Sign In to Follow Application
View All Documents & Correspondence

Non Lipidated Variants Of Neisseria Meningitidis Orf2086 Antigens

Abstract: The present invention relates to compositions including an isolated non pyruvylated non lipidated ORF2086 polypeptide and methods thereof. In an exemplary embodiment the compositions described herein are immunogenic. The present invention further relates to compositions that elicit a bactericidal immune response in a mammal against an ORF2086 subfamily B polypeptide from serogroup B Neisseria meningitidis and methods related thereto.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
18 February 2013
Publication Number
41/2014
Publication Type
INA
Invention Field
PHARMACEUTICALS
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2019-03-28
Renewal Date

Applicants

WYETH LLC
Five Giralda Farms Madison New Jersey 07940

Inventors

1. ANDERSON Annaliesa Sybil
Pfizer Inc. 401 N. Middletown Road Building 140 4th Floor Pearl River New York 10965
2. HOISETH Susan Kay
17 Coe Farm Road Montebello NY 10901
3. JANSEN Kathrin Ute
Pfizer Inc. 401 N. Middletown Road Building 140 4th Floor Pearl River New York 10965
4. MORAN Justin Keith
Pfizer Inc. 401 N. Middletown Road Building 140 4th Floor Pearl River New York 10965
5. RUPPEN Mark Edward
Pfizer Inc. 401 N. Middletown Road Building 140 4th Floor Pearl River New York 10965

Specification

NON-LIPIDATED VARIANTS OF NEISSERIA MENINGITIDIS
ORF2086 ANTIGENS
This application asserts priority to U.S. Provisional Application Serial No.
61/381 ,837, filed on September 10, 201 0, which is hereby incorporated by reference in
its entirety.
FIELD OF THE INVENTION
The present invention relates to non-lipidated variants of Neisseria meningitidis
ORF2086 antigens in immunogenic compositions as described herein. The present
invention also relates to methods of preserving the conformation of non-lipidated
variants of Neisseria meningitidis ORF2086 antigens. The present invention further
includes compositions and methods relating to improved expression of non-lipidated N.
meningitidis ORF2086 antigens, as compared to the corresponding wild-type antigen.
Background of the Invention
rLP2086 is a recombinant 28-kDa lipoprotein that induces cross-reactive
bacterial antibodies against a number of Neisseria meningitidis strains, including
Neisseria meningitidis serotype B (MnB) strains, or more precisely, serogroup B (MnB)
strains. Based on deduced amino acid sequence homology, two different subfamilies of
rLP2086 were identified, A and B. These two subfamilies were used in the formulation
of the MnB-rLP2086 vaccine samples containing 20, 60,120, and 200 mg mL each in 10
mM Histidine (pH 6.0), 150 mM NaCI, and 0.5 mg/mL aluminum with varying levels of
Polysorbate 80 (PS-80). Native LP2086 is a lipoprotein. Fletcher et al. Infection &
Immunity vol. 72(4):2088-2100 (2004) demonstrated that rLP2086 with an amino
terminal lipid was more immunogenic than non-lipidated versions of the same protein in
mice. Additional preclinical and clinical studies have demonstrated that the combination
of these two lipidated proteins can provide broad coverage across the fHBP family .
Meningococcal meningitis is a devastating disease that can kill children and young
adults within hours despite the availability of antibiotics. There remains a need for
suitable serogroup B meningococcal immunogenic compositions.
Summary of the Invention
To meet these and other needs for a meningococcal vaccine, additional
compositions have been evaluated to provide coverage for using non-lipidated variants
of N. meningitidis ORF2086 polypeptides. A first aspect of the present invention
provides an immunogenic composition comprising a non-lipidated ORF2086 protein,
wherein the ORF2086 protein is a B44, a B02, a B03, a B22, a B24, a B09, an A05, an
A04, an A12, or an A22 variant. In some embodiments, the ORF2086 protein is a B44,
a B22, a B09, an A05, an A12, or an A22 variant.
Another aspect of the present invention provides an immunogenic composition
comprising a non-lipidated ORF2086 protein Subfamily B variant (P2086 Subfamily B
polypeptide). In some embodiments, the P2086 Subfamily B polypeptide is a B44, a
B02, a B03, a B22, a B24, or a B09 variant. In some embodiments, the immunogenic
composition further comprises a non-lipidated ORF2086 protein Subfamily A variant
(P2086 Subfamily A polypeptide). In some embodiments, the P2086 Subfamily A
polypeptide is an A05, an A04, an A 12, or an A22 variant.
In some embodiments, the immunogenic composition further comprises an
adjuvant. In some embodiments, the adjuvant is an aluminum adjuvant, a saponin, a
CpG nucleotide sequence or any combination thereof. In some embodiments, the
aluminum adjuvant is AIP0 , AI(OH)3, Al2(S0 4 )3, or alum. In some embodiments the
concentration of aluminum in the immunogenic composition is between 0.125 g/ml and
0.5 g/r l. In some embodiments the concentration of aluminum in the immunogenic
composition is 0.25 pg/ml. In a preferred embodiment, the concentration of aluminum in
the immunogenic composition is between 0.125 mg/ml and 0.5 mg/ml. In some
preferred embodiments the concentration of aluminum in the immunogenic composition
is 0.25 mg/ml.
In some embodiments, the saponin concentration in the immunogenic
composition is between 1 mg/ml and 250 mg ml. In some embodiments, the saponin
concentration in the immunogenic composition is between 10 mg ml and 100 mg/ml. In
some embodiments, the saponin concentration in the immunogenic composition is 10
mg/ml. In some embodiments, the saponin concentration in the immunogenic
composition is 100 mg ml. In some embodiments, the saponin is QS-21 Stimulon®
(Agenus, Lexington, MA) or ISCOMATRIX® (CSL Limited, Parkville, Australia).
In some embodiments, the immunogenic composition confers the ability to raise
an immunogenic response to Neisseria meningitidis after administration of multiple
doses of the immunogenic composition to a subject. In some embodiments, the
immunogenic response is conferred after administration of two doses to the subject. In
some embodiments, the immunogenic response is conferred after administration of
three doses to the subject.
Another aspect of the invention provides a composition conferring increased
immunogenicity of a non-lipidated P2086 antigen, wherein the composition comprises a
saponin and at least one non-lipidated P2086 antigen. In some embodiments, the
saponin concentration in the immunogenic composition is between 1 mg ml and 250
g/ml. In some embodiments, the saponin concentration in the immunogenic
composition is between 10 g/ml and 100 mg/ml. In some embodiments, the saponin
concentration in the immunogenic composition is 10 Mg/ml. In some embodiments, the
saponin concentration in the immunogenic composition is 100 mg/ml. In some
embodiments, the saponin is QS-21 or ISCOMATRIX.
In some embodiments, the composition further comprises aluminum. In some
embodiments, the aluminum is present as AIP0 4, AI(OH)3, Al2(S0 4 )3, or alum. In some
embodiments the concentration of aluminum in the composition is between 0.125 mg ml
and 0.5 Mg/ml. In some embodiments the concentration of aluminum in the composition
is 0.25 g/ml. In a preferred embodiment, the concentration of aluminum in the
composition is between 0.1 25 mg/ml and 0.5 mg/ml. In some preferred embodiments
the concentration of aluminum in the composition is 0.25 mg/ml.
In some embodiments, the immunogenic composition confers the ability to raise
an immunogenic response to Neisseria meningitidis after administration of multiple
doses of the immunogenic composition to a subject. In some embodiments, the
immunogenic response is conferred after administration of two doses to the subject. In
some embodiments, the immunogenic response is conferred after administration of
three doses to the subject.
In some embodiments, the non-lipidated P2086 antigen is a P2086 Subfamily B
polypeptide. In some embodiments, the P2086 Subfamily B polypeptide is a B44, a
B02, a B03, a B22, a B24 or a B09 variant. In some embodiments, the non-lipidated
P2086 antigen is a P2086 Subfamily A polypeptide. In some embodiment, the P2086
Subfamily A polypeptide is an A05, an A04, an A 12, or an A22 variant.
In some embodiments, the composition comprises at least two non-lipidated
P2086 antigens, wherein the two non-lipidated P2086 antigens are at least one
non-lipidated P2086 Subfamily A polypeptide and at least one non-lipidated P2086
Subfamily B polypeptide. In some embodiments, the non-lipidated P2086 Subfamily A
polypeptide is an A05 variant and the non-lipidated P2086 Subfamily B polypeptide is a
B44 variant. In some embodiments, the non-lipidated P2086 Subfamily A polypeptide is
an A05 variant and the non-lipidated P2086 Subfamily B polypeptide is a B22 variant.
In some embodiments, the non-lipidated P2086 Subfamily A polypeptide is an A05
variant and the non-lipidated P2086 Subfamily B polypeptide is a B09 variant.
Another aspect of the invention provides a method for conferring immunity to a
subject against a Neisseria meningitidis bacteria, wherein the method comprises the
step of administering to the subject an immunogenic composition comprising a
non-lipidated P2086 Subfamily B polypeptide. In some embodiments, the P2086
Subfamily B polypeptide is a B44, a B02, a B03, a B22, a B24 or a B09 variant. In
some embodiments, the immunogenic composition further comprises a P2086
Subfamily A polypeptide. In some embodiments, the P2086 Subfamily A polypeptide is
an A05, an A04, an A 12, or an A22 variant.
In some embodiments, the immunogenic composition further comprises an
adjuvant. In some embodiments, the adjuvant is an aluminum adjuvant, a saponin, a
CpG nucleotide sequence or any combination thereof. In some embodiments, the
aluminum adjuvant is AIP0 4, AI(OH)3, A I2(S0 4 )3, or alum. In some embodiments, the
concentration of aluminum in the immunogenic composition is between 0.125 g/ml and
0.5 pg/ml. In some embodiments, the concentration of aluminum in the immunogenic
composition is 0.25 pg/ml. In a preferred embodiment, the concentration of aluminum in
the immunogenic composition is between 0.125 mg/ml and 0.5 mg/ml. In some
embodiments, the concentration of aluminum in the immunogenic composition is 0.25
mg/ml.
In some embodiments, the saponin concentration in the immunogenic
composition is between 1 mg/ml and 250 mg ml. In some embodiments, the saponin
concentration in the immunogenic composition is between 10 g/ml and 100 mg/ml. In
some embodiments, the saponin concentration in the immunogenic composition is 10
pg/ml. In some embodiments, the saponin concentration in the immunogenic
composition is 100 g/ml. In some embodiments, the saponin is QS-21 or
ISCOMATRIX.
In some embodiments, the immunogenic composition is administered to the
subject in multiple doses over a dosing schedule. In some embodiments, the
immunogenic composition is administered to the subject in two doses over a dosing
schedule. In some embodiments, the immunogenic composition is administered to the
subject in three doses over a dosing schedule.
Another aspect of the invention provides a method of producing a non-lipidated
P2086 variant comprising the steps of (a) cloning an ORF2086 variant nucleic acid into
an expression vector to generate an ORF2086 expression vector; (b) transforming
bacteria with the OFR2086 expression vector; (c) inducing expression of the P2086
variant from the ORF2086 expression vector; and (d) isolating the expressed P2086
variant protein; wherein the ORF2086 expression vector does not comprise a lipidation
control sequence. In some embodiments, the bacteria is E. coli. In some
embodiments, expression is induced by addition of IPTG.
In some embodiments, the codon encoding the N-terminal Cys of the P2086
variant is deleted. In some embodiments, the codon encoding the N-terminal Cys of the
P2086 variant is mutated to generate an Ala, Gly or Val codon. In some embodiments,
the P2086 variant is an A05, B01 , or B44 variant. In some embodiments, the P2086
variant is a B09 variant.
In some embodiments, the N-terminal tail is mutated to add Ser and Gly residues
to extend the Gly/Ser stalk immediately downstream of the N-terminal Cys. In some
embodiments, the total number of Gly and Ser residues in the Gly/Ser stalk is at least 7,
at least 8, at least 9, at least 10, at least 11, or at least 12.
In some embodiments, the codons of the N-terminal tail of the P2086 variant are
optimized by point mutagenesis. In some embodiments, the codons of the N-terminal
tail of the ORF2086 variant are optimized by point mutagenesis such that the codon
encoding the fifth amino acid of the ORF2086 variant is 100% identical to nucleotides
13-1 5 of SEQ ID NO: 8 and the codon encoding the thirteenth amino acid of the
ORF2086 variant is 100% identical to nucleotides 37-39 of SEQ ID NO: 8 . In some
embodiments, the N-terminal tail of the non-lipidated ORF2086 variant is optimized
such that the 5' 45 nucleic acids are 100% identical to nucleic acids 1-45 of SEQ ID NO:
8. In some embodiments, the N-terminal tail of the non-lipidated ORF2086 variant is
optimized such that the 5' 42 nucleic acids are 100% identical to nucleic acids 4-45 of
SEQ ID NO: 8. In some embodiments, the N-terminal tail of the non-lipidated ORF2086
variant is optimized such that the 5' 39 nucleic acids are 100% identical to nucleic acids
4-42 of SEQ ID NO: 8. In some embodiments, the N-terminal tail of the non-lipidated
P2086 variant comprises at least one amino acid substitution compared to amino acids
1-15 of SEQ ID NO: 18. In some embodiments, the N-terminal tail of the non-lipidated
P2086 variant comprises two amino acid substitutions compared to amino acids 1-15 of
SEQ ID NO: 18. In some embodiments, the N-terminal tail of the non-lipidated P2086
variant comprises at least one amino acid substitution compared to amino acids 2-15 of
SEQ ID NO: 8. In some embodiments, the N-terminal tail of the non-lipidated P2086
variant comprises two amino acid substitutions compared to amino acids 2- 5 of SEQ
ID NO: 18. In some embodiments, the amino acid substitutions are conservative amino
acid substitutions.
In one embodiment, the present invention relates to stable formulations of
Neisseria meningitis ORF2086 Subfamily B Antigens in immunogenic compositions.
The present invention also relates to methods of preserving the conformation of
Neisseria meningitis ORF2086 Antigens and methods for determining the potency of
Neisseria meningitis rl_P2086 antigens.
In one aspect, the invention relates to a composition that includes an isolated
non-pyruvylated non-lipidated ORF2086 polypeptide. In one embodiment, the
composition is immunogenic. In another embodiment, the polypeptide includes a
deletion of an N-terminal Cys compared to the corresponding wild-type non-lipidated
ORF2086 polypeptide. In one embodiment, the polypeptide includes the amino acid
sequence selected from the group consisting of SEQ ID NO:1 2, SEQ ID NO:13, SEQ ID
NO:14, SEQ ID NO:15, SEQ ID NO :16, SEQ ID NO:17, SEQ ID NO:1 8, SEQ ID NO:1 9,
SEQ ID NO: 20, and SEQ ID NO: 2 1, wherein the cysteine at position 1 is deleted. In
another embodiment, the polypeptide includes the amino acid sequence selected from
the group consisting of SEQ ID NO: 44, SEQ ID NO: 49, SEQ ID NO: 50, and SEQ ID
NO: 55.
In yet another embodiment, the polypeptide is encoded by a nucleotide sequence
that is operatively linked to an expression system, wherein said expression system is
capable of being expressed in a bacterial cell. In one embodiment, the expression
system is a plasmid expression system. In one embodiment, the bacterial cell is an E.
coli cell. In another embodiment, the nucleotide sequence is linked to a regulatory
sequence that controls expression of said nucleotide sequence.
In another aspect, the invention relates to a composition that includes a nonpyruvylated
non-lipidated ORF2086 polypeptide obtainable by a process. The process
includes expressing a nucleotide sequence encoding a polypeptide having the amino
acid sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:13,
SEQ ID NO:14, SEQ ID NO:1 5, SEQ ID NO:16 SEQ ID NO:17, SEQ ID NO:18, SEQ
ID NO:1 9, SEQ ID NO: 20, and SEQ ID NO: 2 1, wherein the cysteine at position 1 is
deleted, wherein the nucleotide sequence is operatively linked to an expression system
that is capable of being expressed in a bacterial cell. In one embodiment, the bacterial
cell is E. coli.
In one aspect, the invention relates to a composition that includes an isolated
polypeptide, which includes the amino acid sequence set forth in SEQ ID NO: 49, and
an isolated polypeptide, which includes the amino acid sequence set forth in SEQ ID
NO: 44. In one embodiment, the compositions described herein are immunogenic. In
another embodiment, the compositions described herein further include an ORF2086
subfamily A polypeptide from serogroup B N. meningitidis. In another embodiment,
compositions described herein elicit a bactericidal immune response in a mammal
against an ORF2086 subfamily B polypeptide from serogroup B N. meningitidis.
In one aspect, the invention relates to an isolated polypeptide that includes the
amino acid sequence set forth in SEQ ID NO: 49. In another aspect, the invention
relates to an isolated nucleotide sequence that includes SEQ ID NO: 46. In one aspect,
the invention relates to an isolated nucleotide sequence that includes SEQ ID NO: 47.
In one aspect, the invention relates to an isolated nucleotide sequence that includes
SEQ ID NO: 48. In one aspect, the invention relates to an isolated polypeptide that
includes the amino acid sequence set forth in SEQ ID NO: 50. In one aspect, the
invention relates to an isolated nucleotide sequence that includes SEQ ID NO: 45. In
one aspect, the invention relates to an isolated polypeptide that includes the amino acid
sequence set forth in SEQ ID NO: 44.
In one aspect, the invention relates to a plasmid that includes a nucleotide
sequence selected from the group consisting of SEQ ID NO: 46, SEQ ID NO: 47, SEQ
ID NO: 48, and SEQ ID NO: 45, wherein the plasmid is capable of being expressed in a
bacterial cell. In one embodiment, the bacterial cell is E. coli.
In one aspect, the invention relates to a method of eliciting bactericidal antibodies
specific to an ORF2086 subfamily B serogroup B N. meningitidis in a mammal. The
method includes administering to the mammal an effective amount of an isolated
polypeptide that includes the amino acid sequence selected from the group consisting
of SEQ ID NO: 44 and SEQ ID NO: 49, or a combination thereof.
In one aspect, the invention relates to a method for producing a polypeptide. The
method includes expressing in a bacterial cell a polypeptide, which includes a sequence
having greater than 90% identity to SEQ ID NO:21 , said sequence including at least one
domain selected from the group consisting of amino acids 13-18 of SEQ ID NO: 2 1,
amino acids 2 1-34 of SEQ ID NO: 2 1, and amino acids 70-80 of SEQ ID NO: 2 1, or a
combination thereof, wherein the sequence lacks an N-terminal cysteine. The method
further includes purifying the polypeptide. In one embodiment, the sequence further
includes at least one domain selected from the group consisting of amino acids 96-1 16
of SEQ ID NO: 2 1, amino acids 158-1 70 of SEQ ID NO: 2 1, amino acids 172-1 85 of
SEQ ID NO: 2 1, amino acids 187-1 99 of SEQ ID NO: 2 1, amino acids 2 13-224 of SEQ
ID NO: 2 1, amino acids 226-237 of SEQ ID NO: 2 1, amino acids 239-248 of SEQ ID
NO: 2 1, or a combination thereof. In one embodiment, the bacterial cell is E. coli.
In one aspect, the invention relates to an isolated polypeptide produced by a
process that includes the method described herein. In another aspect, the invention
relates to an immunogenic composition produced by a process that includes the method
described herein.
In one aspect, the invention relates to an immunogenic composition that includes
an ORF2086 subfamily B polypeptide from serogroup B N. meningitidis, wherein the
polypeptide is a non-pyruvylated non-lipidated B44. In one embodiment, the
composition further includes a second ORF2086 subfamily B polypeptide from
serogroup B N. meningitidis, wherein the second polypeptide is a non-pyruvylated nonlipidated
B09. In one embodiment, the composition includes no more than 3 ORF2086
subfamily B polypeptides. In another embodiment, the composition includes no more
than 2 ORF2086 subfamily B polypeptides. In one embodiment, the composition further
includes a ORF2086 subfamily A polypeptide. In another embodiment, the composition
includes an A05 subfamily A polypeptide.
Brief Description of the Drawings
Figure 1: P2086 Variant Nucleic Acid Sequences.
Figure 2: P2086 Variant Amino Acid Sequences. The Gly/Ser stalk in the N-terminal tail
of each variant is underlined.
Figure 3: Structure of the ORF2086 Protein
Figure 4: Removal of N-terminal Cys Results in Loss of Expression in E. coli.
Figure 5: Effect of Gly/Ser Stalk Length on Non-lipidated ORF2086 Variant Expression.
The sequence associated with the protein variant labeled B01 is set forth in SEQ ID NO:
35. The sequence associated with the protein variant labeled B44 is set forth in SEQ ID
NO: 36. The sequence associated with the protein variant labeled A05 is set forth in
SEQ ID NO: 37. The sequence associated with the protein variant labeled A22 is set
forth in SEQ ID NO: 38. The sequence associated with the protein variant labeled B22
is set forth in SEQ ID NO: 39. The sequence associated with the protein variant labeled
A 19 is set forth in SEQ ID NO: 40.
Figure 6: High Levels of Non-lipidated B09 Expression Despite A Short Gly/Ser Stalk.
The left two lanes demonstrated expression of the N-terminal Cys-deleted B09 variant
before and after induction. The third and fourth lanes demonstrate expression of the
N-terminal Cys positive B09 variant before and after induction. The right most lane is a
molecular weight standard. The amino acid sequence shown under the image is set
forth in SEQ ID NO: 4 1. The nucleotide sequence representative of the N-terminal Cysdeleted
A22 variant, referred to as "A22 001" in the figure, is set forth in SEQ ID NO:
42, which is shown under SEQ ID NO: 4 1 in the figure. The nucleotide sequence
representative of the N-terminal Cys-deleted B22 variant, referred to as "B22_001" in
the figure, is set forth in SEQ ID NO: 52. The nucleotide sequence representative of the
N-terminal Cys-deleted B09 variant, referred to as "B09_004" in the figure, is set forth in
SEQ ID NO: 53.
Figure 7: Codon Optimization Increases Expression of Non-lipidated B22 and A22
Variants. The left panel demonstrates expression of the N-terminal Cys-deleted B22
variant before (lanes 1 and 3) and after (lanes 2 and 4) IPTG induction. The right panel
demonstrates expression of the N-terminal Cys-deleted A22 variant before (lane 7) and
after (lane 8) IPTG induction. Lanes 5 and 6 are molecular weight standards.
Figure 8: P2086 Variant Nucleic and Amino Acid Sequences
Sequence Identifiers
SEQ ID NO: 1 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant A04 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 2 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant A05 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 3 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant A12 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 4 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant A12-2 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 5 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant A22 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 6 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B02 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 7 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B03 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 8 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B09 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 9 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B22 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 10 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B24 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 11 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B44 gene, which includes a codon encoding an N-terminal Cys.
SEQ ID NO: 12 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant A04, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 13 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant A05, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 14 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant A12, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 15 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant A22, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 16 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B02, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 17 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B03, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 18 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B09, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 19 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B22, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 20 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B24, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 2 1 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B44, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 22 sets forth a DNA sequence for a forward primer, shown in Example 2 .
SEQ ID NO: 23 sets forth a DNA sequence for a reverse primer, shown in Example 2 .
SEQ ID NO: 24 sets forth a DNA sequence for a forward primer, shown in Example 2,
Table 1.
SEQ ID NO: 25 sets forth a DNA sequence for a reverse primer, shown in Example 2,
Table 1.
SEQ ID NO: 26 sets forth a DNA sequence for a forward primer, shown in Example 2,
Table 1.
SEQ ID NO: 27 sets forth a DNA sequence for a reverse primer, shown in Example 2,
Table 1.
SEQ ID NO: 28 sets forth a DNA sequence for a Gly/Ser stalk, shown in Example 4 .
SEQ ID NO: 29 sets forth the amino acid sequence for a Gly/Ser stalk, shown in
Example 4, which is encoded by, for example SEQ ID NO: 28.
SEQ ID NO: 30 sets forth a DNA sequence for a Gly/Ser stalk, shown in Example 4 .
SEQ ID NO: 3 1 sets forth the amino acid sequence a Gly/Ser stalk, shown in Example
4, which is encoded by, for example SEQ ID NO: 30.
SEQ ID NO: 32 sets forth a DNA sequence for a Gly/Ser stalk, shown in Example 4 .
SEQ ID NO: 33 sets forth the amino acid sequence for a Gly/Ser stalk, which is
encoded by, for example, SEQ ID NO: 32 and SEQ ID NO: 34.
SEQ ID NO: 34 sets forth a DNA sequence for a Gly/Ser stalk, shown in Example 4 .
SEQ ID NO: 35 sets forth the amino acid sequence for the N-terminus of N.
meningitidis, serogroup B, 2086 variant B01 , shown in Figure 5.
SEQ ID NO: 36 sets forth the amino acid sequence for the N-terminus of N.
meningitidis, serogroup B, 2086 variant B44, shown in Figure 5.
SEQ ID NO: 37 sets forth the amino acid sequence for the N-terminus of N.
meningitidis, serogroup B, 2086 variant A05, shown in Figure 5.
SEQ ID NO: 38 sets forth the amino acid sequence for the N-terminus of N.
meningitidis, serogroup B, 2086 variant A22, shown in Figure 5.
SEQ ID NO: 39 sets forth the amino acid sequence for the N-terminus of N.
meningitidis, serogroup B, 2086 variant B22, shown in Figure 5.
SEQ ID NO: 40 sets forth the amino acid sequence for the N-terminus of N.
meningitidis, serogroup B, 2086 variant A 19, shown in Figure 5.
SEQ ID NO: 4 1 sets forth the amino acid sequence for the N-terminus of a N.
meningitidis, serogroup B, 2086 variant, shown in Figure 6.
SEQ ID NO: 42 sets forth a DNA sequence for the N-terminus of N. meningitidis,
serogroup B, 2086 variant A22, shown in Figure 6 .
SEQ ID NO: 43 sets forth a codon-optimized DNA sequence for the N. meningitidis,
serogroup B, 2086 variant B44 gene, wherein the codon encoding an N-terminal
cysteine is deleted, as compared to SEQ ID NO: 11. Plasmid pDK087 includes SEQ ID
NO: 43.
SEQ ID NO: 44 sets forth the amino acid sequence for a non-lipidated N. meningitidis,
serogroup B, 2086 variant B44. SEQ ID NO: 44 is identical to SEQ ID NO: 2 1 wherein
the N-terminal cysteine at position 1 of SEQ ID NO: 2 1 is deleted. SEQ ID 44 is
encoded by, for example, SEQ ID NO: 43.
SEQ ID NO: 45 sets forth a codon-optimized DNA sequence for the N. meningitidis,
serogroup B, 2086 variant B09 gene, wherein the codon encoding an N-terminal
cysteine is deleted, and wherein the sequence includes codons encoding an additional
Gly/Ser region, as compared to SEQ ID NO: 8 . Plasmid pEB063 includes SEQ ID NO:
45.
SEQ ID NO: 46 sets forth a codon-optimized DNA sequence for the N. meningitidis,
serogroup B, 2086 variant B09 gene, wherein the codon encoding an N-terminal
cysteine is deleted, as compared to SEQ ID NO: 8. Plasmid pEB064 includes SEQ ID
NO: 46.
SEQ ID NO: 47 sets forth a codon-optimized DNA sequence for the N. meningitidis,
serogroup B, 2086 variant B09 gene, wherein the codon encoding an N-terminal
cysteine is deleted, as compared to SEQ ID NO: 8. Plasmid pEB 065 includes SEQ ID
NO: 47.
SEQ ID NO: 48 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B09 gene, wherein the codon encoding an N-terminal cysteine is deleted, as
compared to SEQ ID NO: 8. Plasmid pLA1 34 includes SEQ ID NO: 48.
SEQ ID NO: 49 sets forth the amino acid sequence for a non-lipidated N. meningitidis,
serogroup B, 2086 variant B09. SEQ ID NO: 49 is identical to SEQ ID NO: 8 wherein
the N-terminal cysteine at position 1 of SEQ ID NO: 18 is deleted. SEQ ID 49 is
encoded by, for example, a DNA sequence selected from the group consisting of SEQ
ID NO: 46, SEQ ID NO: 47, and SEQ ID NO: 48.
SEQ ID NO: 50 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B09, wherein the codon encoding an N-terminal cysteine is deleted and
wherein the sequence includes codons encoding an additional Gly/Ser region, as
compared to SEQ ID NO: 18. SEQ ID NO: 50 is encoded by, for example, SEQ ID NO:
45.
SEQ ID NO: 5 1 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B44 gene, wherein the codon encoding an N-terminal cysteine is deleted, as
compared to SEQ ID NO: 11. Plasmid pLN056 includes SEQ ID NO: 5 1 .
SEQ ID NO: 52 sets forth a DNA sequence for the N-terminus of N. meningitidis,
serogroup B, 2086 variant B22, shown in Figure 6 .
SEQ ID NO: 53 sets forth a DNA sequence for the N-terminus of N. meningitidis,
serogroup B, 2086 variant B09, shown in Figure 6 .
SEQ ID NO: 54 sets forth a DNA sequence for a N. meningitidis, serogroup B, 2086
variant A05 gene, wherein the codon encoding an N-terminal cysteine is deleted, as
compared to SEQ ID NO: 2.
SEQ ID NO: 55 sets forth the amino acid sequence for a non-lipidated N. meningitidis,
serogroup B, 2086 variant A05. SEQ ID NO: 55 is identical to SEQ ID NO: 13 wherein
the N-terminal cysteine at position 1 of SEQ ID NO: 13 is deleted. SEQ ID NO: 55 is
encoded by, for example, SEQ ID NO: 54.
SEQ ID NO: 56 sets forth the amino acid sequence of a serine-glycine repeat
sequence, shown in Example 7.
SEQ ID NO: 57 sets forth the amino acid sequence for a non-lipidated N. meningitidis,
serogroup B, 2086 variant B01 . SEQ ID NO: 57 is identical to SEQ ID NO: 58 wherein
the N-terminal cysteine at position 1 of SEQ ID NO: 58 is deleted.
SEQ ID NO: 58 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B01 , which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 59 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B15, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 60 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B16, which includes an N-terminal Cys at amino acid position 1.
SEQ ID NO: 6 1 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant B22,in which the codon for the N-terminal Cys at amino acid position 1 of SEQ
ID NO: 19 is replaced with a codon for a Glycine.
SEQ ID NO: 62 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant B22, in which the N-terminal Cys at amino acid position 1 of SEQ ID NO:
19 is replaced with a Glycine.
SEQ ID NO: 63 sets forth a DNA sequence for the N. meningitidis, serogroup B, 2086
variant A22,in which the codon for the N-terminal Cys at amino acid position 1 of SEQ
ID NO: 15 is replaced with a codon for a Glycine.
SEQ ID NO: 64 sets forth the amino acid sequence for the N. meningitidis, serogroup B,
2086 variant A22, in which the N-terminal Cys at amino acid position 1 of SEQ ID NO:
15 is replaced with a Glycine.
Detailed Description of the Invention
Unless defined otherwise, all technical and scientific terms used herein have the
same meaning as those commonly understood by one of ordinary skill in the art to
which this invention belongs. Although methods and materials similar or equivalent to
those described herein can be used in the practice or testing of the present invention,
suitable methods and materials are described below. The materials, methods and
examples are illustrative only, and are not intended to be limiting. All publications,
patents and other documents mentioned herein are incorporated by reference in their
entirety.
It is noted that in this disclosure, terms such as "comprises", "comprised",
"comprising", "contains", "containing" and the like can have the meaning attributed to
them in U.S. patent law; e.g., they can mean "includes", "included", "including" and the
like. Such terms refer to the inclusion of a particular ingredients or set of ingredients
without excluding any other ingredients. Terms such as "consisting essentially of and
"consists essentially of have the meaning attributed to them in U.S. patent law, e.g.,
they allow for the inclusion of additional ingredients or steps that do not detract from the
novel or basic characteristics of the invention, i.e., they exclude additional unrecited
ingredients or steps that detract from novel or basic characteristics of the invention, and
they exclude ingredients or steps of the prior art, such as documents in the art that are
cited herein or are incorporated by reference herein, especially as it is a goal of this
document to define embodiments that are patentable, e.g., novel, non-obvious,
inventive, over the prior art, e.g., over documents cited herein or incorporated by
reference herein. And, the terms "consists of and "consisting of have the meaning
ascribed to them in U.S. patent law; namely, that these terms are close-ended.
Accordingly, these terms refer to the inclusion of a particular ingredient or set of
ingredients and the exclusion of all other ingredients.
Definitions
As used herein, the singular forms "a," "an," and "the" include plural references
unless the context clearly dictates otherwise. Thus, e.g., references to "the method"
includes one or more methods, and/or steps of the type described herein and/or which
will become apparent to one of ordinary skill in the art upon reading this disclosure and
so forth.
As used herein, the plural forms include singular references unless the context
clearly dictates otherwise. Thus, e.g., references to "the methods" includes one or more
methods, and/or steps of the type described herein and/or which will become apparent
to one of ordinary skill in the art upon reading this disclosure and so forth.
As used herein, "about" means within a statistically meaningful range of a value
such as a stated concentration range, time frame, molecular weight, temperature or pH.
Such a range can be within an order of magnitude, typically within 20%, more typically
still within 10%, and even more typically within 5% of a given value or range. The
allowable variation encompassed by the term "about" will depend upon the particular
system under study, and can be readily appreciated by one of ordinary skill in the art.
Whenever a range is recited within this application, every whole number integer within
the range is also contemplated as an embodiment of the invention.
The term "adjuvant" refers to a compound or mixture that enhances the immune
response to an antigen as further described and exemplified herein. Non-limiting
examples of adjuvants that can be used in the vaccine of the present invention include
the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.), alum, mineral gels such as
aluminum hydroxide gel, oil-in-water emulsions, water-in-oil emulsions such as, e.g.,
Freund's complete and incomplete adjuvants, Block copolymer (CytRx, Atlanta Ga.),
QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron, Emeryville Calif.),
AMPHIGEN® adjuvant, saponin, Quil A or other saponin fraction, monophosphoryl lipid
A, and Avridine lipid-amine adjuvant.
An "antibody" is an immunoglobulin molecule capable of specific binding to a
target, such as a carbohydrate, polynucleotide, lipid, polypeptide, etc., through at least
one antigen recognition site, located in the variable region of the immunoglobulin
molecule. As used herein, unless otherwise indicated by context, the term is intended
to encompass not only intact polyclonal or monoclonal antibodies, but also engineered
antibodies (e.g., chimeric, humanized and/or derivatized to alter effector functions,
stability and other biological activities) and fragments thereof (such as Fab, Fab',
F(ab')2, Fv), single chain (ScFv) and domain antibodies, including shark and camelid
antibodies), and fusion proteins comprising an antibody portion, multivalent antibodies,
multispecific antibodies (e.g., bispecific antibodies so long as they exhibit the desired
biological activity) and antibody fragments as described herein, and any other modified
configuration of the immunoglobulin molecule that comprises an antigen recognition
site. An antibody includes an antibody of any class, such as IgG, IgA, or IgM (or
sub-class thereof), and the antibody need not be of any particular class. Depending on
the antibody amino acid sequence of the constant domain of its heavy chains,
immunoglobulins can be assigned to different classes. There are five major classes of
immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these may be further
divided into subclasses (isotypes), e.g., lgG1 , lgG2, lgG3, lgG4, lgA1 and lgA2 in
humans. The heavy-chain constant domains that correspond to the different classes of
immunoglobulins are called alpha, delta, epsilon, gamma, and mu, respectively. The
subunit structures and three-dimensional configurations of different classes of
immunoglobulins are well known.
"Antibody fragments" comprise only a portion of an intact antibody, wherein the
portion preferably retains at least one, preferably most or all, of the functions normally
associated with that portion when present in an intact antibody.
The term "antigen" generally refers to a biological molecule, usually a protein,
peptide, polysaccharide, lipid or conjugate which contains at least one epitope to which
a cognate antibody can selectively bind; or in some instances to an immunogenic
substance that can stimulate the production of antibodies or T-cell responses, or both,
in an animal, including compositions that are injected or absorbed into an animal. The
immune response may be generated to the whole molecule, or to one or more various
portions of the molecule (e.g., an epitope or hapten). The term may be used to refer to
an individual molecule or to a homogeneous or heterogeneous population of antigenic
molecules. An antigen is recognized by antibodies, T-cell receptors or other elements
of specific humoral and/or cellular immunity. The term "antigen" includes all related
antigenic epitopes. Epitopes of a given antigen can be identified using any number of
epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping
Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996)
Humana Press, Totowa, N. J . For example, linear epitopes may be determined by e.g.,
concurrently synthesizing large numbers of peptides on solid supports, the peptides
corresponding to portions of the protein molecule, and reacting the peptides with
antibodies while the peptides are still attached to the supports. Such techniques are
known in the art and described in, e.g., U.S. Pat. No. 4,708,871 ; Geysen et al. (1984)
Proc. Natl. Acad. Sci. USA 8 1 :3998-4002; Geysen et al. (1986) Molec. Immunol.
23:709-715, all incorporated herein by reference in their entireties. Similarly,
conformational epitopes may be identified by determining spatial conformation of amino
acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic
resonance. See, e.g., Epitope Mapping Protocols, supra. Furthermore, for purposes of
the present invention, an "antigen" may also be used to refer to a protein that includes
modifications, such as deletions, additions and substitutions (generally conservative in
nature, but they may be non-conservative), to the native sequence, so long as the
protein maintains the ability to elicit an immunological response. These modifications
may be deliberate, as through site-directed mutagenesis, or through particular synthetic
procedures, or through a genetic engineering approach, or may be accidental, such as
through mutations of hosts, which produce the antigens. Furthermore, the antigen can
be derived, obtained, or isolated from a microbe, e.g. a bacterium, or can be a whole
organism. Similarly, an oligonucleotide or polynucleotide, which expresses an antigen,
such as in nucleic acid immunization applications, is also included in the definition.
Synthetic antigens are also included, for example, polyepitopes, flanking epitopes, and
other recombinant or synthetically derived antigens (Bergmann et al. (1993) Eur. J.
Immunol. 23:2777 2781 ; Bergmann et al. (1996) J. Immunol. 157:3242 3249; Suhrbier,
A. (1997) Immunol and Cell Biol. 75:402 408; Gardner et al. (1998) 12th World AIDS
Conference, Geneva, Switzerland, Jun. 28 - Jul. 3, 1998).
The term "conservative" amino acid substitutions may be made on the basis of
similarity in polarity, charge, solubility hydrophobicity, hydrophilicity, and/or the
amphipathic nature of the residues involved. For example, non-polar (hydrophobic)
amino acids include alanine, leucine, isoleucine, valine, proline, tryptophan, and
methionine; polar/neutral amino acids include glycine, serine, threonine, cysteine,
tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include
arginine, lysine, and histidine; and negatively charged (acidic) amino acids include
aspartic acid and glutamic acid. In some embodiments, the conservative amino acid
changes alter the primary sequence of the ORF2086 polypeptides, but do not alter the
function of the molecule. When generating these mutants, the hydropathic index of
amino acids can be considered. The importance of the hydropathic amino acid index in
conferring interactive biologic function on a polypeptide is generally understood in the
art (Kyte & Doolittle, 1982, J. Mol. Biol., 157(1 ):1 05-32). It is known that certain amino
acids can be substituted for other amino acids having a similar hydropathic index or
score and still result in a polypeptide with similar biological activity. Each amino acid
has been assigned a hydropathic index on the basis of its hydrophobicity and charge
characteristics. Those indices are: isoleucine (+4.5); valine (+4.2); leucine (+3.8);
phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1 .9); alanine (+1 .8); glycine
(-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1 .3); proline (-1 .6);
histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5);
lysine (-3.9); and arginine (-4.5).
It is believed that the relative hydropathic character of the amino acid residue
determines the secondary and tertiary structure of the resultant polypeptide, which in
turn defines the interaction of the polypeptide with other molecules, such as enzymes,
substrates, receptors, antibodies, antigens, and the like. It is known in the art that an
amino acid can be substituted by another amino acid having a similar hydropathic index
and still obtain a functionally equivalent polypeptide. In such changes, the substitution
of amino acids whose hydropathic indices are within +1-2 is preferred, those within +/-1
are particularly preferred, and those within +/-0.5 are even more particularly preferred.
Conservative amino acids substitutions or insertions can also be made on the
basis of hydrophilicity. As described in U.S. Pat. No. 4,554,101 , which is hereby
incorporated by reference the greatest local average hydrophilicity of a polypeptide, as
governed by the hydrophilicity of its adjacent amino acids, correlates with its
immunogenicity and antigenicity, i.e., with a biological property of the polypeptide. U.S.
Pat. No. 4,554,101 reciates that the following hydrophilicity values have been assigned
to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0±1); glutamate
(+3.0±1 ); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); proline (-0.5±1 ) ;
threonine (-0.4); alanine (-0.5); histidine (-0.5); cysteine (-1 .0); methionine (-1 .3); valine
(-1 .5); leucine (-1 .8); isoleucine (-1 .8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan
(-3.4). It is understood that an amino acid can be substituted for another having a
similar hydrophilicity value and still obtain a biologically equivalent, and in particular, an
immunologically equivalent polypeptide. In such changes, the substitution of amino
acids whose hydrophilicity values are within ±2 is preferred; those within ± 1 are
particularly preferred; and those within ±0.5 are even more particularly preferred.
Exemplary substitutions which take various of the foregoing characteristics into
consideration are well known to those of skill in the art and include, without limitation:
arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and
asparagine; and valine, leucine and isoleucine.
The term "effective immunogenic amount" as used herein refers to an amount of
a polypeptide or composition comprising a polypeptide which is effective in eliciting an
immune response in a vertebrate host. For example, an effective immunogenic amount
of a rl_P2086 protein of this invention is an amount that is effective in eliciting an
immune response in a vertebrate host. The particular "effective immunogenic dosage
or amount" will depend upon the age, weight and medical condition of the host, as well
as on the method of administration. Suitable doses are readily determined by persons
skilled in the art.
The term "Gly/Ser stalk" as used herein refers to the series of Gly and Ser
residues immediately downstream of the N-terminal Cys residue of a protein encoded
by ORF2086. There can be between 5 and 12 Gly and Ser residues in the Gly/Ser
stalk. Accordingly, the Gly/Ser stalk consists of amino acids 2 to between 7 and 13 of
the protein encoded by ORF2086. Preferably, the Gly/Ser stalk consists of amino acids
2 and up to between 7 and 13 of the protein encoded by ORF2086. The Gly/Ser stalks
of the P2086 variants of the present invention are represented by the underlined
sequences in Figure 2 (SEQ ID NO: 12-21 ) . As shown herein, the length of the Gly/Ser
stalk can affect the stability or expression level of a non-lipidated P2086 variant. In an
exemplary embodiment, effects from affecting the length of the Gly/Ser stalk are
compared to those from the corresponding wild-type variant.
The term "immunogenic" refers to the ability of an antigen or a vaccine to elicit an
immune response, either humoral or cell-mediated, or both.
An "immunogenic amount", or an "immunologically effective amount" or "dose",
each of which is used interchangeably herein, generally refers to the amount of antigen
or immunogenic composition sufficient to elicit an immune response, either a cellular (T
cell) or humoral (B cell or antibody) response, or both, as measured by standard assays
known to one skilled in the art.
The term "immunogenic composition" relates to any pharmaceutical composition
containing an antigen, e.g. a microorganism, or a component thereof, which
composition can be used to elicit an immune response in a subject. The immunogenic
compositions of the present invention can be used to treat a human susceptible to N.
meningidis infection, by means of administering the immunogenic compositions via a
systemic transdermal or mucosal route. These administrations can include injection via
the intramuscular (i.m.), intraperitoneal (i.p.), intradermal (i.d.) or subcutaneous routes;
application by a patch or other transdermal delivery device; or via mucosal
administration to the oral/alimentary, respiratory or genitourinary tracts. In one
embodiment, the immunogenic composition may be used in the manufacture of a
vaccine or in the elicitation of a polyclonal or monoclonal antibodies that could be used
to passively protect or treat a subject.
Optimal amounts of components for a particular immunogenic composition can
be ascertained by standard studies involving observation of appropriate immune
responses in subjects. Following an initial vaccination, subjects can receive one or
several booster immunizations adequately spaced.
The term "isolated" means that the material is removed from its original
environment (e.g., the natural environment if it is naturally occurring or from it's host
organism if it is a recombinant entity, or taken from one environment to a different
environment). For example, an "isolated" protein or peptide is substantially free of
cellular material or other contaminating proteins from the cell or tissue source from
which the protein is derived, or substantially free of chemical precursors or other
chemicals when chemically synthesized, or otherwise present in a mixture as part of a
chemical reaction. In the present invention, the proteins may be isolated from the
bacterial cell or from cellular debris, so that they are provided in a form useful in the
manufacture of an immunogenic composition. The term "isolated" or "isolating" may
include purifying, or purification, including for example, the methods of purification of the
proteins, as described herein. The language "substantially free of cellular material"
includes preparations of a polypeptide or protein in which the polypeptide or protein is
separated from cellular components of the cells from which it is isolated or
recombinantly produced. Thus, a protein or peptide that is substantially free of cellular
material includes preparations of the capsule polysaccharide, protein or peptide having
less than about 30%, 20%, 10%, 5%, 2.5%, or 1%, (by dry weight) of contaminating
protein or polysaccharide or other cellular material. When the polypeptide/protein is
recombinantly produced, it is also preferably substantially free of culture medium, i.e.,
culture medium represents less than about 20%, 10%, or 5% of the volume of the
protein preparation. When polypeptide or protein is produced by chemical synthesis, it
is preferably substantially free of chemical precursors or other chemicals, i.e., it is
separated from chemical precursors or other chemicals which are involved in the
synthesis of the protein or polysaccharide. Accordingly, such preparations of the
polypeptide or protein have less than about 30%, 20%, 10%, 5% (by dry weight) of
chemical precursors or compounds other than polypeptide/protein or polysaccharide
fragment of interest.
The term "N-terminal tail" as used herein refers to the N-terminal portion of a
protein encoded by ORF2086, which attaches the protein to the cell membrane. An
N-terminal tail is shown at the bottom of the side view structure in Figure 3 . An
N-terminal tail typically comprises the N-terminal 16 amino acids of the protein encoded
by ORF2086. In some embodiments, the N-terminal tail is amino acids 1- 16 of any one
of SEQ ID NOs: 2-21The term "ORF2086" as used herein refers to Open Reading
Frame 2086 from a Neisseria species bacteria. Neisseria ORF2086, the proteins
encoded therefrom, fragments of those proteins, and immunogenic compositions
comprising those proteins are known in the art and are described, e.g., in
WO2003/063766, and in U.S. Patent Application Publication Nos. US 2006025741 3 and
US 20090202593, each of which is hereby incorporated by reference in its entirety.
The term "P2086" generally refers to the protein encoded by ORF2086. The "P"
before "2086" is an abbreviation for "protein." The P2086 proteins of the invention may
be lipidated or non-lipidated. "LP2086" and "P2086" typically refer to lipidated and
non-lipidated forms of a 2086 protein, respectively. The P2086 protein of the invention
may be recombinant. "rl_P2086" and "rP2086" typically refer to lipidated and
non-lipidated forms of a recombinant 2086 protein, respectively. "2086" is also known
as factor H-binding protein (fHBP) due to its ability to bind to factor H.
The term "pharmaceutically acceptable carrier" as used herein is intended to
include any and all solvents, dispersion media, coatings, antibacterial and antifungal
agents, isotonic and absorption delaying agents, and the like, compatible with
administration to humans or other vertebrate hosts. Typically, a pharmaceutically
acceptable carrier is a carrier approved by a regulatory agency of a Federal, a state
government, or other regulatory agency, or listed in the U.S. Pharmacopeia or other
generally recognized pharmacopeia for use in animals, including humans as well as
non-human mammals. The term "carrier" refers to a diluent, adjuvant, excipient, or
vehicle with which the pharmaceutical composition is administered. Such
pharmaceutical carriers can be sterile liquids, such as water and oils, including those of
petroleum, animal, vegetable or synthetic origin. Water, saline solutions and aqueous
dextrose and glycerol solutions can be employed as liquid carriers, particularly for
injectable solutions. Suitable pharmaceutical excipients include starch, glucose,
lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water,
ethanol and the like. The composition, if desired, can also contain minor amounts of
wetting, bulking, emulsifying agents, or pH buffering agents. These compositions can
take the form of solutions, suspensions, emulsion, sustained release formulations and
the like. Examples of suitable pharmaceutical carriers are described in "Remington's
Pharmaceutical Sciences" by E. W. Martin. The formulation should suit the mode of
administration. The appropriate carrier will be evident to those skilled in the art and will
depend in large part upon the route of administration.
A "protective" immune response refers to the ability of an immunogenic
composition to elicit an immune response, either humoral or cell mediated, which serves
to protect the subject from an infection. The protection provided need not be absolute,
i.e., the infection need not be totally prevented or eradicated, if there is a statistically
significant improvement compared with a control population of subjects, e.g. infected
animals not administered the vaccine or immunogenic composition. Protection may be
limited to mitigating the severity or rapidity of onset of symptoms of the infection. In
general, a "protective immune response" would include the induction of an increase in
antibody levels specific for a particular antigen in at least 50% of subjects, including
some level of measurable functional antibody responses to each antigen. In particular
situations, a "protective immune response" could include the induction of a two fold
increase in antibody levels or a four fold increase in antibody levels specific for a
particular antigen in at least 50% of subjects, including some level of measurable
functional antibody responses to each antigen. In certain embodiments, opsonising
antibodies correlate with a protective immune response. Thus, protective immune
response may be assayed by measuring the percent decrease in the bacterial count in
a serum bactericidal activity (SBA) assay or an opsonophagocytosis assay, for instance
those described below. Such assays are also known in the art. For meningococcal
vaccines, for example, the SBA assay is an established surrogate for protection. In
some embodiments, there is a decrease in bacterial count of at least 10%, 25%, 50%,
65%, 75%, 80%, 85%, 90%, 95% or more, as compared to the bacterial count in the
absence of the immunogenic composition.
The terms "protein", "polypeptide" and "peptide" refer to a polymer of amino acid
residues and are not limited to a minimum length of the product. Thus, peptides,
oligopeptides, dimers, multimers, and the like, are included within the definition. Both
full-length proteins and fragments thereof are encompassed by the definition. The
terms also include modifications, such as deletions, additions and substitutions
(generally conservative in nature, but which may be non-conservative), to a native
sequence, preferably such that the protein maintains the ability to elicit an
immunological response within an animal to which the protein is administered. Also
included are post-expression modifications, e.g. glycosylation, acetylation, lipidation,
phosphorylation and the like.
The term "recombinant" as used herein refers to any protein, polypeptide, or cell
expressing a gene of interest that is produced by genetic engineering methods. The
term "recombinant" as used with respect to a protein or polypeptide, means a
polypeptide produced by expression of a recombinant polynucleotide. The proteins of
the present invention may be isolated from a natural source or produced by genetic
engineering methods. "Recombinant," as used herein, further describes a nucleic acid
molecule, which, by virtue of its origin or manipulation, is not associated with all or a
portion of the polynucleotide with which it is associated in nature. The term
"recombinant" as used with respect to a host cell means a host cell which includes a
recombinant polynucleotide.
The terms "stablizer" refers to a compound that binds to an antigen and
maintains the epitopes or immunoreactivity of the antigen over a period of time.
Stabilizers are known in the art. Examples of stabilizers include multivalent cations, for
example, calcium or aluminum.
The term "subject" refers to a mammal, bird, fish, reptile, or any other animal.
The term "subject" also includes humans. The term "subject" also includes household
pets. Non-limiting examples of household pets include: dogs, cats, pigs, rabbits, rats,
mice, gerbils, hamsters, guinea pigs, ferrets, birds, snakes, lizards, fish, turtles, and
frogs. The term "subject" also includes livestock animals. Non-limiting examples of
livestock animals include: alpaca, bison, camel, cattle, deer, pigs, horses, llamas,
mules, donkeys, sheep, goats, rabbits, reindeer, yak, chickens, geese, and turkeys.
The term "mammals" as used herein refers to any mammal, such as, for
example, humans, mice, rabbits, non-human primates. In a preferred embodiment, the
mammal is a human.
The terms "vaccine" or "vaccine composition", which are used interchangeably,
refer to pharmaceutical compositions comprising at least one immunogenic composition
that induces an immune response in a subject.
General Description
The present invention arises out of the novel discovery that particular
formulations and dosing schedules of non-lipidated variants of P2086 elicit higher
bactericidal antibody titers than previous formulations of P2086, as described, for
example, in Fletcher et al., Infection & Immunity. Vol. 72(4):2088-21 00 (2004).
Alternatively, the present invention arises out of the novel discovery that particular
formulations and dosing schedules of non-lipidated variants of P2086 elicit higher
bactericidal antibody titers than commercially available formulations of lipidated LP2086
variants. It is noted, however, that commercial formulations of lipidated LP2086 may
not be presently available. Higher response rates (as defined by a four fold increase or
greater in SBA titers over baseline) were observed for the vaccine containing the
non-lipidated rP2086 variant compared to the lipidated rl_P2086 vaccine. The
formulation of the non-lipidated P2086 variant elicited bactericidal antibodies against a
broader spectrum of strains, including strains with both similar (>92% ID) and diverse
(<92% ID) LP2086 sequences.
The present invention also identifies previously unidentified difficulties expressing
non-lipidated P2086 variants and provides methods for overcoming these difficulties
and novel compositions there from. While plasmid constructs encoding non-lipidated
P2086 variants provided strong expression of the non-lipidated variants, these variants
were pyruvylated on the N-terminal Cys. Pyruvylation prevents or reduces the
likelihood of manufacturing consistency or uniformity of the polypeptides. The inventors
further found that deletion of the N-terminal Cys from the non-lipidated P2086 variant
sequences avoided pyruvylation of non-lipidated P2086 variants. Attempts to overcome
the pyruvylation by deletion of the codon for the N-terminal Cys either abrogated
expression or resulted in the expression of insoluble variants. Alternatively, removal of
the N-terminal Cys from the non-lipidated P2086 variants decreased expression in
some variants. Surprisingly, however, the inventors discovered that at least nonpyruvylated
non-lipidated A05, B01 , B09, and B44 variants can be expressed despite
deletion of the N-terminal Cys residue. Generally, these polypeptides could be
expressed without additional modifications other than the Cys deletion, as compared to
the corresponding wild-type non-lipidated sequence. See, for example, Examples 2 and
4. Furthermore, the inventors discovered that the non-pyruvylated non-lipidated
variants were surprisingly immunogenic and they unexpectedly elicited bactericidal
antibodies.
Accordingly, the present invention provides two methods for overcoming or
reducing the likelihood of these difficulties in expressing non-lipidated variants.
However, additional methods are contemplated by the present invention. The first
method was to vary the length of the Gly/Ser stalk in the N-terminal tail, immediately
downstream of the N-terminal Cys. The second method was codon optimization within
the N-terminal tail. However, optimization of additional codons is contemplated by the
present invention. These methods provide enhanced expression of soluble
non-lipidated P2086 variants. For example, in one embodiment, enhanced expression
of soluble non-lipidated P2086 variants is compared to expression of the corresponding
wild-type non-lipidated variants.
Isolated polypeptides
The inventors surprisingly discovered isolated non-pyruvylated, non-lipidated
ORF2086 polypeptides. The inventors further discovered that the polypeptides are
unexpectedly immunogenic and are capable of eliciting a bactericidal immune response.
As used herein, the term "non-pyruvylated" refers to a polypeptide having no
pyruvate content. Non-lipidated ORF2086 polypeptides having a pyruvate content
typically exhibited a mass shift of +70, as compared to the corresponding wild-type
polypeptide. In one embodiment, the inventive polypeptide does not exhibit a mass shift
of +70 as compared to the corresponding wild-type non-lipidated polypeptide when
measured by mass spectrometry. See, for example, Example 10.
In another embodiment, the isolated non-pyruvylated, non-lipidated ORF2086
polypeptide includes a deletion of an N-terminal cysteine residue compared to the
corresponding wild-type non-lipidated ORF2086 polypeptide. The term "N-terminal
cysteine" refers to a cysteine (Cys) at the N-terminal or N-terminal tail of a polypeptide.
More specifically, the "N-terminal cysteine" as used herein refers to the N-terminal
cysteine at which LP2086 lipoproteins are lipidated with a tripalmitoyl lipid tail, as is
known in the art. For example, when referring to any one of SEQ ID NOs: 12-21 as a
reference sequence, the N-terminal cysteine is located at position 1.
The term "wild-type non-lipidated ORF2086 polypeptide" or "wild-type nonlipidated
2086 polypeptide" or "wild-type non-lipidated polypeptide" as used herein
refers to an ORF2086 polypeptide having an amino acid sequence that is identical to
the amino acid sequence of the corresponding mature lipidated ORF2086 polypeptide
found in nature. The only difference between the non-lipidated and lipidated molecules
is that the wild-type non-lipidated ORF2086 polypeptide is not lipidated with a
tripalmitoyl lipid tail at the N-terminal cysteine.
As is known in the art, the non-lipidated 2086 form is produced by a protein
lacking the original leader sequence or by a leader sequence which is replaced with a
portion of sequence that does not specify a site for fatty acid acylation in a host cell.
See, for example, WO2003/063766, which is incorporated herein by reference in its
entirety.
Examples of a non-lipidated ORF2086 include not only a wild-type non-lipidated
ORF2086 polypeptide just described but also polypeptides having an amino acid
sequence according to any one of SEQ ID NOs: 12-21 wherein the N-terminal Cys is
deleted and polypeptides having an amino acid sequence according to any one of SEQ
ID NOs: 12-21 wherein the N-terminal Cys is substituted. Further examples of a nonlipidated
ORF2086 polypeptide include amino acid sequences selected from SEQ ID
NO: 44, SEQ ID NO: 49, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 62, and SEQ ID
NO: 64.
Examples of a wild-type non-lipidated ORF2086 polypeptide include polypeptides
having an amino acid sequence according to any one of SEQ ID NOs: 12-21 , shown in
Figure 2, SEQ ID NO: 58, SEQ ID NO: 59 , and SEQ ID NO: 60. These exemplary wildtype
non-lipidated ORF2086 polypeptides include an N-terminal Cys.
As used herein, for example, a "non-lipidated" B44 polypeptide includes a
polypeptide having the amino acid sequence selected from SEQ ID NO: 2 1, SEQ ID
NO: 2 1 wherein the N-terminal Cys at position 1 is deleted, and SEQ ID NO: 44. A
"wild-type non-lipidated" B44 polypeptide includes a polypeptide having the amino acid
sequence SEQ ID NO: 2 1 . A "non-pyruvylated non-lipidated" B44 polypeptide includes
a polypeptide having the amino acid sequence selected from SEQ ID NO: 2 1 wherein
the N-terminal Cys at position 1 is deleted and SEQ ID NO: 44.
As another example, as used herein, a "non-lipidated" B09 polypeptide includes
a polypeptide having the amino acid sequence selected from SEQ ID NO: 18, SEQ ID
NO: 18 wherein the N-terminal Cys at position 1 is deleted, SEQ ID NO: 49, and SEQ
ID NO: 50. A "wild-type non-lipidated" B09 polypeptide includes a polypeptide having
the amino acid sequence SEQ ID NO: 18. A "non-pyruvylated non-lipidated" B09
includes a polypeptide having the amino acid sequence selected from SEQ ID NO: 18
wherein the N-terminal Cys at position 1 is deleted, SEQ ID NO: 49, and SEQ ID NO:
50.
As yet a further example, as used herein, a "non-lipidated" A05 polypeptide
includes a polypeptide having the amino acid sequence selected from SEQ ID NO: 13,
SEQ ID NO: 13 wherein the N-terminal Cys at position 1 is deleted, and SEQ ID NO:
55. A "wild-type non-lipidated" A05 includes a polypeptide having the amino acid
sequence SEQ ID NO: 13. A "non-pyruvylated non-lipidated" A05 includes a
polypeptide having the amino acid sequence selected from SEQ ID NO: 13 wherein the
N-terminal Cys at position 1 is deleted and SEQ ID NO: 55.
The term "deletion" of the N-terminal Cys as used herein includes a mutation that
deletes the N-terminal Cys, as compared to a wild-type non-lipidated polypeptide
sequence. For example, a "deletion" of the N-terminal Cys refers to a removal of the
amino acid Cys from a reference sequence, e.g., from the corresponding wild-type
sequence, thereby resulting in a decrease of an amino acid residue as compared to the
reference sequence.
In another embodiment, the N-terminal Cys is substituted with an amino acid that
is not a Cys residue. For example, in an exemplary embodiment, the N-terminal Cys at
position 1 of SEQ ID NOs: 12-21 includes a C®G substitution at position 1. See, for
example, SEQ ID NO: 62 as compared to SEQ ID NO: 19 (B22 wild-type), and SEQ ID
NO: 64 as compared to SEQ ID NO: 15 (A22 wild-type). Exemplary amino acids to
replace the N-terminal Cys include any non-Cys amino acid, preferably a polar
uncharged amino acid such as, for example, glycine. In a preferred embodiment, the
substitution is made with a non-conservative residue to Cys.
The inventors surprisingly discovered that expressing non-lipidated ORF2086
polypeptides having a deletion of an N-terminal Cys residue resulted in no detectable
pyruvylation when measured by mass spectrometry, as compared to the corresponding
wild-type non-lipidated ORF2086 polypeptide. Examples of non-pyruvylated nonlipidated
ORF2086 polypeptides include those having an amino acid sequence selected
from the group consisting of SEQ ID NO:12 (A04), SEQ ID NO:13 (A05), SEQ ID NO:14
(A1 2), SEQ ID NO:15 (A22), SEQ ID NO:1 6 (B02) SEQ ID NO:1 7 (B03), SEQ ID
NO:1 8 (B09), SEQ ID NO:19 (B22), SEQ ID NO: 20 (B24), and SEQ ID NO: 2 1 (B44),
wherein the cysteine at position 1 is deleted. Additional examples of isolated nonpyruvylated,
non-lipidated ORF2086 polypeptides include polypeptides having an amino
acid sequence selected from the group consisting of SEQ ID NO: 44 , SEQ ID NO: 49,
SEQ ID NO: 50 , and SEQ ID NO: 55. Preferably, the non-pyruvylated non-lipidated
2086 polypeptide includes at least about 250, 255, or 260 consecutive amino acids, and
at most about 270, 269, 268, 267, 266, 265, 264, 263, 260, 259, 258, 257, 256, or 255
consecutive amino acids. Any minimum value may be combined with any maximum
value to define a range. More preferably, the polypeptide has at least 254 or 262
consecutive amino acids.
In one embodiment, the isolated non-pyruvylated, non-lipidated ORF2086
polypeptide is encoded by a nucleotide sequence that is operatively linked to an
expression system, wherein the expression system is capable of being expressed in a
bacterial cell. In an exemplary embodiment, the nucleotide sequence is linked to a
regulatory sequence that controls expression of the nucleotide sequence.
Suitable expression systems, regulatory sequences, and bacterial cells are
known in the art. For example, any plasmid expression vector, e.g., PET™ (Novogen,
Madison Wis.) or PMAL™ (New England Biolabs, Beverly, Mass.) can be used as long
as the polypeptide is able to be expressed in a bacterial cell. Preferably, the PET™
vector is used for cloning and expression of recombinant proteins in E. coli. In the
PET™ system, the cloned gene may be expressed under the control of a phage T7
promotor. Exemplary bacterial cells include Pseudomonas fluorescens, and preferably,
E. coli.
In one aspect, the invention relates to a non-pyruvylated non-lipidated ORF2086
polypeptide obtainable by the process. The polypeptide is preferably isolated. The
invention further relates to compositions that include a non-pyruvylated non-lipidated
ORF2086 polypeptide obtainable by a process. The composition is preferably an
immunogenic composition. The process includes expressing a nucleotide sequence
encoding a polypeptide having the amino acid sequence selected from the group
consisting of SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:1 5, SEQ ID
NO : 1 6 SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20, and SEQ ID
NO: 2 1, wherein the cysteine at position 1 is deleted. The nucleotide sequence is
operatively linked to an expression system that is capable of being expressed in a
bacterial cell. In one embodiment, the process includes expressing a nucleotide
sequence encoding a polypeptide having the amino acid sequence selected from the
group consisting of SEQ ID NO: 44, SEQ ID NO: 49 , SEQ ID NO: 50, and SEQ ID NO:
55. In another embodiment, the nucleotide sequence is selected from the group
consisting of SEQ ID NO: 43, SEQ ID NO: 5 1, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID
NO: 48, SEQ ID NO: 45, SEQ ID NO: 54. Preferably the bacterial cell is E. coli.
In one aspect, the invention relates to a composition that includes a first isolated
polypeptide, which includes the amino acid sequence set forth in SEQ ID NO: 49, and a
second isolated polypeptide, which includes the amino acid sequence set forth in SEQ
ID NO: 44. In a preferred embodiment, the polypeptides are immunogenic. In another
preferred embodiment, the composition further includes an ORF2086 subfamily A
polypeptide from serogroup B N. meningitidis. Preferably, the ORF2086 subfamily A
polypeptide is a non-pyruvylated non-lipidated ORF2086 subfamily A polypeptide. In an
exemplary embodiment, the ORF2086 subfamily A polypeptide is A05, examples of
which include, for example, SEQ ID NO: 13, wherein the N-terminal cysteine at position
1 is deleted, and SEQ ID NO: 55.
In another aspect, the invention relates to a method for producing an isolated
polypeptide. The method includes expressing in a bacterial cell a polypeptide, which
includes a sequence having greater than 90% identity to SEQ ID NO:21 , said sequence
includes at least one domain selected from the group consisting of amino acids 13-18 of
SEQ ID NO: 2 1, amino acids 2 1-34 of SEQ ID NO: 2 1, and amino acids 70-80 of SEQ
ID NO: 2 1, or a combination thereof, wherein the polypeptide lacks an N-terminal
cysteine. The method further includes purifying the polypeptide. The polypeptide
produced therein includes a non-pyruvylated non-lipidated ORF2086 polypeptide.
Preferably, the polypeptide is immunogenic. In a preferred embodiment, the bacterial
cell is E. coli.
Examples of polypeptides that include at least one domain selected from the
group consisting of amino acids 13-1 8 of SEQ ID NO: 2 1, amino acids 2 1-34 of SEQ ID
NO: 2 1, and amino acids 70-80 of SEQ ID NO: 2 1, or a combination thereof, include
SEQ ID NO: 12 (A04), SEQ ID NO: 13 (A05), SEQ ID NO: 14 (A12), SEQ ID NO: 15
(A22), SEQ ID NO: 16 (B02), SEQ ID NO: 17 (B03), SEQ ID NO: 18 (B09), SEQ ID NO:
19 (B22), SEQ ID NO: 20 (B24), and SEQ ID NO: 2 1 (B44). Preferably the cysteine at
position 1 of these polypeptides is deleted. Further exemplary polypeptides include
SEQ ID NO: 44, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 55, SEQ ID NO: 62, and
SEQ ID NO: 64.
In one exemplary embodiment, the isolated polypeptide sequence further
includes at least one domain selected from the group consisting of amino acids 96-1 16
of SEQ ID NO: 2 1, amino acids 158-1 70 of SEQ ID NO: 2 1, amino acids 172-1 85 of
SEQ ID NO: 2 1, amino acids 187-1 99 of SEQ ID NO: 2 1, amino acids 2 3-224 of SEQ
ID NO: 2 1, amino acids 226-237 of SEQ ID NO: 2 1, amino acids 239-248 of SEQ ID
NO: 2 1, or a combination thereof. Examples of polypeptides that include at least one
domain selected from the group consisting of amino acids 13- 8 of SEQ ID NO: 2 1,
amino acids 2 1-34 of SEQ ID NO: 2 1, and amino acids 70-80 of SEQ ID NO: 2 1, or a
combination thereof, and further including at least one domain selected from the group
consisting of amino acids 96-1 16 of SEQ ID NO: 2 1, amino acids 158-1 70 of SEQ ID
NO: 2 1, amino acids 172-185 of SEQ ID NO: 2 1, amino acids 187-1 99 of SEQ ID NO:
2 1, amino acids 2 13-224 of SEQ ID NO: 2 1, amino acids 226-237 of SEQ ID NO: 2 1,
amino acids 239-248 of SEQ ID NO: 2 , or a combination thereof, include SEQ ID NO:
16 (B02), SEQ ID NO: 17 (B03), SEQ ID NO: 18 (B09), SEQ ID NO: 19 (B22), SEQ ID
NO: 20 (B24), and SEQ ID NO: 2 1 (B44). Preferably the cysteine at position 1 of these
polypeptides is deleted. Further exemplary polypeptides include a polypeptide having
the amino acid sequence selected from SEQ ID NO: 44, SEQ ID NO: 49, SEQ ID NO:
50, and SEQ ID NO: 55, and SEQ ID NO: 62.
In one aspect, the invention relates to an isolated polypeptide produced by a
process described herein. In one embodiment, the isolated polypeptide is a nonpyruvylated
non-lipidated polypeptide. In another aspect, the invention relates to an
immunogenic composition produced by a process described herein.
In one aspect, the invention relates to an isolated polypeptide that includes the
amino acid sequence set forth in SEQ ID NO: 18 wherein the N-terminal Cys at position
1 is deleted or SEQ ID NO: 49. Exemplary nucleotide sequences that encode SEQ ID
NO: 49 include sequences selected from SEQ ID NO: 46, SEQ ID NO: 47, and SEQ ID
NO: 48. Preferably, the nucleotide sequence is SEQ ID NO: 46. In one aspect, the
invention relates to an isolated nucleotide sequence that includes SEQ ID NO: 46. In
one aspect, the invention relates to an isolated nucleotide sequence that includes SEQ
ID NO: 47. In one aspect, the invention relates to an isolated nucleotide sequence that
includes SEQ ID NO: 48.
In one aspect, the invention relates to a plasmid including a nucleotide sequence
selected from SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 45,
wherein the plasmid is capable of being expressed in a bacterial cell. Suitable
expression systems, regulatory sequences, and bacterial cells are known in the art, as
described above. Preferably, the bacterial cell is E. coli.
In another aspect, the invention relates to an isolated polypeptide that includes
the amino acid sequence set forth in SEQ ID NO: 50. In an exemplary embodiment,
SEQ ID NO: 50 is encoded by SEQ ID NO: 45.
In yet another aspect, the invention relates to an isolated polypeptide that
includes the amino acid sequence set forth in SEQ ID NO: 2 1 wherein the N-terminal
Cys is deleted or SEQ ID NO: 44. Exemplary nucleotide sequences that encode SEQ
ID NO: 44 include sequences selected from SEQ ID NO: 43 and SEQ ID NO: 5 .
Preferably, the nucleotide sequence is SEQ ID NO: 43. In one aspect, the invention
relates to an isolated nucleotide sequence that includes SEQ ID NO: 43.
Immunogenic Compositions
In a preferred embodiment, the compositions described herein including an
isolated non-pyruvylated non-lipidated ORF2086 polypeptide are immunogenic.
Immunogenic compositions that include a protein encoded by a nucleotide sequence
from Neisseria meningitidis ORF2086 are known in the art. Exemplary immunogenic
compositions include those described in WO2003/063766, and US patent application
publication numbers US 20060257413 and US 20090202593, which are incorporated
herein by reference in their entirety. Such immunogenic compositions described therein
include a protein exhibiting bactericidal activity identified as ORF2086 protein,
immunogenic portions thereof, and/or biological equivalents thereof. The ORF2086
protein refers to a protein encoded by open reading frame 2086 of Neisseria species.
The protein may be a recombinant protein or an isolated protein from native
Neisseria species. For example, Neisseria ORF2086 proteins may be isolated from
bacterial strains, such as those of Neisseria species, including strains of Neisseria
meningitidis (serogroups A, B, C, D, W-135, X, Y, Z, and 29E), Neisseria gonorrhoeae,
and Neisseria lactamica, as well as immunogenic portions and/or biological equivalents
of said proteins.
The ORF2086 proteins include 2086 Subfamily A proteins and Subfamily B
proteins, immunogenic portions thereof, and/or biological equivalents thereof. 2086
subfamily A proteins and 2086 subfamily B proteins are known in the art, see, for
example Fletcher et al., 2004 cited above and Murphy et al., J Infect Dis. 2009 Aug
1;200(3):379-89. See also WO2003/063766, which discloses SEQ ID NOs: 260 to 278
therein as representing amino acid sequences associated with proteins of 2086
Subfamily A. In addition, disclosed in WO2003/063766 are SEQ ID NOS: 279 to 299
therein as representing amino acid sequences associated with proteins of 2086
Subfamily B. WO2003/063766 is incorporated herein by reference in its entirety. The
ORF2086 proteins or equivalents thereof, etc. may be lipidated or non lipidated.
Preferably, the Neisseria ORF2086 protein is non lipidated. Alternatively, the
immunogenic compositions may be combinations of lipidated and non lipidated
ORF2086 proteins.
In (an) one embodiment, the immunogenic composition includes an isolated
protein having at least 95% amino acid sequence identity to a protein encoded by a
nucleotide sequence from Neisseria ORF2086.
In one embodiment, the immunogenic composition includes an isolated protein
having at least 95% amino acid sequence identity to a Subfamily A protein encoded by
a nucleotide sequence from Neisseria ORF2086. Preferably, the immunogenic
composition includes an isolated Subfamily A protein encoded by a nucleotide
sequence from Neisseria ORF2086. In some embodiments, the ORF2086 Subfamily A
polypeptide is an A05, an A04, an A 12, or an A22 variant.
In some embodiments, the ORF2086 Subfamily A polypeptide is an A05, an A12, or an
A22 variant.
In another embodiment, the immunogenic composition includes an isolated
protein having at least 95% amino acid sequence identity to a Subfamily B protein
encoded by a nucleotide sequence from Neisseria ORF2086. Preferably, the
immunogenic composition includes an isolated Subfamily B protein encoded by a
nucleotide sequence from Neisseria ORF2086. In some embodiments, the ORF2086
Subfamily B protein is a B44, a B02, a B03, a B22, a B24 or a B09 variant. In some
embodiments, the ORF2086 Subfamily B protein is a B44, a B22, or a B09 variant.
In a preferred embodiment, the immunogenic composition includes an isolated
non-pyruvylated non-lipidated polypeptide having at least 95% amino acid sequence
identity to a Subfamily B protein encoded by a nucleotide sequence from Neisseria
ORF2086. For example, in some embodiments, the ORF2086 Subfamily B protein is
sequences selected from a B44 having an amino acid sequence as shown in SEQ ID
NO: 2 1; a B02 having an amino acid sequence as shown in SEQ ID NO: 16; a B03
having an amino acid sequence as shown in SEQ ID NO: 17; a B22 having an amino
acid sequence as shown in SEQ ID NO:19; a B24 having an amino acid sequence as
shown in SEQ ID NO: 20; or a B09 variant having an amino acid sequence as shown in
SEQ ID NO:1 8, wherein the N-terminal Cys is deleted, or a combination thereof.
More preferably, the immunogenic composition includes a non-pyruvylated nonlipidated
B09 polypeptide, a non-pyruvylated non-lipidated B44 polypeptide, or
combinations thereof. In one embodiment, the composition includes a non-pyruvylated
non-lipidated B09 variant having the amino acid sequence as shown in SEQ ID NO:1 8,
wherein the N-terminal Cys is deleted, a non-pyruvylated non-lipidated B44 having the
amino acid sequence as shown in SEQ ID NO: 2 1, wherein the N-terminal Cys is
deleted, or a combination thereof. In another embodiment, the immunogenic
composition includes a non-pyruvylated non-lipidated B09 having SEQ ID NO: 49, a
non-pyruvylated non-lipidated B44 having SEQ ID NO: 44, or a combination thereof.
In one aspect, the invention relates to an immunogenic composition that includes
an ORF2086 subfamily B polypeptide from serogroup B N. meningitidis, wherein the
polypeptide is a non-pyruvylated non-lipidated B44. The B44 may include the amino
acid sequence as shown in SEQ ID NO: 2 1, wherein the N-terminal Cys is deleted or
SEQ ID NO: 44. In one embodiment, the composition further includes a second
ORF2086 subfamily B polypeptide from serogroup B N. meningitidis, wherein the
second polypeptide is a non-pyruvylated non-lipidated B09. The B09 may include the
amino acid sequence as shown in SEQ ID NO: 18, wherein the N-terminal Cys is
deleted, or SEQ ID NO: 49. In one embodiment, the immunogenic composition is a
vaccine.
In another embodiment, the composition includes no more than 3 ORF2086
subfamily B polypeptides. In a further embodiment, the composition includes no more
than 2 ORF2086 subfamily B polypeptides.
In one embodiment, the composition further includes one or more ORF2086
subfamily A polypeptides. In a preferred embodiment, the composition includes an A05
subfamily A polypeptide.
In yet another embodiment, the immunogenic composition includes an isolated
protein having at least 95% amino acid sequence identity to a Subfamily A protein
encoded by a nucleotide sequence from Neisseria ORF2086, and an isolated protein
having at least 95% amino acid sequence identity to a Subfamily B protein encoded by
a nucleotide sequence from Neisseria ORF2086.
Preferably, the immunogenic composition includes an isolated Subfamily A
protein encoded by a nucleotide sequence from Neisseria ORF2086 and an isolated
Subfamily B protein encoded by a nucleotide sequence from Neisseria ORF2086. More
preferably, the immunogenic composition includes an isolated non-pyruvylated nonlipidated
Subfamily A ORF2086 polypeptide and an isolated non-pyruvylated nonlipidated
Subfamily B ORF2086 polypeptide. In some embodiments, the ORF2086
Subfamily A polypeptide is an A05, an A04, an A12, or an A22 variant. In a preferred
embodiment, the ORF2086 Subfamily A polypeptide is an A05 having an amino acid
sequence as shown in SEQ ID NO: 13; an A04 having an amino acid sequence as
shown in SEQ ID NO: 12; an A12 having an amino acid sequence as shown in SEQ ID
NO: 14; or an A22 variant having an amino acid sequence as shown in SEQ ID NO: 15,
wherein the N-terminal Cys is deleted, or any combination thereof. In some
embodiments, the ORF2086 Subfamily B protein is a B44, a B02, a B03, a B22, a B24
or a B09 variant. In a preferred embodiment, the ORF2086 Subfamily B protein is a
B44 having the amino acid sequence as shown in SEQ ID NO: 2 1; a B02 having an
amino acid sequence as shown in SEQ ID NO: 16; a B03 having an amino acid
sequence as shown in SEQ ID NO: 17; a B22 having an amino acid sequence as
shown in SEQ ID NO:19; a B24 having an amino acid sequence as shown in SEQ ID
NO: 20; or a B09 variant having an amino acid sequence as shown in SEQ ID NO:18,
wherein the N-terminal Cys is deleted, or a combination thereof.
In one embodiment, the immunogenic composition includes a 1:1 ratio of a
Subfamily A protein to a Subfamily B protein.
In another aspect, the isolated polypeptides and compositions described herein
elicit a bactericidal immune response in a mammal against an ORF2086 polypeptide
from serogroup B N. meningitidis. The compositions have the ability to induce
bactericidal anti-meningococcal antibodies after administration to a mammal, and in
preferred embodiments can induce antibodies that are bactericidal against strains with
the respective subfamilies. Further information on bactericidal responses is given
below. See, for example, Examples 6, 11, 12, and 13. Bactericidal antibodies are an
indicator of protection in humans and preclinical studies serve as a surrogate, and any
new immunogenic composition candidate should elicit these functional antibodies.
In an exemplary embodiment, the isolated non-pyruvylated non-lipidated B09
polypeptide having SEQ ID NO: 18 wherein the N-terminal Cys at position 1 is deleted
or SEQ ID NO: 49, and immunogenic compositions thereof, elicits bactericidal
antibodies against (e.g., that can bind to) an ORF2086 polypeptide from serogroup B N.
meningitidis, subfamily A or preferably subfamily B. Preferably, the non-pyruvylated
non-lipidated B09 polypeptide and immunogenic compositions thereof, elicits
bactericidal antibodies against the A05 variant (SEQ ID NO: 13); B44 variant (SEQ ID
NO: 2 1); B16 variant (SEQ ID NO: 60); B24 variant (SEQ ID NO: 20); B09 variant (SEQ
ID NO: 18), or a combination thereof. In an exemplary embodiment, the nonpyruvylated
non-lipidated B09 polypeptide and immunogenic compositions thereof,
elicits bactericidal antibodies against B44 variant (SEQ ID NO: 2 1) ; B16 variant (SEQ ID
NO: 60); B24 variant (SEQ ID NO: 20); B09 variant (SEQ ID NO: 18), or a combination
thereof. See, for example, Example 11, Example 12, and Example 13.
In another exemplary embodiment, the isolated non-pyruvulated non-lipidated
B44 polypeptide having SEQ ID NO: 2 1 wherein the N-terminal Cys at position 1 is
deleted or SEQ ID NO: 44, and immunogenic compositions thereof, elicits bactericidal
antibodies against (e.g., that can bind to) an ORF2086 polypeptide from serogroup B N.
meningitidis, subfamily B. Preferably, the non-pyruvylated non-lipidated B44
polypeptide and immunogenic compositions thereof, elicits bactericidal antibodies
against the B44 variant (SEQ ID NO: 2 1) ; B 16 variant (SEQ ID NO: 60); B24 variant
(SEQ ID NO: 20); B09 variant (SEQ ID NO: 18), or a combination thereof. See, for
example, Example 11. Additionally, the non-pyruvylated non-lipidated B44 polypeptide
and immunogenic compositions thereof may also elicit bactericidal antibodies that bind
to the B02 variant (SEQ ID NO: 16). See, for example, Example 12 and Example 13.
Moreover, the non-pyruvylated non-lipidated B44 polypeptide and immunogenic
compositions thereof may also elicit bactericidal antibodies that bind to B03 variant
(SEQ ID NO: 17) and B 15 variant (SEQ ID NO: 59). See, for example, Example 6.
In a further exemplary embodiment, the isolated non-pyruvulated non-lipidated
B22 polypeptide having SEQ ID NO: 19 wherein the N-terminal Cys at position 1 is
deleted, and immunogenic compositions thereof, elicits bactericidal antibodies against
(e.g., that can bind to) an ORF2086 polypeptide from serogroup B N. meningitidis,
subfamily B. Preferably, the non-pyruvylated non-lipidated B22 polypeptide elicits
bactericidal antibodies against the B44 variant (SEQ ID NO: 2 1); B 16 variant (SEQ ID
NO: 60); B24 variant (SEQ ID NO: 20); B09 variant (SEQ ID NO: 18), or a combination
thereof. See, for example, Example 13.
In one embodiment, the isolated non-pyruvylated non-lipidated A05 polypeptide
having SEQ ID NO: 13 wherein the N-terminal Cys is deleted or SEQ ID NO: 55, and
immunogenic compositions thereof, elicits bacteridial antibodies against (e.g., that can
bind to) an ORF2086 polypeptide from serogroup B N. meningitidis, subfamily A.
Preferably, the non-pyruvylated non-lipidated A05 and immunogenic compositions
thereof, elicits bactericidal antibodies against the A05 variant (SEQ ID NO: 13), A22
variant (SEQ ID NO: 15), A12 variant (SEQ ID NO: 14), or a combination thereof. See,
for example, Example 6 and 13.
In one aspect, the invention relates to a method of eliciting bactericidal antibodies
specific to serogroup B N. meningitidis in a mammal. In an exemplary embodiment, the
method includes eliciting bactericidal antibodies specific to an ORF2086 subfamily B
serogroup B N. meningitidis, an ORF2086 subfamily A serogroup B N. meningitidis, or a
combination thereof. The method includes administering to the mammal an effective
amount of an isolated non-pyruvylated non-lipidated 2086 polypeptide or immunogenic
composition thereof, as described above.
In a preferred embodiment, the method includes eliciting bactericidal antibodies
specific to an ORF2086 subfamily B serogroup B N. meningitidis. The isolated
polypeptide or immunogenic composition includes a non-pyruvylated non-lipidated B44
polypeptide. In another preferred embodiment, the composition further includes a nonpyruvylated
non-lipidated B09 polypeptide. In an exemplary embodiment, the isolated
polypeptide or immunogenic composition includes SEQ ID NO: 49, SEQ ID NO: 44, or a
combination thereof. In another exemplary embodiment, the isolated polypeptide or
immunogenic composition includes SEQ ID NO: 18, wherein the N-terminal Cys at
position 1 is deleted, SEQ ID NO: 2 1, wherein the N-terminal Cys at position 1 is
deleted, or a combination thereof, In yet another exemplary embodiment, the isolated
polypeptide or immunogenic composition includes SEQ ID NO: 19, wherein the Nterminal
Cys at position 1 is deleted,
In a preferred embodiment, the method includes eliciting bactericidal antibodies
specific to an ORF2086 subfamily A serogroup B N. meningitidis. The isolated
polypeptide or immunogenic composition includes a non-pyruvylated non-lipidated A05
polypeptide. In a preferred embodiment, the isolated polypeptide or immunogenic
composition includes SEQ ID NO: 13, wherein the N-terminal Cys at position 1 is
deleted, In another preferred embodiment, the composition further includes a nonpyruvylated
non-lipidated B44 polypeptide. See, for example, Example 6 and 13. In an
exemplary embodiment, the isolated polypeptide or immunogenic composition includes
SEQ ID NO: 55, SEQ ID NO: 44, or a combination thereof. In a preferred embodiment,
the isolated polypeptide or immunogenic composition includes SEQ ID NO: 13, wherein
the N-terminal Cys at position 1 is deleted, SEQ ID NO: 2 1, wherein the N-terminal Cys
at position 1 is deleted, or a combination thereof.
The immunogenic composition may include a protein encoded by a nucleotide
sequence from Neisseria ORF2086, polynucleotides, or equivalents thereof as the sole
active immunogen in the immunogenic composition. Alternatively, the immunogenic
composition may further include active immunogens, including other Neisseria sp.
immunogenic polypeptides, or immunologically-active proteins of one or more other
microbial pathogens (e.g. virus, prion, bacterium, or fungus, without limitation) or
capsular polysaccharide. The compositions may comprise one or more desired proteins,
fragments or pharmaceutical compounds as desired for a chosen indication.
Any multi-antigen or multi-valent immunogenic composition is contemplated by
the present invention. For example, the immunogenic composition may include
combinations of two or more ORF2086 proteins, a combination of ORF2086 protein with
one or more Por A proteins, a combination of ORF2086 protein with meningococcus
serogroup A, C, Y and W135 polysaccharides and/or polysaccharide conjugates, a
combination of ORF2086 protein with meningococcus and pneumococcus
combinations, or a combination of any of the foregoing in a form suitable for a desired
administration, e.g., for mucosal delivery. Persons of skill in the art would be readily
able to formulate such multi-antigen or multi-valent immunologic compositions.
The present invention also contemplates multi-immunization regimens wherein
any composition useful against a pathogen may be combined therein or therewith the
compositions of the present invention. For example, without limitation, a patient may be
administered the immunogenic composition of the present invention and another
immununological composition for immunizing against human papillomavirus virus
(HPV), such as the HPV vaccine GARDASIL®, as part of a multi-immunization regimen.
Persons of skill in the art would be readily able to select immunogenic compositions for
use in conjunction with the immunogenic compositions of the present invention for the
purposes of developing and implementing multi-immunization regimens.
The ORF2086 polypeptides, fragments and equivalents can be used as part of a
conjugate immunogenic composition; wherein one or more proteins or polypeptides are
conjugated to a carrier in order to generate a composition that has immunogenic
properties against several serotypes, or serotypes of N. meningitidis, specifically
meningococcus serogroups specifically serogroup B, and/or against several diseases.
Alternatively, one of the ORF2086 polypeptides can be used as a carrier protein for
other immunogenic polypeptides. Formulation of such immunogenic compositions is
well known to persons skilled in this field.
Immunogenic compositions of the invention preferably include a pharmaceutically
acceptable carrier. Suitable pharmaceutically acceptable carriers and/or diluents include
any and all conventional solvents, dispersion media, fillers, solid carriers, aqueous
solutions, coatings, antibacterial and antifungal agents, isotonic and absorption delaying
agents, and the like. Suitable pharmaceutically acceptable carriers include, for example,
one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol and
the like, as well as combinations thereof.
Pharmaceutically acceptable carriers may further include minor amounts of
auxiliary substances such as wetting or emulsifying agents, preservatives or buffers,
which enhance the shelf life or effectiveness of the antibody. The preparation and use of
pharmaceutically acceptable carriers is well known in the art. Except insofar as any
conventional media or agent is incompatible with the active ingredient, use thereof in
the immunogenic compositions of the present invention is contemplated.
Immunogenic compositions can be administered parenterally, e.g., by injection,
either subcutaneously or intramuscularly, as well as orally or intranasally. Methods for
intramuscular immunization are described by Wolff et al. Biotechniques ; 1(4):474-85,
(1991 ) . and by Sedegah et al. PNAS Vol. 9 1, pp. 9866-9870, ( 1 994). Other modes of
administration employ oral formulations, pulmonary formulations, suppositories, and
transdermal applications, for example, without limitation. Oral formulations, for
example, include such normally employed excipients as, for example, pharmaceutical
grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose,
magnesium carbonate, and the like, without limitation. Preferably, the immunogenic
composition is administered intramuscularly.
The immunogenic compositions of the present invention can further comprise
one or more additional "immunomodulators", which are agents that perturb or alter the
immune system, such that either up-regulation or down-regulation of humoral and/or
cell-mediated immunity is observed. In one particular embodiment, up-regulation of the
humoral and/or cell-mediated arms of the immune system is preferred. Examples of
certain immunomodulators include, for example, an adjuvant or cytokine, or
ISCOMATRIX (CSL Limited, Parkville, Australia), described in U.S. Patent No.
5,254,339 among others.
Non-limiting examples of adjuvants that can be used in the vaccine of the present
invention include the RIBI adjuvant system (Ribi Inc., Hamilton, Mont.), alum, mineral
gels such as aluminum hydroxide gel, oil-in-water emulsions, water-in-oil emulsions
such as, e.g., Freund's complete and incomplete adjuvants, Block copolymer (CytRx,
Atlanta Ga.), QS-21 (Cambridge Biotech Inc., Cambridge Mass.), SAF-M (Chiron,
Emeryville Calif.), AMPHIGEN® adjuvant, saponin, Quil A or other saponin fraction,
monophosphoryl lipid A, and Avridine lipid-amine adjuvant. Non-limiting examples of
oil-in-water emulsions useful in the vaccine of the invention include modified SEAM62
and SEAM 1/2 formulations. Modified SEAM62 is an oil-in-water emulsion containing
5% (v/v) squalene (Sigma), 1% (v/v) SPAN® 85 detergent (ICI Surfactants), 0.7% (v/v)
polysorbate ® 80 detergent (ICI Surfactants), 2.5% (v/v) ethanol, 200 g/ml Quil A, 100
g/ml cholesterol, and 0.5% (v/v) lecithin. Modified SEAM 1/2 is an oil-in-water emulsion
comprising 5% (v/v) squalene, 1% (v/v) SPAN® 85 detergent, 0.7% (v/v) polysorbate
80 detergent, 2.5% (v/v) ethanol, 100 pg/ml Quil A, and 50 pg/ml cholesterol.
Other "immunomodulators" that can be included in the vaccine include, e.g., one
or more interleukins, interferons, or other known cytokines or chemokines. In one
embodiment, the adjuvant may be a cyclodextrin derivative or a polyanionic polymer,
such as those described in U.S. patent numbers 6,165,995 and 6,610,310, respectively.
It is to be understood that the immunomodulator and/or adjuvant to be used will depend
on the subject to which the vaccine or immunogenic composition will be administered,
the route of injection and the number of injections to be given.
In some embodiments, the adjuvant is saponin. In some embodiments, the
saponin concentration is between 1 g/ml and 250 mg/ml; between 5 mg ml and 150
Mg/ml; or between 10 g/ml and 100 mg/ml. In some embodiments, the saponin
concentration is about 1 mg ml; about 5 mg/ml; about 10 mg/ml; about 20 mg/ml; about
30 mg/ml; about 40 mg/ml; about 50 mg ml; about 60 mg ml; about 70 mg ml; about 80
Mg/ml; about 90 Mg/ml; about 100 Mg l; about 110 M / l; about 120 Mg/ml; about 130
Mg/ml; about 140 Mg ml; about 150 M / l; about 160 Mg/ml; about 170 Mg/ml; about 180
Mg/ml; about 190 Mg/ml; about 200 Mg/ml; about 2 10 Mg/ml; about 220 Mg/ml; about 230
Mg/ml; about 240 Mg/ml; or about 250 Mg/ml.
In certain preferred embodiments, the proteins of this invention are used in an
immunogenic composition for oral administration which includes a mucosal adjuvant
and used for the treatment or prevention of N. meningitidis infection in a human host.
The mucosal adjuvant can be a cholera toxin; however, preferably, mucosal adjuvants
other than cholera toxin which may be used in accordance with the present invention
include non-toxic derivatives of a cholera holotoxin, wherein the A subunit is
mutagenized, chemically modified cholera toxin, or related proteins produced by
modification of the cholera toxin amino acid sequence. For a specific cholera toxin
which may be particularly useful in preparing immunogenic compositions of this
invention, see the mutant cholera holotoxin E29H, as disclosed in Published
International Application WO 00/18434, which is hereby incorporated herein by
reference in its entirety. These may be added to, or conjugated with, the polypeptides
of this invention. The same techniques can be applied to other molecules with mucosal
adjuvant or delivery properties such as Escherichia coli heat labile toxin (LT).
Other compounds with mucosal adjuvant or delivery activity may be used such
as bile; polycations such as DEAE-dextran and polyornithine; detergents such as
sodium dodecyl benzene sulphate; lipid-conjugated materials; antibiotics such as
streptomycin; vitamin A; and other compounds that alter the structural or functional
integrity of mucosal surfaces. Other mucosally active compounds include derivatives of
microbial structures such as MDP; acridine and cimetidine. STIMULON™ QS-21 , MPL,
and IL-12, as described above, may also be used.
The immunogenic compositions of this invention may be delivered in the form of
ISCOMS (immune stimulating complexes), ISCOMS containing CTB, liposomes or
encapsulated in compounds such as acrylates or poly(DL-lactide-co- glycoside) to form
microspheres of a size suited to adsorption. The proteins of this invention may also be
incorporated into oily emulsions.
An amount (i.e., dose) of immunogenic composition that is administered to the
patient can be determined in accordance with standard techniques known to those of
ordinary skill in the art, taking into consideration such factors as the particular antigen,
the adjuvant (if present), the age, sex, weight, species, condition of the particular
patient, and the route of administration.
For example, a dosage for an adolescent human patient may include at least
0.1 mg, 1 mg, 10 mg, or 50 g of a Neisseria ORF2086 protein, and at most 80 pg, 100
pg, 150 pg, or 200 g of a Neisseria ORF2086 protein. Any minimum value and any
maximum value may be combined to define a suitable range.
Adjuvants
Immunogenic compositions as described herein also comprise, in certain
embodiments, one or more adjuvants. An adjuvant is a substance that enhances the
immune response when administered together with an immunogen or antigen. A
number of cytokines or lymphokines have been shown to have immune modulating
activity, and thus are useful as adjuvants, including, but not limited to, the interleukins
1- , 1-b, 2, 4, 5, 6, 7, 8, 10, 12 (see, e.g., U.S. Patent No. 5,723,127), 13, 14, 15, 16, 17
and 18 (and its mutant forms); the interferons-a, b and g ; granulocyte-macrophage
colony stimulating factor (GM-CSF) (see, e.g., U.S. Patent No. 5,078,996 and ATCC
Accession Number 39900); macrophage colony stimulating factor (M-CSF); granulocyte
colony stimulating factor (G-CSF); and the tumor necrosis factors a and b.
Still other adjuvants that are useful with the immunogenic compositions
described herein include chemokines, including without limitation, MCP-1 , MIP-1 ,
MIR - 1 , and RANTES; adhesion molecules, such as a selectin, e.g., L-selectin,
P-selectin and E-selectin; mucin-like molecules, e.g., CD34, GlyCAM-1 and MadCAM-1 ;
a member of the integrin family such as LFA-1 , VLA-1 , Mac-1 and p 150.95; a member
of the immunoglobulin superfamily such as PECAM, ICAMs, e.g., ICAM-1 , ICAM-2 and
ICAM-3, CD2 and LFA-3; co-stimulatory molecules such as B7-1 , B7-2,CD40 and
CD40L; growth factors including vascular growth factor, nerve growth factor, fibroblast
growth factor, epidermal growth factor, PDGF, BL-1 , and vascular endothelial growth
factor; receptor molecules including Fas, TNF receptor, Fit, Apo-1 , p55, WSL-1 , DR3,
TRAMP, Apo-3, AIR, LARD, NGRF, DR4, DR5, KILLER, TRAIL-R2, TRICK2, and DR6;
and Caspase (ICE).
Other exemplary adjuvants include, but are not limited to aluminum hydroxide;
aluminum phosphate; STIMULON™ QS-21 (Aquila Biopharmaceuticals, Inc.,
Framingham, Mass.); MPL™ (3-O-deacylated monophosphoryl lipid A; Corixa,
Hamilton, Mont.), 529 (an amino alkyl glucosamine phosphate compound, Corixa,
Hamilton, Mont.), IL-12 (Genetics Institute, Cambridge, Mass.); GM-CSF (Immunex
Corp., Seattle, Wash.); N-acetyl-muramyl-L-theronyl-D-isoglutamine (thr-MDP);
N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP);
N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1 '-2
'-dipalmitoyl-sn-glycero-3-hydroxyphos-phoryloxy-ethylamin e) (CGP 19835A, referred
to as MTP-PE); and cholera toxin. In certain preferred embodiments, the adjuvant is
QS-21 .
Additional exemplary adjuvants include non-toxic derivatives of cholera toxin,
including its A subunit, and/or conjugates or genetically engineered fusions of the N.
meningitidis polypeptide with cholera toxin or its B subunit ("CTB"), procholeragenoid,
fungal polysaccharides, including schizophyllan, muramyl dipeptide, muramyl dipeptide
("MDP") derivatives, phorbol esters, the heat labile toxin of E. coli , block polymers or
saponins.
Aluminum phosphate has been used as the adjuvant in a phase 1 clinical trial to
a concentration 0.125 mg/dose, much lower than the limit of 0.85 mg/ dose specified by
the US Code of Federal Regulations [610.1 5(a)]. Aluminum-containing adjuvants are
widely used in humans to potentiate the immune response of antigens when
administered intramuscularly or subcutaneously. In some embodiments, the
concentration of aluminum in the immunogenic composition is between 0.125 g/ml and
0.5 pg/rnl; between 0.20 g/ml and 0.40 g/ml; or between 0.20 g/ml and 0.30 pg/ml.
In some embodiments, the concentration of aluminum in the immunogenic composition
is about 0.1 25 pg/ml; about 0.1 5 mg/ml; about 0.1 5 pg/ml; about 0.20 mg/ml; about
0.225 Mg/ml; about 0.25 Mg/ml; about 0.275 Mg/ml; about 0.30 pg/ml; about 0.325
Mg/ml; about 0.35 g/ml; about 0.375 g/ l; about 0.40 g/ml; about 0.425 g/ml;
about 0.45 Mg/ml; about 0.475 Mg/ml; or about 0.50 Mg/ml.
In a preferred embodiment, the concentration of aluminum in the immunogenic
composition is between 0.1 25 mg/ml and 0.5 mg/ml; between 0.20 mg/ml and 0.40
mg/ml; or between 0.20 mg/ml and 0.30 mg/ml. In some embodiments, the
concentration of aluminum in the immunogenic composition is about 0.125 mg/ml;
about 0.15 mg/ml; about 0.1 75 mg/ml; about 0.20 mg/ml; about 0.225 mg/ml; about
0.25 mg/ml; about 0.275 mg/ml; about 0.30 mg/ml; about 0.325 mg/ml; about 0.35
mg/ml; about 0.375 mg/ml; about 0.40 mg/ml; about 0.425 mg/ml; about 0.45 mg/ml;
about 0.475 mg/ml; or about 0.50 mg/ml.
Suitable adjuvants used to enhance an immune response further include, without
limitation, MPL™ (3-O-deacylated monophosphoryl lipid A, Corixa, Hamilton, MT),
which is described in U.S. Patent No. 4,912,094. Also suitable for use as adjuvants are
synthetic lipid A analogs or aminoalkyl glucosamine phosphate compounds (AGP), or
derivatives or analogs thereof, which are available from Corixa (Hamilton, MT), and
which are described in United States Patent No. 6,1 13,918. One such AGP is
2-[(R)-3-Tetradecanoyloxytetradecanoylamino] ethyl
2-Deoxy-4-0-phosphono-3-0-[(R)-3-tetradecanoyoxytetradecanoyl]-
2-[(R)-3-tetradecanoyloxytetradecanoyl-amino]-b-D-glucopyranoside, which is
also known as 529 (formerly known as RC529). This 529 adjuvant is formulated as an
aqueous form (AF) or as a stable emulsion (SE).
Still other adjuvants include muramyl peptides, such as
N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP),
N-acetyl-normuramyl-L-alanine-2-(1'-2' dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-
ethylamine (MTP-PE); oil-in-water emulsions, such as MF59 (U.S. Patent No.
6,299,884) (containing 5% Squalene, 0.5% polysorbate 80, and 0.5% Span 85
(optionally containing various amounts of MTP-PE) formulated into submicron particles
using a microfluidizer such as Model 110Y microfluidizer (Microfluidics, Newton, MA)),
and SAF (containing 10% Squalene, 0.4% polysorbate 80, 5% pluronic-blocked polymer
L 12 1, and thr-MDP, either microfluidized into a submicron emulsion or vortexed to
generate a larger particle size emulsion); incomplete Freund's adjuvant (IFA); aluminum
salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate;
Amphigen; Avridine; L 121/squalene; D-lactide-polylactide/glycoside; pluronic polyols;
killed Bordetella; saponins, such as Stimulon™ QS-21 (Antigenics, Framingham, MA.),
described in U.S. Patent No. 5,057,540, ISCOMATRIX (CSL Limited, Parkville,
Australia), described in U.S. Patent No. 5,254,339, and immunostimulating complexes
(ISCOMATRIX); Mycobacterium tuberculosis; bacterial lipopolysaccharides; synthetic
polynucleotides such as oligonucleotides containing a CpG motif (e.g., U.S. Patent No.
6,207,646); IC-31 (Intercell AG, Vienna, Austria), described in European Patent Nos.
1,296,71 3 and 1,326,634; a pertussis toxin (PT) or mutant thereof, a cholera toxin or
mutant thereof (e.g., U.S. Patent Nos. 7,285,281 , 7,332,174, 7,361 ,355 and 7,384,640);
or an E. coli heat-labile toxin (LT) or mutant thereof, particularly LT-K63, LT-R72 (e.g.,
U.S. Patent Nos. 6,149,91 9, 7,1 15,730 and 7,291 ,588).
Methods of Producing Non-Lipidated P2086 Antigens
In one aspect, the invention relates to a method of producing a non-pyruvylated
non-lipidated ORF2086 polypeptide. The method includes expressing a nucleotide
sequence encoding a ORF2086 polypeptide wherein the N-terminal cysteine is deleted
as compared to the corresponding wild-type sequence, and wherein the nucleotide
sequence is operatively linked to an expression system that is capable of being
expressed in a bacterial cell. Exemplary polypeptides produced by the method include
any polypeptide described herein. For example, preferably, the polypeptide has the
amino acid sequence set forth in SEQ ID NO: 12; SEQ ID NO: 13; SEQ ID NO: 14; SEQ
ID NO: 15; SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 18; SEQ ID NO: 19; SEQ ID
NO: 20; SEQ ID NO: 2 1, wherein the cysteine at position 1 is deleted, as compared to
the corresponding wild-type sequence. Additional exemplary polypeptides include a
polypeptide having the amino acid sequences sequences selected from SEQ ID NO:
44, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 55, SEQ ID NO: 57, SEQ ID NO: 62,
and SEQ ID NO: 64. The method further includes purifying the polypeptide.
In some embodiments, the invention provides a method for producing soluble
non-lipidated P2086 antigens comprising the steps of cloning the ORF2086 variant
nucleic acid sequence into an E. coli expression vector without a lipidation control
sequence, transforming E. coli bacteria with the ORF2086 expression vector, inducing
expression and isolating the expressed P2086 protein. In some embodiments,
expression is induced with IPTG.
In some embodiments, the codon for the N-terminal Cys of the ORF2086 variant
is deleted. Examples of such codons include TGC. In some embodiments, the codon
for the N-terminal Cys of the ORF2086 variant is mutated by point mutagenesis to
generate an Ala, Gly, or Val codon. In some embodiments, Ser and Gly codons are
added to the N-terminal tail of the ORF2086 variant to extend the Gly/Ser stalk
immediately downstream of the N-terminal Cys. In some embodiments, the total
number of Gly and Ser residues within the Gly/Ser stalk is at least 7, 8, 9, 10, 11, or 12.
In some embodiments, the codon for the N-terminal Cys is deleted. In some
embodiments, the N-terminal 7, 8, 9, 10, 1, or 12 residues are either Gly or Ser.
In some embodiments, the codons of the N-terminal tail of the non-lipidated
ORF2086 variant are optimized by point mutagenesis. In some embodiments, the
N-terminal tail of the non-lipidated ORF2086 variant is optimized to match the
N-terminal tail of the B09 variant. In some embodiments, the codons of the N-terminal
tail of the ORF2086 variant are optimized by point mutagenesis such that the codon
encoding the fifth amino acid of the ORF2086 variant is 100% identical to nucleotides
13-1 5 of SEQ ID NO: 8 and the codon encoding the thirteenth amino acid of the
ORF2086 variant is 100% identical to nucleotides 37-39 of SEQ ID NO: 8 . In some
embodiments, the N-terminal tail of the non-lipidated ORF2086 variant is optimized
such that the 5' 45 nucleic acids are 100% identical to nucleic acids 1-45 of SEQ ID NO:
8. In some embodiments, the N-terminal tail of the non-lipidated ORF2086 variant is
optimized such that the 5' 42 nucleic acids are 100% identical to nucleic acids 4-45 of
SEQ ID NO: 8. In some embodiments, the N-terminal tail of the non-lipidated ORF2086
variant is optimized such that the 5' 39 nucleic acids are 100% identical to nucleic acids
4-42 of SEQ ID NO: 8. In some embodiments, the N-terminal tail of the non-lipidated
P2086 variant comprises at least one amino acid substitution compared to amino acids
1-15 of SEQ ID NO: 18. In some embodiments, the N-terminal tail of the non-lipidated
P2086 variant comprises two amino acid substitutions compared to amino acids 1-15 of
SEQ ID NO: 18. In some embodiments, the N-terminal tail of the non-lipidated P2086
variant comprises at least one amino acid substitution compared to amino acids 2-15 of
SEQ ID NO: 18. In some embodiments, the N-terminal tail of the non-lipidated P2086
variant comprises two amino acid substitutions compared to amino acids 2-15 of SEQ
ID NO: 18. In some embodiments, the amino acid substitutions are conservative amino
acid substitutions.
In some embodiments, the codons of the non-lipidated variant have been
optimized for increased expression. Codon optimization is known in the art. See, e.g.,
Sastalla et al, Applied and Environmental Microbiology, vol . 75(7): 2099-21 10 (2009)
and Coleman et al, Science, vol. 320: 1784 (2008). In some embodiments, codon
optimization includes matching the codon utilization of an amino acid sequence with the
codon frequency of the host organism chosen while including and/or excluding specific
DNA sequences. In some embodiments, codon optimization further includes minimizing
the corresponding secondary mRNA structure to reduce translational impediments. In
some embodiments, the N-terminal tail has been codon optimized to comprise any one
of SEQ ID NO: 28, 30, 32, and 34. In some embodiments, the Gly/Ser stalk has been
codon optimized to comprise any one of SEQ ID NO: 28, 30, 32, and 34.
In order that this invention may be better understood, the following examples are
set forth. The examples are for the purpose of illustration only and are not to be
construed as limiting the scope of the invention.
Immunogenic Composition Formulations
In certain embodiments, the immunogenic compositions of the invention further
comprise at least one of an adjuvant, a buffer, a cryoprotectant, a salt, a divalent cation,
a non-ionic detergent, an inhibitor of free radical oxidation, a diluent or a carrier.
The immunogenic compositions of the invention may further comprise one or
more preservatives in addition to a plurality of meningococcal protein antigens and
capsular polysaccharide-protein conjugates. The FDA requires that biological products
in multiple-dose (multi-dose) vials contain a preservative, with only a few exceptions.
Vaccine products containing preservatives include vaccines containing benzethonium
chloride (anthrax), 2-phenoxyethanol (DTaP, HepA, Lyme, Polio (parenteral)), phenol
(Pneumo, Typhoid (parenteral), Vaccinia) and thimerosal (DTaP, DT, Td, HepB, Hib,
Influenza, JE, Mening, Pneumo, Rabies). Preservatives approved for use in injectable
drugs include, e.g., chlorobutanol, m-cresol, methylparaben, propylparaben,
2-phenoxyethanol, benzethonium chloride, benzalkonium chloride, benzoic acid, benzyl
alcohol, phenol, thimerosal and phenylmercuric nitrate.
Formulations of the invention may further comprise one or more of a buffer, a
salt, a divalent cation, a non-ionic detergent, a cryoprotectant such as a sugar, and an
anti-oxidant such as a free radical scavenger or chelating agent, or any multiple
combination thereof. The choice of any one component, e.g., a chelator, may
determine whether or not another component (e.g., a scavenger) is desirable. The final
composition formulated for administration should be sterile and/or pyrogen free. The
skilled artisan may empirically determine which combinations of these and other
components will be optimal for inclusion in the preservative containing immunogenic
compositions of the invention depending on a variety of factors such as the particular
storage and administration conditions required.
In certain embodiments, a formulation of the invention which is compatible with
parenteral administration comprises one or more physiologically acceptable buffers
selected from, but not limited to, Tris (trimethamine), phosphate, acetate, borate, citrate,
glycine, histidine and succinate. In certain embodiments, the formulation is buffered to
within a pH range of about 6.0 to about 9.0, preferably from about 6.4 to about 7.4.
In certain embodiments, it may be desirable to adjust the pH of the immunogenic
composition or formulation of the invention. The pH of a formulation of the invention
may be adjusted using standard techniques in the art. The pH of the formulation may
be adjusted to be between 3.0 and 8.0. In certain embodiments, the pH of the
formulation may be, or may adjusted to be, between 3.0 and 6.0, 4.0 and 6.0, or 5.0 and
8.0. In other embodiments, the pH of the formulation may be, or may adjusted to be,
about 3.0, about 3.5, about 4.0, about 4.5, about 5.0, about 5.5, about 5.8, about 6.0,
about 6.5, about 7.0, about 7.5, or about 8.0. In certain embodiments, the pH may be,
or may adjusted to be, in a range from 4.5 to 7.5, or from 4.5 to 6.5, from 5.0 to 5.4,
from 5.4 to 5.5, from 5.5 to 5.6, from 5.6 to 5.7, from 5.7 to 5.8, from 5.8 to 5.9, from 5.9
to 6.0, from 6.0 to 6.1 , from 6.1 to 6.2, from 6.2 to 6.3, from 6.3 to 6.5, from 6.5 to 7.0,
from 7.0 to 7.5 or from 7.5 to 8.0. In a specific embodiment, the pH of the formulation is
about 5.8.
In certain embodiments, a formulation of the invention which is compatible with
parenteral administration comprises one or more divalent cations, including but not
limited to MgC , CaC^ and MnCl2, at a concentration ranging from about 0.1 mM to
about 10 mM, with up to about 5 mM being preferred.
In certain embodiments, a formulation of the invention which is compatible with
parenteral administration comprises one or more salts, including but not limited to
sodium chloride, potassium chloride, sodium sulfate, and potassium sulfate, present at
an ionic strength which is physiologically acceptable to the subject upon parenteral
administration and included at a final concentration to produce a selected ionic strength
or osmolarity in the final formulation. The final ionic strength or osmolality of the
formulation will be determined by multiple components (e.g., ions from buffering
compound(s) and other non-buffering salts. A preferred salt, NaCI, is present from a
range of up to about 250 mM, with salt concentrations being selected to complement
other components (e.g., sugars) so that the final total osmolarity of the formulation is
compatible with parenteral administration (e.g., intramuscular or subcutaneous injection)
and will promote long term stability of the immunogenic components of the
immunogenic composition formulation over various temperature ranges. Salt-free
formulations will tolerate increased ranges of the one or more selected cryoprotectants
to maintain desired final osmolarity levels.
In certain embodiments, a formulation of the invention which is compatible with
parenteral administration comprises one or more cryoprotectants selected from but not
limited to disaccharides (e.g., lactose, maltose, sucrose or trehalose) and polyhydroxy
hydrocarbons (e.g., dulcitol, glycerol, mannitol and sorbitol).
In certain embodiments, the osmolarity of the formulation is in a range of from
about 200 mOs/L to about 800 mOs/L, with a preferred range of from about 250 mOs/L
to about 500 mOs/L, or about 300 mOs/L - about 400 mOs/L. A salt-free formulation
may contain, for example, from about 5% to about 25% sucrose, and preferably from
about 7% to about 15%, or about 10% to about 12% sucrose. Alternatively, a salt-free
formulation may contain, for example, from about 3% to about 12% sorbitol, and
preferably from about 4% to 7%, or about 5% to about 6% sorbitol. If salt such as
sodium chloride is added, then the effective range of sucrose or sorbitol is relatively
decreased. These and other such osmolality and osmolarity considerations are well
within the skill of the art.
In certain embodiments, a formulation of the invention which is compatible with
parenteral administration comprises one or more free radical oxidation inhibitors and/or
chelating agents. A variety of free radical scavengers and chelators are known in the
art and apply to the formulations and methods of use described herein. Examples
include but are not limited to ethanol, EDTA, a EDTA/ethanol combination,
triethanolamine, mannitol, histidine, glycerol, sodium citrate, inositol hexaphosphate,
tripolyphosphate, ascorbic acid/ascorbate, succinic acid/succinate, malic acid/maleate,
desferal, EDDHA and DTPA, and various combinations of two or more of the above. In
certain embodiments, at least one non-reducing free radical scavenger may be added at
a concentration that effectively enhances long term stability of the formulation. One or
more free radical oxidation inhibitors/chelators may also be added in various
combinations, such as a scavenger and a divalent cation. The choice of chelator will
determine whether or not the addition of a scavenger is needed.
In certain embodiments, a formulation of the invention which is compatible with
parenteral administration comprises one or more non-ionic surfactants, including but not
limited to polyoxyethylene sorbitan fatty acid esters, Polysorbate-80 (Tween 80),
Polysorbate-60 (Tween 60), Polysorbate-40 (Tween 40) and Polysorbate-20 (Tween
20), polyoxyethylene alkyl ethers, including but not limited to Brij 58, Brij 35, as well as
others such as Triton X-1 00; Triton X-1 14, NP40, Span 85 and the Pluronic series of
non-ionic surfactants (e.g., Pluronic 121 ) , with preferred components Polysorbate-80 at
a concentration from about 0.001 % to about 2% (with up to about 0.25% being
preferred) or Polysorbate-40 at a concentration from about 0.001 % to 1% (with up to
about 0.5% being preferred).
In certain embodiments, a formulation of the invention comprises one or more
additional stabilizing agents suitable for parenteral administration, e.g., a reducing agent
comprising at least one thiol (-SH) group (e.g., cysteine, N-acetyl cysteine, reduced
glutathione, sodium thioglycolate, thiosulfate, monothioglycerol, or mixtures thereof).
Alternatively or optionally, preservative-containing immunogenic composition
formulations of the invention may be further stabilized by removing oxygen from storage
containers, protecting the formulation from light (e.g., by using amber glass containers).
Preservative-containing immunogenic composition formulations of the invention
may comprise one or more pharmaceutically acceptable carriers or excipients, which
includes any excipient that does not itself induce an immune response. Suitable
excipients include but are not limited to macromolecules such as proteins, saccharides,
polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers,
sucrose (Paoletti et al, 2001 , Vaccine, 19:21 18), trehalose, lactose and lipid aggregates
(such as oil droplets or liposomes). Such carriers are well known to the skilled artisan.
Pharmaceutically acceptable excipients are discussed, e.g., in Gennaro, 2000,
Remington: The Science and Practice of Pharmacy, 20th edition, ISBN:0683306472.
Compositions of the invention may be lyophilized or in aqueous form, i.e.
solutions or suspensions. Liquid formulations may advantageously be administered
directly from their packaged form and are thus ideal for injection without the need for
reconstitution in aqueous medium as otherwise required for lyophilized compositions of
the invention.
Direct delivery of immunogenic compositions of the present invention to a subject
may be accomplished by parenteral administration (intramuscularly, intraperitoneally,
intradermally, subcutaneously, intravenously, or to the interstitial space of a tissue); or
by rectal, oral, vaginal, topical, transdermal, intranasal, ocular, aural, pulmonary or other
mucosal administration. In a preferred embodiment, parenteral administration is by
intramuscular injection, e.g., to the thigh or upper arm of the subject. Injection may be
via a needle (e.g., a hypodermic needle), but needle free injection may alternatively be
used. A typical intramuscular dose is 0.5ml_. Compositions of the invention may be
prepared in various forms, e.g., for injection either as liquid solutions or suspensions. In
certain embodiments, the composition may be prepared as a powder or spray for
pulmonary administration, e.g., in an inhaler. In other embodiments, the composition
may be prepared as a suppository or pessary, or for nasal, aural or ocular
administration, e.g., as a spray, drops, gel or powder.
Optimal amounts of components for a particular immunogenic composition may
be ascertained by standard studies involving observation of appropriate immune
responses in subjects. Following an initial vaccination, subjects can receive one or
several booster immunizations adequately spaced.
Packaging and Dosage Forms
Immunogenic compositions of the invention may be packaged in unit dose or
multi-dose form (e.g. 2 doses, 4 doses, or more). For multi-dose forms, vials are
typically but not necessarily preferred over pre-filled syringes. Suitable multi-dose
formats include but are not limited to: 2 to 10 doses per container at 0.1 to 2 ml per
dose. In certain embodiments, the dose is a 0.5 mL dose. See, e.g., International
Patent Application WO2007/1 27668, which is incorporated by reference herein.
Compositions may be presented in vials or other suitable storage containers, or
may be presented in pre-filled delivery devices, e.g., single or multiple component
syringes, which may be supplied with or without needles. A syringe typically but need
not necessarily contains a single dose of the preservative-containing immunogenic
composition of the invention, although multi-dose, pre-filled syringes are also
envisioned. Likewise, a vial may include a single dose but may alternatively include
multiple doses.
Effective dosage volumes can be routinely established, but a typical dose of the
composition for injection has a volume of 0.5 ml_. In certain embodiments, the dose is
formulated for administration to a human subject. In certain embodiments, the dose is
formulated for administration to an adult, teen, adolescent, toddler or infant (i.e., no
more than one year old) human subject and may in preferred embodiments be
administered by injection.
Liquid immunogenic compositions of the invention are also suitable for
reconstituting other immunogenic compositions which are presented in lyophilized form.
Where an immunogenic composition is to be used for such extemporaneous
reconstitution, the invention provides a kit with two or more vials, two or more
ready-filled syringes, or one or more of each, with the contents of the syringe being
used to reconstitute the contents of the vial prior to injection, or vice versa.
Alternatively, immunogenic compositions of the present invention may be
lyophilized and reconstituted, e.g., using one of a multitude of methods for freeze drying
well known in the art to form dry, regular shaped (e.g., spherical) particles, such as
micropellets or microspheres, having particle characteristics such as mean diameter
sizes that may be selected and controlled by varying the exact methods used to prepare
them. The immunogenic compositions may further comprise an adjuvant which may
optionally be prepared with or contained in separate dry, regular shaped (e.g.,
spherical) particles such as micropellets or microspheres. In such embodiments, the
present invention further provides an immunogenic composition kit comprising a first
component that includes a stabilized, dry immunogenic composition, optionally further
comprising one or more preservatives of the invention, and a second component
comprising a sterile, aqueous solution for reconstitution of the first component. In
certain embodiments, the aqueous solution comprises one or more preservatives, and
may optionally comprise at least one adjuvant (see, e.g., WO2009/1 09550 (incorporated
herein by reference).
In yet another embodiment, a container of the multi-dose format is selected from
one or more of the group consisting of, but not limited to, general laboratory glassware,
flasks, beakers, graduated cylinders, fermentors, bioreactors, tubings, pipes, bags, jars,
vials, vial closures (e.g., a rubber stopper, a screw on cap), ampoules, syringes, dual or
multi-chamber syringes, syringe stoppers, syringe plungers, rubber closures, plastic
closures, glass closures, cartridges and disposable pens and the like. The container of
the present invention is not limited by material of manufacture, and includes materials
such as glass, metals (e.g., steel, stainless steel, aluminum, etc.) and polymers (e.g.,
thermoplastics, elastomers, thermoplastic-elastomers). In a particular embodiment, the
container of the format is a 5 ml Schott Type 1 glass vial with a butyl stopper. The
skilled artisan will appreciate that the format set forth above is by no means an
exhaustive list, but merely serve as guidance to the artisan with respect to the variety of
formats available for the present invention. Additional formats contemplated for use in
the present invention may be found in published catalogues from laboratory equipment
vendors and manufacturers such as United States Plastic Corp. (Lima, OH), VWR.
EXAMPLES
Example 1: Experimental Procedures
Serum bactericidal assay
Cynomolgus macaques (n = 5/group) were immunized intramuscularly with
rl_P2086 or rP2086 (A + B) proteins adsorbed to AIP0 4. Cynomolgus macaques are an
example of non-human primates. Animals were vaccinated at weeks 0, 4 and 24, and
ORF2086-specific IgG and functional antibody titers were determined at weeks 0, 4, 6
and 26. Serum ORF2086-specific IgG titers were determined against rl_P2086A and B.
Functional antibody titers were examined by serum bactericidal assay (SBA)
against Neisseria meningitidis strains expressing either LP2086 with sequences
homologous or heterologous to those contained in the vaccine.
Serum bactericidal antibodies in macaques or rabbits immunized with ORF2086
vaccine were determined using SBAs with human complement. Rabbit immune sera or
macaques immune sera were heat-inactivated to remove intrinsic complement activity
and subsequently serially diluted 1:2 in Dulbecco's PBS with Ca2+ and Mg2+ (D-PBS)
in a 96-well microtiter plate to test for serum bactericidal activity against N. meningitidis
strains. Bacteria used in the assay were grown in GC media supplemented with
Kellogg's supplement (GCK) and monitored by optical density at 650 nm. Bacteria were
harvested for use in the assay at a final De of 0.50-0.55, diluted in D-PBS and 1000-
3000 CFU were added to the assay mixture with 20% human complement.
Human serum with no detectable bactericidal activity was used as the exogenous
complement source. Complement sources were tested for suitability against each
individual test strain. A complement source was used only if the number of bacteria
surviving in controls without added immune sera was >75%. Ten unique complement
sources were required to perform the SBAs described in this study.
After a 30 min incubation at 37°C with 5% C0 2, D-PBS was added to the reaction
mixture and aliquots transferred to microfilter plates filled with 50% GCK media. The
microfilter plates were filtered, incubated overnight at 37°C with 5% C0 2 and
microcolonies were stained and quantified. The serum bactericidal titers were defined
as the interpolated reciprocal serum dilution that yielded a 50% reduction in CFU
compared to the CFU in control wells without immune sera. The SBA titer is defined as
the reciprocal of the interpolated dilution of test serum that causes a 50% reduction in
bacterial counts after a 30min incubation at 37°C. Susceptibility to killing with ORF2086
immune sera was established if there was a 4-fold or greater rise in SBA titer for
ORF2086 immune sera compared to the corresponding pre-immune sera. Sera that
were negative against the assay strain at the starting dilution were assigned a titer of
one half the limit of detection for the assay (i.e. 4).
Example 2: Cloning and Expression of Non-Lipidated ORF2086 Variants
The mature P2086 amino acid sequence corresponding to residues 27-286 from
N. meningitidis strain M98250771 (A05) was originally derived from PCR amplification
from genomic DNA. The forward primer, with a sequence of
TGCCATATGAGCAGCGGAAGCGGAAG (SEQ ID NO: 22), annealed to the 5'
sequence and contained an Ndel site for cloning. The reverse primer, with a sequence
of CGGATCCCTACTGTTTGCCGGCGATGC (SEQ ID NO: 23), annealed to the 3' end
of the gene and contained a termination codon TAG followed by restriction site BamHI.
The 799 bp amplified fragment was first cloned into an intermediate vector PCR2.1
(Invitrogen, Carlesbac, CA) This plasmid was cleaved with Ndel and BamHI, and was
ligated into expression vector pET9a (Novagen, Madison, Wl) which had been cleaved
with Ndel and BamHI. The resulting vector pLA100 (which includes SEQ ID NO: 54),
expressed the mature Subfamily A05 P2086 from strain M98250771 without the Nterminal
cysteine (see SEQ ID NO: 13 wherein the N-terminal Cys at position 1 is
deleted or SEQ ID NO: 55) that would be present in the lipidated protein. BLR(DE3) £ .
coli host strain [F- ompT hsdSB(rB-mB-) gal dcm A(srl-recA)306::Tn10 (TetR) (DE3)]
(Novagen) was used to obtain expression of fHBP.
The same cloning steps were used to prepare the B02, B03, B09, B22, B24, B44,
A04, A 12, and A22 N-terminal Cys-deleted variants. The N-terminal Cys-containing
variants were also prepared by this same method using forward primers which also
included the Cys codon (e.g. the first codon of SEQ ID NOs: 1-1 1) . Based on the
sequences provided herein, the skilled worker would be able to design forward and
reverse primers for each of these variants. For example, the following primers were
used to amplify the B44 non-lipidated variant followed by cloning into pET9a using Ndel
and Blpl.
Table 1
Results
Non-lipidated plasmid constructs were strongly expressed, but the non-lipidated
protein variants were pyruvylated at the N-terminal Cys residue. See Examples 8 and
9, which describes, for example, a method for expressing the constructs. To overcome
this pyruvylation, the N-terminal Cys codon was deleted. See, for example, Example
10. Deletion of the N-terminal Cys, however, abrogated expression of the A22 and B22
variants. See e.g., Figure 4 . The A05, B01 , and B44 variants, however, were still
expressed despite deletion of the N-terminal Cys residue. See, for example, SEQ ID
NO: 13 (A05), wherein the N-terminal Cys at position 1 is deleted, SEQ ID NO: 35 (B01
N-terminus), and SEQ ID NO: 2 1(B44),wherein the N-terminal Cys at position 1 is
deleted. See e.g., Figure 5. In addition, expression of the non-lipidated B09 variant
was not affected by deletion of the N-terminal Cys residue. See, for example, Example
4.
Example 3: Effect of Gly/Ser Stalk on Non-Lipidated Variant Expression
To determine why the A05, B01 , and B44 variants were expressed in the
absence of the N-terminal Cys and the A22 and B22 variants were not, the sequences
of these variants were aligned. The A05, B01 , and B44 variants all possess an
extended series of 10 or 11 Gly and Ser residues immediately following the N-terminal
Cys (i.e. Gly/Ser stalk). The A22 and B22 variants, however, only had a Gly/Ser stalk
consisting of 6 Gly and Ser residues. Accordingly, the Gly/Ser stalk of the A22 and B22
variants was expanded by insertion of additional Gly and Ser residues.
Long Gly/Ser stalk variants were prepared by the methods described in Example
2 using forward primers that encode a Gly/Ser stalk with either 10 or 11 Gly and Ser
residues.
The N-terminal Cys-deleted, long Gly/Ser stalk ( 10-1 1 Gly/Ser residues) A22 and
B22 variants showed increased expression over the N-terminal Cys-deleted A22 and
B22 short Gly/Ser stalk (6 Gly/Ser residues) variants. These expression levels,
however, were still reduced compared to the A05, B01 , and B44 variant expression
levels.
Example 4: Codon Optimization
Expression of the non-lipidated B09 variant was not affected by deletion of the
N-terminal Cys residue (see SEQ ID NO: 18, wherein the cysteine at position 1 is
deleted, or SEQ ID NO: 49). See, e.g., Figure 6. Sequence evaluation of the B09
variant demonstrated that the B09 variant has a Gly/Ser stalk consisting of 6 Gly and
Ser residues, similar to the Gly/Ser stalk of the A22 and B22 variants. Indeed, the
N-terminal tails of the B09 and A22 variants are identical at the amino acid level. The
N-terminal tails of the B09 and A22 variants (SEQ ID NO: 53 and 42, respectively),
however, vary at the nucleic acid level by 2 nucleic acids: nucleic acids 15 and 39 of
SEQ ID NO: 8. See e.g., Figure 6. The first 14 amino acids of the N-terminal tail of the
B22 variant are identical to the B09 and A22 variants, and the N-terminal tail of the B22
variant only differs at the 15th amino acid. Nucleic acids 1-42 of the B22 variant are
identical to nucleic acids 1-42 of the A22 variant. Nucleic acids 1-42 of the B22 variant
(see SEQ ID NO: 52) are identical to nucleic acids 1-42 of B09 (see SEQ ID NO: 53) but
for differences at nucleic acids 15 and 39, when optimally aligned. Accordingly, the B22
variant differs from the B09 variant at amino acids 15 and 39 of SEQ ID NO: 8. This last
sentence contains a typographical error and should state that the B22 variant differs
from the B09 variant at nucleic acids 15 and 39 of SEQ ID NO: 8.
To determine if the nucleic acid differences affected the expression level of the
B09 variant compared to the A22 and B22 variants, the A22 and B22 variants were
mutated by point mutation to incorporate nucleic acids 15 and 39 into the corresponding
codons for Gly5 and Gly13. Incorporation of these silent nucleic acid mutations
significantly increased expression of the A22 and B22 N-terminal Cys-deleted variants
to levels similar to the N-terminal Cys-deleted B09 variant. See e.g., Figure 7.
Accordingly, codon optimization to match the B09 variant can increase expression of
N-terminal Cys-deleted non-lipidated P2086 variants.
Further analysis of the non-lipidated variant sequences suggested additional
codon optimizations in the Gly/Ser stalk to improve expression. Accordingly, additional
non-lipidated variants were constructed by the method of Example 2 using forward
primers comprising such codon optimized sequences. The forward primers used to
generate optimized Gly/Ser stalks include any of the following sequences:
ATGAGCTCTGGAGGTGGAGGAAGCGGGGGCGGTGGA (SEQ ID NO: 28)
M S S G G G G S G G G G (SEQ ID NO: 29)
ATGAGCTCTGGAAGCGGAAGCGGGGGCGGTGGA (SEQ ID NO: 30)
M S S G S G S G G G G (SEQ ID NO: 3 1)
ATGAGCTCTGGAGGTGGAGGA (SEQ ID NO: 32)
M S S G G G G (SEQ ID NO: 33)
ATGAGCAGCGGGGGCGGTGGA (SEQ ID NO: 34)
M S S G G G G (SEQ ID NO: 33)
Example 5: Immunogenic Composition Formulation Optimization
ISCOMATRIX formulated vaccines generate a rapid immune response resulting
in a reduction in the number of dosages required to achieve a greater than 4 fold
response rate as measured in a serum bactericidal assay. Groups of five rhesus
macaques were immunized with different formulations of a bivalent non-lipidated
rP2086 vaccine. The vaccine included a non-pyruvylated non-lipidated A05 variant
(SEQ ID NO: 13 wherein the N-terminal Cys at position 1 is deleted or SEQ ID NO: 55
encoded by SEQ ID NO: 54) and a non-pyruvylated non-lipidated B44 variant (SEQ ID
NO: 2 1 wherein the N-terminal Cys at position 1 is deleted or SEQ ID NO: 44 encoded
by SEQ ID NO: 5 1) . The adjuvant units are as follows: AIPO is 250 meg, ISCOMATRIX
is between 10 and 100 meg. The adjuvant units for AIPO4 shown in Tables 2-5 are
shown as milligram units, and are therefore shown as 0.25 (milligram) as opposed to
250 meg.
The immunization schedule was 0, 4 and 24 wks with bleeds at 0, 4, 6 and 26
weeks. There were no increases in SBA titers at post dose one for any of the groups. At
post dose two, an increase in SBA titers and the number of responders as defined by a
4 fold increase in SBA titer above baseline was observed for formulations containing the
ISCOMATRIX adjuvant. Tables 2 and 3 provide the SBA GMTs observed for a fHBP
Subfamily A and B strain respectively. SBA GMTs for the ISCOMATRIX formulations
were 3-1 9 and 4 - 2 4 fold higher than those observed for the AIPO4 formulation for the
A and B subfamily strains respectively. Enhanced titers were also observed at post
dose three for the ISCOMATRIX formulations at 13-95 and 2 - 10 for a fHBP Subfamily
A and B strain respectively compared to the AIPO4 formulation. Analysis of the
responder rates, as defined by a four fold or greater increase in SBA titer over baseline
revealed a similar trend (Tables 4 and 5).
Table 2 : SBA titers (GMTs) obtained for against a MnB LP2086 Subfamily A
strain
immune serum from rhesus macaques immunized with different formulations
of a bivalent
rP2086 vaccine
Adjuvant Geometric Mean titer (GMT)
Vaccine lipidation AIP04 ISCOMATRIX® wkO wk4 wk6 wk26
0.25 +
10 + +++
A05/B44 0.25 10 + ++
100 ++ ++++
0.25 100 + +++
Five monkeys pi r group; Immunization sc ledule: 0, 4, 24 weeks; bleed
scrledule 0, ί \ , 6 and 26 wks. SBA tesl strain MnB M98 250771 .
"-" < 8; "+ ' 8-32; "++" 33-128; "+++" 129-512; "++++" >512
Table 4: Number of rhesus macaques with a >4 fold rise in SBA Titer us
MnB
LP2086 Subfamily A strain
Adjuvant No. of responders
Vaccine lipidation AIP04 ISCOMATRIX® wkO wk4 wk6 wk26
0.25 0 0 0
10 0 0 5
A05/B44 0.25 10 0 0 5
100 0 0 5
0.25 100 0 0 5

Example 6: Immunoprotection conferred by Lipidated and Non-Lipidated
Variants
A recombinantly expressed non-lipidated P2086 variant (B44) induces broad
protection as measured by SBA against strains that represent diverse fHBP variants
(from about 85% to about <92% ID) LP2086 sequences. These response rates were
obtained for a non lipidated vaccine formulated with AIP0 4. See Table 6, which shows
SBA response rates to a subfamily B fHBP MnB strain generated by a bivalent fHBP
vaccine. The non-lipidated vaccine (represented by a "-" under the "lipidation" column)
included 1mcg per protein of a non-pyruvylated non-lipidated A05 variant (SEQ ID NO:
13 wherein the N-terminal Cys at position 1 is deleted) and a non-pyruvylated nonlipidated
B44 variant (SEQ ID NO: 2 1 wherein the N-terminal Cys at position 1 is
deleted) .
Alternatively, a recombinantly expressed non-lipidated P2086 variant (B44)
induces greater immune responses as measured by SBA titer than a lipidated variant
(B01 ) against strains bearing similar (>92% ID) and diverse (<92% ID) LP2086
sequences. Higher response rates (as defined by a four fold increase or greater in SBA
titers over baseline) was observed for the vaccine containing the non-lipidated rP2086
B44 compared to the lipidated rl_P2086 B01 vaccine (Table 6).
According to Table 6, non-lipidated B44 is a preferred subfamily B component of
fHBP in a composition for providing broad coverage against (e.g., eliciting bactericidal
antibodies against) multiple LP2086 variant strains.
Surprisingly, the inventors noted that LP2086 B09 variant strains are particularly
unlikely to have positive SBA response rates with regard to heterologous (non-B09)
ORF2086 polypeptides. In particular, the inventors found that LP2086 B09 is an
exception in terms of an assay strain against which the A05/B44 immunogenic
composition described in Table 6 elicited bactericidal antibodies. Therefore, in a
preferred embodiment an immunogenic composition of the invention includes a B09
polypeptide, in particular in the context of a composition including more than one
ORF2086 subfamily B polypeptide. In a preferred embodiment an immunogenic
composition that includes a non lipidated B44 may also include a non-lipidated B09
polypeptide.
Table 6 : SBA response rates to a Subfamily B fHBP MnB strains
generated by bivalent fHBP vaccines
Immune serum from rhesus macaques.
% ID to
Matched
LP2086
Adjuvant Variant of Vaccine lipidation Subfamilyfor % responders
non-lipidated PD3 Wk 26 Assay Strain
Vaccine
Component
B02 A05/B01 + 80
99.6
A05/B44 100
AIP04 B03 A05/B01 + 86.7 50
0.25mg A05/B44 - 80
B09 AA0055//BB0414 +- 86.3 00
B15 AA0055//BB0414 +- 86.7 2850
B16 A05/B01 + 0 87.1 A05/B44 - 50
B16 A05/B01 + 0
87.1 A05/B44 - 60
B24 A05/B01 + 0
A05/B44 - 85.9 60
B44 A05/B01 + 100
A05/B44 - 100 100
ISCOMATRIX®
A05 A05/B44 - 100 100
( 10 meg)
ISCOMATRIX®
A05 A05/B44 - 100 100
(100 meg)
ISCOMATRIX®
A22 A05/B44 - 88.9 80
( 10 meg)
ISCOMATRIX® A22 A05/B44 - 88.9 100
(100 meg)
Five monkeys per group; Immunization schedule: 0, 4, 24 weeks; bleed schedule 0, 4,
6, and 26 wks.
Example 7 : Codon Optimization of the B44 and B09 Variants
Although the expression levels achieved in the preceding examples were
adequate for many applications, further optimization was desirable, and E. coli
expression constructs containing additional codon optimization over the full length of the
protein were prepared and tested. One such improved sequence for expression of a
non-Cys B44 protein was found to be the nucleic acid sequence set forth in SEQ ID NO:
43. As shown in Example 9, the expression construct containing SEQ ID NO: 43
showed enhanced expression compared to that of the non-optimized wild type
sequence.
Expression of the N-terminal Cys deleted B09 protein was improved by applying
codon changes from the above optimized B44 (SEQ ID NO: 43) construct to B09 (SEQ
ID NO: 48). To generate optimized B09 sequences, the B44 optimized DNA sequence
(SEQ ID NO: 43) was first aligned to the DNA sequence of the B09 allele (SEQ ID NO:
48). The entire non-lipidated coding sequence of the B09 allele (SEQ ID NO: 48) was
optimized to reflect the codon changes seen in the B44 optimized allele (SEQ ID NO:
43) wherever the amino acids between B44 (SEQ ID NO: 44) and B09 (SEQ ID NO: 49)
were identical. Codon sequences in the B09 allele corresponding to the identical amino
acids between the B09 allele and the B44 allele were changed to reflect the codon used
in the B44 optimized sequence (SEQ ID NO: 43). Codon sequences for amino acids
that differ between B09 (SEQ ID NO: 49) and B44 (SEQ ID NO: 44) were not changed
in the B09 DNA sequence.
Additionally, the non-lipidated B44 amino acid sequence (SEQ ID NO: 44)
contains two sequential serine-glycine repeat sequences (S-G-G-G-G)(SEQ ID NO:
56)(see also amino acids 2 to 6 of SEQ ID NO: 44) at its N-terminus, whereas the B09
allele contains only one serine-glycine repeat at the N-terminus (see amino acids 2 to 6
and amino acids 7 to 1 of SEQ ID NO: 49). The two serine-glycine repeats at the Nterminus
of B44 (amino acids 2 to 6 and amino acids 7 to 11 of SEQ ID NO: 44) also
have different codon usage (see nucleotides 4 to 18 and nucleotides 19 to 33 of SEQ ID
NO: 43), and different combinations of the optimized B44 serine-glycine repeat (e.g.,
either nucleotides 4 to 18 of SEQ ID NO: 43, or nucleotides 19 to 33 of SEQ ID NO: 43,
or a combination thereof) were applied to the B09 DNA sequence (SEQ ID NO: 48, e.g.,
applied to nucleotides 4 to 18 of SEQ ID NO: 48) in order to examine the effect on
recombinant protein expression.
Three different versions of optimized B09 were constructed: SEQ ID NO: 45
contains both serine-glycine repeats (GS1 and GS2) (nucleic acids 4 to 33 of SEQ ID
NO: 43) from the optimized B44, SEQ ID NO: 46 contains GS1 (nucleic acids 4 to 18 of
SEQ ID NO: 43), and SEQ ID NO: 47 contains GS2 (nucleic acids 19 to 33 of SEQ ID
NO: 43). The DNA for all of the above codon optimized sequences were chemically
synthesized using standard in the art chemistry. The resulting DNA was cloned into
appropriate plasmid expression vectors and tested for expression in E. coli host cells as
described in Examples 8 and 9.
Example 8 : Method for Expressing ORF2086, B09 variant
Cells of E. coii K-1 2 strain (derivatives of wild-type W31 10 (CGSC4474) having
deletions in recA, fhuA and araA) were transformed with plasmid pEB063, which
includes SEQ ID NO: 45, pEB064, which includes SEQ ID NO: 46, plasmid pEB065,
which includes SEQ ID NO: 47, or plasmid pLA134, which includes SEQ ID NO: 48.
The preferred modifications to the K-1 2 strain are helpful for fermentation purposes but
are not required for expression of the proteins.
Cells were inoculated to a glucose-salts defined medium. After 8 hours of
incubation at 37°C a linear glucose feed was applied and incubation was continued for
an additional 3 hours. Isopropyl b-D-l-thiogalactopyranoside (IPTG) was added to the
culture to a final concentration of 0.1 mM followed by 12 hours of incubation at 37°C.
Cells were collected by centrifugation at 16,000xg for 10 minutes and lysed by addition
of Easy-Lyse™ Cell Lysing Kit" from Lienco Technologies (St. Louis, MO) and loading
buffer. The cleared lysates were analyzed for expression of B09 by Coomassie staining
of SDS-PAGE gels and/or Western blot analysis with quantitation by a scanning
densitometer. The results from scanning densitometry are below in Table 7:
Example 9 : Method for Expressing ORF2086, B44 variant
Cells of E. coli B strain (BLR(DE3), Novagen) were transformed with plasmid
pLN056, which includes SEQ ID NO: 5 1. Cells of E. coli K-12 strain (derivative of wildtype
W31 10) were transformed with plasmid pDK087, which includes SEQ ID NO: 43.
Cells were inoculated to a glucose-salts defined medium. After 8 hours of incubation at
37°C a linear glucose feed was applied and incubation was continued for an additional 3
hours. Isopropyl b-D-l-thiogalactopyranoside (IPTG) was added to the culture to a final
concentration of 0.1 mM followed by 12 hours of incubation at 37°C. Cells were
collected by centrifugation at1 6,000xg for 10 minutes and lysed by addition of Easy-
Lyse™ Cell Lysing Kit" from Lienco Technologies (St. Louis, MO) and loading buffer.
The supermatants were analyzed for expression of B09 by Coomassie staining of SDSPAGE
gels and/or Western blot analysis, with quantitation by a scanning densitometer.
The results from scanning densitometry are below in Table 8 :
Example 10: Pyruvylation
The present example demonstrates that the N-terminal Cys residue of non-lipidated
ORF2086 proteins can become pyruvylated when expressed in, for example, E. coli.
Heterologous protein accumulation during production of variants A05 (SEQ ID
NO: 13) and B44 (SEQ ID NO: 2 1) were monitored using reverse-phase high
performance liquid chromatography (RP-HPLC). This separation was interfaced with a
quadrupole time-of-flight mass spectrometer (QTOF-MS) to provide a means of
monitoring formation of product related variants.
After being expressed in the E. coli B and/or K-1 2 host cells, products derived
from these fermentations underwent a purification procedure during which a product
modification was observed. Deconvolution of the mass spectra characterized the
variants as exhibiting mass shifts of +70 Da, as compared to native products of 27640
and 27572 Da for A05 and B44, respectively.
Published literature indicated that a +70 Da mass shift had previously been
observed in proteins and has been attributed to pyruvylation of the amino-terminal
residue.
The presence and location of the pyruvate group was confirmed using the mass
spectral fragmentation data (MS/MS). The data indicated that the modification was on
an amino-terminal cysteine residue, i.e., amino acid at position 1, according to A05 and
B44. For A05, the percentage of pyruvylated polypeptides was about 30%, as
compared to the total number of A05 polypeptides (SEQ ID NO: 13). For B44 the
percentage of pyruvylated polypeptides was about 25%, as compared to the total
number of B44 polypeptides (SEQ ID NO: 21).
When A05 (SEQ ID NO: 13 wherein the N-terminal Cys at position 1 is deleted or
SEQ ID NO: 55) and B44 variants (SEQ ID NO: 2 1 wherein the N-terminal Cys at
position 1 is deleted or SEQ ID NO: 44), which do not contain an amino-terminal
cysteine, were purified, there was no detectable pyruvylation (+70 Da).
Example 11 : Immunogenicity of B09 and B44, individually and in combination
5 - 10 groups of rhesus maccaques monkeys were immunized with B09 variant
(SEQ ID NO: 49 encoded by SEQ ID NO: 48) or B44 variant (SEQ ID NO: 44 encoded
by SEQ ID NO: 43), or the A05, B09 and B44 (SEQ ID NO: 55, SEQ ID NO: 49 encoded
by SEQ ID NO: 48, and SEQ ID NO: 44 encoded by SEQ ID NO: 43, respectively)
formulated with 250 meg of AIPO4 per dose. The monkeys were vaccinated via the
intramuscular route at weeks 0, 4 and 8 with 10 meg each of non-lipidated fHBP alone
or in combination as listed in Table 9 and 10. Both weeks 0 and 12 serum samples
were analyzed in SBAs against MnB strains with either subfamily A or subfamily B fHBP
variants. Responders were recorded as animals with a 4 x rise in titer. The B44 variant
tested was the optimized construct (SEQ ID NO: 43) and the broad response rates that
were observed in previous studies (table above) were maintained for the optimized
construct (Table 9) the B44 vaccine alone or in combination with B09. The B09 vaccine
alone (Table 10) could also generate broadly cross reactive immune responses (Table
10).
Table 9: Response rates obtained for non lipidated fHBP vaccines in rhesus macaques
Rhesus macaques (n= 10) were immunized i.m. at weeks 0, 4 and 8 with 10 meg each
of non-lipidated fHBP alone or in combination as listed in the Vaccine column in
formulation with 250 meg of AIPO4. Both weeks 0 and 10 serum samples were
analyzed in SBAs against the MnB strains listed in the table. Responders are recorded
as animals with a 4 x rise in titer.
Table 9 indicates, for example, that a composition including a combination of
non-pyruvylated non-lipidated B44, B09, and A05 showed higher cross-coverage
against the test variants as compared to the cross-coverage from a composition
including B44 alone. In view of results shown in the present application, including in
particular Table 6 and Table 9 together, compositions including B44, B09 and A05 alone
or in combination are preferred embodiments of the present invention. In particular,
compositions including both B44 and B09 are disclosed. Such composition preferably
further includes a subfamily A polypeptide, such as in particular A05.
Table 10: Response rates obtained for non lipidated fHBP B09 vaccine in rhesus
macaques
Rhesus macaques (n= 5) were immunized i.m. at weeks 0, 4 and 8 with 10 meg each of
non-lipidated fHBP alone or in combination as listed in the Vaccine column in
formulation with 250 meg of AIP0 4. Both weeks 0 and 10 serum samples were
analyzed in SBAs against the MnB strains listed in the table. Responders are recorded
as animals with a 4 x rise in titer.
Example 12: Immunoprotection conferred by Lipidated and Non-Lipidated
Variants construct
Twenty female New Zealand white rabbits, 2.5-3.5 kg, obtained from Charles River
Canada, were pre-screened by whole cell ELISA and 10 animals were selected for this
study based on their low background titers against the test strains representing fHBP
variants B02 (SEQ ID NO: 16) and B44 (SEQ ID NO: 2 1) (Table 11) . Group of three
animals were i.m. immunized with 100 g of each protein formulated with 50 mg
ISCOMATRIX per 0.5 ml dose at weeks 0, 4 and 9 (Table 12). Group 1 was vaccinated
with non-lipidated B44 (SEQ ID NO: 44). A control group was included that was
vaccinated with lipidated B01 formulated with AIP04 (250 meg) Rabbits were bled at
weeks 0, 4, 9 and 10. Individual sera from week 10 were prepared and analyzed by
serum bactericidal assay against multiple serogroup B meningococcal strains from the
fHBP B subfamily.
Table 11: Rabbits Used in The Study
Species: Rabbit
Strain: New Zealand white
Source: 3 Charles River Laboratory
No. of Animals Per Group 3
Total No. of Animals: 9
Age and Sex: Female
Weight: 2.5-3.5 kg
Table 12
rfHBP Aluminium
ISCOMATRIX
# of , . . , . . ( 0.5 Phosphate
Group Variant hpidated (Mg/0.5 ml
animals ml (pg/0.5 ml
dose)
dose) dose)
1 3 B44 100 50
2 3 B01 100 50
3 3 B01 + 100 - 100
Immunization schedule Weeks 0, 4, 9; Bleed schedule Weeks 0, 4, 9,1 0
Serum Bactericidal Assay (SBA): A microcolony-based serum bactericidal assay (SBA)
against multiple serogroup B meningococcal strains (Table 13) was performed on
individual serum samples. Human sera from donors were qualified as the complement
source for the strain tested in the assay. Complement-mediated antibody-dependent
bactericidal titers were interpolated and expressed as the reciprocal of the dilution of the
test serum that killed 50% of the meningococcal cells in the assay. The limit of
detection of the assay was an SBA titer of 4. An SBA titer of <4 was assigned number
of 2. A > 4-fold rise of SBA titers in the week 10 sera in comparison to the titers in the
pre-bleed was calculated and compared.
Serum bactericidal antibody activity as measured in the SBA is the immunologic
surrogate of protection against meningococcal disease. The ability of immunization with
non-lipidated rfHBP to elicit bactericidal antibodies in rabbits was determined by SBA.
SBA measures the level of antibodies in a serum sample by mimicking the complementmediated
bacterial lysis that occurs naturally. Rabbit serum samples collected from
week 10 were analyzed by SBA against strains with a B44 fHBP or a B02 fHBP. As
shown in Table 13 , one week after the third immunization (week 10), all serum samples
displayed bactericidal activity against both test strains. (Table 13). The non-lipidated
B44 (SEQ ID NO: 44) was more immunogenic than non-lipidated B01 in New Zealand
Rabbits against these strains. The non lipidated B44 (SEQ ID NO: 44) formulated with
the iscomatrix adjuvant gave comparable titers to the lipidated B01 formulated with
aluminium phosphate against these strains. Rabbit pre-bleed sera showed generally no
pre-existing bactericidal activity against the tested strains.
Table 13: Serum Bactericidal Activity against fHBP Subfamily B Strains in New Zealand
White Rabbits Vaccinated with Recombinant Non-lipidated fHBP
GMT SBA Titer against
test variant
Subfamily B variant B44 (SEQ B02 (SEQ
(formulation) ID NO: 2 1) ID NO: 16)
Non lipidated B44 (SEQ ID 6675 7140
NO: 44)(lscomatrix)
Non lipidated B01 625 1052
(ISCOMATRIX)
Lipidated B01 (AIP0 4) 10099 10558
Example 13: Immunogenicity of six non-lipidated factor H binding proteins in New
Zealand white rabbits.
Groups of 5 rabbits were immunized with non-lipidated fHBP variants as described in
Table 14. Vaccines were administered at 0, 4 and 9 weeks. Rabbit serum samples
collected from weeks 0 and 10 were analyzed by SBA against the strains with
homologous and heterologous fHBP sequences. Table 14 shows the percent
responders post the third immunization. One week after the third immunization (week
10), all serum samples displayed bactericidal activity against the homologous strains as
well as other test strains from the same fHBP subfamily. Rabbits pre-bleed sera
showed generally no pre-existing bactericidal activity against the tested strains.
Table 14: Post Dose Three Percent of Responders in New Zealand White Rabbits
Vaccinated with Recombinant Non-lipidated fHBPs
MnB fHBP Proteins Used
B09 SEQ ID NO: 18, wherein the Cys at position 1 is
deleted, or SEQ ID NO: 49 encoded by SEQ ID
NO: 48.
B22 SEQ ID NO: 19, wherein the Cys at position 1 is
deleted
B44 SEQ ID NO: 2 1, wherein the Cys at position 1 is
deleted, or SEQ ID NO: 44 encoded by SEQ ID
NO: 5 1
Test variants in Table 14:
The invention also provides the following embodiments as defined in the clauses below:
C 1. An immunogenic composition comprising a P2086 polypeptide, wherein
the P2086 is a B44, a B02, a B03, a B22, a B24, a B09, an A05, an A04, an A12, or an
A22 variant.
C2. An immunogenic composition comprising a P2086 Subfamily B
polypeptide, wherein the P2086 Subfamily B polypeptide is a B44, a B02, a B03, a B22,
a B24 or a B09 variant.
C3. The immunogenic composition of C2 further comprising a P2086
Subfamily A polypeptide.
C4. The immunogenic composition of C3, wherein the P2086 Subfamily A
polypeptide is an A05, an A04, an A12, or an A22 variant.
C5. The immunogenic composition of any one of C 1-4, wherein the
composition further comprises an adjuvant.
C6. The immunogenic composition of C5, wherein the adjuvant is selected
from the group consisting of:
a) an aluminum adjuvant;
b) a saponin
c) a CpG nucleotide sequence; and
d) any combination of a), b) and c).
C7. The immunogenic composition according to C6, wherein the aluminum
adjuvant is selected from the group consisting of AIP0 4, AI(OH)3, Al2(S0 4)3 and alum.
C8. The immunogenic composition according to C6 or C7, wherein the
concentration of aluminum is between 0.125 g/ml and 0.5 pg/ml.
C9. The immunogenic composition according to C8, wherein the concentration
of aluminum is 0.25 pg/ml.
C 10. The immunogenic composition according to any one of C6-9, wherein the
saponin concentration is between 1 g/ml and 250 pg/ml.
C 11. The immunogenic composition according to C10, wherein the saponin
concentration is between 10 pg/ml and 100 pg/ml.
C12. The immunogenic composition according to C10, wherein the saponin
concentration is 10 mg/ml.
C13. The immunogenic composition according to C10, wherein the saponin
concentration is 100 pg/ml.
C 14. The immunogenic composition according to any one of C6-1 3, wherein the
saponin is QS-21 or ISCOMATRIX.
C 15. The immunogenic composition according to any one of C 1- 14, wherein the
composition confers the ability to raise an immunogenic response to a Neisseria
meningitidis bacteria after administration of multiple doses to a subject.
C16. The immunogenic composition according to C15, wherein the
immunogenic response to the Neisseria meningitidis bacteria is conferred after
administration of 2 doses to the subject.
C17. The immunogenic composition according to C15, wherein the
immunogenic response to the Neisseria meningitidis bacteria is conferred after
administration of 3 doses to the subject.
C18. A composition conferring increased immunogenicity on a non-lipidated
P2086 antigen, wherein the composition comprises a saponin and at least one
non-lipidated P2086 antigen.
C19. The immunogenic composition according to C18, wherein the saponin
concentration is between 1 mg/ml and 250 pg/ml.
C20. The immunogenic composition according to C19, wherein the saponin
concentration is between 10 pg/ml and 100 mg/ml.
C21 . The immunogenic composition according to C19, wherein the saponin
concentration is 10 mg/ml.
C22. The immunogenic composition according to C19, wherein the saponin
concentration is 100 pg/ml.
C23. The immunogenic composition according to any one of C 18-22, wherein
the saponin is QS-21 or ISCOMATRIX.
C24. The immunogenic composition according to any one of C 18-23 further
comprising aluminum.
C25. The immunogenic composition according to C24, wherein the
concentration aluminum is between 0.125 pg/ml and 0.5 mg/ml.
C26. The immunogenic composition according to C25, wherein the
concentration of aluminum is 0.25 pg/ml.
C27. The immunogenic composition according to any one of C 18-26, wherein
the composition confers an immunogenic response to a Neisseria meningitidis bacteria
after administration of multiple doses to the subject.
C28. The immunogenic composition according to C27, wherein the
immunogenic response to the Neisseria meningitidis bacteria is conferred after
administration of 2 doses to the subject.
C29. The immunogenic composition according to C27, wherein the
immunogenic response to the Neisseria meningitidis bacteria is conferred after
administration of 3 doses to the subject.
C30. The immunogenic composition according any one of C18-29, wherein the
non-lipidated P2086 antigen is a non-lipidated P2086 Subfamily B polypeptide.
C31 . The immunogenic composition according to C30, wherein the
non-lipidated P2086 Subfamily B polypeptide is a B44, a B02, a B03, a B22, a B24 or a
B09 variant.
C32. The immunogenic composition according any one of C18-29, wherein the
non-lipidated P2086 antigen is a non-lipidated P2086 Subfamily A polypeptide.
C33. The immunogenic composition according to C32, wherein the
non-lipidated P2086 Subfamily A polypeptide is an A05, an A04, an A12, or an A22
variant.

What is Claimed is :
1. A composition comprising an isolated non-pyruvylated non-lipidated ORF2086
polypeptide.
2. The composition of claim 1, wherein the composition is immunogenic.
3. The composition of claim 1, wherein the polypeptide comprises a deletion of an Nterminal
Cys compared to the corresponding wild-type non-lipidated ORF2086
polypeptide.
4. The composition of claim 1, wherein the polypeptide comprises the amino acid
sequence selected from the group consisting of SEQ ID NO:1 2, SEQ ID NO:13,
SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 SEQ ID NO:17, SEQ ID NO:1 8,
SEQ ID NO:1 9, SEQ ID NO: 20, and SEQ ID NO: 2 1, wherein the cysteine at
position 1 is deleted.
5. The composition of claim 4, wherein the polypeptide comprises the amino acid
sequence selected from the group consisting of SEQ ID NO: 44, SEQ ID NO: 49,
SEQ ID NO: 50, and SEQ ID NO: 55.
6. The composition of claim 1, wherein the polypeptide is encoded by a nucleotide
sequence that is operatively linked to an expression system, wherein said
expression system is capable of being expressed in a bacterial cell.
7. The composition of claim 6, wherein the expression system is a plasmid expression
system.
8. The composition of claim 6, wherein the bacterial cell is an E. coli cell.
9. The composition of claim 6, wherein the nucleotide sequence is linked to a
regulatory sequence that controls expression of said nucleotide sequence.
10. The composition of claim 1, wherein the polypeptide comprises a substitution of an
N-terminal Cys compared to the corresponding wild-type non-lipidated ORF2086
polypeptide.
83
11.A composition comprising a non-pyruvylated non-lipidated ORF2086 polypeptide
obtainable by a process comprising expressing a nucleotide sequence encoding a
polypeptide having the amino acid sequence selected from the group consisting of
SEQ ID NO:1 2, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16,
SEQ ID NO:1 7, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO: 20, and SEQ ID NO:
2 1, wherein the cysteine at position 1 is deleted, wherein the nucleotide sequence is
operatively linked to an expression system that is capable of being expressed in a
bacterial cell.
12. The composition of claim 0, wherein the bacterial cell is E. coli.
13. A composition comprising an isolated polypeptide, which comprises the amino acid
sequence set forth in SEQ ID NO: 49, and an isolated polypeptide, which comprises
the amino acid sequence set forth in SEQ ID NO: 44.
14. The composition according to any of claims 1-1 3, wherein the composition is
immunogenic.
15 .The composition of claim 13, further comprising an ORF2086 subfamily A
polypeptide from serogroup B Neisseria meningitidis.
16. The composition according to any of claims 1-1 3, wherein the composition elicits a
bactericidal immune response in a mammal against an ORF2086 subfamily B
polypeptide from serogroup B Neisseria meningitidis.
17. An isolated polypeptide comprising the amino acid sequence set forth in SEQ ID
NO: 49.
18. An isolated nucleotide sequence comprising SEQ ID NO: 46.
19. An isolated nucleotide sequence comprising SEQ ID NO: 47.
20. An isolated nucleotide sequence comprising SEQ ID NO: 48.
2 1 .An isolated polypeptide comprising the amino acid sequence set forth in SEQ ID
NO: 50.
22. An isolated nucleotide sequence comprising SEQ ID NO: 45.
23. An isolated polypeptide comprising the amino acid sequence set forth in SEQ ID
NO: 44.
84
24. A plasmid comprising a nucleotide sequence selected from the group consisting of
SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 45, wherein the
plasmid is capable of being expressed in a bacterial cell.
25. The plasmid of claim 24, wherein the bacterial cell is E. coli.
26. A method of eliciting bactericidal antibodies specific to an ORF2086 subfamily B
serogroup B Neisseria meningitidis in a mammal, comprising administering to the
mammal an effective amount of an isolated polypeptide comprising the amino acid
sequence selected from the group consisting of SEQ ID NO: 44 and SEQ ID NO: 49,
or a combination thereof.
27. A method for producing a polypeptide comprising expressing in a bacterial cell a
polypeptide, which comprises a sequence having greater than 90% identity to SEQ
ID NO:21 , said sequence comprising at least one domain selected from the group
consisting of amino acids 13-1 8 of SEQ ID NO: 2 1, amino acids 2 1-34 of SEQ ID
NO: 2 1, and amino acids 70-80 of SEQ ID NO: 2 1, or a combination thereof, wherein
the sequence lacks an N-terminal cysteine; and purifying the polypeptide.
28. The method of claim 27, wherein the sequence further comprises at least one
domain selected from the group consisting of amino acids 96-1 16 of SEQ ID NO: 2 1,
amino acids 158-1 70 of SEQ ID NO: 2 , amino acids 172-1 85 of SEQ ID NO: 2 1,
amino acids 187-1 99 of SEQ ID NO: 2 , amino acids 2 13-224 of SEQ ID NO: 2 1,
amino acids 226-237 of SEQ ID NO: 2 1, amino acids 239-248 of SEQ ID NO: 2 1, or
a combination thereof.
29. The method of claim 27, wherein the bacterial cell is E. coli.
30. An isolated polypeptide produced by a process comprising the method of claim 27.
3 1 .An immunogenic composition produced by a process comprising the method of
claim 27.
85
32. An immunogenic composition comprising an ORF2086 subfamily B polypeptide from
serogroup B Neisseria meningitidis, wherein the polypeptide is a non-pyruvylated
non-lipidated B44.
33. The composition of claim 32, further comprising a second ORF2086 subfamily B
polypeptide from serogroup B Neisseria meningitidis, wherein the second
polypeptide is a non-pyruvylated non-lipidated B09.
34. The composition of claim 32, wherein said composition comprises no more than 3
ORF2086 subfamily B polypeptides.
35. The composition of claim 32, wherein said composition comprises no more than 2
ORF2086 subfamily B polypeptides.
36. The composition of claim 32, wherein said composition further comprises a
ORF2086 subfamily A polypeptide.
37. The composition of claim 36, wherein said composition comprises an A05 subfamily
A polypeptide.

Documents

Application Documents

# Name Date
1 1503-DELNP-2013.pdf 2013-02-22
2 1503-delnp-2013-Correspondence-Others-(22-03-2013).pdf 2013-03-22
3 1503-delnp-2013-Form-3-(12-08-2013).pdf 2013-08-12
4 1503-delnp-2013-Correspondence-Others-(12-08-2013).pdf 2013-08-12
5 1503-delnp-2013-GPA.pdf 2013-08-20
6 1503-delnp-2013-Form-5.pdf 2013-08-20
7 1503-delnp-2013-Form-3.pdf 2013-08-20
8 1503-delnp-2013-Form-2.pdf 2013-08-20
9 1503-delnp-2013-Form-18.pdf 2013-08-20
10 1503-delnp-2013-Form-1.pdf 2013-08-20
11 1503-delnp-2013-Correspondence-others.pdf 2013-08-20
12 1503-delnp-2013-Claims.pdf 2013-08-20
13 1503-DELNP-2013-FER.pdf 2017-09-07
14 1503-DELNP-2013-PETITION UNDER RULE 137 [09-10-2017(online)].pdf 2017-10-09
15 1503-DELNP-2013-FORM 3 [09-10-2017(online)].pdf 2017-10-09
16 1503-DELNP-2013-FER_SER_REPLY [15-02-2018(online)].pdf 2018-02-15
17 1503-DELNP-2013-DRAWING [15-02-2018(online)].pdf 2018-02-15
18 1503-DELNP-2013-COMPLETE SPECIFICATION [15-02-2018(online)].pdf 2018-02-15
19 1503-DELNP-2013-CLAIMS [15-02-2018(online)].pdf 2018-02-15
20 1503-DELNP-2013-ABSTRACT [15-02-2018(online)].pdf 2018-02-15
21 1503-DELNP-2013-FORM 3 [20-09-2018(online)].pdf 2018-09-20
22 1503-DELNP-2013-HearingNoticeLetter.pdf 2019-01-07
23 1503-DELNP-2013-REQUEST FOR ADJOURNMENT OF HEARING UNDER RULE 129A [28-01-2019(online)].pdf 2019-01-28
24 1503-DELNP-2013-Information under section 8(2) (MANDATORY) [31-01-2019(online)].pdf 2019-01-31
25 1503-DELNP-2013-ExtendedHearingNoticeLetter_28Feb2019.pdf 2019-01-31
26 1503-DELNP-2013-Correspondence to notify the Controller (Mandatory) [27-02-2019(online)].pdf 2019-02-27
27 1503-DELNP-2013-FORM-26 [28-02-2019(online)].pdf 2019-02-28
28 1503-DELNP-2013-Power of Attorney-060319.pdf 2019-03-08
29 1503-DELNP-2013-Correspondence-060319.pdf 2019-03-08
30 1503-DELNP-2013-Written submissions and relevant documents (MANDATORY) [14-03-2019(online)].pdf 2019-03-14
31 1503-DELNP-2013-PatentCertificate28-03-2019.pdf 2019-03-28
32 1503-DELNP-2013-IntimationOfGrant28-03-2019.pdf 2019-03-28
33 1503-DELNP-2013-RELEVANT DOCUMENTS [06-03-2020(online)].pdf 2020-03-06
34 1503-DELNP-2013-RELEVANT DOCUMENTS [11-03-2020(online)].pdf 2020-03-11
35 1503-DELNP-2013-FORM-26 [16-07-2020(online)].pdf 2020-07-16
36 1503-DELNP-2013-RELEVANT DOCUMENTS [04-09-2021(online)].pdf 2021-09-04
37 1503-DELNP-2013-FORM-26 [26-11-2021(online)].pdf 2021-11-26
38 1503-delnp-2013-GPA-220322.pdf 2022-03-23
39 1503-delnp-2013-Correspondence-220322.pdf 2022-03-23
40 1503-DELNP-2013-RELEVANT DOCUMENTS [27-09-2022(online)].pdf 2022-09-27

Search Strategy

1 searchstrategy_07-09-2017.pdf

ERegister / Renewals

3rd: 05 May 2019

From 08/09/2013 - To 08/09/2014

4th: 05 May 2019

From 08/09/2014 - To 08/09/2015

5th: 05 May 2019

From 08/09/2015 - To 08/09/2016

6th: 05 May 2019

From 08/09/2016 - To 08/09/2017

7th: 05 May 2019

From 08/09/2017 - To 08/09/2018

8th: 05 May 2019

From 08/09/2018 - To 08/09/2019

9th: 05 May 2019

From 08/09/2019 - To 08/09/2020

10th: 10 Aug 2020

From 08/09/2020 - To 08/09/2021