Pioneer (41.1 kD) with
novel peptide domains was larger than HrpN (39.7 kD) [The molecular weight of
both Pioneer and HrpN were not compared with molecular weight standards on an
acrylamide gel but their molecular weight for each amino acid were deduced from
the nucleotide sequences of a gene using Winstar program].
H) In the HR observed in tobacco leaves, it was noted that Pioneer induces the immune system of a plants at a lower dose and faster than HrpN
Therefore, it is clear that Pioneer is more suitable than HrpN from Envima amylovora foi the development of a better biopesticide eliciting the excellent KR
Example 3: The study of biological activity using plant HR-inducing protein (Pioneer)
1) Control effect against powdery mildew (Sphaerotheca fuliginea) of cucumbers
To evaluate the control effect of Pioneer against powdery mildew (Sphaerotheca fuliginea), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein.
Cucumbers were cultivated by the conventional "rain-protecting" method prevailing in agricultural farms. The test materials were applied based on the 3-time repeated randomized complete block design. The stems and leaves of cucumbers were treated with the HR-inducing protein, Pioneer, at a dose of 20 µg/mℓ according to the recommended dose by EDEN Bioscience corporation
EDEN Bioscience's Messenger® was used as a control at the same dose above, together with locally produced Fenarimol (chemical pesticide) based on the instruction in use. The treatment methods are as follows:
(1)Treatment by three times: Pioneer, Messenger® and Fenarimol were sprayed to the stems and leaves of cucumber three times each at intervals of 10 days after early stage of powdery mildew (Sphaerotheca fuliginea).
(2) Treatment by four times: Pioneer, Messenger® and Fenarimol were sprayed to the stems and leaves of cucumber thiee times each at the implantation of day 7, 21, 35, and 49
The disease severity of powdery mildew (Sphaerotheca fuliginea) from the upper 8 leaves to the bottom 3 leaves of cucumbers was measured 7 days after treatment based on the following criteria (0: no disease, 1: 1-5%, 2: 5.1-20%, 3: 20.1-40%, 4- more than 40%).
Table 5
(Table Removed)
As shown in the table 5, Pioneer is expected to be used as an excellent pesticide, since both three-time and four-time treatments showed that its control effects were increased by 122.6% and 187 0% as compared w ith Messenger®
2) Enhanced production of cucumbers
To ascertain the enhanced production of cucumbers with the treatment of
Pioneer, the stems and leaves of cucumbers were treated with Pioneer at a dose of 20
US/ml 5 times each at intervals of 14 days from day 7 before implantation. HrpN, a
control, was also given to the stems and leaves of cucumbers at the same dose as aforementioned
The cucumbers for this experiment were harvested at the implantation of day 8,10,12,14,16,18,21,23, 25, and 30. Under the judgment that the cucumbers with 20 cm m length can be commercialized, the results are indicated as a marketable rate as follows.
Table 6 (Table Removed)
Note . marketable fruit/ total fruit
From the above tables, it was noted that the marketable rate treated with Pioneer was increased by 8.1% as compared to that of non-treatment, and 4.6% as compared to that of HrpM
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN.
3) Increase of contents in photosynthesis arid chlorophyll of cucumbers
To ascertain the physiological reaction of cucumbers, namely, the increase of
contents in photosynthesis and chlorophyll of cucumbers, when treated with Pioneer, the stems and leaves of cucumbers were treated with Pioneer at a dose of 20 fig/\\\l 5 times each at intervals of 14 days from day 7 before implantation HrpN, a control, was also given to the stems and leaves of cucumbers at the same dose as aforementioned
The cucumbers for this experiment were harvested at the implantation of day 34, 42 and 56 and investigated using a portable photosynthesis device (LCA-4 system, ADC BioScientific Ltd., UNK; light source. 1,500 µmole) and a chlorophyll device (Chlorophyll meter SPAD-502, Minolta, Japan). Table 7
(Table Removed)
From the above table, it was noted that when cucumbers was treated with Pioneer, the contents of photosynthesis and chlorophyll were increased by 16.2% and 5.4%, respectively, vs non-treatment and 9.8% and 2 0%, respectively vs. HrpN.
Therefore, Pioneer may be effectively used as a plant growth activator and a fertilizer than HrpN
4) Control effect against blight of pepper (Phytovhthora capsici)
To evaluate the control effect of Pioneer against blight of pepper (PhytopJitliora capsici), a gene encoding the plant HR-mducing protein was cloned into pKEP3 vector to purify the protein Peppers were cultivated b) the conventional ''open field culture" method prevailing in agricultural farms The stems and leaves of peppei were treated with Pioneer at the doses of 10, 20 and 40 µg/mℓ HrpN, a control, was also given to the stems and leaves of pepper at the same dose as aforementioned. The treatment was performed as follows
CD At the intervals of day 8 and 12 after implantation, the stems and leaves of peppers were treated with each concentration of both Pioneer and HrpN. Phx/tophthora capsici (2X106 cells/mℓ) was inoculated to peppers, so treated, and their disease severity was measured 63 days after treatment.Table 8
(Table Removed)
As shown m table 8, it was noted that Pioneer (10 µg/mℓ) exhibited better control effect than HrpN (40µg/mℓ).
Therefore, Pioneer can be effectively used as a pesticide at a lower dose than HrpN protein
5) Control effect against anthracnose of pepper (Colletotrichum orbiculare)
To evaluate the control effect of Pioneer against anthracnose of pepper (Colletotrichum orbiculare), a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein. Peppers were cultivated by the conventional "open field culture" method prevailing in agricultural farms. The stems and leaves of peppers were treated with Pioneer at a dose of 10 µg/mℓ 5 times at the implantation of day 14 from day 7 before treatment. HrpN, a control, was also given to the stems and leaves of peppers at the same dose. The treatment was performed as follows-(D At the implementation of day 8 and 12, the stems and leaves of peppers were treated with each concentration of both Pioneer and HrpN. At the implementation of day 20, 27, 34 and 40, implanted peppers, so treated, were indicated as health and unhealthy fruits. Table 9
(Table Removed)
As shown in table 9, Pioneer exhibited better control effect against anthracnose of pepper (Colletotrichum orbiculare) than HrpN by 14.3%. Therefore, Pioneer can be effectively used as a pesticide than HrpN
6) Enhanced production of peppers
To ascertain the enhanced production of peppers with the treatment of Pioneer, Pioneer was sprayed 5 times to the stems and leaves of peppers at a dose of 10 µg/mℓ at implantation of day 8 and 12 HrpN, a control, was also inoculated to the stems and leaves of peppers at the same dose. The treatment was performed as follows
(L Immersion plus spray method Peppers were lmmerged m both Pioneer and HrpN at a dose of 10 µg/mℓ and immerged at 28 °C for 24 hours. Then, these peppers were sowed in a pot with soil, grown for 46 days and planted in an open field At the implementation of day 8 and 12, the stems and leaves of peppers were spraved with both Pioneer and HrpN protein The peppers for this experiment were harvested at the implantation of day 18, 25, 32, 39 and 46
Table 10
(Table Removed)
As shown in table 10, it was noted that Pioneer exhibited better production by 22 7% than HrpN
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN.
7) Increase of contents in photosynthesis and chlorophyll of peppers
To ascertain the physiological reaction of cucumbers, namely, the increase of contents in photosynthesis and chlorophyll of peppers, when treated -with Pioneer, the stems and leaves of peppers were treated with Pioneer at a dose c: 20 µg/mℓ 5 times at the intervals of 14 days from day ~ before treatment HrpN, a control, was also given to the stems and leaves of peppers at the same dose as aforementioned
The peppers for this experiment were harvested at the implantar.on of day 34, 42 and 56 and investigated using a portable photosynthesis device (LCA-4 system, ADC BioScientific Ltd., UNK; light source 1,500 µmole) and a chlorophyll device (Chlorophyll meter SPAD-502, Minolta, Japan). Table 11
(Table Removed)
From :he above table, it was noted that when peppers was treated with Pioneer, the contents of photosynthesis and chlorophyll were increased by 16 0% and 6 7%, respectr ely, vs non -treatment and 7.5% and 4.9%, respectively vs. HrpN.
Therefore, Pioneer can be more effectively used as a plant growth activator and a fei tilizer than HrpN
8) Control effect against downy mildew of oriental melon (Psendoperonospora cubensis) To evaluate the control effect of Pioneer against downy mildew of oriental melon (Pseitdcseronospcra cubensis), a gene encoding the plant HR-mducmg protein was cloned in:o pKEP3 vector to purify the protein The stems and leaves of oriental melons were treated with Pioneer at a dose of 40 µg/mℓ 5 times. HrpN, a control, was also giver to the stems and leaves of oriental melons at the same dose. The treatment was performed as follows-
(D Immersion plus spray method: Oriental melon seeds were immerged in both Pioneer and KrpN protein at a dose of 10 µg/mℓ for 24 hours. Then, these seeds were sowed in a pot. At the implementation of day 17 and 28, the stems and leaves of melons were rreated with both Pioneer and HrpN.
(2) Spiav method. At the implementation of day 17 and 28, the stems and leaves of oriental melons were treated with both Pioneer and HipN.
The disease severity of downy mildew was measured 55 days after treatment. Table 12

(Table Removed)
As shown m tab.e 12, it was noted that both :he spray and its immersion plus spra\ of Pioneer exhib.ted better control effect than those of HrpN by 96 0% and 44 6Z:, respectively Therefore, Pioneer can be more effectively used as a pesticide than HrpN
9) Control effect against blight of sweet pepper (Phytophthora capsici)
To evaluate the control effect of Pioneer against blight of sweet pepper
(Phytophthora capsici), a gene encoding the plant HR-mducing protein vras cloned into
pKEP3 vector to purify the protein.
Sweet peppers were implanted to a 25 cm port and cultivated at a glass
house The stems and leaves of sweet peppers were treated with Pioneer at a dose of
20 µg/mℓ, according tc the recommended dose by EDEN Bioscience corporation.
HrpN, a control, was also given to the stems and leaves of sweet peppers at the same
dose The treatment was performed as follows:
CD S days after implantation, the stems and leaves of sweet peppers were treated
with both Pioneer and HrpN. Phytophthora capsici (2 X106 cells/mℓ) was inoculated to
sweet peppers, so treated, and disease severity was measured 45 days after
treatment
Table 13
(Table Removed)
As shown m table 13, it was noted that Pioneer exhibited better control effect than H:pN by 87.1%.
Therefore, Pioneer can be more effectively used as a pesticide than HrpN.
10) Enhanced production of sweet peppers
To ascertain the enhanced production of sweet peppers treated with Pioneer, the stems and leaves of sweet peppeis were treated with Pioneer ar a dose of 40 µg/mℓ S davs after implantation. HrpN, a control, was also given to the stems and leaves of sweet peppers at the same dose
Sweet peppers were implanted to a 25 en port and cultivated at a glass house Sweet peppers, so treated, were investigated at the implantation of day 41 and 45. Table 14
(Table Removed)
s shown in table 14, it was noted that Pioneer exhibits better enhanced production effect of sweet peppers than HrpN by 21 6%
Therefore, Pioneer can be more effectively used as a plant growth activator
and a fertilizer than HrpN.
11) Enhanced production of strawberries
To ascertain the erJianced production of strawberries treated with Pioneer, Pioneer, the stems and leaves of strawberries cultivated at a green house was treated with Pioneer at a dose of 20 µg/ mℓ. HrpN, a control, was also given to the stems and leaves of green peppers at the same dose.
At the implantation of day 30, 33, 38, 41, 48 and 55, strawberries were harvested and indicated as total weight value (g).
Table 15
(Table Removed)
As shown in table 14, it was noted that Pioneer exhibited better facilitated production effect of strawberries than HrpN by 13 8%.
Therefore, Pioneer can be more effectively used as a plant growth activator and a fertilizer than HrpN
12) Control effect against blight of rice (Magiiaporthe gnsea)
To evaluate the control effect of Pioneer against blight of rice (Magnaportiie grisea), a gene encoding the plant HR-inducmg protein was cloned into pKEP3 vector
to purify the protein.
Rice was cultivated by the conventional "open field culture" method prevailing m agricultural farms The stems and leaves of rice was treated with Pioneer at the doses of 10 µ/g/mℓ, and immerged at 28 °C for 24 hours Rice seeds were sowed to a seedbed, grown for 16 days and implanted to a test field
Then, the stems and leaves of rice were sprayed with Pioneer at the intervals of dav 45 and 52. HrpN, a control, was also given to the stems and leaves of rice at the same dose and method as aforementioned. The disease severity was measured 85 days after treatment. Table 16
(Table Removed)
As shown in table 16, it was noted that Pioneer (10 µg/mℓ) exhibited better control effect than HrpN (20 µg/ mℓ).
Therefore, Pioneer can be more effectively used as a pesticide at a lower dose than HrpN
13) Repellent effect against aphis
To evaluate the repellent effect of Pioneer against aphis, a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein
Cucumbers were selected as host plants of aphis.
Cucumbers were cultivated by the conventional "rain-protecting" method prevailing in agricultural farms. The stems and leaves of cucumbers were treated with Pioneer at a dose of 20 fig/ ml. HrpN, a control, was also given to the stems and leaves of cucumbers at the same dose.
When the height of cucumbers was lm, the stem and lead of cucumbers were treated with both Pioneer and HrpN.
The number of naturally occurring aphis at cucumbers was counted 7 days after treatment. Table 17
(Table Removed)
As shown in table 17, it was noted that Pioneer had better repellant effect against aphis at a lower dose than HrpN by 29.4%.
Therefore, Pioneer can be more effectively used as a repellent than HrpN.
14) Enhancement effect of growth m seeding culture of rice
To ascertain the enhancement effect of growth in seeding culture of rice treated with Pioneer, a gene encoding the plant HR-inducing protein was cloned into pKEP3 vector to purify the protein.
The stems and leaves of rice were treated with Pioneer at the doses of 10, 20 and 40 µg/ml, diluted at MES buffer and immerged at 28 °C for 24 hrs. Rice seeds were sowed to a seedbed, grown for 16 days and implanted to a test field. HrpN, a control, was also given to the stems and leaves of rice at the same dose and method as aforementioned.
As a result, better growth in seeding culture of rice treated with Pioneer was observed by about 3-4 cm vs. non-treatment and 1 cm higher than HrpN
A higher dose (40 µg/mℓ) of Pioneer was required for better enhancement of rice's growth
Therefore, Pioneer can be more effectively used as a seed-treating agent which can promote the growth of rice seeds than HrpN.
INDUSTRIAL APPLICABILITY
As mentioned above, a novel Erwinia pynfohae WT#3 (KCCM 10283) according to the present invention is isolated and identified, and a novel protein (Pioneer) or a polypeptide translated from a plant HR-inducmg gene (KCCM 10282) ot this strain shows that Pioneer has improved properties in inducing plant resistance, plant growth promotion, insect repellent effect, increase of photosynthesis and chlorophyll, and seed treatment effect than a HrpN from Erwinia amylovora ATCC155801. The former readily elicits the plant hypersensitive response at a lower dose and faster than HrpN, thus, the protein from Erunma pyrifohae WT#3 (KCCM 10283) is quite suitable for the development of a novel and better plant hypersensitive reaction eliciting biopesticide.
Therefore, this invention is advantageous in developing a novel and improved biopesticide and a fertilizer

What is claimed is:
1. Enoinia pyrifoliae WT#3 (KCCM10283), an Envinia pathogen effective in controlling plant diseases and activating plant growth.
2. A gene (KCCM 10282) encoding a protein or a polypeptide in a non-infectious form originated from Envinia pyrifoliae which induces a hypersensitive reaction or resistance to pests in plants when plant cells are in contact with or treated by said gene.
3. A gene (KCCM 10282) according to claim 2, wherein said DNA molecule has a nucleotide sequences of No, 5.
4. A gene according to claim 2, wherein said protein or polypeptide has amino acid sequences of No. 6.
5. A gene according to claim 2, wherein said Envi7iia pyrifoliae is Enoinia pyrifoliae WT#3 (KCCM 10283).
6. An expression system containing the gene according to claim 2.
7. An expression system according to claim 6, wh ;rein the gene has a nucleotide sequences of No. 5.
8. Transformants containing the gene according to claim 2.
9. Tansformants according to 8, wherein said transformants are selected from the group consisting of bacteria and plants.

10. A protein or polypeptide in a non-infectious form derived from Enoinia pyrifoliae which induces a hypersensitive reaction or resistance to pathogens in plants when in contact with plant cells.
11. The protein or polypeptide according to claim 10, wherein said Enoinia pyrifoliae is Enoinia pyrifoliae WT#3 (KCCM 10283).
12. The protein or polypeptide according to claim 10, wherein said protein or polypeptide has a nucleotide sequences of No. 6.
13. The protein or polypeptide according to claim 10, wherein said protein or polypeptide is a recombinant.
14. A biopesticide composition containing said protein or polypeptide and a carrier according to claim 11.
15. A pesticide using said protein or polypeptide and a carrier according to claim 11.
16. A plant growth activator using the protein or polypeptide ar.d carriers according to claim 11.
17. A seed-treating agent using said protein or polypeptide and a carrier according to claim 11.
18. An insect repellent using said protein or polypeptide and a carrier according to claim 11.
19. A fertilizer using said protein or polypeptide and a carrier according to claim 11.
20. A method for producing a protein or polypeptide that induces a hypersensitive response or resistance on a mass-scale by isolating and purifying said protein or polypeptide from cultures of Enrinia pynfoliae WT#3 (KCCM 10283) and transformants containing a plant HR-inducing gene of the strain (KCCM 10282) from Erwinia pyrifoliae WT#3 (KCCM 10283).

Documents

Application Documents

# Name Date
1 227-delnp-2004-pct-409.pdf 2011-08-21
2 227-delnp-2004-pct-332.pdf 2011-08-21
3 227-delnp-2004-pct-304.pdf 2011-08-21
4 227-delnp-2004-pct-301.pdf 2011-08-21
5 227-delnp-2004-pct-210.pdf 2011-08-21
6 227-delnp-2004-gpa.pdf 2011-08-21
7 227-delnp-2004-form-5.pdf 2011-08-21
8 227-delnp-2004-form-3.pdf 2011-08-21
9 227-delnp-2004-form-2.pdf 2011-08-21
10 227-delnp-2004-form-18.pdf 2011-08-21
11 227-delnp-2004-form-1.pdf 2011-08-21
12 227-delnp-2004-drawings.pdf 2011-08-21
13 227-delnp-2004-description (complete).pdf 2011-08-21
14 227-delnp-2004-correspondence-others.pdf 2011-08-21
15 227-delnp-2004-claims.pdf 2011-08-21
16 227-delnp-2004-assignment.pdf 2011-08-21
17 227-DELNP-2004-Abstract.pdf 2011-08-21
18 227-DELNP-2004_EXAMREPORT.pdf 2016-06-30