Abstract: The present invention relates to antibodies capable of binding specifically to i) the human anti-insulin/lGF-I hy-hricl receptor (hybrid-R) or ii) both to said hybrid-R and the human insulin-like growth factor I receptor (1GF-IR) and/or capable of specially inhibiting the tyrosine kinase activity of said hybrid-R or both hybrid-R and IGF-IR, especially monoclonal antibodies of murine, chimeric and humanized origin, as well as the amino acid and nucleic acid sequences coding for these antibodies. The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overcxprcssing, or with an abnormal activation of, hybrid-R or of both hybrid-R and 1GF-IR or any pathology connected with the overexprcssion, or abnormal activation, of said receptor as well as in processes or kits for diagnosis of illnesses connected with the overexpression of the hybrid-R or both hybrid-R and 1GF-TR. The invention finally comprises products and/or compositions com-prising such antibodies in combination with anti-EGFR antibodies and/or compounds and/or anti-cancer agents or agents conjugated with toxins and their use for the prevention and/or the treatment of certain cancers.
NOVEL ANTI-INSULIN/IGF-I HYBRID RECEPTOR OR ANTI-INSULIN/IGF-I HYBRID RECEPTOR AND IGF-IR ANTIBODIES AND USES THEREOF
The present invention relates to novel antibodies capable of binding specifically to i) the human Insulin/IGF-I hybrid receptor, isoform(s) A and/or B, (hereinafter referred as "hybrid-R" or sometimes as "hybrid-Rs", "hybrid-RsA" for isoform A or "hybrid-RsB" for isoform B) and/or ii) both the hybrid-R and insulin-like growth factor I receptor (hereinafter referred as "IGF-IR") and/or capable of specifically ininbiting the tyrosine kinase activity of said hybrid-R or of both hybrid-R and IGF-IR, especially monoclonal antibodies of murine, cinmeric and humanized origin, as well as the amino acid and nucleic acid sequences coding for these antibodies. The invention likewise comprises the use of these antibodies as a medicament for the prophylactic and/or therapeutic treatment of cancers overexpressing, or with an abnormal activation of, hybrid-R or both hybrid-R and IGF-IR or any pathology connected with the overexpression, or an abnormal activation, of said receptor(s) as well as in processes or kits for diagnosis of illnesses connected with the overexpression, or an abnormal activation, of the hybrid-R or both hybrid-R and IGF-IR. The invention finally comprises products and/or compositions comprising such antibodies in combination with anti-EGFR antibodies and/or compounds and/or anti-cancer agents or agents conjμgated with toxins and their use for the prevention and/or the treatment of certain cancers.
The insulin-like growth factor I receptor called IGF-IR is a receptor with tyrosine kinase activity having 70% homology with the insulin receptor (hereinafter referred as "IR"). Sequence(s) coding for IGF-IR are registered under Accession Number NM_000875 in the NCBI Genbank. Another data, without limitation and incorporated herein by reference, describing IGF-IR sequence(s) is Ulrich et al., 1986, EMBO J., 5(10):2503-2512. IGF-IR is a glycoprotein of molecular weight approximately 350,000. It is a hetero-tetrameric receptor of winch each half-linked by disulfide bridges- is composed of an extracellular osubunit and of a transmembrane /?-subunit (see figure 1). IGF-IR binds its native ligands, preferably IGF1 and IGF2, with a very ingh affinity (Kd #1 nM) but is equally capable of binding to insulin with an
affinity 100 to 1000 times less. Conversely, the IR binds insulin with a very ingh affinity althoμgh the IGFs only bind to the IR with a 100 times lower affinity. The tyrosine kinase domain of IGF-IR and of IR has a very ingh sequence homology althoμgh the zones of weaker homology respectively concern the cysteine-rich region situated on the a-subunit and the C-terminal part of the jS-subunit. The sequence differences observed in the a-subunit are situated in the binding zone of the ligands and are therefore at the origin of the relative affinities of IGF-IR and of IR for the IGFs and insulin respectively. The differences in the C-terminal part of the β-subunit result in a divergence in the signalling pathways of the two receptors; IGF-IR mediating mitogenic, differentiation and antiapoptosis effects, winle the activation of the IR principally involves effects at the level of the metabolic pathways (Baserga et al., Biocinm. Biophys. Acta, 1332:F105-126, 1997; Baserga R., Exp. Cell. Res., 253:1-6, 1999).
The cytoplasmic tyrosine kinase proteins are activated by the binding of the ligand to the extracellular domain of the receptor. The activation of the kinases in its turn involves the stimulation of different intra-cellular substrates, including IRS-1, IRS-2, She and Grb 10 (Peruzzi F. et al., J. Cancer Res. Clin. Oncol., 125:166-173, 1999). The two major substrates of IGF-IR are IRS and She winch mediate, by the activation of numerous effectors downstream, the majority of the growth and differentiation effects connected with the attachment of the IGFs to tins receptor (figure 2). The availability of substrates can consequently dictate the final biological effect connected with the activation of the IGF-IR. When IRS-1 predominates, the cells tend to proliferate and to transform. When Shc dominates, the cells tend to differentiate (Valentinis B. et al., J. Biol. Chem., 274:12423-12430, 1999). It seems that the route principally involved for the effects of protection against apoptosis is the phosphatidyl-inositol 3-kinases (PI 3-kinases) route (Frisco M. et al., Horm. Metab. Res., 31:80-89, 1999; Peruzzi F. et al., J. Cancer Res. Clin. Oncol., 125:166-173,1999).
The role of the IGF system in carcinogenesis has become the subject of intensive research in the last ten years. Tins interest followed the discovery of the fact that in addition to its mitogenic and antiapoptosis properties, IGF-IR seems to be
required for the establishment and the maintenance of a transformed phenotype. In fact, it has been well established that an overexpression or a constitutive activation of IGF-IR leads, in a great variety of cells, to a growth of the cells independent of the support in media devoid of fetal calf serum, and to the formation of tumors in nude mice. Tins in itself is not a unique property since a great variety of products of overexpressed genes can transform cells, including a good number of receptors of growth factors. However, the crucial discovery winch has clearly demonstrated the major role played by IGF-IR in the transformation has been the demonstration that the R- cells, in winch the gene coding for IGF-IR has been inactivated, are totally refractory to transformation by different agents winch are usually capable of transforming the cells, such as the E5 protein of bovine papilloma virus, an overexpression of EGFR or of PDGFR, the T antigen of SV 40, activated ras or the combination of these two last factors (Sell C. et al., Proc. Natl. Acad. Sci., USA, 90:11217-11221, 1993; Sell C. et al., Mol. Cell. Biol., 14:3604-3612, 1994; Morrione A. J., Virol., 69:5300-5303, 1995; Coppola D. et al., Mol. Cell. Biol., 14:4588-4595, 1994; DeAngelis T et al., J. Cell. Physiol., 164:214-221,1995).
IGF-IR is expressed in a great variety of tumors and of tumor lines and the IGFs amplify the tumor growth via their attachment to IGF-IR. Other arguments in favor of the role of IGF-IR in carcinogenesis come from studies using murine monoclonal antibodies directed against the receptor or using negative dominants of IGF-IR. in effect, murine monoclonal antibodies directed against IGF-IR ininbit the proliferation of numerous cell lines in culture and the growth of tumor cells in vivo (Arteaga C. et al., Cancer Res., 49:6237-6241, 1989; Li et al., Biochem. Biophys. Res. Com., 196:92-98, 1993; Zia F et al., J. Cell. Biol., 24:269-275, 1996; Scotlandi K et al., Cancer Res., 58:4127-4131, 1998). It has likewise been shown in the works of Jiang et al. (Oncogene, 18:6071-6077, 1999) that a negative dominant of IGF-IR is capable of ininbiting tumor proliferation.
For the first time, data illustrating the recognition of hybrid-R or both hybrid-R and IGF-IR by the same monoclonal antibody able to ininbit specifically, in vitro and in vivo, the tumoral growth, thus allowing to treat cancer, more particularly breast cancer,
Able to conjointly express the two receptor types are shown in the present example (see particularly example 26). Actually, the capacity of 7C10 and h7C10 to recognize and/or ininbit the tyrosine kinase activity of hybrid-R or both hybrid-R and IGF-IR allow to avoid the escape of tumor consequent upon the expression, or the abnormal activation, of tins hybrid-R. Such an antibody could be an innovative therapeutic compound of a essential interest for the treatment of cancer.
Cancer pathologies are characterized by an uncontrolled cellular growth. In several cancer, growth factors are specifically binding with their receptors and then transmit growth, transformation and/or survival signals to the tumoral cell. The growth factor receprtors over-expression at the tumoral cell surface is largely described (Salomon DS et al., Grit. Rev. Oncol. Hematol, 1995,19:183; Burrow S. et al., J. Surg. Oncol, 1998, 69:21 ; Hakam A. et al., Hum. Pathol., 1999, 30:1128; Railo M.J. et al., Eur. J. Cancer, 1994, 30:307; Happerfield L.C. et al., J. Pathol., 1997, 183:412). Tins over-expression, or abnormal activation, leading to a direct perturbation of cellular growth regulation mechanisms, can also affect the cell sensibility to induced apoptose by classical chemotherapies or radiotherapies.
During last few years, it has been show that the targeting of growth factor receptors, like EGFR or Her2/neu over-expressed on the tumoral cell surface, with respectively humanized (herceptin®) or cinmeric (C225) antibodies results in an significant ininbition of the tumoral growth on patients and in a significant increase of the efficacity of classical chemotherapy treatments (Carter P., Nature Rev. Cancer, 2001, 1(2):118; Hortobagyi G. N., Semin. Oncol., 2001, 28:43; Herbst R.S. et al., Semin. Oncol., 2202, 29:27). Other receptors like IGF-IR or VEGF-R (for vascular endothelial growth factor receptor) have been identified as potential target in several preclinical studies.
More particularly, IGF-IR is part of the tyrosine kinase receptors. It shows a ingh homology with the Insulin receptor (IR) winch exist under two isoforms A and B. Sequences of IR, isoforms A and B, are registered under Accession Numbers X02160 and M10051, respectively, in the NCBI Genbank. Other datas, without limitations, relating to IR are incorporated herein by references (Vinten et al., 1991, Proc. Natl.
Acad. Sci. USA, 88:249-252; Belfiore et al., 2002, The Journal of Biological Chemistry, 277:39684-39695; Dumesic et al., 2004, The Journal of Endocrinology & Metabolism, 89(7):3561-3566).
The IGF-IR and IR are tetrameric glycoproteins composed of two extracellular a- and two transmembrane β-subunits linked by disulfide bonds. Each a-subunit, containing the ligand-binding site is approximately 130- to 135-kDa, whereas each β-subunit containing the tyrosine kinase domain is approximately 90- to 95- kDa. These receptors share more than 50% overall arnino acid sequence similarity and 84% similarity in the tyrosine kinase domain. After ligand binding, phosphorylated receptors recruit and phosphorylate docking proteins, including the insulin receptor substrate-1 protein family (IRSl), Gabl and She (Avruch, 1998, Mol.Cell. Biochem., 182:31-48; Roth et al., 1988, Cold Spring Harbor Symp. Quant. Biol., 53:537-543; Winte, 1998, Mol. Cell. Biochem., 182:3-11; Laviola et al., 1997, J. Clin. Invest., 99:830-837; Cheatham et al., 1995, Endocr. Rev., 16:117-142), leading to the activation of different intracellular mediators. Althoμgh both the IR and IGF-IR similarly activate major signalling pathways, differences exist in the recruitment of certain docking proteins and intracellular mediators between both receptors (Sasaoka et al., 1996, Endocrinology 137:4427-4434; Nakae et al., 2001, Endocr. Rev., 22:818-835; Dupont and Le Roith, 2001, Horm. Res., 55, Suppl.2:22-26; Koval et al., 1998, Biochem. J., 330:923-932). These differences are the basis for the predominant metabolic effects elicited by IR activation and the predominant mitogenic, transforming and anti-apoptotic effects elicited by IGF-IR activation (De Meyts et al., 1995, Ann. N.Y. Acad. Sci., 766:388-401; Singh et al., 2000, Frisco et al., 1999, Horm. Metab. Res., 31:80-89 ; Kido et al., 2001, J. Clin. Endocrinol. Metab., 86:972-979). Insulin binds with ingh affinity to the IR (100-fold ingher than to the IGF-IR), whereas insulin-like growth factors (IGF1 and IGF2) bind to the IGF-IR with 100-fold ingher affinity than to the IR.
The human IR exists in two isoforms, IR-A and IR-B, generated by alternative splicing of the IR gene that either excludes or includes 12 amino acid residues encoded by a small exon (exon 11) at the carboxy-terminus of the IR a-subunit. The relative abundance of IR isoforms is regulated by tissue specific and unknown factors (Moller et al., 1989, Mol. Endocrinol., 3:1263-1269; Mosthaf et al., 1990, EMBO J., 9:2409-2413). IR-B is the predominant IR isoform in normal adult tissues (adipose tissue, liver
and muscle) that are major target tissues for the metabolic effects of insulin (Moller et al, 1989; Mosthaf et al., 1990). IR-A is the predominant isoform in fetal tissues and mediates fetal growth in response to IGF2 (Frasca et al., 1999, Mol. Cell. Biol., 19:3278-3288), as also sμggested by genetic studies carried out in transgenic mice (DeCinara et al., 1990, Nature ,345:78-80; Louvi et al., 1997, Dev. Biol., 189:33-48). Moreover, when cells transform and become malignant, dedifferentiation is often associated with an increased IR-A relative abundance (Pandini et al., 2002, The Journal of Biological Chemistry, Vol. 277, N° 42, PP3 9684-3 9695).
Given the ingh degree of homology, the insulin and IGF-I half-receptors (composed of one a- and one (3-subunit) can heterodimerize, leading to the formation of insulin/IGF-I hybrid receptors (Hybrid-R) (Soos et al., 1990, Biochem J., 270:383-390; Kasuya et al., 1993, Biochemistry, 32:13531-13536; Seely et al., 1995, Endocrinology 136:1635-1641; Bailyes et al., 1997, Biochem J., 327:209-215).
Both IR isoforms are equally able to form hybrids with IGF-IR. Hybrid-R, however, have different functional characteristics. Hybrid-RsB has reduced affinity for IGF1 and especially for IGF2. In contrast, Hybrid-RsA has a ingh affinity for IGF1 and bind also IGF2 and insulin at a physiological concentration range. The expression of Hybrid-RsA uβ-regulates the IGF system by two different mechanisms i) binding (with ingh affinity) and activation by both IGF1 and IGF2 (winch do not occur with the Hybrid-RsB), ii) activation of the IGF-IR pathway after insulin binding. Insulin binding to Hybrid-RsA phosphorylates the IGF-IR β-subunit and activates an IGF-IR-specific substrate (Crldl) so that Hybrid-RsA sinfts insulin to IGF-IR signaling (Pandini et al., 2002).
in several tissues, like liver, spleen or placenta, Hybrid-R are more represented than IGF-IR (Bailyes et al., 1997). As tumor tissues overexpress, or present an abnormal activation, both IGF-IR and IR-A (Frasca et al., 1999; Sciacca et al., 1999, Oncogene 18:2471-2479; Vella et al., 2001, Mol. Pathol., 54:121-124), Hybrid-RsA may also be overexpressed in a variety of human malignancies, including thyroid and breast cancers providing a selective growth advantage to malignant cells able to respond by a type IGF-IR signalisation following a stimulation by IGF1 and/or IGF2 but also by insulin at physiological concentrations (Bailyes et al., 1997; Pandini et al., 1999, Clin.
Cancer Res., 5:1935-1944 ; Belfiore et al., 1999, Biocinmie (Paris) 81:403-407 ; Frasca et al., 1999 ; Sciacca et al.51999 ; Vella et al., 2001).
The realisation of such "therapeutic tools" able to block in the same time the two receptors is of particular interest as they will allow to avoid the escape phenomena mediated by the expression, or abnormal activation, in a same tumor of hybrid-R or both hybrid-R and IGF-IR.
The present invention allows to block the hybrid-R activity by generating a compound, and more particularly an antibody, of ingh affinity able to bind to said receptor and also to block its activation by its native ligands, preferably IGF1, IGF2 or Insulin.
The present invention also allows to jointly block the hybrid-R and IGF-IR activity by generating a compound, and more particularly an antibody, of ingh affinity able to bind to said two receptors and also to block their activation respectively their native ligands, preferably by IGF1, IGF2 or Insulin.
The present invention also deals with the use of an isolated antibody according to the present invention, or a fragment thereof, said antibody or fragment being able to bind to i) human hybrid-R, and/or to ininbit the binding of its native ligands, preferably IGF1, IGF2 and/or Insulin, and/or also able to specifically ininbit the tyrosine kinase activity of said hybrid-R, and/or ii) both human hybrid-R and human IGF-IR ,and/or to ininbit the binding of their native ligands, preferably IGF1 and/or IGF2 and/or insulin, and/or also able to ininbit specifically the tyrosine kinase activity of said hybrid-R and IGF-IR.
More particularly, in a preferred embodiment, said antibody is characterized in that it comprises the sequences of the 7C10 and h7C10 antibodies anti-IGF-IR, and fragment thereof, of the present invention, notably the antibodies anti-IGF-IR according to the present invention having a light chain comprising at least a CDR region selected in the group consisting in SEQ ID No. 2, 4 or 6 (or at least a CDR with at least 80% of homology after optimal alignment with SEQ ID No. 2, 4 or 6), and/or a heavy chain comprising at least a CDR region selected in the group consisting in SEQ ID No. 8, 10
or 12 (or at least a CDR with at least 80% of homology after optimal alignment with SEQIDNo. 8,10 or 12).
According to another preferred embodiment, said antibody is used for cancer therapy, more particularly breast cancer therapy.
Actually, it is known that breast tumoral cells specifically present on their surface IGF-IR but also a great number of Insulin receptor and, as a consequence, a great number of Hybrid-R (Frasca et al., 1999; Sciacca et al., 1999; Vella et al.} 2001).
The object of the present invention is to be able to have available a murine monoclonal antibody, preferably a cinmerized or humanized antibody, winch will recognize hybrid-R or both hybrid-R and IGF-IR specifically and with great affinity. Tins antibody will interact little or not at all with the IR on insulin. Its attachment will be able to ininbit in vitro the growth of tumors expressing, or with an abnormal activation of, hybrid-R or both hybrid-R and IGF-IR by interacting principally with the signal transduction pathways activated during interactions between i) hybrid-R with its native ligands, preferably IGF1, IGF2 and insulin and/or ii) both hybrid-R and IGF-IR with thek respective native ligands, preferably IGF1, IGF2, insulin for hybrid-R and IGF1, IGF2 for IGF-IR. Tins antibody will be able to be active in vivo on all the types of tumors expressing, or with an abnormal activation of, hybrid-R or both hybrid-R and IGF-IR including estrogen-dependent tumors of the breast and tumors of the prostate, winch is not the case for the anti-IGF-IR monoclonal antibodies (written MAb or MAB) currently available. In effect, αIR3, winch refers to the domain of IGF-IR, totally ininbits the growth of estrogen-dependent tumors of the breast (MCF-7) in vitro but is without effect on the corresponding model in vivo (Arteaga C. et al., J. Clin. Invest. 84:1418-1423, 1989). In the same way, the scFv-Fc fragment derived from the murine monoclonal 1H7 is only weakly active on the tumor of the breast MCF-7 and totally inactive on an androgen-independent tumor of the prostate (Li S.L. et al., Cancer Immunol. Immunother., 49:243-252, 2000). None of these known antibodies are described as being able to recognize, or ininbit the tyrosine kinase activity, of the hybrid-R.
In a surprising manner, the inventors have demonstrated a cinmeric antibody (called C7C10) and two humanized antibodies respectively called h7C10 humanized form 1 and h7C10 humanized form 2, derivatives of the murine monoclonal antibody 7C10, recognising hybrid-R or both hybrid-R and IGF-IR and corresponding to all of the criteria stated above, that is to say to a nonrecognition of the receptor on the insulin, to an in vitro blockage of the IGF1 and/or IGF2 proliferation induced but likewise to the in vivo ininbition of the growth of different tumors expressing, or with an abnormal activation of, hybrid-R or both hybrid-R and IGF-IR among winch are an osteosarcoma, a non-small cell lung tumor and a pancreatic tumor BxPC3 but likewise and more particularly the estrogen-dependent tumor of the breast MCF-7 and an androgen-independent tumor of the prostate DU-145. In the same way, and in a surprising manner, the intensity of ininbition of the tumor growth of MCF-7 cells in vivo by the antibody 7C10 is comparable, or even significantly superior, to that observed with tamoxifen, one of the reference compounds in the treatment of estrogen-dependent tumors of the breast. Furthermore, it has been shown that these antibodies ininbit the phosphorylation of the tyrosine of the beta chain of IGF-IR and of IRS1, the first substrate of the receptor. Moreover, it has likewise been established that these antibodies cause the internalization of said receptor and its degradation contrary to what is usually observed with natural ligands winch allow the rapid recycling of the receptor on the surface of the cells. It has been possible to characterize these antibodies by their peptidic and nucleic sequence, especially by the sequence of their regions determining their complementarity (CDR) for hybrid-R and/or IGF-IR.
As the compound is preferably of IgGl isotype, other mechanisms of action involving effector functions, such as for example ADCC and/or CDC, could explain the in vivo efficacy of the antobody of the present invention.
Thus, according to a first embodiment, a subject of the present invention is an isolated antibody, or one of its functional fragments, said antibody or one of its said fragments being characterized in that it is capable of binding to the hybrid-R, isoform(s) A and/or B, and ininbiting the binding of its native ligand, preferably designated herein as IGF1 and/or IGF2 and/or insulin, and/or capable of specifically ininbiting the
tyrosine kinase activity of said hybrid-R, said isolated antibody comprising a light chain comprising at least one complementarity determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 2, 4 and 6, and/or comprising a heavy chain comprising at least one CDR chosen from the CDRs of sequence SEQ ID Nos. 8, 10 and 12.
In the present description, the terms "to bind" and "to attach" have the same meaning and are inter-changeable.
In the present description, the terms polypeptides, polypeptide sequences, peptides and proteins attached to antibody compounds or to their sequence are interchangeable.
It must be understood here that the invention does not relate to the antibodies in natural form, that is to say they are not in their natural environment but that they have been able to be isolated or obtained by purification from natural sources, or else obtained by genetic recombination, or by chemical synthesis, and that they can then contain unnatural amino acids as will be described further on.
By CDR region or CDR, it is intended to indicate the hypervariable regions of the heavy and light chains of the immunoglobulins as defined by Kabat et al. (Kabat et al., Sequences of proteins of immunological interest, 5th Ed., U.S. Department of Health and Human Services, NIH, 1991, and later editions). 3 heavy chain CDRs and 3 light chain CDRs exist. The term CDR or CDRs is used here in order to indicate, according to the case, one of these regions or several, or even the whole, of these regions winch contain the majority of the amino acid residues responsible for the binding by affinity of the antibody for the antigen or the epitope winch it recognizes.
By "percentage of identity" between two nucleic acid or amino acid sequences in the sense of the present invention, it is intended to indicate a percentage of nucleotides or of identical amino acid residues between the two sequences to be compared, obtained after the best alignment (optimum alignment), tins percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length. The comparisons of sequences between two nucleic acid or amino acid sequences are traditionally carried out by comparing these sequences after having aligned them in an optimum manner, said comparison being able
to be carried out by segment or by "comparison window". The optimum alignment of the sequences for the comparison can be carried out, in addition to manually, by means of the local homology algorithm of Smith and Waterman (1981) [Ad. App. Math. 2:482], by means of the local homology algorithm of Neddleman and Wunsch (1970) [J, Mol. Biol., 48:443], by means of the similarity search method of Pearson and Lipman (1988) [Proc. Natl. Acad. Sci. USA 85:2444), by means of computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI, or else by BLAST N or BLAST P comparison software).
The percentage of identity between two nucleic acid or amino acid sequences is determined by comparing these two sequences aligned in an optimum manner and in winch the nucleic acid or amino acid sequence to be compared can comprise additions or deletions with respect to the reference sequence for an optimum alignment between these two sequences. The percentage of identity is calculated by deteraiining the number of identical positions for winch the nucleotide or the amino acid residue is identical between the two sequences, by dividing tins number of identical positions by the total number of positions in the comparison window and by multiplying the result obtained by 100 in order to obtain the percentage of identity between these two sequences.
For example, it is possible to use the BLAST program, "BLAST 2 sequences" (Tatusova et al., "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250) available on the site http://www.ncbi.nlm.nih.gov/ gorf7bl2.html, the parameters used being those given by default (in particular for the parameters "open gap penalty" : 5, and "extension gap penalty" : 2; the matrix chosen being, for example, the matrix "BLOSUM 62" proposed by the program), the percentage of identity between the two sequences to be compared being calculated directly by the program.
By amino acid sequence having at least 80%, preferably 85%, 90%, 95% and 98% identity with a reference amino acid sequence, those having, with respect to the reference sequence, certain modifications, in particular a deletion, addition or substitution of at least one amino acid, a truncation or an elongation are preferred. In the
case of a substitution of one or more consecutive or nonconsecutive amino acid(s), the substitutions are preferred in winch the substituted amino acids are replaced by "equivalent" amino acids. The expression "equivalent amino acids" is aimed here at indicating any amino acid capable of being substituted with one of the amino acids of the base structure without, however, essentially modifying the biological activities of the corresponding antibodies and such as will be defined later, especially in the examples.
These equivalent amino acids can be determined either by relying on their structural homology with the amino acids winch they replace, or on results of comparative trials of biological activity between the different antibodies capable of being carried out.
By way of example, mention is made of the possibilities of substitution capable of being carried out without resulting in a profound modification of the biological activity of the corresponding modified antibody. It is thus possible to replace leucine by valine or isoleucine, aspartic acid by glutamic acid, glutamine by asparagine, arginine by lysine, etc., the reverse substitutions being naturally envisageable under the same conditions.
The antibodies according to the present invention are preferably specific monoclonal antibodies, especially of marine, cinmeric or humanized origin, winch can be obtained according to the standard methods well known to the person skilled in the art.
In general, for the preparation of monoclonal antibodies or their functional fragments, especially of murine origin, it is possible to refer to techniques winch are described in particular in the manual "Antibodies" (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor NY, pp. 726, 1988) or to the technique of preparation from hybridomas described by Kohler and Milstein (Nature, 256:495-497, 1975).
The monoclonal antibodies according to the invention can be obtained, for example, from an animal cell immunized against the hybrid-R or both against the hybrid-R and IGF-IR, or one of their fragments containing the epitope specifically
recognized by said monoclonal antibodies according to the invention. Said hybrid-R or both hybrid-R and IGF-IR, or one of their said fragments, can especially be produced according to the usual working methods, by genetic recombination starting with a nucleic acid sequence contained in the cDNA sequence coding for the hybrid-R or IGF-IR or by peptide synthesis starting from a sequence of amino acids comprised in the peptide sequence of the hybrid-R or IGF-IR.
The monoclonal antibodies according to the invention can, for example, be purified on an affinity column on winch the hybrid-R and/or IGF-IR or one of their fragments containing the epitope specifically recognized by said monoclonal antibodies according to the invention has previously been immobilized. More particularly, said monoclonal antibodies can be purified by chromatography on protein A and/or G, followed or not followed by ion-exchange chromatography aimed at eliminating the residual protein contaminants as well as the DNA and the LPS, in itself followed or not followed by exclusion chromatography on Sepharose gel in order to eliminate the potential aggregates due to the presence of dimers or of other multimers. In an even more preferred manner, the whole of these techniques can be used simultaneously or successively. Such a purification can be done in the same time or sequenced with first a recognation on hybrid-R and, in a second step, the recognation of the IGF-IR.
Cinmeric or humanized antibodies are likewise included in antibodies according to the present invention.
By cinmeric antibody, it is intended to indicate an antibody winch contains a natural variable (light chain and heavy chain) region derived from an antibody of a given species in combination with the light chain and heavy chain constant regions of an antibody of a species heterologous to said given species.
The antibodies or their fragments of cinmeric type according to the invention can be prepared by using the techniques of genetic recombination. For example, the cinmeric antibody can be produced by cloning a recombinant DNA containing a promoter and a sequence coding for the variable region of a nonhuman, especially murine, monoclonal antibody according to the invention and a sequence coding for the constant region of human antibody. A cinmeric antibody of the invention encoded by such a recombinant gene will be, for example, a mouse-man cinmera, the specificity of
tins antibody being determined by the variable region derived from the murine DNA and its isotype determined by the constant region derived from the human DNA. For the methods of preparation of cinmeric antibodies, it is possible, for example, to refer to the document Verhoeyn et al. (BioEssays, 8:74, 1988).
By humanized antibody, it is intended to indicate an antibody winch contains CDR regions derived from an antibody of nonhuman origin, the other parts of the antibody molecule being derived from one (or from several) human antibodies. Moreover, some of the residues of the segments of the skeleton (called FR) can be modified in order to conserve the affinity of the binding (Jones et al., Nature, 321:522-525, 1986; Verhoeyen et al., Science, 239:1534-1536, 1988; Riechmann et al, Nature, 332:323-327,1988).
The humanized antibodies according to the invention or their fragments can be prepared by techniques known to the person skilled in the art (such as, for example, those described in the documents Singer et al., J. Immun., 150:2844-2857, 1992; Mountain et al., Biotechnol. Genet. Eng. Rev., 10:1-142, 1992; or Bebbington et al., Bio/Technology, 10:169-175, 1992). Such humanized antibodies according to the invention are preferred for their use in in vitro diagnostic methods, or in vivo prophylactic and/or therapeutic treatment.
By functional fragment of an antibody according to the invention, it is intended to indicate in particular an antibody fragment, such as Fv, scFv (sc for single chain), Fab, F(ab')2, Fab', scFv-Fc fragments or diabodies, or any fragment of winch the half-life time would have been increased by chemical modification, such as the addition of poly(alkylene) glycol such as poly(ethylene) glycol ("PEGylation") (pegylated fragments called Fv-PEG, scFv-PEG, Fab-PEG, F(ab')2-PEG or Fab'-PEG) ("PEG" for Poly(Ethylene) Glycol), or by incorporation in a liposome, said fragments having at least one of the characteristic CDRs of sequence SEQ ID No. 2, 4, 6, 8, 10 or 12 according to the invention, and, especially, in that it is capable of exerting in a general manner an even partial activity of the antibody from winch it is descended, such as in particular the capacity to recognize and to bind to the hybrid-R or both the hybrid-R and IGF-IR, and, if necessary, to ininbit the activity of the hybrid-R or both the hybrid-R and the IGF-IR.
Preferably, said functional fragments will be constituted or will comprise a partial sequence of the heavy or light variable chain of the antibody from winch they are derived, said partial sequence being sufficient to retain the same specificity of binding as the antibody from winch it is descended and a sufficient affinity, preferably at least equal to 1/100, in a more preferred manner to at least 1/10, of that of the antibody from winch it is descended, with respect to the hybrid-R or both hybrid-R and IGF-IR.
Such a functional fragment will contain at the minimum 5 amino acids, preferably 10, 15, 25, 50 and 100 consecutive amino acids of the sequence of the antibody from winch it is descended.
Preferably, these functional fragments will be fragments of Fv, scFv, Fab, F(ab')2, F(ab'), scFv-Fc, scFV-CHs type or diabodies, winch generally have the same specificity of binding as the antibody from winch they are descended. According to the present invention, antibody fragments of the invention can be obtained starting from antibodies such as described above by methods such as digestion by enzymes, such as pepsin or papain and/or by cleavage of the disulfide bridges by chemical reduction. In another manner, the antibody fragments comprised in the present invention can be obtained by techniques of genetic recombination likewise well known to the person skilled in the art or else by peptide synthesis by means of, for example, automatic peptide synthesizers such as those supplied by the company Applied Biosystems, etc.
According another aspect, the present invention concerns the antibody, or one of its functional fragments, as described above, said antibody being characterized in that it is also capable of binding the IGF-IR and ininbiting the binding of its native ligands, preferably designated herein as IGF1 and/or IGF2, and/or capable of specifically ininbiting the tyrosine kinase activity of said IGF-IR.
in a more preferred manner, the invention comprises the antibodies, or their functional fragments, according to the present invention, especially cinmeric or humanized antibodies, obtained by genetic recombination or by chemical synthesis.
in a preferred embodiment, a subject of the invention is an antibody, or one of its functional fragments, according to the invention, characterized in that it comprises a heavy chain comprising at least one CDR chosen from the CDRs of sequence SEQ ID Nos. 8, 10 and 12 or a sequence having at least 80% identity after optimum alignment with the sequence SEQ ID Nos. 8,10 and 12.
Among the six short CDR sequences, the tinrd CDR of the heavy chain (CDRH3) has a greater size variability (greater diversity essentially due to the mechanisms of arrangement of the genes winch give rise to it). It can be as short as 2 amino acids althoμgh the longest size known is 26. Functionally, CDRH3 plays a role in part in the determination of the specificity of the antibody (Segal et al., PNAS, 71:4298-4302, 1974; Amit et al., Science, 233:747-753, 1986; Chotina et al., J. Mol. Biol., 196:901-917, 1987; Chotina et al., Nature, 342:877-883, 1989; Caton et al., J. Immunol., 144:1965-1968, 1990; Sharon et al., PNAS, 87:4814-4817, 1990; Sharon et al., J. hnmunol., 144:4863-4869, 1990; Kabat et al., J. Immunol., 147:1709-1719, 1991).
It is known that only a low percentage of the amino acids of the CDRs contribute to the construction of an antibody binding site, but these residues must be maintained in a very specific tri dimensional conformation.
In a more preferred manner, the present invention relates to an antibody or one of its functional fragments, according to the invention, characterized in that it comprises a heavy chain comprising at least two of the three CDRs or the three CDRs of sequence SEQ ID Nos. 8, 10 and 12, or at least two of three CDRs or three CDRs of sequence respectively having at least 80% identity after optimum alignment with the sequence SEQ ID Nos. 8,10 and 12.
in a likewise preferred embodiment, a subject of the invention is an antibody or one of its functional fragments, according to the invention, characterized in that it comprises a light chain comprising at least one CDR chosen from the CDRs of sequence SEQ ID Nos. 2, 4 and 6, or a CDR whose sequence has at least 80% identity after optimum alignment with the sequence SEQ ID Nos. 2,4 and 6.
in a more preferred embodiment, a subject of the invention is an antibody or one of its functional fragments according to the invention, characterized in that it comprises a light chain comprising at least two of the three CDRs or the three CDRs of sequence SEQ ID Nos. 2, 4 and 6, or at least two of three CDRs or three CDRs of sequence respectively having at least 80% identity after optimum alignment with the sequence SEQ ID Nos. 2,4 and 6.
In a more preferred manner, the antibody or one of its functional fragments according to the invention is characterized in that it comprises a heavy chain comprising the three CDRs of sequence SEQ ID Nos. 8, 10 and 12, or three CDRs of sequence respectively having at least 80% of identity after optimum alignment with the sequence SEQ ID No. 8,10 and 12 and in that it moreover comprises a light chain comprising the three CDRs of sequence SEQ ID Nos. 2, 4 and 6, or three CDRs of sequence respectively having at least 80% of identity after optimum alignment with the sequence SEQ ID Nos. 2,4 and 6.
According to another aspect, a subject of the present invention is an antibody or one of its functional fragments, according to the invention, characterized in that it does not attach or it does not attach in a significant manner to the human IR.
in a preferred manner, said functional fragments according to the present invention will be chosen from the fragments Fv, scFv, Fab, (Fab')2, Fab', scFv-Fc, scFV-CHs or diabodies, or any functional fragment whose half-life would have been increased by a chemical modification, especially by PEGylation, or by incorporation in a liposome.
According to another aspect, the invention relates to a murine hybridoma capable of secreting a monoclonal antibody according to the present invention, especially the hybridoma of murine origin such as deposited at the Centre National de Culture De Microorganisme (CNCM, National Center of Microorganism Culture) (Institut Pasteur, Paris, France) on September 19, 2001 under the number 1-2717.
The monoclonal antibody here called 7C10, or one of its functional fragments, characterized in that said antibody is secreted by the hybridoma deposited at the CNCM on September 19, 2001 under the number 1-2717 is, of course, part of the present invention.
In a particular embodiment, the present invention relates to a murine antibody, or one of its functional fragments, according to the invention, characterized in that said antibody comprises a light chain of sequence comprising the amino acid sequence SEQ ID No. 54, or a sequence having at least 80% identity after optimum alignment with the sequence SEQ ID No. 54, or/and in that it comprises a heavy chain of sequence comprising the amino acid sequence SEQ ID No. 69, or a sequence having at least 80% identity after optimum alignment with the sequence SEQ ID No. 69.
According to a likewise particular aspect, the present invention relates to a cinraeric antibody, or one of its functional fragments, according to the invention, characterized in that said antibody moreover comprises the light chain and heavy chain constant regions derived from an antibody of a species heterologous to the mouse, especially man, and in a preferred manner in that the light chain and heavy chain constant regions derived from a human antibody are respectively the kappa or lambda and gamma-1, gamma-2 or gamma-4 region.
According to a likewise particular aspect, the present invention relates to a humanized antibody or one of its functional fragments, according to the invention, characterized in that said antibody comprises a light chain and/or a heavy chain in winch the skeleton segments FR1 to FR4 (such as defined below in examples 12 and 13, in tables 5 and 6) of said light chain and/or heavy chain are respectively derived from skeleton segments FR1 to FR4 of human antibody light chain and/or heavy chain.
According to a preferred embodiment, the humanized antibody or one of its functional fragments, according to the present invention is characterized in that said humanized antibody comprises a light chain comprising the amino acid sequence SEQ ID No. 61 or 65, or a sequence having at least 80% identity after optimum alignment with the sequence SEQ ID No. 61 or 65, or/and in that it comprises a heavy chain comprising the amino acid sequence SEQ ID No. 75, 79 or 83, or a sequence having at least 80% identity after optimum alignment with the sequence SEQ ID No. 75, 79 or 83.
Preferably, the humanized antibody, or one of its functional fragments, according to the invention is characterized in that said humanized antibody comprises a light chain comprising the amino acid sequence SEQ ID No. 65, and in that it comprises a heavy chain of sequence comprising the amino acid sequence SEQ ID No. 79 or 83, preferably SEQ ID No. 83.
According to a novel aspect, the present invention relates to an isolated nucleic acid, characterized in that it is chosen from the following nucleic acids:
a nucleic acid, DNA or RNA, coding for an antibody, or one of its
functional fragments, according to the invention;
a complementary nucleic acid of a nucleic acid such as defined in a); and
a nucleic acid of at least 18 nucleotides capable of hybridizing under
conditions of great stringency with at least one of the CDRs of nucleic acid sequence
SEQ ED No. 1,3, 5, 7, 9 or 11, or with a sequence having at least 80%, preferably 85%, 90%, 95% and 98%, identity after optimum alignment with the sequence SEQ ID No. 1, 3, 5, 7, 9 or 11.
By nucleic acid, nucleic or nucleic acid sequence, polynucleotide, oligonucleotide, polynucleotide sequence, nucleotide sequence, terms winch will be employed indifferently in the present invention, it is intended to indicate a precise linkage of nucleotides, winch are modified or unmodified, allowing a fragment or a region of a nucleic acid to be defined, containing or not containing unnatural nucleotides, and being able to correspond just as well to a double-stranded DNA, a single-stranded DNA as to the transcription products of said DNAs.
It must also be understood here that the present invention does not concern the nucleotide sequences in their natural chromosomal environment, that is to say in the natural state. It concerns sequences winch have been isolated and/or purified, that is to say that they have been selected directly or indirectly, for example by copy, their environment having been at least partially modified. It is thus likewise intended to indicate here the isolated nucleic acids obtained by genetic recombination by means, for example, of host cells or obtained by chemical synthesis.
By nucleic sequences having a percentage of identity of at least 80%, preferably 85%, 90%, 95% and 98%, after optimum alignment with a preferred sequence, it is intended to indicate the nucleic sequences having, with respect to the reference nucleic sequence, certain modifications such as, in particular, a deletion, a truncation, an elongation, a cinmeric fusion and/or a substitution, especially point substitution. It preferably concerns sequences in winch the sequences code for the same amino acid sequences as the reference sequence, tins being connected to the degeneracy of the genetic code, or complementary sequences winch are capable of hybridizing specifically with the reference sequences, preferably under conditions of ingh stringency, especially such as defined below.
A hybridization under conditions of ingh stringency signifies that the temperature conditions and ionic strength conditions are chosen in such a way that they allow the maintenance of the hybridization between two fragments of complementary DNA. By way of illustration, conditions of ingh stringency of the hybridization step for
the purposes of defining the polymicleotide fragments described above are advantageously the following.
The DNA-DNA or DNA-RNA hybridization is carried out in two steps: (1) prehybridization at 42°C for 3 hours in phosphate buffer (20 mM, pH 7.5) containing 5 x SSC (1 x SSC corresponds to a 0.15 M NaCl + 0.015 M sodium citrate solution), 50% of formamide, 7% of sodium dodecyl sulfate (SDS), 10 x Denhardt's, 5% of dextran sulfate and 1% of salmon sperm DNA; (2) actual hybridization for 20 hours at a temperature dependent on the size of the probe (i.e.: 42°C, for a probe size > 100 nucleotides) followed by 2 washes of 20 minutes at 20°C in 2 x SSC + 2% of SDS, 1 wash of 20 minutes at 20°C in 0.1 x SSC + 0.1% of SDS. The last wash is carried out in 0.1 x SSC + 0.1% of SDS for 30 minutes at 60°C for a probe size > 100 nucleotides. The hybridization conditions of ingh stringency described above for a polynucleotide of defined size can be adapted by the person skilled in the art for oligonucleotides of greater or smaller size, according to the teacinng of Sambrook et al. (1989, Molecular cloning: a laboratory manual. 2nd Ed. Cold Spring Harbor).
The invention likewise relates to a vector comprising a nucleic acid according to the present invention.
The invention aims especially at cloning and/or expression vectors winch contain a nucleotide sequence according to the invention.
The vectors according to the invention preferably contain elements winch allow the expression and/or the secretion of the nucleotide sequences in a determined host cell. The vector must therefore contain a promoter, signals of initiation and termination of translation, as well as appropriate regions of regulation of transcription. It must be able to be maintained in a stable manner in the host cell and can optionally have particular signals winch specify the secretion of the translated protein. These different elements are chosen and optimized by the person skilled in the art as a function of the host cell used. To tins effect, the nucleotide sequences according to the invention can be inserted into autonomous replication vectors in the chosen host, or be integrative vectors of the chosen host.
Such vectors are prepared by methods currently used by the person skilled in the art, and the resulting clones can be introduced into an appropriate host by standard methods, such as lipofection, electroporation, thermal shock, or chemical methods.
The vectors according to the invention are, for example, vectors of plasmidic or viral origin. They are useful for transforming host cells in order to clone or to express the nucleotide sequences according to the invention.
The invention likewise comprises the host cells transformed by or comprising a vector according to the invention.
The host cell can be chosen from prokaryotic or eukaryotic systems, for example bacterial cells but likewise yeast cells or animal cells, in particular mammalian cells. It is likewise possible to use insect cells or plant cells.
The invention likewise concerns animals, except man, winch comprise at least one cell transformed according to the invention.
According to another aspect, a subject of the invention is a process for production of an antibody, or one of its functional fragments according to the invention, characterized in that it comprises the following stages:
culture in a medium and appropriate culture conditions of a host cell
according to the invention; and
the recovery of said antibodies, or one of their functional fragments, thus
produced starting from the culture medium or said cultured cells.
The cells transformed according to the invention can be used in processes for preparation of recombinant polypeptides according to the invention. The processes for preparation of a polypeptide according to the invention in recombinant form, characterized in that they employ a vector and/or a cell transformed by a vector according to the invention, are themselves comprised in the present invention. Preferably, a cell transformed by a vector according to the invention is cultured under conditions winch allow the expression of said polypeptide and said recombinant peptide is recovered.
As has been said, the host cell can be chosen from prokaryotic or eukaryotic systems. In particular, it is possible to identify nucleotide sequences according to the invention, facilitating secretion in such a prokaryotic or eukaryotic system. A vector according to the invention carrying such a sequence can therefore advantageously be
used for the production of recombinant proteins, intended to be secreted. In effect, the purification of these recombinant proteins of interest will be facilitated by the fact that they are present in the supernatant of the cell culture rather than in the interior of the host cells.
It is likewise possible to prepare the polypeptides according to the invention by chemical synthesis. Such a preparation process is likewise a subject of the invention. The person skilled in the art knows the processes of chemical synthesis, for example the techniques employing solid phases (see especially Steward et al., 1984, Solid phase peptide synthesis, Pierce Chem. Company, Rockford, 111, 2nd ed., (1984)) or techniques using partial solid phases, by condensation of fragments or by a classical synthesis in solution. The polypeptides obtained by chemical synthesis and being able to contain corresponding unnatural amino acids are likewise comprised in the invention.
The antibodies, or one of their functional fragments, capable of being obtained by a process according to the invention are likewise comprised in the present invention.
According to a second embodiment, the present invention concerns an antibody according to the invention such as described further above, characterized in that it is, moreover, capable of binding specifically to the human epidermal growth factor receptor EGFR and/or capable of specifically ininbiting the tyrosine kinase activity of said EGFR.
In a general manner, the growth factors are small proteins involved in the regulation of the proliferation and of the differentiation of normal cells. Some of these growth factors likewise play an important role in the initiation and the maintenance of cell transformation, being able to function as autocrine or paracrine factors. Tins is especially the case, in addition to the IGF1 described further above, for the epidermal growth factor EGF, winch seems particularly involved in the appearance of the tumor phenotype, the progression of tumors and the generation of metastases.
EGF and IGF1 exert their action throμgh the intermediary of their respective receptor here called EGFR and hybrid-R or both hybrid-R with IGF-IR. It concerns in the two cases membrane receptors with tyrosine kinase activity whose overexpression is described in numerous cancers. It must, however, be noted that the interaction of these two receptors is not clearly established and that the studies carried out by various teams
in tins connection give contradictory results as to the collaboration of these two receptors.
Studies carried out on prostate rumor cells show that the interruption of the autocrine loop EGF/EGFR hy an anti-EGFR monoclonal antibody (here called "MAB" or "MAb") is manifested by a complete loss of the response of the DU145 cells to IGFl (Connolly J.M. and Rose D.P., Prostate, Apr. 24(4):167-75, 1994; Putz T. et al., Cancer Res., Jan. 1, 59(l):227-33, 1999). These results would sμggest that a blockage of the receptor for the EGF would be sufficient in order to obtain a total ininbition of the transformation signals generated by the activation of the three receptors (EGFR, hybrid-R and IGF-IR). On the other hand, other studies (Pietrzkowski et al., Cell Growth Differ, Apr., 3(4): 199-205, 1992; Coppola et al., Mol Cell Biol., Jul., 14(7):4588-95, 1994) have shown that an over-expression of EGFR necessitates the presence of a functional IGF-IR in order to exert its mitogenic and transformant potential, althoμgh IGF-IR does not necessitate, for its part, the presence of functional EGFR in order to mediate its action. Tins second series of studies would be more in agreement with a strategy tending preferentially to block hybrid-R or hybrid-R with IGF-IR with the aim of simultaneously affecting the two receptors.
In a surprising manner, the inventors have, firstly, demonstrated that a coininbition of the attachment of the IGFl and/or IGF2 and/or insulin to the hybrid-R or both the attachment of the IGFl and/or IGF2 and/or insulin to the hybrid-R with the attachement of the IGFl and/or IGF2 to the IGF-IR and of the attachment of the EGF to the EGFR allows a significant synergy of action of these two actions to be obtained against the in vivo tumor growth in nude mice carrying a tumor expressing these three receptors. One of the more probable hypotheses winch is able to explain tins synergy of action is that the two growth factors EGF and IGFl (and/or IGF2) themselves act in synergy in the transformation of normal cells to cells with tumoral character and/or in the growth and/or the proliferation of tumor cells for certain tumors, especially for those overexpressing, or with an abnormal activation of, the three receptors EGFR,hybrid-R and IGF-IR and/or having an overactivation of the transduction signal mediated by these three receptors, in particular at the level of the tyrosine kinase activity of these receptors.
According to a preferred aspect of tins embodiment, the invention concerns an antibody such as described further above, characterized in that it consists of a bispecific antibody comprising a second motif specifically ininbiting the attachment of the EOF to the EGFR and/or specifically ininbiting the tyrosine kinase activity of said EGFR.
The term "second motif is intended to indicate above especially a sequence of amino acids comprising a fragment capable of specifically binding to EGFR, in particular a CDR region of a variable chain of an anti-EGFR antibody, or one of the fragments of tins CDR region of sufficient length in order to exert tins specific binding, or else several CDR regions of an anti-EGFR antibody.
The bispecific or bifunctional antibodies form a second generation of monoclonal antibodies in winch two different variable regions are combined in the same molecule (Hollinger and Bohlen, 1999, Cancer and metastasis rev., 18:411-419). Their use has been demonstrated both in the diagnostic field and in the therapy field from their capacity to recruit new effector functions or to target several molecules on the surface of tumor cells. These antibodies can be obtained by chemical methods (Glennie MJ et al., 1987, J. ImmunoL, 139:2367-2375; Repp R. et al, 1995, J. Hemat, 377-382) or somatic methods (Staerz U.D. and Sevan M.J., 1986, PNAS 83:1453-1457; Suresh M.R. et al., 1986, Method Enzymol., 121:210-228) but likewise and preferentially by genetic engineering techniques winch allow the heterodimerization to be forced and thus facilitate the process of purification of the antibody soμght (Merchand et al., 1998, Nature Biotech., 16:677-681).
These bispecific antibodies can be constructed as entire IgG, as bispecific Fab'2, as Fab'PEG or as diabodies or else as bispecific scFv but likewise as a tetravalent bispecific antibody or two attachment sites are present for each antigen targeted (Park et al., 2000, Mol. ImmunoL, 37(18):! 123-30) or its fragments as described further above.
In addition to an economic advantage from the fact that the production and the administration of a bispecific antibody are less onerous than the production of two specific antibodies, the use of such bispecific antibodies has the advantage of reducing the toxicity of the treatment. Tins is because the use of a bispecific antibody allows the total quantity of circulating antibodies to be reduced and, consequently, the possible toxicity.
In a preferred embodiment of the invention, the bispecific antibody is a bivalent or tetravalent antibody.
In practice, the interest in using a tetravalent bispecific antibody is that it has a greater avidity in comparison with a bivalent antibody on account of the presence of three attachment sites for each target, respectively IGF-IR, hybrid-R and EGFR in the present invention.
In a similar manner to the selection of the functional fragments of the anti-hybrid-R or both anti-hybrid-R and anti-IGF-IR antibody described above, said second motif is selected from the fragments Fv, Fab, F(ab')2, Fab', scFv, scFv-Fc, scFv-CHs and the diabodies, or any form whose half-life would have been increased like the pegylated fragments such as Fv-PEG, scFv-PEG, Fab-PEG, F(ab')2-PEG or Fab'-PEG. According to an even more preferred aspect of the invention, said second anti-EGFR motif is descended from the mouse monoclonal antibody 225, its mouse-man cinmeric derivative C225, or a humanized antibody derived from tins antibody 225.
According to yet another aspect, a subject of the invention is an antibody, or one of its functional fragments, according to the invention as a medicament, preferably a humanized antibody such as defined above. Antibody, for the remainder of the present description, must be understood as an i) anti-hybrid-R or ii) both anti-hybrid-R and anti-IGF-IR antibody as well as a bispecific anti-hybrid-R/EGFR or both anti-hybrid-R and anti-IGF-IR/EGFR antibody.
The invention likewise concerns a pharmaceutical composition comprising by way of active principle a compound consisting of or comprising an antibody, or one of its functional fragments according to the invention, preferably mixed with an excipient and/or a pharmaceutically acceptable veincle.
According to yet another embodiment, the present invention likewise concerns a pharmaceutical composition such as described further above winch comprises a second compound chosen from the compounds capable of specifically ininbiting the attachment of the EGF to the human epidermal growth factor receptor EGFR and/or capable of specifically ininbiting the tyrosine kinase activity of said EGFR.
in a preferred aspect of the invention, said second compound is chosen from the isolated anti-EGFR antibodies, or their functional fragments, capable of ininbiting by competition the attachment of the EGF to the EGFR. More particularly, said anti-EGFR
antibody is chosen from the monoclonal, cinmeric or humanized anti-EGFR antibodies, or their functional fragments. Even more particularly, said functional fragments of the anti-EGFR antibody are chosen from the fragments Fv, Fab, F(ab')2> Fab', scFv-Fc, scFv-CH3 or diabodies, or any fragment whose half-life would have been increased, like pegylated fragments. Said antibody can consist, in an even more preferred manner, of the mouse monoclonal antibody 225, its mouse-man cinmeric derivative C225 (also called IMC-C225) or a humanized antibody derived from tins antibody 225.
Another complementary embodiment of the invention consists in a composition such as described above winch comprises, moreover, as a combination product for simultaneous, separate or sequential use, a cytotoxic/cytostatic agent and/or an ininbitor of the tyrosine kinase activity respectively of the receptors for IGF1 and/or for EGF, a corticosteroid agent, an anti-emetic agent, a cancer vaccine, an analgesic agent, an anti-vascular agent and/or an anti-proliferative agent. Such agents will be described in more details herinafter in the present specification.
"Simultaneous use" is understood as meaning the administration of the two compounds of the composition according to the invention in a single and identical pharmaceutical form.
"Separate use" is understood as meaning the administration, at the same time, of the two compounds of the composition according to the invention in distinct pharmaceutical forms.
"Sequential use" is understood as meaning the successive administration of the two compounds of the composition according to the invention, each in a distinct pharmaceutical form.
in a general fasinon, the composition according to the invention considerably increases the efficacy of the treatment of cancer. In other words, the therapeutic effect of the anti-hybrid-R or both anti-hybrid-R and anti-IGF-IR antibody according to the invention is potentiated in an unexpected manner by the administration of a cytotoxic agent. Another major subsequent advantage produced by a composition according to the invention concerns the possibility of using lower efficacious doses of active principle, winch allows the risks of appearance of secondary effects to be avoided or to be reduced, in particular the effects of the cytotoxic agent.
In addition, tins composition according to the invention would allow the expected therapeutic effect to be attained more rapidly.
In a particularly preferred embodiment, said composition as a combination product according to the invention is characterized in that said cytotoxic/ cytostatic agent is chosen from the agents interacting with DNA, the antimetabolites, the topoisomerase I or II ininbitors, or else the spindle ininbitor or stabilizer agents or else any agent capable of being used in chemotherapy. Such cytotoxic/cytostatic agents, for each of the aforesaid classes of cytotoxic agents, are, for example, cited in the 2001 edition of VIDAL, on the page devoted to the compounds attached to the cancerology and hematology column "Cytotoxics", these cytotoxic compounds cited with reference to tins document are cited here as preferred cytotoxic agents.
In a particularly preferred embodiment, said composition as a combination product according to the invention is characterized in that said cytotoxic agent is coupled chemically to said antibody for simultaneous use.
In a particularly preferred embodiment, said composition according to the invention is characterized in that said cytotoxic/cytostatic agent is chosen from the spindle ininbitor or stabilizer agents, preferably vinorelbine and/or vinflunine and/or vincristine.
Immunoliposomes are liposomes capable of veincling compounds, such as cytotoxic and/or cytostatic agents, such as described above, and of addressing them to tumor cells by means of antibodies or of antibody fragments attached to their surface. The antibodies or antibody fragments used are directed against antigens overexpressed at the surface of tumor cells and/or surface antigens the expression of winch is restricted to tumor cells. They are preferably directed against tyrosine kinase receptors, and more particularly against the receptors for IGF-I, EGF or else VEGF. A preferred antibody is a monoclonal or polyclonal, preferably monoclonal, or even humanized, antibody winch will recognize the hybrid-R or both the hybrid-R and the IGF-IR specifically and with ingh affinity. Even more preferably, tins antibody consists of the antibody winch is the subject of the present invention.
The use of immunoliposomes for ininbiting tumor cell growth has been described in the literature. By way of example, mention may be made of the immunoliposomes winch target proteins, such as ErbB2 (Hurwitz E. et al., Cancer
Immunol. Immunother, 49:226-234, 2000; Park J.W. et al., Clinical Cancer Res., 8:1172-1181, 2002) or EGFR (Harding J.A. et al., Biocinm. Biophys. Acta, 1327:181-192,1997), or glycolipids such as the ganglioside GD2 (Pastorino F. et al., Cancer Res., 63:86-92,2003).
Immunoliposomes combine the advantages of liposomes and of immunoconjμgates. Liposomes in fact make it possible to encapsulate cytotoxic and/or cytostatic agents and thus to protect them against degradation. They also have the advantage of decreasing the toxicity of the veinculed agents and of reducing the side effects that they induce. They may thus allow the use of agents winch are much more toxic than the agents conventionally used in anticancer chemotherapies. The conjμgation of antibodies or of antibody fragments to the surface of liposomes has the advantage of thus providing a system for specific targeting and addressing of the cytotoxic agent encapsulated in the liposome. In addition, unlike immunoconjμgates, since the veinculed agent is not covalently coupled to the antibody or to the antibody fragment, it will be completely active as soon as it is introduced into the target cell.
The antibodies or antibody fragments may be attached, without any limitation, covalently to the surface of the liposomes using conventional methods of bioconjμgation. The coupling of these antibodies or of the fragments will be carried out on the lipids or lipids carrying a PEG winch have been inserted into the liposomal membrane. In the case of a PEG-lipid, the coupling will be carried out on the PEG in the distal position with respect to the lipid. Liposomes carrying PEG groups (PEG-grafted liposomes) have the advantage of having longer half-lives than "naked" liposomes. By way of example, mention may be made of coupling of the antibody or of the fragment, via tinol groups, to the activated lipids or PEG-lipids exinbiting maleimide or bromoacetyl groups. The tinol groups for tins type of coupling may come from 2 sources. They may be free cysteine residues introduced into a recombinant fragment of the antibody of interest, for example Fab' or scFv fragments with an additional cysteine residue, or released after enzymatic hydrolysis of the antibody of interest and controlled reduction, winch is the case, for example, during the preparation of Fab' fragments from complete antibodies. Complete antibodies can also be coupled, after controlled oxidation of the oligosaccharides carried by the heavy chains, to lipids or PEG-lipids exinbiting free amine or hydrazide groups.
Since tumor cells overexpressing, or with an abnormal activation of, the hybrid-R or both the hybrid-R and the IGF-IR generally possess the property of also overexpressing EGFR, it could also prove to be advantageous to claim bispecific immunoliposomes for targeting the hybrid-R, or both the hybrid-R and the IGF-IR, with the EGFR. Similarly, monospecific liposomes to the surface of winch would be grafted one of the native ligands for these three receptors, IGF1, IGF2, insulin or EGF, or bispecific liposomes, would make it possible to target the same tumor cells overexpressing, or with an abnormal activation of, at least one of these receptors. Tins approach has been described for the EGFR (Kullberg E.B. et al., Pharm. Res., 20:229-236,2003) but not for the hybrid-R or both the hybrid-R and the IGF-IR.
Such immunoliposomes having antibodies anti-hybrid-R or both anti-hybrid-R and anti-IGR-IR, or fragments thereof, attached covalently to the surface of the liposomes, are comprised in the present invention.
Method for the treatment of cancer wherein such imrnunoliposomes are administrated to patient in need of such treatment, forms also part of the present invention.
in order to facilitate the coupling between said cytotoxic agent and said antibody according to the invention, it is especially possible to introduce spacer molecules between the two compounds to be coupled, such as poly(alkylene) glycols like polyethylene glycol, or else amino acids, or, in another embodiment, to use active derivatives of said cytotoxic agents into winch would have been introduced functions capable of reacting with said antibody according to the invention. These coupling techniques are well known to the person skilled in the art and will not be expanded upon in the present description.
In another preferred embodiment, said ininbitor of the tyrosine kinase activity of the receptors for IGF1 and/or for EGF is selected from the group consisting of derived natural agents, dianilinophthalimides, pyrazolo- or pyrcolopyridopyrirnidines or else quinazilines. Such ininbitory agents are well known to the person skilled in the art and described in the literature (Ciardiello F., Drμgs 2000, Siappl. 1,25-32).
Other ininbitors of EGFR can, without any limitation, consist of the anti-EGFR monoclonal antibodies C225 and 22Mab (ImClone Systems Incorporated), ABX-EGF (Abgenix/Cell Genesys), EMD-7200 (Merck KgaA) or the compounds ZD-1834, ZD-
1838 and ZD-1839 (AstraZeneca), PKI-166 (Novartis), PKI-166/CGβ-75166 (Novartis), PTK 787 (Novartis), CP 701 (Cephalon), leflunomide (Pharmacia/Sμgen), CI-1033 (Warner-Lambert Parke-Davis), CI-1033/PD 183, 805 (Warner-Lambert Parke-Davis), CL-387, 785 (Wyeth-Ayerst), BBR-1611 (Boehringer Mannheim GmbH/Roche), Naamidine A (Bristol-Myers Squibb), RC-3940-II (Pharmacia), BffiX-1382 (Boehringer Ingelheim), OLX-103 (Merck & Co), VRCTC-310 (Ventech Research), EOF fusion toxin (Seragen Inc.), DAB-389 (Seragen/Lilgand), ZM-252808 (Imperial Cancer Research Fund), RG-50S64 (INSERM), LFM-A12 (Parker Hμghes Cancer Center), Win-P97 (Parker Hμghes Cancer Center), GW-282974 (Glaxo), KT-8391 (Kyowa Hakko) or the "EGFR Vaccine" (York Medical/Centro de Immunologia Molecular).
According to yet another embodiment of the invention, the composition such as described above can likewise comprise another antibody compound directed against the extracellular domain of the HER2/neu receptor, as a combination product for simultaneous, separate or sequential use, intended for the prevention and for the treatment of cancer, especially the cancers overexpressing said HER2/neu receptor and the receptor IGF-IR and/or EGFR, such as especially cancer of the breast.
Reference can be made especially to the publications of Albanell et al. (J. of the National Cancer Institute, 93(24):1830-1831, 2001) and of Lu et al. (J. of the National Cancer Institute, 93(24):1852-1857, 2001) justifying the unexpected interest in combining an anti-HER2/neu antibody with an anti-hybrid-R or both anti-hybrid-R and anti-IGF-IR antibody according to the present invention.
In a particular manner, said anti-HER2/neu antibody of the composition according to the invention is the antibody called Trastuzumab (also called Herceptin).
The invention relates, in another aspect, to a composition characterized in that one, at least, of said antibodies, or one of their functional fragments, is conjμgated with a cell toxin and/or a radioelement.
Preferably, said toxin or said radioelement is capable of ininbiting at least one cell activity of cells expressing, or with an abnormal activation of, the hybrid-R or both the hybrid-R and the IGF-IR and/or EGFR, in a more preferred manner capable of preventing the growth or the proliferation of said cell, especially of totally inactivating said cell.
Preferably also, said toxin is an enterobacterial toxin, especially Pseudomonas exotoxin A.
The radio elements (or radioisotopes) preferably conjμgated to the antibodies employed for the therapy are radioisotopes winch emit gamma rays and preferably iodine131, yttrium90, gold199, palladium100, copper67, bismuth217 and antimony211. The radioisotopes winch emit beta and alpha rays can likewise be used for the therapy.
By toxin or radioelement conjμgated to at least one antibody, or one of its functional fragments, according to the invention, it is intended to indicate any means allowing said toxin or said radioelement to bind to said at least one antibody, especially by covalent coupling between the two compounds, with or without introduction of a linking molecule.
Among the agents allowing binding in a chemical (covalent), electrostatic or noncovalent manner of all or part of the components of the conjμgate, mention may particularly be made of benzoquinone, carbodiimide and more particularly EDC (1-ethyl-3-[3-dimethylaminopropyl]-carbodiimide hydrochloride), dimaleimide, ditinobis-nitrobenzoic acid (DTNB), N-succinimidyl S-acetyl tino-acetate (SATA), the bridging agents having one or more phenylazide groups reacting with the ultraviolets (U.V.) and preferably N-[-4-(azidosalicylamino)butyl]-3 '-(2'-pyridylditino)-propionamide (APDP), N-succinimid-yl 3-(2-pyridylditino)propionate (SPDP), 6-hydrazino-nicotinamide (HYNIC).
Another form of coupling, especially for the radioelements, can consist in the use of a bifunctional ion chelator.
Among these chelates, it is possible to mention the chelates derived from EDTA (ethylenediaminetetraacetic acid) or from DTPA (diethylenetriaminepentaacetic acid) winch have been developed for binding metals, especially radioactive metals, and immunoglobulins. Thus, DTPA and its derivatives can be substituted by different groups on the carbon chain in order to increase the stability and the rigidity of the ligand-metal complex (Krejcarek et al., 1977; Brechbiel et al., 1991; Gansow, 1991; US patent 4,831,175).
For example diethylenetriaminepentaacetic acid (DTPA) and its derivatives, winch have been widely used in medicine and in biology for a long time either in their free form, or in the form of a complex with a metallic ion, have the remarkable
characteristic of forming stable chelates with metallic ions and of being coupled with proteins of therapeutic or diagnostic interest such as antibodies for the development of radioimmunoconjμgates in cancer therapy (Meases et al., 1984; Gansow et al., 1990).
Likewise preferably, said at least one antibody forming said conjμgate according to the invention is chosen from its functional fragments, especially the fragments amputated of their Fc component such as the scFv fragments.
The present invention moreover comprises the use of the composition according to the invention for the preparation of a medicament.
More particularly, according to another embodiment, the invention concerns the use of an antibody, or one of its functional fragments, and/or of a composition for the preparation of a medicament intended for the prevention or for the treatment of an illness induced by an overexpression and/or an abnormal activation of the hybrid-R and/or EGFR, and/or connected with a hyperactivation of the transduction pathway of the signal mediated by the interaction of the native ligands of these receptors, preferably of IGF 1, IGF2 or insulin with hybrid-R, and/or of EGF with EGFR and/or HER2/neu.
According to another embodiment, the invention concerns the use of an antibody, or one of its functional fragments, and/or of a composition for the preparation of a medicament intended for the prevention or for the treatment of an illness induced by an overexpression and/or an abnormal activation of both the hybrid-R and the IGF-IR and/or EGFR, and/or connected with a hyperactivation of the transduction pathway of the signal mediated by the interaction of the native ligands of these receptors, preferably of IGF1, IGF2 or insulin with hybrid-R, of IGF1 or IGF2 with IGF-IR and/or of EGF with EGFR and/or HER2/neu.
In the present specification, by the object of the invention "use of a product or a composition for the preparation of a medicament intended for the prevention or for the treatment of a disease", it is also comprised " a method of preventing or treatment of such disease comprising the administration of said product or composition in a patient in need of such treatment".
Preferably, said use according to the invention is characterized in that the administration of said medicament does not induce or induces only slightly secondary effects connected with ininbition of the IR, that is to say ininbition of the interaction of
the IR with its natural ligands due to the presence of said medicament, especially by a competitive ininbition connected with the attachment of said medicament to the IR.
The present invention moreover comprises the use of an antibody, or one of its functional fragments, preferably humanized, and/or of a composition according to the invention for the preparation of a medicament intended to ininbit the transformation of normal cells into cells with tumoral character, preferably IGF-dependent, especially IGF1- and/or IGF2-dependent, and/or EGF-dependent and/or HER2/neu-dependent cells.
The present invention likewise relates to the use of an antibody, or one of its functional fragments, preferably humanized, and/or of a composition according to the invention for the preparation of a medicament intended to ininbit the growth and/or the proliferation of tumor cells, preferably IGF-dependent, especially IGF1- and/or IGF2-dependent, and/or EGF-dependent and/or estrogen- dependent, and/or HER_2/neu-dependent cells.
In a general manner, a subject of the present invention is the use of an antibody, or one of its functional fragments, preferably humanized, and/or of a composition according to the invention, for the preparation of a medicament intended for the prevention or for the treatment of cancer preferably expressing, or with an abnormal activation of, hybrid-R, or both hybrid-R and IGF-IR, and/or EGFR, and/or of cancer preferably having a hyperactivation of the transduction pathway of the signal mediated by the interaction between the hybrid-R and its native ligands, preferably IGF1., IGF2 and insulin and/or IGF-IR and its native ligands, preferably IGF1 and IGF2 or, for example, the overexpression of IRS1 and/or between EGFR with its native ligand, preferably EGF.
The subject of the present invention is likewise the use of an antibody, or one of its functional fragments, preferably humanized, and/or of a composition according to the invention, for the preparation of a medicament intended for the prevention or for the treatment of psoriasis, psoriasis whose epidermal hyperproliferation can be connected with the expression or the overexpression of the hybrid-R, or of both the hybrid-R and the IGF-IR, and/or EGFR, and/or with the hyperactivation of the transduction pathway of the signal mediated by the interaction of hybrid-R or both hybrid-R and IGF-IR respectively with their natural ligands (Wraight C.J. et al, Nat. Biotechnol., 2000,
18(5):521-526, Reversal of epidermal hyperproliferation in psoriasis by insulin-like growth factor I receptor antisense oligonucleotides) and/or of EGFR with its natural ligands.
Among the cancers winch can be prevented and/or treated with the antibody according to the invention and able to bind (or ininbit tyrosine kinase activity) the hybrid-R, breast cancer and thyroid cancer, or any other cancer overexpressing, or with an abnormal activation of hybrid-R is preferred.
Among the cancers winch can be prevented and/or treated with the antibody according to the invention and able to bind (or ininbit tyrosine kinase activity) both the hybrid-R and IGF-IR, prostate cancer, osteosarcomas, lung cancer, breast cancer, endometrial cancer, pancreatic cancer, myeloid cancer, bladder cancer, thyroid cancer, melanoma or colorectal cancer or any other cancer overexpressing, or with an abnormal activation of both hybrid-R and IGF-IR is preferred.
According to yet another aspect, a subject of the present invention is a method of diagnosis, preferably in vitro, of illnesses connected with an overexpression or an underexpression, preferably an overexpression, of the hybrid-R and/or EGFR starting from a biological sample in winch the abnormal presence of hybrid-R and/or EGFR is suspected, characterized in that said biological sample is contacted with an antibody, or one of its functional fragments, according to the invention, it being possible for said antibody to be, if necessary, labeled.
in still another aspect, a subject of the present invention is a method of diagnosis, preferably in vitro, of illnesses connected with an overexpression or an underexpression, preferably an overexpression, of both the hybrid-R and the IGF-IR, and/or EGFR starting from a biological sample in winch the abnormal presence of both hybrid-R and IGF-IR, and/or EGFR is suspected, characterized in that said biological sample is contacted with an antibody, or one of its functional fragments, according to the invention, it being possible for said antibody to be, if necessary, labeled.
Preferably, said illnesses connected with the overexpression, or with an abnormal activation of, of the hybrid-R or both the hybrid-R and the IGF-IR and/or EGFR in said diagnosis method will be cancers.
Said antibody, or one of its functional fragments, can be present in the form of an irnmunoconjμgate or of a labeled antibody so as to obtain a detectable and/or quantifiable signal.
The antibodies labeled according to the invention or their functional fragments include, for example, antibodies called immunoconjμgates winch can be conjμgated, for example, with enzymes such as peroxidase, alkaline phosphatase, a-D-galactosidase, glucose oxydase, glucose amylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase or glucose 6-phosphate dehydrogenase or by a molecule such as biotin, digoxygenin or 5-bromodeoxyuridine. Fluorescent labels can be likewise conjμgated to the antibodies or to their functional fragments according to the invention and especially include fluorescein and its derivatives, fluorochrome, rhodamine and its derivatives, GFP (GFP for "Green Fluorescent Protein"), dansyl, umbelliferone etc. In such conjμgates, the antibodies of the invention or their functional fragments can be prepared by methods known to the person skilled in the art. They can be coupled to the enzymes or to the fluorescent labels directly or by the intermediary of a spacer group or of a linking group such as a polyaldehyde, like glutaraldehyde, ethylenediaminetetraacetic acid (EDTA), diethylene-triaminepentaacetic acid (DPTA), or in the presence of coupling agents such as those mentioned above for the therapeutic conjμgates. The conjμgates containing labels of fluorescein type can be prepared by reaction with an isotinocyanate.
Other conjμgates can likewise include chemoluminescent labels such as luminol and the dioxetanes, bio-luminescent labels such as luciferase and luciferin, or else radioactive labels such as iodine123, iodine125, iodine126, iodine133, bromine77, technetium"m, indium111, indium113"1, gallium67, gallium68, ruthenium95, ruthenium97, ruthenium103, ruthenium105, mercury107, mercury203, rhenium99"1, rhenium101, rhenium105, scandium47, tellurium121"1, tellurium122"1, tellurium125"1, thulium165, thulium167, thulium168, fluorine18, yttrium199, iodine131. The methods known to the person skilled in the art existing for coupling the therapeutic radioisotopes to the antibodies either directly or via a chelating agent such as EDTA, DTP A mentioned above can be used for the radioelements winch can be used in diagnosis. It is likewise possible to mention labeling with Na[I125] by the chloramine T method [Hunter W.M. and Greenwood F.C. (1962) Nature 194:495] or else with technetium99"1 by the technique of Crockford et al.
(US patent 4,424,200) or attached via DTPA as described by Hnatowich (US patent 4,479,930).
Thus, the antibodies, or their functional fragments, according to the invention can be employed in a process for the detection and/or the quantification of an overexpression or of an underexpression, preferably an overexpression, or with an abnormal activation of, of the IGF-IR and/or hybrid-R and/or EGFR in a biological sample, characterized in that it comprises the following steps:
the contacting of the biological sample with an antibody, or one of its
functional fragments, according to the invention; and
the demonstration of the hybrid-R, or both hybrid-R and IGF-IR, and/or
EGFR/antibody complex possibly formed.
in a particular embodiment, the antibodies, or their functional fragments, according to the invention, can be employed in a process for the detection and/or the quantification of the hybrid-R, or of both the hybrid-R and the IGF-IR, and/or EGFR in a biological sample, for the monitoring of the efficacy of a prophylactic and/or therapeutic treatment of IGF- and/or EGF-dependent cancer or else of psoriasis.
More generally, the antibodies, or their functional fragments, according to the invention can be advantageously employed in any situation where the expression, or with an abnormal activation of, of the hybrid-R, or both hybrid-R and IGF-IR, and/or EGFR must be observed in a qualitative and/or quantitative manner.
Preferably, the biological sample is formed by a biological fluid, such as serum, whole blood, cells, a tissue sample or biopsies of human origin.
Any procedure or conventional test can be employed in order to carry out such a detection and/or dosage. Said test can be a competition or sandwich test, or any test known to the person skilled in the art dependent on the formation of an immune complex of antibody-antigen type. Following the applications according to the invention, the antibody or one of its functional fragments can be immobilized or labeled. Tins immobilization can be carried out on numerous supports known to the person skilled in the art. These supports can especially include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, or natural or modified cells. These supports can be either soluble or insoluble.
By way of example, a preferred method brings into play immuno enzymatic processes according to the ELISA technique, by immunofluorescence, or radio-immunoassay (RIA) technique or equivalent.
Thus, the present invention likewise comprises the kits or sets necessary for carrying out a method of diagnosis of illnesses induced by an overexpression or an underexpression of the hybrid-R and/or EGFR or for carrying out a process for the detection and/or the quantification of an overexpression or of an underexpression of the hybrid-R and/or EGFR in a biological sample, preferably an overexpression, or with an abnormal activation of, of said receptor(s), characterized in that said kit or set comprises the following elements:
an antibody, or one of its functional fragments, according to the invention;
optionally, the reagents for the formation of the medium favorable to the
immunological reaction;
optionally, the reagents allowing the demonstration of hybrid-R and/or
EGFR/antibody complexes produced by the immunological reaction.
in a second aspect, the invention also comprises the kits or sets necessary for carrying out a method of diagnosis of illnesses induced by an overexpression or an underexpression of both the hybrid-R and the IGF-IR, and/or EGFR or for carrying out a process for the detection and/or the quantification of an overexpression or of an underexpression of both the hybrid-R and the IGF-IR, and/or EGFR in a biological sample, preferably an overexpression, or with an abnormal activation of, of said receptor(s), characterized in that said kit or set comprises the following elements:
an antibody, or one of its functional fragments, according to the invention;
optionally, the reagents for the formation of the medium favorable to the
immunological reaction;
optionally, the reagents allowing the demonstration of hybrid-R/IGF-IR
antibody and/or EGFR/antibody complexes produced by the immunological reaction.
The invention moreover relates to the use of a composition as a combination product according to the invention, for the preparation of a medicament intended for the prevention or for the treatment of cancer, especially cancers for winch said cytotoxic
agent or said anti-HER2/neu antibody is generally prescribed and, especially, for winch cancers the tumor cells express or overexpress the IGF-IR and/or EGFR.
A subject of the invention is likewise the use of an antibody according to the invention for the preparation of a medicament intended for the specific targeting of a biologically active compound to cells expressing or overexpressing the hybrid-R or both the hybrid-R and the IGF-IR and/or EGFR.
It is intended here by biologically active compound to indicate any compound capable of modulating, especially of ininbiting, cell activity, in particular their growth, their proliferation, transcription or gene translation.
A subject of the invention is also an in vivo diagnostic reagent comprising an antibody according to the invention, or one of its functional fragments, preferably labeled, especially radiolabeled, and its use in medical imaging, in particular for the detection of cancer connected with the expression or the overexpression by a cell of the hybrid-R, or both the hybrid-R and the IGF-IR, and/or EGFR.
The invention likewise relates to a composition as a combination product or to an anti-hybrid-R, or both anti-hybrid-R and anti-IGF-IR, and/or EGFR/toxin conjμgate or radioelement, according to the invention, as a medicament.
Preferably, said composition as a combination product or said conjμgate according to the invention will be mixed with an excipient and/or a pharmaceutically acceptable veincle.
In the present description, pharmaceutically acceptable veincle is intended to indicate a compound or a combination of compounds entering into a pharmaceutical composition not provoking secondary reactions and winch allows, for example, facilitation of the administration of the active compound(s), an increase in its lifespan and/or in its efficacy in the body, an increase in its solubility in solution or else an improvement in its conservation. These pharmaceutically acceptable veincles are well known and will be adapted by the person skilled in the art as a function of the nature and of the mode of administration of the active compound(s) chosen.
Preferably, these compounds will be administered by the systemic route, in particular by the intravenous route, by the intramuscular, intradermal, intraperitoneal or subcutaneous route, or by the oral route. In a more preferred manner, the composition
comprising the antibodies according to the invention will be administered several times, in a sequential manner.
Their modes of administration, dosages and optimum pharmaceutical forms can be determined according to the criteria generally taken into account in the establishment of a treatment adapted to a patient such as, for example, the age or the body weight of the patient, the seriousness of ins/her general condition, the tolerance to the treatment and the secondary effects noted.
The antibody, or fragments thereof, could be use alone or in association with another antibody able to target another growth factor implied in the proliferation or dissemination of tumoral cells. It could also be used in association with a chemotherapeutic agent or another tyrosine kinase ininbitor in co-administration or in the form of an immuno-conjμgate, said agent being chemical, biological and/or natural. Fragments of said antibody could also be use in bispecific antibodies obtained by recombinant mechanisms or biochemical coupling, and then associating the specificity of the above described antibody with the specificity of other antibodies able to recognise other receptors involved in the proliferation, the angiogenese or any other mechanisms involved in the tumoral development.
Particular aspect of the present invention: cytotoxic and/or cytostatic active agent coupled to an addressing system, particularly to the antibodies 7C10, C7C10 or h7C10, or fragment thereof, according to the present invention capable of binding specifically to the hybrid-R or both the hybrid-R and the IGF-IR.
The present invention relates also to novel compounds comprising a cytotoxic and/or cytostatic active agent coupled to an addressing system. More particularly, the present invention relates to a compound comprising a Vinca alkaloid coupled to an antibody capable of binding specifically to the hybrid-R or both the hybrid-R and the IGF-IR and/or capable of specifically ininbiting the tyrosine kinase activity of said hybrid-R or both hybrid-R and IGF-IR, in particular a monoclonal antibody of murine, cinmeric, primatized, humanized and human origin. The invention also relates to the mode of coupling of the elements of said compound and also comprises the use of these compounds as a medicinal product for the prophylactic and/or therapeutic treatment of cancer, more particularly of cancers overexpressing hybrid-R and/or IGF-IR, or of any
pathological condition associated with overexpression, or with an abnormal activation of, of said receptor(s).
Currently, along with surgery and radiotherapy, chemotherapy represents one of the most effective means of combating cancer. Many cytotoxic and/or cytostatic agents have been isolated or synthesized and make it possible to destroy or reduce, if not definitively, at least significantly, the tumor cells. However, the toxic activity of these agents is not limited to tumor cells, and the non-tumor cells are also effected and can be destroyed. More particularly, side effects are observed on rapidly renewing cells, such as haematopoietic cells or cells of the epithelium, in particular of the mucous membranes. By way of illustration, the cells of the gastrointestinal tract are largely effected by the use of cytotoxic agents.
One of the aims of the present invention is also to be able to provide a compound winch makes it possible to limit the side effects on normal cells winle at the same time conserving a ingh cytotoxicity on tumor cells.
According to an original approach, the applicant, rather than developing new molecules, has soμght to overcome the problem of toxicity of known molecules by limiting to tumor cells the access of said molecules. To do tins, the applicant has developed an antibody-type addressing system for targeting only tumor cells.
One of the advantages of tins approach is to be able to use known cytotoxic agents winch are well defined in pharmacological and pharmacokinetic terms. In addition, it is then possible to use strong cytotoxic agents winch until now have been neglected in favour of cytotoxic agents winch are less strong but winch have a better therapeutic index (and therefore exinbit fewer side effects).
Another advantage lies in the use of an antibody, i.e. of a product of biological origin winch does not add any toxicity to that of the cytotoxic agent, in addition, as will be subsequently developed, the choice of the antibody makes it possible to accumulate with the action of the cytotoxic agent its own biological activity.
The applicant has demonstrated that the use of a Vinca alkaloid coupled to an addressing device is of value in chemotherapy.
According to a first aspect, a subject of the present invention is a compound comprising at least one molecule of active agent coupled to an addressing system, said at least one molecule of active agent being a strong cytotoxic and/or cytostatic
compound chosen from Vinca alkaloids, and said addressing system being a polyclonal or monoclonal antibody, winch may be bispecific, or a functional fragment thereof, capable of targeting, preferably specifically, tumor cells.
An advantage of a compound according to the invention is that the active agent is directly broμght to the target cells by the antibody and, besides the fact that it does not degrade the other cells, its biological activity is not decreased.
One of the advantages associated with using antibodies as an addressing system is that it is possible to couple several active agents to them, thus increasing the efficacy of the compound. Specifically, since the compound is broμght directly to the target cells, the fact that there are several active agents will not lead to an increase in side effects, but only to an increase in the desired in situ effect on the tumor cells.
By way of non-limiting examples of targeting antibodies winch can be used according to the invention, mention may be made, without any limitation, of the CeaVac antibodies directed against colorectal tumor cells, and the Y Theragyn/pemtumomab and OvaRex antibodies directed against ovarian tumor cells.
The present invention relates to a compound as described above, winch comprises from 1 to 50 molecules of active agent, preferably from 1 to 10, and better still from 1 to 6. The choice of the number of molecules of active agent depends, inter alia, on the molecular weight of each of the elements. For example, by way of indication, for an antibody of IgGl type with a molecular weight of 150 000 Da, it is preferred to couple from 4 to 6 molecules of vinblastine with a molecular weight of 900 Da (Petersen et al., Cancer Res., 1991, 51:2286). If the antibody is conjμgated with too large an amount of cytotoxic agents, there is a risk that said agents will mask the recognition site for the antigen and decrease its activity.
In practice, the compound winch is the subject of the invention is used as a medicinal product, and more particularly as an medicinal product intended for the treatment of cancer.
The present invention differs from the prior art not only in the sense that the choice of the antibody is aimed at targeting tumor cells as described above, but also in that said antibody exinbits an intrinsic activity on the tumor cells.
According to another embodiment of the invention, the compound as described above is also capable of ininbiting tumor cell proliferation and/or apoptotic function
restoration by blocking transduction signals, the progression of cells in the cell cycle and/or membrane-bound receptor availability (phenomena of internalization and of degradation of said receptor), or of reverting an apoptosis-resistant phenotype in the case of an antibody directed against the IGF-IR, insofar as it is widely described that overexpression of tins receptor confers on tumor cells a means of withstanding apoptosis and in particular apoptosis induced by chemotherapy compounds (Beech D. J. et al., Oncology reports, 2001, 8:325-329; Grothe A. et al., J. Cancer Res. clin Oncol., 1999, 125:166-173). Another mechanism of action of the compound as described above may be associated with the Fc portion of the antibody, if a whole antibody is used, and may consist of the setting up of effector mechanisms such as ADCC (antibody-dependent cellular cytotoxicity) and CDC (complement-dependent cytotoxicity).
By way of non-limiting example of antibodies, mention may be made of Avastin/Bevacizumab winch acts on colorectal cancers by interfering with tumor angiogenesis, Rituxan/rituximab, the activity of winch is mainly related to the effector functions of the molecule, and in particular ADCC, and also Herceptin/trastuzumab winch acts by ininbition of signal transduction and ininbition of cell progression in the cell cycle, and also, in large part, by initiating ADCC mechanisms.
Vinca alkaloids correspond to the family of natural compounds of winch vinblastine, vincristine, anhydrovinblastine and leurosine, winch are present in considerable amounts in plants, are demonstrative examples.
The term "Vinca alkaloids" should also be understood to mean all the derivatives present in small amounts, such as deoxyvinblastine or leurosidine, taken by way of non-limiting examples. It should also be understood to mean derivatives of natural structure but winch are obtained by synthesis, such as, without any limitation, anhydrovinblastine.
The term "Vinca alkaloid" should also be understood to mean all the compounds derived from these natural compounds by chemical or biochemical modification in one or more steps. These modifications may affect the "vindoline" component or the "velbanamine" component or both components simultaneously. The Vinca alkaloids, as such, are known to those skilled in the art (Antitumor Bisindole Alkaloids from Catharanthus roseus (L.)). The Alkaloids, Brossi A. et al., M. Ed. Academic Press Inc. San Diego, vol. 37, 1990; Jacquesy J.C. et al., Biomedical Chemistry: Applying
Chemical Principles to the Understanding and Treatment of Disease, edited by Torrence, P.P., John Wiley and Sons Inc.: New York, 2000, pp. 227-246; Fahy J. et al, J. Current Pharm. Des., 2001, 7:1181-97; Duflos A. et al., Novel Aspects of Natural and Modified Vinca Alkaloids, Curr. Med. Chem. - Anti-Cancer Agents, 2002,2:55-70).
The preferred derivatives according to the present invention are those winch exinbit a pharmacological advantage established by virtue of cytotoxicity assays or activity assays on certain specific targets, such as tubulin, or winch have demonstrated advantages in in vivo tests on animals. Among these compounds, mention may be made of the derivatives currently used in anticancer chemotherapy: vinblastine, vincristine, vindesine and vinorelbine, and also the derivatives winch have demonstrated an advantage in clinical studies, such as vinepidine, vinfosiltine, vinzolidine and vinflunine.
The invention is therefore partly based on the choice of an original cytotoxic agent without any bias from the prior art.
More particularly, a subject of the present invention is a compound as described above, in winch said Vinca alkaloid is selected from vinblastine, deoxyvinblastine, deoxyleurosidine, vincristine, vindesine, vinorelbine, vinepidine, vinfosiltine, vinzolidine and vinflunine.
The subject of the invention has, more specifically, been demonstrated and exemplified using deoxyvinblastine and its 4'-S isomer, commonly known as deoxyleurosidine.
The structure of each of these two compounds has been described for many years, but their pharmacological activity is considered to be moderate or weak (Neuss N. et al., Tetrahedron Letters, 1968, No. 7, pp 783-7; United States Patent 4,143,041, Eli Lilly and Company, Filed Nov. 25, 1977; and recently, Kuehne M. E. et al., J. Org. Chem., 1989, 54, 14:3407-20; Kuehne M. E., Org. Biomol. Chem., 2003 1:2120-36). Their real advantage as a compound with unquestionable antitumor pharmacological activity has never been described and demonstrated by in vivo experiments on murine tumor models.
The present invention therefore relates to a compound as described above, in winch said Vinca alkaloid is (4'-R) deoxyvinblastine and/or (4'-S) deoxyleurosidine.
The greater activity of these two derivatives has been demonstrated against P388 marine leukaemia grafted intravenously on day 0. The compound is administered intraperitoneally in a single dose on day 1. The protocol for tins test is described by Kruczynski A. et al., Cancer Chemotherapy and Pharmacology, 1998, volume 41, pages 437 to 447.
Conventionally, the in vivo activity of cytotoxic compounds is expressed by the T/C at a dose expressed in mg per kg. The T/C corresponds to the ratio, multiplied by 100, of the median of the survival time of the treated animals to the median of the survival time of the control animals.
By way of example, for cytotoxic agents used to date, the maximum activity of vinblastine sulphate is expressed at the dose of 5 mg/kg, with T/C =143. The maximum activity of vincristine sulphate is expressed at the doses of 1.25 and 2.5 mg/kg, with T/C = 143 in both cases.
Unexpectedly, the maximum activity of deoxyvinblastine ditartrate is expressed at the dose of 20 mg/kg, with T/C = 214 and the maximum activity of deoxyleurosidine ditartrate is expressed at the dose 2.5 mg/kg, with T/C = 200.
In view of these results, the present invention therefore relates to the use of (4'-R) deoxyvinblastine and/or (4'-S) deoxyleurosidine, collectively referred to as deoxyvinblastine in the remainder of the description, for treating cancer.
According to a preferred form, as described above, the present invention envisages the coupling of deoxyvinblastine to a compound of the monoclonal or polyclonal, preferably monoclonal, antibody type.
More particularly, as will subsequently be described, a preferred antibody making up the compound winch is the subject of the present invention is a monoclonal or polyclonal, preferably monoclonal, antibody winch will recognize the IGF-IR specifically and with ingh affinity, and winch will have the ability to ininbit the growth of tumors, more particularly of tumors expressing the IGF-IR.
The cytoplasmic protein tyrosine kinases are activated by binding of the ligand to the extracellular domain of the receptor. Activation of the kinases leads, in turn, to stimulation of various intracellular substrates, including IRS-1, ISR-2, She and Grb 10 (Peruzzi F. et al., J. Cancer Res. Clin. Oncol., 125:166-173, 1999). The two major substrates for the IGF-IR are IRS and She, winch mediate, by activation of many
downstream effectors, most of growth and differentiation effects associated with the binding of IGFs to tins receptor. Substrate availability can, consequently, dictate the final biological effect associated with activation of the IGF-IR. When IRS-1 predominates, the cells tend to proliferate and to transform. When She dominates, the cells tend to differentiate (Valentinis B. et al., J. Biol. Chem., 274:12423-12430, 1999). It appears that the pathway mainly implicated for the effects of protection against apoptosis is the phosphatidylinositol 3-kinases (PI 3-kinases) pathway (Frisco M. et al., Horm. Metab. Res., 31:80-89, 1999; Peruzzi F. et al., J. Cancer Res. Clin. Oncol., 125:166-173,1999).
According to a preferred embodiment, a subject of the present invention is a compound as described above (cytotoxic and/or cytostatic active agent coupled to an addressing system), comprising an antibody capable of recognizing the IGF-IR specifically and with ingh affinity. Tins antibody will interact little or not at all with the insulin receptor IR. Its binding should ininbit, in vitro, the growth of tumors expressing the IGF-IR by interacting mainly with the signal transduction pathways activated during IGF 1/IGF-IR and IGF2/IGF-IR interactions. Tins antibody should be active in vivo on all tumor types expressing the IGF-IR, including oestrogen-dependent breast tumors and prostate rumors, winch is not the case for the anti-IGF-IR monoclonal antibodies (referred to as MAb or MAB) currently available, in fact, aIR3, winch is a reference in the IGF-IR field, completely ininbits the growth of oestrogen-dependent breast tumors (MCF-7) in vitro, but has no effect on the corresponding in vivo model (Artega C. et al., J. Clin. Invest., 84:1418-1423, 1989). Similarly, the scFv-Fc fragment derived from the murine monoclonal 1H7 is only weakly active on the MCF-7 breast tumor and completely inactive on an androgen-independent prostate tumor (Li S.L. et al., Cancer Immunol. Immunother., 49:243-252,2000).
According to a preferred embodiment, a subject of the present invention is a compound (cytotoxic and/or cytostatic active agent coupled to an addressing system) as described above, comprising an antibody, or one of its functional fragments, said antibody or one of its said fragments being capable of binding specifically to the human insulin-like growth factor-I receptor IGF-IR and, where appropriate, capable of
ininbiting the natural binding of the IGF-IR ligands IGF1 and/or IGF2, and/or capable of specifically ininbiting the tyrosine kinase activity of said IGF-IR.
Such a compound has a double advantage.
Firstly, it makes it possible, as described above, to bring the cytotoxic agent directly to tumor cells, more particularly tumor cells overexpressing, or with an abnormal activation of, the hybrid-R or both the hybrid-R and the IGF-IR, and thus to decrease the side effects in normal cells.
Secondly, its mode of action is not limited to targeting. The compound winch is the subject of the present invention cumulates the action of the cytotoxic agent winch makes it possible to destroy the tumor cells and the action of the antibody winch will ininbit the growth of tumor cells, preferably of tumor cells expressing, or with an abnormal activation of, the hybrud-R or both the hybrid-R and the IGF-IR, by interacting with the signal transduction pathways, and will make it possible to decrease the resistance to apoptosis of cells overexpressing the receptor for IGF1 and, consequently, to improve the activity of chemotherapy drags, part of the mechanism of action of winch lies in the induction of apoptosis.
According to a preferred embodiment of the compound (cytotoxic and/or cytostatic active agent coupled to an addressing system) winch is the subject of tins particularly object of the present invention, the monoclonal antibody, or one of its functional fragments, is the 7C10, a C7C10 or a h7C10, or fragment thereof, or then-derived antibodies, as described in the first part of the present specification directed to the antibodies anti-hybrid-R or both anti-hybrid-R and anti-IGR-IR of the present invention.
In tins respect, the applicant filed a French patent application FR 03/08538 on July 11, 2003 for "Novel antitumor immunoconjμgates". The content of tins patent application is incorporated herein by way of reference.
Immunoliposomes containing such particular cytotoxic and/or cytostatic agents, such as described above, such as the vinca alkaloids, and of addressing them to tumor cells by means of antibodies or of antibody fragments attached to their surface are comprised in the present invention.
Method of treatement of cancer, particularly the preferred cancers cited above, comprising the administration of the present immunoliposomes forms also part of the present invention.
The antibodies or antibody fragments used are directed against antigens overexpressed at the surface of tumor cells and/or surface antigens the expression of winch is restricted to tumor cells. They are preferably directed against tyrosine kinase receptors, and more particularly against the receptors for IGF-I, EGF or else VEGF. A preferred antibody is a monoclonal or polyclonal, preferably monoclonal, or even humanized, antibody winch will recognize the hybrid-R, or both the hybrid-R and the IGF-IR, specifically and with ingh affinity. Even more preferably, tins antibody consists of the antibody anti-hybrid-R or both anti-hybrid-R and anti-IGR-IR winch is the subject of the present invention described in the first part of the specification.
According to another embodiment of the compound (cytotoxic and/or cyto static active agent coupled to an addressing system) winch is a subject of the present invention, the monoclonal antibody as described above is also capable of binding specifically to the human epidermal growtll factor receptor, EGFR, and/or capable of specifically ininbiting the tyrosine kinase activity of said EGFR.
According to a preferred aspect of tins embodiment of the compound(cytotoxic and/or cytostatic active agent coupled to an addressing system), the coupled monoclonal antibody consists of a bispecific antibody comprising a second unit winch specifically ininbits the binding of EGF to the EGFR and/or winch specifically ininbits the tyrosine kinase activity of said EGFR.
In a preferred embodiment of the invention, the bispecific antibody winch can be used here for cytotoxic and/or cytostatic active agent coupled to an addressing system according to tins invention is those as described in the first part of the presnt specification related to bispecific antibodies of the invention.
Another aspect of the invention concerns the mode of coupling between the antibody and the cytotoxic agent. Whatever the nature of the coupling, winch may be direct or indirect, stable or labile, it should in no way impair the respective biological functions of the antibody and of the cytotoxic agent. It is clearly understood that any coupling satisfying tins characteristic, and known to those skilled in the art, is included in the scope of the present patent application. In addition, the coupling, and more
particularly the linkage used, must allow release of the deoxyvinblastine, in the 4-deacetylated or 3-acid, or 4-deacetylated and 3-acid, form, or in the form of one of these forms carrying all or part of said linkage used, in the target cells.
According to a preferred embodiment, the coupling is chemical coupling. More particularly, said chemical coupling is composed of an anchorage on the Vinca alkaloid, an anchorage on the antibody and a linkage connecting these two anchorages.
The term "linkage" should be understood to mean any structure capable of providing a bond of whatever possible nature between the two elements of the compound, namely a chemical molecule and an antibody.
In terms of the anchorage on the Vinca alkaloid, several possibilities are envisaged. Mention may, for example, be made of an anchorage on the alcohol function in the 4-position after deacetylation of the 4-acetoxy group of said Vinca alkaloid.
In another embodiment, the anchorage on the Vinca alkaloid is effected on the acid function in the 3-position after deacetylation of the 4-acetoxy group and demethylation of the ester function in the 3-position of said Vinca alkaloid.
According to yet another embodiment of the invention, the anchorage on the Vinca alkaloid is effected on the acid function in the 3-position directly by reaction on the ester function in the 3-position of said Vinca alkaloid.
According to yet another embodiment of the invention, the anchorage on the Vinca alkaloid is effected via an ester or tinoester function on the hydroxyl function in the 3-position.
An additional embodiment consists in effecting the anchorage on the Vinca alkaloid via an amide function or an ester function or a hydrazide function on the acid function in the 4-position.
As regards the anchorage on the antibody, it should in no way denature the antibody, so as not to decrease its ability to recognize and interact with the tumor cells.
To do tins, it is preferable for the anchorage on the antibody to be effected on the oligosaccharides, the lysines and/or the aspartic acid and glutamic acid residues.
The Vinca alkaloid may also be coupled on the carboxylic functions of the antibody, carried by the aspartic acid and glutamic acid residues of the antibody. For example, an amine, hydrazide or hydrazine derivative of the Vinca alkaloid will be
coupled on these residues in the presence of a compound of carbodiimide type, such as N-(3-dimethylaminopropyl)-N'-ethylcarbodiimide (or ED AC).
In practice, it is even more preferable to effect the anchorage on the oligosaccharides present on the antibody. Specifically, there are no oligosaccharides in the recognition sites of the antibody and, as a result, there is no risk of impairing the recognition/biological activity capacities of said antibody. According to a preferred embodiment of the invention, the anchorage is effected on the oligosaccharides present on the asparagines (Asn) winch are followed by a consensus sequence consisting of an amino acid and a serine or a threonine. For example, without any limitation, a preferred anchorage on the IgGl antibody used in the invention is on Asn297.
A combined anchorage, i.e. an anchorage on oligosaccharides, lyines and/or aspartic acid and glutamic acid, is also covered.
An additional embodiment consists in greatly increasing the density of the Vinca alkaloid in order to attain 10 to 50 mol per mole of antibody. Mention may be made of the coupling of a hemisuccinate derivative of the Vinca alkaloid on a lysine polymer (Poly-L-Lys or Poly-D-Lys). The conjμgate thus obtained is then coupled on the oligosaccharides of the antibody, oxidized beforehand with meta-periodate.
In another embodiment, a hydrazide derivative of the Vinca alkaloid may be coupled on a dextran oxidized beforehand with meta-periodate. The conjμgate obtained is then coupled to the antibody via the lysine residues.
According to yet another embodiment, a hemisuccinate derivative of the Vinca alkaloid may be coupled on a dextran activated beforehand by controlled oxidation with meta-periodate and then substituted with a compound of diamide type. The conjμgate obtained is then coupled on the lysine residues of the antibody.
According to a preferred embodiment of the invention, the anchorage on the antibody is effected by reaction of an amine function, a hydrazine function, a hydrazide function or an acid function winch has been activated.
More particularly, the anchorage on the antibody is effected by reaction of an epoxide function or of a disulpinde function, a sulpinde function or an acid function winch has been activated, with a nitrogen-containing residue or with a hydroxyl residue or with a tinol residue of said antibody.
Mention may also be made, in a nonlimiting manner, of other linkages winch may also be used to covalently attach the Vinca alkaloids to the antibodies or to their functional fragments (Garnett et al., Adv. Drμg Deliv. Rev., 2001, 171-216), such as aldehydes winch make it possible to form Scinff bases, winch can then be stabilized by reduction with sodium borohydride or cyanoborohydride; disulpindes winch have the advantage of being able to release the Vinca alkaloids inside the tumor cell by virtue of the intracytoplasmic reducing environment; more stable tinoethers; more labile tinoesters; linkages winch are labile in acidic medium, winch have the advantage of allowing release of the cytotoxic agent in the tumor, winch is generally more acid, or during the passage from the endosome (pH 6.0 6.8) to the lysosome (pH 4.5 5.5), or else enzyme-degradable linkages winch have the advantage of being stable in the serum and of releasing the cytotoxic agent in the intracellular medium of the tumor cell.
Mention may also be made of peptide sequences of the Ala Leu type, winch can be cleaved by lysosomal hydrolases (Masquelier et al., J. Med. Chem., 1980, 23:1166-1170) or else linkages of the hydrazone type, such as those used in the gemtuzumab ozogamicin immunoconjμgate used in the treatment of certain types of leukaemia and sold under the name Mylotarg (Hamann et al., Bioconjμgate Chem., 2002,13:47).
As described above, a preferred form of the invention uses a linkage winch allows release of the deoxyvinblastine in the tumor cells.
A first means for achieving tins consists in using a linkage connecting the two anchorages winch consists of a peptide chain. In fact, such a peptide linkage will be degraded/hydrolysed in the target cells by the enzymes of the endosomes and of the lysosomes.
According to another embodiment of the invention, the linkage connecting the two anchorages consists of a linear or branched carbon-based chain. In the latter case, it is envisaged that one or more aromatic, ethylenic or acetylenic groups and also one or more ketone, amide, ester, hydrazide, hydrazone, amine, ether, sulpinde or disulpinde groups are included in the carbon chain in a distinct or combined manner. For example, in the case of an attachment via a disulpinde bridge, it is the reducing medium winch will allow cleavage of the linkage and release of the deoxyvinblastine.
In all cases, only the linkage is destroyed in order to release the active principle, said active principle and the antibody themselves remaining intact.
According to yet another embodiment, there is no linkage, but the Vinca alkaloid is coupled directly with a nitrogen-containing residue or with a hydroxyl residue or with a tinol residue of the antibody.
The advantage of such a direct coupling lies in the absence of anchorage linkage and, consequently, in the absence of an immune reaction by the patient against tins linkage. The appearance of anti-linkage antibodies secreted by the body in response to the intrusion of said linkage is thus, for example, avoided.
More particularly, the compound according to the invention is characterized in that the acid function in the 4-position of the Vinca alkaloid is coupled, via a hydrazide function, with an aldehyde residue of the antibody, generated beforehand.
The invention also relates to a pharmaceutical composition comprising, as active principle, a compound comprising or consisting of a Vinca alkaloid coupled to an antibody, or one of its functional fragments, according to the invention, to winch a pharmaceutically acceptable excipient and/or veincle is preferably added.
The present invention also comprises the use of the compound according to the invention for preparing a medicinal product.
More particularly, according to another embodiment, the invention relates to the use of a compound as described above and/or of a composition comprising such a compound, for preparing a medicinal product intended for the prevention or treatment of cancers, in particular cancers induced by overexpression and/or activation, or with an abnormal activation of, of the hybrid-R, or both the hybrid-R and the IGF-IR, and/or EGFR winch is abnormal, and/or associated with hyperactivation of the signal transduction pathway mediated by the interaction of IGF 1, IGF2 or insulin with hybrid-R alone or in combination with the interaction of IGF1 or IGF2 with IGF-IR and/or of EGF with EGFR.
Among the cancers winch may be prevented and/or treated, prostate cancer, osteosarcomas, lung cancer, breast cancer, endometrial cancer or colon cancer, or any other cancer overexpressing IGF-IR, is preferred.
According another aspect, the invention concerns a humanized anti-IGF-IR antibody, or antigen-binding fragment thereof, wherein said anti-IGF-IR antibody, or antigen-binding fragment, comprises at least one complementary determining region of non-human origin and at least one framework region having at least one human residue,
herein said antibody is characterized as:
a) binding IGF-IR but not IR alone; and/or
b) ininbiting the binding between a human IGF-IR and its native ligand,
preferably designated herein as IGF1 and/or IGF2, with an ininbition constant and/or
ICso of less than 100 nM, preferably less than 50 nM; and/or
specifically ininbiting the tyrosine kinase activity of said IGF-IR; and/or
having a binding affinity of 10 nM or less for said IGF-IR; and/or
down-regulating IGF-IR expression; and/or
ininbiting in vivo rumor growth;
wherein said antibody comprises a heavy chain amino acid sequence comprising human FR1, FR2, and FR3 amino acid sequences that correspond to those of a human germline such as, for example, the human Kabat subgroup I(A) germline, or conservative substitutions or somatic mutations therein, and/or
wherein said antibody comprises a light chain amino acid sequence comprising human FR1, FR2, and FR3 amino acid sequences that correspond to those of a human germline such as, for example, the human Kabat subgroup II germline, or conservative substitutions or somatic mutations therein, and
wherein the FR sequences of the heavy chain are linked with CDR1, CDR2, and CDR3 of sequences derived from a non-human source and comprising the amino acid sequences selected from the group consisting of SEQ ID Nos. 8,10 and 12, and/or
wherein the FR sequences of the light chain are linked with CDR1, CDR2, and CDR3 of sequences derived from a non-human source and comprising the amino acid sequences selected from the group consisting of SEQ ID Nos. 2, 4 and 6.
In a second embodiment, the present invention also deals with a humanized anti-hybrid-R antibody or antigen-binding fragment thereof, wherein said anti-hybrid-R antibody or antigen-binding fragment comprises at least one complementary determining region of non-human origin and at least one framework region having at least one human residue, wherein said antibody is characterized as:
a) binding hybrid-R but not IR alone; and/or
b) ininbiting the binding between a human hybrid-R and its native ligand,
preferably designated herein as IGF1 and/or IGF2 and/or insulin, with an ininbition
constant and/or ICso of less than 100 nM, preferably less than 50 nM; and/or
specifically ininbiting the tyrosine kinase activity of said hybrid-R; and/or
having a binding affinity of 10 nM or less for said hybrid-R; and/or
down-regulating hybrid-R expression; and/or
ininbiting in vivo tumor growth;
wherein said antibody comprises a heavy chain amino acid sequence comprising human FR1, FR2, and FR3 amino acid sequences that correspond to those of a human germline such as, for example, the human Kabat subgroup I(A) germline, or conservative substitutions or somatic mutations therein,
wherein said antibody comprises a light chain amino acid sequence comprising human FR1, FR2, and FR3 amino acid sequences that correspond to those of a human germline such as, for example, the human Kabat subgroup II germline, or conservative substitutions or somatic mutations therein, and
wherein the FR sequences are linked with CDR1, CDR2, and CDR3 sequences derived from a non-human source and comprising the amino acid sequences selected from the group consisting of SEQ ID Nos. 8,10 and 12, and/or
wherein the FR sequences of the light chain are linked with CDR1, CDR2, and CDR3 of sequences derived from a non-human source and comprising the amino acid sequences selected from the group consisting of SEQ ID Nos. 2,4 and 6.
Moreover, according a tinrd embodiment of the invention, it is envisaged a humanized anti-IGF-IR and hybrid-R antibody or antigen-binding fragment thereof, wherein said anti-IGF-IR and hybrid-R antibody or antigen-binding fragment comprises at least one complementary determining region of non-human origin and at least one framework region having at least one human residue, wherein said antibody is characterized as:
a) binding IGF-IR and hybrid-R but not IR alone; and/or
b) ininbiting the binding between a human IGF-IR and its native ligand,
preferably designated herein as IGF1 and/or IGF2, with an ininbition constant and/or
ICso of less than 100 nM, preferably less than 50 nM, and also a human hybrid-R, and
its natural ligand designated herein as IGF1 and/or IGF2 and/or insulin, with an
ininbition constant and/or ICso of less than 100 nM, preferably less than 50 nM; and/or
specifically ininbiting the tyrosine kinase activity of both said IGF-IR and
hybrid-R; and/or
having a binding affinity of 10 nM or less for said hybrid-R and of 10 nM or
less for said IGF-IR; and/or
down-regulating both IGF-IR and hybrid-R expression; and/or
ininbiting in vivo tumor growth;
wherein said antibody comprises a heavy chain amino acid sequence comprising human FR1, FR2, and FR3 amino acid sequences that correspond to those of a human germline such as, for example, the human Kabat subgroup I(A) gennline, or conservative substitutions or somatic mutations therein, and/or
wherein said antibody comprises a light chain amino acid sequence comprising human FR1, FR2, and FR3 amino acid sequences that correspond to those of a human germline such as, for example, the human Kabat subgroup II germline, or conservative substitutions or somatic mutations therein, and
wherein the FR sequences are linked with CDR1, CDR2, and CDR3 sequences derived from a non-human source and comprising the amino acid sequences selected from the group consisting of SEQ ID Nos. 8,10 and 12, and/or
wherein the FR sequences of the light chain are linked with CDR1, CDR2, and CDR3 of sequences derived from a non-human source and comprising the amino acid sequences selected from the group consisting of SEQ ID Nos. 2,4 and 6.
The invention also describes a method of modulating IGF-IR activity in IGF-IR-responsive mammalian cells comprising: contacting the cells with an antibody specific for said receptor, wherein said antibody comprises a light and a heavy chain, said light chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 2,4 and 6 and said heavy chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 8,10, and 12.
In a second embodiment, the invention describes a method of modulating hybrid-R activity in hybrid-R-responsive mammalian cells comprising: contacting the cells with an antibody specific for said receptor, wherein said antibody comprises a light and a heavy chain, said light chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 2, 4 and 6 and said heavy
chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 8,10, and 12.
Then, in a tinrd embodiment, an object of the present invention is a method of jointly modulating IGF-IR and hybrid-R activities in IGF-IR and hybrid-R-responsive mammalian cells comprising: contacting the cells with an antibody specific for said receptors, wherein said antibody comprises a light and a heavy chain, said light chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 2, 4 and 6 and said heavy chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 8,10, and 12.
More particularly, the methods above described, and wherein the antibody modulates IGF-IR activity, is directed against, without limitation, mammalian cells selected from the group consisting of breast cancer cells, prostate cancer cells, colorectal cancer cells, lung cancer cells, bladder cancer cells, kidney cancer cells, thyroid cancer cells, osteosarcomas cells, pancreatic cancer cells, melanoma and myeloid cells.
The method above descirbed, wherein the antibody modulates hybrid-R activity, is directed against, without limitation, mammalian cells selected from the group consisting of breast cancer cells or thyroid cancer cells. The same for the modulation of both hybrid-R and IGF-IR.
The invention also deals with method of decreasing IGF-IR activity in IGF-IR-responsive mammalian cells comprising: contacting the cells with an antibody specific for said receptor in an amount sufficient to decrease the activity of IGF-IR, wherein said antibody comprises a light and a heavy chain, said light chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 2, 4 and 6 and said heavy chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 8, 10, and 12.
In a similar manner than previous method, the invention concerns, in a second embodiment, a method of decreasing hybrid-R activity in hybrid-R-responsive mammalian cells comprising: contacting the cells with an antibody specific for said receptor in an amount sufficient to decrease the activity of hybrid-R, wherein said
antibody comprises a light and a heavy chain, said light chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 2, 4 and 6 and said heavy chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 8, 10, and 12.
In a tinrd embodiment, it is envisaged a method of jointly decreasing IGF-IR and hybrid-R activities in IGF-IR and hybrid-R-responsive mammalian cells comprising: contacting the cells with an antibody specific for said receptors in an amount sufficient to decrease the activities of IGF-IR and hybrid-R, wherein said antibody comprises a light and a heavy chain, said light chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 2, 4 and 6 and said heavy chain comprising at least one complementary determining region CDR chosen from the CDRs of sequence SEQ ID Nos. 8, 10, and 12.
The method above mentionned, wherein the antibody decreases IGF-IR activity, concerns mammalian cells selected from the group consisting of, without limitation, breast cancer cells, prostate cancer cells, colorectal cancer cells, lung cancer cells, bladder cancer cells, kidney cancer cells, thyroid cancer cells, osteosarcomas cells, pancreatic cancer cells, melanoma and myeloid cells.
The method above mentionned, wherein the antibody decreases hybrid-R activity, concerns mammalian cells selected from the group consisting of, without limitation, breast cancer cells or thyroid cancer cells. The same for both hybrid-R and IGF-IR.
The invention also concerns a method of identifying an IGF-IR modulator comprising:
contacting IGF-IR with an antibody according to the invention able to bind
IGF-IR;
contacting the complex of (a) with a compound library;
identifying a compound winch disrupts the complex of (a); and
determining whether the compound exinbits agonist or antagonist activity at
the IGF-IR, wherein tins activity indicates identification of an IGF-IR modulator.
In a second embodiment, the invention consists in a method of identifying a hybrid-R modulator comprising:
contacting hybrid-R with an antibody according to the invention able to bind
hybrid-R;
contacting the complex of (a) with a compound library;
identifying a compound winch disrupts the complex of (a); and
determining whether the compound exinbits agonist or antagonist activity at
the hybrid-R, wherein tins activity indicates identification of a hybrid-R modulator.
In a tinrd embodiment, a method of identifying an IGF-IR and hybrid-R modulator comprising the following stps is an object of the invention:
contacting IGF-IR and hybrid-R with an antibody according to the invention
able to bind IGF-IR and hybrid-R;
contacting the complex of (a) with a compound library;
identifying a compound winch disrupts the complex of (a); and
determining whether the compound exinbits agonist or antagonist activity at
the IGF-IR and hybrid-R, wherein tins activity indicates identification of an IGF-IR and
hybrid-R modulator.
The present invention is also describing a method of identifying an IGF-IR modulator comprising:
screening a library of peptide sequences, wherein said library of peptide
sequences bind to IGF-IR, and wherein the library is derived from a peptide sequence
comprising at least one sequence selected from the group consisting of SEQ ID Nos. 2,
4, 6, 8,10 and 12; and
determining whether the amino acid sequence isolated in (a) exinbits agonist
or antagonist activity at IGF-IR-responsive cell selected from the group consisting of
cell lines displaying IGF-IR, such as, for example, MCF-7, T47D, BT20, ZR-75-1,
MDA-MB-231 for breast cells, PCS and DU145 for prostate cells, A549, A427 and SK-
LU-1 for lung cells, HT29, Colo205 and CaCo-2 for colon cells, BC-PAP, FRO and
ARO for thyroid cells, SK-OV-3 for ovarian cells, BxPC3, MiaPaCa-2 and LN36 for
pancreas cells, SK-ES-1 for renal adrenal cancer sarcoma cells, Daoy, TE-671 and
D283 Med for medulloblastoma cells, MM-1S and MM-1R for retinoblastoma multiple
myeloma cells and SK-MEL-28 for melanoma cells wherein tins activity indicates identification of an IGF-IR modulator.
It is also described a method of identifying a hybrid-R modulator comprising:
screening a library of peptide sequences, wherein said library of peptide
sequences bind to hybrid-R, and wherein the library is derived from a peptide sequence
comprising at least one sequence, preferably 2, 3, 4, 5 and 6 different sequences,
selected from the group consisting of SEQ ID Nos. 2,4, 6, 8, 10 and 12; and
determining whether the amino acid sequence isolated in (a) exinbits agonist
or antagonist activity at hybrid-R-responsive cell selected from the group consisting of
cell lines displaying hybrid-R, such as, for example, MDA-MB-231, MDA-MB-157,
MDA-MB-468, MDA-MB-453 and ZR-75 for breast cells and BC-PAP for thyroid
cells, wherein tins activity indicates identification of an hybrid-R modulator.
Then, in a tinrd embodiment, it is also an objet of the invention to develop a method of identifying an IGF-IR and hybrid-R modulator comprising:
screening a library of peptide sequences, wherein said library of peptide
sequences bind to IGF-IR and/or hybrid-R, and wherein the library is derived from a
peptide sequence comprising at least one sequence, preferably 2, 3, 4, 5 and 6 different
sequences, selected from the group consisting of SEQ ID Nos. 2,4,6, 8,10 and 12; and
determining whether the amino acid sequence isolated in (a) exinbits agonist
or antagonist activity at IGF-IR and/ir hybrid-R-responsive cell selected from the group
consisting of cell lines displaying IGF-IR and/or hybrid-R, such as, for example, MCF-
7, T47D, BT20, ZR-75-1, MDA-MB-231, MDA-MB-157, MDA-MB-468, MDA-MB-
453 and ZR-75 for breast cells, PCS and DU145 for prostate cells, A549, A427 and SK-
LU-1 for lung cells, HT29, Colo205 and CaCo-2 for colon cells, BC-PAP, FRO and
ARO for thyroid cells, SK-OV-3 for ovarian cells, BxPC3, MiaPaCa-2 and LN36 for
pancreas cells, SK-ES-1 for renal adrenal cancer sarcoma cells, Daoy, TE-671 and
D283 Med for medulloblastoma cells, MM-IS and MM-1R for retinoblastoma multiple
myeloma cells and SK-MEL-28 for melanoma cells, wherein tins activity indicates
identification of an IGF-IR and hybrid-R modulator.
An object of the invention is A method of treating or preventing a medical condition in a subject, winch medical condition is mediated by elevated expression and/or activation of IGF1, comprising administering a binding composition that specifically binds to IGF-IR comprising at least a member selected from the group consisting of:
a light chain arm'no acid sequence winch comprises CDR-L1 defined by SEQ
ID No. 2, CDR-L2 defined by SEQ ID No. 4 and CDR-L3 defined by SEQ ID No. 6;
and/or
a heavy chain amino acid sequence winch comprises CDR-H1 defined by
SEQ ID No. 8, CDR-H2 defined by SEQ ID No. 10 and CDR-H3 defined by SEQ ID
No. 12; to the subject.
In a second embodiment, an object of the inventionis a method of treating or preventing a medical condition in a subject, winch medical condition is mediated by elevated expression and/or activation of hybrid-R comprising administering a binding composition that specifically binds to hybrid-R comprising at least a member selected from the group consisting of:
a light chain amino acid sequence winch comprises CDR-L1 defined by SEQ
ID No. 2, CDR-L2 defined by SEQ ID No. 4 and CDR-L3 defined by SEQ ID No. 6;
and/or
a heavy chain amino acid sequence winch comprises CDR-H1 defined by
SEQ ID No. 8, CDR-H2 defined by SEQ ID No. 10 and CDR-H3 defined by SEQ ID
No. 12; to the subject.
in a tinrd embodiment, an object of the invention is a method of treating or preventing a medical condition in a subject, winch medical condition is mediated by elevated expression and/or activation of IGF-IR and hybrid-R comprising administering a binding composition that specifically binds to IGF-IR and hybrid-R comprising at least a member selected from the group consisting of:
a) a light chain amino acid sequence winch comprises CDR-L1 defined by SEQ ID No. 2, CDR-L2 defined by SEQ ID No. 4 and CDR-L3 defined by SEQ ID No. 6; and/or
a heavy chain amino acid sequence winch comprises CDR-H1 defined by SEQ ID No. 8, CDR-H2 defined by SEQ ID No. 10 and CDR-H3 defined by SEQ ID No. 12; to the subject.
Another object of the invention is a method of determining regression, progression or onset of a pathological disorder characterized by increased expression and/or activation of human IGF-IR relative to normal comprising incubating a sample obtained from a patient with said disorder with a detectable probe that is specific for said human IGF-IR under conditions favoring formation of a probe/IGF-IR complex, the presence of winch is indicative of the regression, progression or onset of said pathological disorder in said patient.
in a second embodiment, another object of the invention is a method of determining regression, progression or onset of a pathological disorder characterized by increased expression and/or activation of human hybrid-R relative to normal comprising incubating a sample obtained from a patient with said disorder with a detectable probe that is specific for said human hybrid-R under conditions favoring formation of a probe/hybrid-R complex, the presence of winch is indicative of the regression, progression or onset of said pathological disorder in said patient.
in a tinrd embodiment, another aspect of the invention is a method of determining regression, progression or onset of a pathological disorder characterized by increased expression and/or activation of both human IGF-IR and hybrid-R relative to normal comprising incubating a sample obtained from a patient with said disorder with a detectable probe that is specific for said human IGF-IR and hybrid-R under conditions favoring formation of a probe/hybrid-R and probe. IGF-IR complex, the presence of winch is indicative of the regression, progression or onset of said pathological disorder in said patient.
By references to "normal", it is intended to normal expression or normal activation of IGF-IR, hybrid-R or both. Any methods of determining expression, or activation, levels known by the man skilled in the art can be used and is incorporated in the present specification. An example of such a method is described in example 42 hereinafter.
In the method above described, the probe is preferably an antibody, said antibody being preferably labeled with a radioactive label, a fluorescent label or an enzyme, and said antibody preferably comprising the antibody of the invention as described in the present specification.
Still another aspect of the invention is a method of following progress of a therapeutic regimen designed to alleviate a condition characterized by abnormal expression and/or activation of human IGF-IR relative to normal comprising:
assaying a sample from a subject to determine level of expression and/or
activation of said IGF-IR at a first time point;
administering the antibody of the invention able to binf IGF-IR to said subject
and assaying level of expression and/or activation of said IGF-IR at subsequent time
points following administration of said antibody; and
comparing said level of said IGF-IR at said subsequent time points to the
level determined in (a) as a determination of effect of said therapeutic regimen, wherein
a decrease in said level of expression and/or activation of IGF-IR subsequent to
administration of said anti-IGF-IR antibody indicates a positive progression of the
therapeutic regimen designed to alleviate said condition.
In a second embodiment, it is also a aspect of the invention to protect a method of following progress of a therapeutic regimen designed to alleviate a condition characterized by abnormal expression and/or activation of human hybrid-R relative to normal comprising:
assaying a sample from a subject to determine level of expression and/or
activation of said hybrid-R at a first time point;
administering the antibody of the invention able to bind hybrid-R to said
subject and assaying level of expression and/or activation of said hybrid-R at
subsequent time points following administration of said antibody; and
comparing said level of said hybrid-R at said subsequent time points to the
level determined in (a) as a determination of effect of said therapeutic regimen, wherein
a decrease in said level of expression and/or activation of hybrid-R subsequent to
administration of said anti-hybrid-R antibody indicates a positive progression of the
therapeutic regimen designed to alleviate said condition.
a tinrd aspect, the invention is claiming a method of following progress of a therapeutic regimen designed to alleviate a condition characterized by abnormal expression and/or activation of both human IGF-IR and hybrid-R relative to normal comprising:
assaying a sample from a subject to determine level of expression and/or
activation of said IGF-IR and hybrid-R at a first time point;
administering the antibody of the invention able to bind both IGF-IR and
hybrid-R to said subject and assaying level of expression and/or activation of said IGF-
IR and hybrid-R at subsequent time points following administration of said antibody;
and
comparing said level of said IGF-IR and hybrid-R at said subsequent time
points to the level determined in (a) as a determination of effect of said therapeutic
regimen, wherein a decrease in said level of expression and/or activation of IGF-IR and
hybrid-R subsequent to administration of said anti-IGF-IR and hybrid-R antibody
indicates a positive progression of the therapeutic regimen designed to alleviate said
condition.
The condition above mentioned comprises i) a tumor that expresses at least an IGF-IR, preferably breast cancer, prostate cancer, colorectal cancer, lung cancer, bladder cancer, kidney cancer, thyroid cancer, osteosarcomas, pancreatic cancer, melanoma and myeloid cancer; or ii) a tumor that expresses at least a hybrid-R, preferably breast cancer or thyroid cancer.
The methods above described can also include, before the administration of step b), the step consisting in measuring the concentration of a specific tumoral antigen in a body sample from the mammal, wherein an elevated concentration of said specific tumoral antigen above a reference range for said specific tumoral antigen indicates a increased risk for cancer.
Specific timoral antigen are described in example 43 hereinafter. Genetic markers can also be used (see example 43).
Methods above described, preferably methods of treating/preventing a medical condition or methods of following progress of a therapeutic regimen are comprising administering to said mammal the antibody of the invention in combination with AN agent selected from the group consisting of a corticosteroid, anti-emetic, cancer vaccine, analgesic, anti-vascular agent, cytokines, non-specific inimunostimulant and anti-proliferative agent.
In a preferred embodiment, said anti-emetic agent is selected from the group consisting of, without limitation, ondansetron hydrochloride, granisetron hydrochloride, metroclopramide, domperidone, haloperidol, cyclizine, lorazepam, prochlorperazine, dexamethasone, levomepromazine, or tropisetron.
In another preferred embodiment, said analgesic agent is selected from the group consisting of, without limitation, ibuprofen, naproxen, choline magnesium trisalicylate, or oxycodone.hydrochloride.
In another particularly preferred embodiment, said anti-proliferative agent is selected from the group consisting of, without limitation, farnesyl protein transferase ininbitors, .alpha.v.beta.3 ininbitors, .alpha.v.beta.5 ininbitors, p53 ininbitors, VEGF ininbitors, VEGFR ininbitors, EGFR ininbitors and Her2neu ininbitors or heterodimers thereof, and PDGFR ininbitors.
Methods above described, preferably methods of treating/preventing a medical condition or methods of following progress of a therapeutic regimen are characterized in that said antibody comprises a heavy chain comprising the amino acid sequences of CDR-1, CDR-2, and CDR-3 wherein said heavy chain CDR's are selected from the group consisting of SEQ ID Nos. 8, 10 or 12, and a light chain comprising the amino acid sequences of CDR-1, CDR-2, and CDR-3, wherein said light chain CDR's are selected from the group consisting of SEQ ID Nos. 2, 4 or 6, or sequences having changes from said CDR sequences selected from the group consisting of conservative changes, wherein said conservative changes are selected from the group consisting of replacement of nonpolar residues by other nonpolar residues, replacement of polar charged residues by other polar uncharged residues, replacement of polar charged residues by other polar charged residues, and substitution of structurally similar residues; and non-conservative substitutions, wherein said non-conservative substitutions are selected from the group consisting of substitution of polar charged residue for polar uncharged residues and substitution of non-polar residues for polar residues, additions and deletions.
In another aspect of the invention, it is claimed a pharmaceutical composition for the treatment or prevention of a disorder in a mammal comprising an amount of a human anti-IGF-ER. antibody that is effective in treating said disorder and a pharmaceutically acceptable carrier, wherein said disorder is selected from the group consisting of breast cancer, prostate cancer cells, colorectal cancer cells, lung cancer cells, bladder cancer cells, kidney cancer cells, thyroid cancer cells, osteosarcomas cells, pancreatic cancer cells, and myeloid cells, wherein said antibody comprises the antibody of the invention above described and able to bind IGF-IR.
Another embodiment is a pharmaceutical composition for the treatment or prevention of a disorder in a mammal comprising an amount of a human anti-hybrid-R antibody that is effective in treating said disorder and a pharmaceutically acceptable carrier, wherein said disorder is selected from the group consisting of breast cancer and thyroid cancer, wherein said antibody comprises the antibody of the invention able to bind hybrid-R.
Another embodiment is also a pharmaceutical composition for the treatment or prevention of a disorder in a mammal comprising an amount of a human anti-IGF-IR and hybrid-R antibody that is effective in treating said disorder and a pharmaceutically acceptable carrier, wherein said disorder is selected from the group consisting of breast cancer and thyroid cancer, wherein said antibody comprises the antibody of the invention able to bind IGF-IR and hybrid-R.
Said pharmaceutical compositions) is further comprising an amount of anti-emetic, cancer vaccine, analgesic, anti-vascular agent, and anti-proliferative agent that, in combination with said antibody, is effective in treating said disorder.
The invention concerns, in another aspect, a method of detecting a binding partner for the antibody of the invention able to bind IGF-IR in a sample, the method comprising:
incubating the antibody of the invention able to bind IGF-IR with a biological
sample obtained from a patient with a cell proliferative disorder characterized by
abnormal level of expression and/or activation of human IGF-IR under conditions
sufficient to allow specific binding of the antibody to its binding partner, and
detecting specific binding, wherein specific binding indicates the presence of
a binding partner in the sampl
A second embodiment is a method of detecting a binding partner for the antibody of the invention able to bind hybrid-R in a sample, the method comprising:
incubating the antibody of the invention able to bind hybrid-R with a
biological sample obtained from a patient with a cell proliferative disorder characterized
by abnormal level of expression and/or activation of human hybrid-R under conditions
sufficient to allow specific binding of the antibody to its binding partner, and
detecting specific binding, wherein specific binding indicates the presence of
a binding partner in the sample.
A tinrd embodiment of the invention is a method of detecting binding partners for the antibody of the invention able to bind IGF-IR and hybrid-R in a sample, the method comprising:
incubating the antibody of the invention able to bind IGF-IR and hybrid-R
with a biological sample obtained from a patient with a cell proliferative disorder
characterized by abnormal level of expression and/or activation of both human IGF-IR
and hybrid-R under conditions sufficient to allow specific binding of the antibody to its
binding partner, and
detecting specific binding, wherein specific binding indicates the presence of
a binding partner in the sample.
The invention also deals with a method of purifying a hybrid receptor from a sample, the method comprising:
incubating the antibody of the invention able to bind hybrid-R with a sample
under conditions to allow specific binding of the antibody and the receptor, and
separating the antibody from the sample and obtaining the purified receptor.
A second embodiment is a method of purifying a IGF-IR from a sample, the method comprising:
incubating the antibody of the invention able to bind IGF-IR with a sample
under conditions to allow specific binding of the antibody and the receptor, and
separating the antibody from the sample and obtaining the purified receptor.
t least, it is also an object of the invention to protect the use of the biological data obtained according to one of the methods of the invention for the determination and/or modification of a therapeutic treatment or regimen.
Other characteristics and advantages of the invention appear in the continuation of the description with the examples and the figures whose legends are represented below.
LEGENDS TO THE FIGURES
Figure 1: Schematic representation of IGF-IR.
Figure 2: Scheme of the transduction of the signals mediated by IGF-IR during the
attachment of IGFs.
Figures 3A, 3B and 3C: Recognition of native IGF-IR expressed on the surface of
MCF-7 cells by the monoclonal antibody 7C10.
For tins experiment, the MCF-7 cells are incubated with the 7C10 antibody or with a
negative control antibody, then recovered with the aid of a fluorescent anti-species
secondary antibody. The labeling is read on a FACS. The first instogram (figure 3A)
corresponds to the MCF-7 cells alone. In the second instogram (figure 3B), the
unshaded curve corresponds to the nonspecific labeling by a control isotype murine
antibody. In the tinrd instogram (figure 3C), the unshaded curve shows the recognition
of IGF-IR by MAB 7C10.
Figures 4A, 4B and 4C: Labeling of Sf9 insect cells respectively expressing IGF-IR or
IR.
Figure 4A shows the labeling of nontransfected cells alone (1) or cells labeled with
control commercial monoclonal antibodies respectively recognizing IGF-IR (2) or IR
(3). In figure 4B, Sf9 cells uniquely expressing IGF-IR are labeled with oIR3 (2) or
anti-IR(3), the peak (1) representing the single cells, in figure 4C, Sf9 cells uniquely
expressing IR are labeled with an anti-IR (3) or oIR3 (2), the peak (1) representing the
single cells.
Figure 5: Ininbitor effect of 7C10 antibody on the proliferation of MCF-7 cells induced
by IGF-L
The MCF-7 cells are incubated in the presence of increasing concentrations of IGF 1 in the presence or in the absence of the MAB to be tested. The cell proliferation is evaluated by following the incorporation of 3H thymidine. The commercial antibody dOR.3 is used as a positive control of the experiment. The 7G3 is a murine anti-IGF-IR IgGl without activity on proliferation and used as a control isotype. Figures 6A, 6B and 6C:
figure 6A: in vivo effect of the monoclonal antibody 7C10 on the growth of
MCF-7 tumors established in nude mice;
figures 6B and 6C: figures respectively from publications of Arteaga et al. (J.
Clin. Invest, 84, 1418-1423, 1989) and from Li et al. (Cancer Immunol. Immunother.,
49, 243-252), and showing for figure 6B the effect of murine aJR.3 (likewise written
aIR3) and for figure 6C the effect of a recombinant scFv-Fc derived from the 1H7
antibody on tumor growth.
Figure 7: Comparative study of the effect of the MAb 7C10 and of tamoxifen on the growth in vivo of the tumor MCF-7.
Figures 8A, 8B, 8C and 8D: Study of the antitumor activity of the murine antibody 7C10 in different xenograft models of tumor cells in vivo.
Figure 8A shows the results obtained on an osteosarcoma model SK-ES-1, figure 8B concerns an androgen-independent tumor of the prostate DU-145, figure 8C a model of non-small cell tumor of the lung A549 and figure 8D a model of pancreatic cancer BxPC3. in these 4 models, the treatment was carried out twice per week i.p. at a rate of 250 /ig/dose/mouse. The curves 7G3, EC2 and 9G4 correspond respectively to three murine IgGl used as an experiment control isotype in each of the models. Figure 9: Study of the antitumor effect of the MAb 7C10 compared to navelbine (vinorelbine) as well as the synergy of the two compounds on the growth in vivo of the line A549.
Figure 10: Comparative activity of MAb oJR3, 7C10 and 1H7 on the IGF2 proliferation induced by MCF-7 cells.
Figure 11: Comparison of the murine 7C10 and cinmeric C7C10 MAb for the ininbition of the IGF1 proliferation of MCF-7 cells in vitro. The antibody 9G4 is a murine IgGl used as an experiment control isotype.
Figure 12: Comparative effect of the 7C10 and bJCIO MAb (humanized 1, written here 7H2HM) on the in vitro model of IGF 1-induced proliferation of MCF-7 cells. Figure 13: Effect of the 7C10 and h7C10 MAb (humanized 1, written here 7H2HM) on the transduction of the signal induced by IGF1. The first line of spots corresponds to the revelation, by an antiphospho-tyrosine antibody, of the phosphorylation of the immunoprecipitated j8 chain from the cells incubated in the presence of IGF1 alone or of IGF1 mixed with various antibodies to be tested. The 9G4 and the hlgGl are respectively the control isotypes of the forms 7C10 and h7C10 (likewise written 7H2HM). The second line of spots corresponds to the revelation of the j3 chain and shows that the quantity deposited in all of the wells is perfectly equivalent. Figure 14: Sequence of the cDNA (SEQ ID No. 48), of its complementary strand (SEQ ID No. 50) and its translation into amino acids (SEQ ID No. 49), of the PCR fragment amplified from the mouse hybridoma 7C10 with the primers MKV-1 and MKC and winch codes for the 3' end of the leader peptide and 7C10 VL.
Figure 15: Sequence of the cDNA (SEQ ID No. 51), of its complementary strand (SEQ ID No. 53) and its translation into amino acids (SEQ ID No. 52), of the PCR fragment amplified from the mouse hybridoma 7C10 with the primers MHV-12 and MHC-1, or MHV-8 and MHC-1 and winch codes for the 3' end of the leader peptide and 7C10 VH. Figure 16: Recognition of the IGF-I receptor by the cinmeric antibody 7C10, likewise called C7C10 (supernatant of cos7-transfected cell culture). Figure 17: Comparison of the amino acid sequence of mouse 7C10 VL (SEQ ID No.
54) with cells of other mouse antibodies having the greatest sequence homology.
The numbering of the amino acids is that of Kabat et al. (1991). The residues in the framework regions (outside CDRs) winch differ between 7C10 VL and Kabat mouse
>
subgroup II (SEQ ID No. 57) are underlined. A dot indicates that the residue is identical at tins position in comparison with the sequence of 7C10 VL. DRB 1-4.3 (SEQ ID No.
55) represents the sequence of the light chain of an anti-human mouse antibody MHC
CLASS II B-Chain (access number in the Kabat databank is N011794). C94-5B11'CL
(SEQ ID No. 56) represents the sequence of the light chain of a mouse antibody (access
number in the Kabat databank is P019314).
Figure 18: Comparison of amino acid sequences of mouse 7C10 VL (SEQ ID No. 54) with cells of human light chains belonging to Kabat human subgroup II (SEQ ID No. 60) and having the greatest sequence homology.
The amino acid sequences are aligned and compared with that of mouse 7C10 VL. A dot indicates that the residue is identical at tins position in comparison with the sequence of 7C10 VL. GM607 (SEQ ID No. 58) represents the sequence of the kappa light chain secreted by the human lymphoblastoid line GM607 (Klobeck et al., Nucleic Acids Res., 12:6995-7006, 1984a and Klobeck et al., Nature, 309:73-76, 1984b, the access number in the Kabat databank is N011606). DPK15/A19 (SEQ ID No. 59) represents the sequence of the human V germinal line kappa II.
Figure 19: Comparison of amino acid sequences of variable regions of the light chains (VL) of mouse 7C10 (SEQ ID No. 54), of human antibody GM 607 (SEQ ID No. 58) and of two versions of humanized 7C10 1 and 2 (SEQ ID Nos. 61 and 65).
The amino acid sequences are aligned and compared with that of mouse 7C10 VL. A dot indicates that the residue is identical at tins position in comparison with the sequence of 7C10 VL. GM607 represents the sequence of the kappa light chain secreted by the human lymphoblastoid line GM607 (Klobeck et al., 1984a and 1984b, access number in the Kabat database: N011606),
Figure 20: cDNA sequence (SEQ ID No. 62), its complementary strand (SEQ ID No. 64) and its translation into amino acids (SEQ ID No. 63), of the gene constructed by de novo assembly coding for the leader peptide and the humanized version 1 of 7C10 VL. Figure 21: cDNA sequence (SEQ ID No. 66), its complementary strand (SEQ ID No.
and its translation into amino acids (SEQ ID No. 67), of the gene constructed by de
novo assembly coding for the leader peptide and the humanized version 2 of 7C10 VL.
Figure 22: Comparison of the amino acid sequences of mouse 7C10 VH (SEQ ID No.
with those of human mouse heavy chains belonging to Kabat mouse subgroup I(A)
and having the greatest sequence homology.
The numbering of the amino acids is that of Kabat et al. (1991). The residues in the framework regions (outside CDRs) winch differ between 7C10 VH and Kabat mouse subgroup I(A) (SEQ ID No. 71) are underlined. A dot indicates that the residue is identical at tins position in comparison with the sequence of mouse 7C10 VH.
ANOS'CL (SEQ ID No. 70) represents the sequence of the heavy chain of a mouse antibody (access number in the Kabat databank: POO 1289).
Figure 23: Comparison of amino acid sequences of mouse 7C10 VH (SEQ ID No. 69) with those of human heavy chains belonging to the Kabat human subgroup II (SEQ ID No. 72) and having the greatest sequence homology.
The underlined residues are part of the canonical structures defined by Chotina et al. (1989). A dot indicates that the residue is identical at tins position in comparison with the mouse 7C10 VH sequence. Human VH FUR1 'CL (SEQ ID No. 73) represents the sequence of the heavy chain of a human anti-lamin B antibody IgM/K of autoimmune origin (Mariette et al., Arthritis and Rheumatism, 36:1315-1324, 1993; access number in Kabat: N020619). Human germline (SEQ ID No. 74) represents the sequence of the human germinal line 4.22 VH IV (Sanz et al., EMBO. J. 8:3741-3748, 1989).
Figure 24: Comparison of the amino acid sequences of the variable regions of the heavy chains (VH) of mouse 7C10 (SEQ ID No. 69) and of the three versions humanized by CDR-grafting humanized VH 1,2 and 3 (respectively SEQ ID Nos. 75, 79 and 83).
The numbering of the residues corresponds to that of Kabat. The sequences are aligned and compared with that of mouse 7C10 VH. A dot indicates that the residue is identical at tins position in comparison with the sequence of mouse 7C10 VH. Figure 25: cDNA sequence (SEQ ID No. 76), its complementary strand (SEQ ID No. 78) and its translation into amino acids (SEQ ID No. 77), of the gene constructed by de novo assembly coding for the leader peptide and the humanized version 1 of 7C10 VH. Figure 26: cDNA sequence (SEQ ID No. 80), its complementary strand (SEQ ID No. 82) and its translation into amino acids (SEQ ID No. 81), of the gene constructed by de novo assembly coding for the leader peptide and the humanized version 2 of 7C10 VH. Figure 27: cDNA sequence (SEQ ID No. 84), its complementary strand (SEQ ID No. 86) and its translation into amino acids (SEQ ID No. 85), of the gene constructed by de novo assembly coding for the leader peptide and the humanized version 3 of 7C10 VH. Figure 28: Comparison of the recognition activity of the IGF-I receptor by the cinmeric antibody 7C10 (called "C7C10") and its humanized version 1 (7C10 hum 1) in ELISA. Figure 29: Influence on the recognition activity of the IGF-I receptor of the humanized versions 1 and 2 of the light chain of the 7C10 antibody in ELISA.
Figure 30: Comparison of the recognition activity of the IGF-I receptor by the cinmeric
antibody 7C10 and three humanized versions of the heavy chain (7C10 hum 1, 2 and 3)
in combination with humanized 7C1O VL 2 in ELISA.
Figure 31: Antitumor activity of the 7C10 antibody in an orthotopic model A549.
Figures 32A, 32B, 32C and 32D: Study of the ADCC observed at the level of A549 and
MCF-7 cells cultured during 4 hours in the presence of the antibody 7H2HM
(respectively figures 32C and 32D). The antibody h4D5 is used in parallel as an
experiment positive control for the cells A549 and MCF-7 (respectively figures 32A
and 32B).
Figures 33A, 33B and 33C: Effects of the antibodies 7C10 and 7H2HM on the cell
cycle of the MCF-7 cells.
Figure 33 A represents the proportion of MCF-7 cells in the GO/G1, S and G2/M phase
in the absence of IGF1, expressed as a significant percentage of total MCF-7 cells
observed.
Figure 33B represents the proportion of MCF-7 cells in the GO/G1, S and G2/M phase
in the presence of IGF 1, expressed as a percentage of total MCF-7 cells observed.
Figure 33C represents the proportion of MCF-7 cells in the S (•) and G2/M (n) phase,
expressed as a percentage of total MCF-7 cells observed, in the presence of the
compounds indicated in the figure compared with a control sample in the absence of
IGF1 ("0").
Figures 34A and 34B: Comparative effect of the antibodies 7C10 and 7H2HM on the
growth of A549 cells in vitro (figure 34A) and on the growth of MCF-7 cells in vivo
(figure 34B).
Figures 35A and 35B: Study of the synergy of the antibody 7H2HM combined with
navelbine (NA) on the model A549 in vivo, compared with the control samples. Figure
35A represents the development of the volume of the implanted tumor as a function of
the treatment carried out starting from the commencement of the treatment and over
approximately 50 days (figure 35A). Figure 35B represents in a particular manner the
results obtained for tins development compared at approximately 48 days. In tins figure,
the results obtained with the antibody 7C10 have been introduced by way of
comparison (the asterisks (*) correspond to the comparison control group/group (7C10
+ Na) or control group/group (7H2HM + Na) in a t-test).
Figure 36: Study of the effect of the antibodies 7C10 and 7H2HM on apoptosis.
Tins figure represents the potentiation of the effect of doxorubicin by the antibodies 7C10 and 7H2HM (doxorubicin 2 /ig/ml).
Figures 37A to 37D: Demonstration by labeling in FACS of the presence of EGFR and of IGF-IR on the surface of A549 cells.
Figure 38: Effect of a coadministration of the MAB 7C10 and 225 on the in vivo growth of the tumor A549.
Figure 39: Effect of a coadministration of the MAB 7C10 and 225 on the survival of mice orthotopically implanted with A549 cells.
Figures 40A and 40B: Demonstration of the ininbition of tyrosine phosphorylation of the beta chain of IGF-IR and of IRS-1 by the MAB 7C10 and 7H2HM. Figure 41: Demonstration of the induction of the internalization of IGF-IR by the MAB 7C10 and 7H2HM.
Figures 42A to 42C: Demonstration of the degradation of IGF-IR by the MAB 7C10 and 7H2HM.
Figures 43A and 43B: Immuno-blotting with an anti-IGF-IR β-subunit and anti-IR β-subunit on filters containing cellular lysates obtained after immunoprecipitation and SDS-PAGE for two independent experiments (A and B).
Figure 44: Immunocapture of R+ cell lysates IGF-IR in Maxisorb plates coated with 17-69 antibody and binding by 125I-IGF1 in the absence or the presence of increasing concentrations of unlabeled ligand (IGF-I) or antibodies (7C10, h7C10,1H7, 9G4). Figure 45: Immunocapture of R-/IR-A cell lysates Hybrid-RA in Maxisorb plates coated with 83-7 antibody and binding by 125I-IGF1 in the absence or the presence of increasing concentrations of unlabeled ligand (IGF-I) or antibodies (7C10, h7C10, 1H7, 9G4).
Figure 46: Immunocapture of R-/IR-B cell lysates Hybrid-RB in Maxisorb plates coated with 83-7 antibody and binding by 125I-IGF1 in the absence or the presence of increasing concentrations of unlabeled ligand (IGF-I) or antibodies (7C10, h7C10, 1H7, 9G4).
Figures 47 A and 47B: Immuno-blotting analysis of antibody induced degradation of the IGF-IR in A549 (A) and MCF-7 (B) cells.
Figure 48: Immune-blotting analysis of antibody degradation pathway of IGF-IR in
MCF-7 cells.
Figure 49: Anti-tumoral activity of the murine antibody 7C10 co-administrated with an
anti-VEGF antibody on mice ortfiopically implanted with A549 cells.
Figures 50 and 51: Comparison of the in vivo anti-tumoral activity of the 7C10 and
h7C10 antibodies on the A549 (figure 50) and MCF-7 (figure 51) models.
Figures 52 and 53: Comparison of the anti-leukaemia activity of vinblastine and
vincristine (figure 52) and of 4'R and 4'S deoxyvinblastines(figure 53).
Figure 54: In vivo antitumor activity of 4' R- and 4' S-deoxyvinblastines conjμgated
with IGR-IR antibodies on human tumors of various origins.
Figure 55: Schematic representation of the biosensor capturing assay. A Mab directed
against the constant Fc portion of either mouse or human IgGl were covalently attached
onto a CMS sensor surface. A limited amount (400 RU) of Mab to be tested were
immobilized and used to capture the analyte inGF-IR. The binding of Mab to the
analyte is described by the association and dissociation rate constants ka and kd,
respectively.
Figures 56A, 56B and 56C: Determination of h7C10 IC50 in the IGF1 induced
proliferative assay. Results are expressed as proliferative indexes in panel A. Panel B
shows an example of ICso calculation and panel C summarizes the ICso data obtained
with 5 different batches of h7C10 antibody.
Figures 57A, 57B, 57C and 57D: 7C10 causes rapid down-regulation of IGF-IR via the
proteasome pathway (fig. 57A). Lysosomal/endosomal pathways (figs. 57B and 57C)
seem also to be involved in the antibody-induced down-regulation. Panel (fig. 57D)
shows the low recovery of the IGF-IR after antibody treatment. In these figures 9G4
and 7G3 Mabs are respectively a irrelevant IgGl antibody and an non neutralizing anti-
IGF-IR antibody (IgGl isotype).
Figure 58: staining of either tumoral or normal tissues from lung and breast cancer
patients. Comparison with tissues from normal regions.
Figure 59: h7C10 down regulation of IGF-IR in vivo. Nine Swiss Nude mice bearing a
MCF-7 xenograft tumor were studied. Tumors from 3 mice were removed before
treatment (lanes 1-3), 3 mice were treated with h7C10 (lanes 4-6) and 3 mice received a
human isotype control (IgGl). Lane 9 is not interpretable because of the low amount of
protein loaded (CK19).
Figures 60A, 60B, 60C: Determination of h7C10 IC50in theIGF2 induced proliferative assay. Results are expressed as proliferative indexes in panel A. Panel B shows an example of ICjo calculation and panel C summarizes the ICso data obtained with 5 different batches of h7C10 antibody.
Example 1: Generation and selection of the murine monoclonal antibody (MAb)
With the aim of generating MAb specifically directed against IGF-IR and not recognizing the IR, a protocol comprising 6 screening stages was envisaged. It consisted in:
immunizing mice with recombinant IGF-IR, in order to generate hybridomas,
screening the culture supernatants by ELISA on the recombinant protein winch
served for immunization,
testing all the supernatants of hybridomas positive by ELISA on the native
receptor overexpressed on the surface of MCF-7 tumor cells,
evaluating the supernatants of hybridomas positive in the two first screenings
in terms of differential recognition of IGF-IR and of IR on insect cells infected with
baculoviruses respectively expressing IGF-IR or IR,
verifying that the antibodies selected at tins stage were capable of ininbiting in
vitro the induced IGF1 proliferation of the MCF-7 cells,
ensuring the in vivo activity, in nude mice, of the candidate retained in terms of
impact on the growth of the tumor MCF-7.
All of these different stages and results obtained will be briefly described below in example 1.
For the immunization stage, mice were injected twice, by the subcutaneous route, with 8 /zg of recombinant IGF-IR. Three days before the fusion of the cells of the female rat with the cells of the murine myeloma Sp2OAgl4, the mice were stimulated by an intravenous injection of 3 /zg of the recombinant receptor. Fourteen days after the fusion, the supernatants of hybridomas were screened by ELISA, on plates sensitized by recombinant IGF-IR. The hybridomas whose supernatants were found positive were conserved and amplified before being tested on the FACScan so as to verify that the antibodies produced were likewise capable of recognizing native IGF-IR. in order to do
tins, MCF-7 cells from an estrogen-dependent rumor of the breast overexpressing IGF-IR were incubated with each of the culture supernatants produced by the hybridomas selected in ELISA. The native/MAb receptor complexes on the surface of the cell were revealed by a secondary anti-species antibody coupled to a fluorochrome. Figures 3A to 3C show a instogram type obtained with the supernatant of the hybridoma 7C10 (figure 3C) compared with a cell labeling alone + secondary antibody (figure 3 A) or with a labeling utilizing a control isotype (figure 3B).
At tins stage of the selection, only the hybridomas secreting MAb at the same time recognizing the recombinant receptor and the native receptor were selected and cloned. The MAb secreted by these hybridomas were produced and then purified before being tested on the FACScan, according to the method described above, on Sf9 insect cells expressing IGF-IR or IR in order to eliminate the hybridomas at the same time recognizing the two receptors. Figure 4A shows a total recovery of the instograms 1, 2, 3 respectively corresponding to the nonirifected cells + secondary antibodies (1), to the noninfected cells labeled by cdR3 + secondary antibodies (2) and to the noninfected cells labeled by an anti-IR antibody + secondary antibodies (3). Tins first result shows well the absence of IGF-IR and of IR detectable on the surface of these noninfected insect cells. Figure 4B shows a labeling of infected cells by a baculovirus expressing IGF-IR. In tins second figure, the o!R3, used as a positive control, labels well, as expected, the cells (peak 2), winle the anti-IR (peak 3) is superimposed on the peak of single cells. Finally, in figure 4C, it is shown that the anti-IR labels well, as expected, the Sf9 cells expressing the IR (peak 3), but in an unexpected manner, the oIR3 described in the literature as specific for IGF-IR seems likewise to recognize the IR (peak 2).
The results obtained in tins tinrd screening system are summarized in table 1 and show the generation of an MAb: 7C10, satisfying the criteria of recognition of the IGF-IR and of nonrecognition of the IR. The isotyping of the Mab 7C10 has shown that it involves anlgGl.
TABLE 1: Comparative reactivity of MAb 7C10 on Sf9 insect cells expressing IGF-IR or IR (Table Removed)
The two last screenings provided for the selection of the MAb consisted in verifying that the latter was very capable of ininbiting the cell proliferation induced by the IGF1 in vitro and in vivo on the cell line MCF-7.
For the in vitro selection, the MCF-7 cells were inoculated, deprived of fetal calf serum, then incubated in the presence of increasing concentrations of IGF1 (from 1 to 50 ng/ml) in the presence or in the absence of the 7C10 antibody to be tested added to a final concentration of 10 jμg/ml. In tins experiment, the commercial oIR3 MAb was introduced as a positive control and the 7G3 MAb (isolated in parallel to the 7C10 and weakly recognizing the native receptor (MFI on the FACS of 50 compared with 200 for the MAb 7C10)) as a control isotype. The cell proliferation is estimated by following on the /3 counter the incorporation of tritiated thymidine by the cells. The results are expressed as a proliferative index. The data presented in figure 5 show that IGF1 is capable of stimulating in a dose-dependent manner the proliferation of the MCF-7 cells. The MAb oIR3, used as a positive control, completely ininbits the proliferation of the MCF-7 cells induced by the IGF-I. In the same manner, the MAb 7C10 significantly ininbits the growth of the MCF-7 cells induced by IGF-I. Finally, the MAb 7G3 used as an isotype control turns out well, as expected, without effect on the tumor cell growth in vitro of the MCF-7 cell.
The in vivo selection was carried out in an established tumor model. In order to do tins, nude mice received a subcutaneous implant of slow-release estrogen, indispensable for the taking of the tumor in a murine model. Twenty-four hours after implantation of the estrogens, 5.106 MCF-7 cells are grafted onto the right flank of the mouse subcutaneously. Five days after tins cell graft, the tumors are measurable and batches of 6 mice are formed at random. The treatment of the mice is carried out twice per week, during 5 to 6 weeks, at the dose of 250 /jg/dose/mouse. In the control group, the mice are treated in the same fasinon with a murine control isotype. The results presented in figure 6A show a very significant ininbition of the tumor growth induced by the antibody 7C10. Tins activity is particularly unexpected if reference is made to the data available concerning oIR3, always used as a reference in the domain of the receptor for IGF1, and known for not having any activity in vivo on the growth of estrogen-dependent tumors (see figure 6B). In the same way, compared with the results obtained with the recombinant antibody scFv-Fc derived from the murine MAb 1H7 (see figure 6C), the MAb 7C10 is much more efficacious in the in vivo ininbition of the growth of the MCF-7 cells. Tins difference of activity could be relaty, winthout any limitation, to some particular properties of 7C10 and h7C10 antibodies winch recognize the hybrid-R, isoform(s) A and/or B, (see example 26). Another non exclusive hypothesis could be the recognition by these antibodies of the atypical IGF-IR as described in the paper of Siddle et al. (Siddle et al., 1994, Horn Res. 41(suppl. 2):56-65).
Equilibrium dissociation constants (Ko) of a series of 7C10 and h7C10 antibodies directed against the extracellular domain of human insulin-like growth factor-1 receptor (inGF-IR) were calculated by the ratio between dissociation and association rate constants, as defined by surface plasmon resonance using a BIAcore X instrument. Capture of the investigated antibodies was used to favour a proper presentation of their antigen-binding site (Figure 55). Therefore, a mixture of goat anti-human IgG Fc and rabbit anti-mouse IgG Fc polyclonal antibodies were covalently linked on both flowcells (FC1 and FC2) of a CMS sensorcinp. Typically 300 to 400 resonance units (RU) of each anti-hlGFl-R Mab were captured on FC2 (FC1 being a reference cell to evaluate non specific interactions of the analyte with the matrix). The
analyte, corresponding to the extracellular domain of hlGFl-R, was tested at 5 different concentrations ranging from 12.5 to 200 nM at 25°C at a flow rate of 30 uVmin. Under tins experimental set-up, a mean kd of 0.86 ± 0.09 nM was obtained for 3 different batches of A2CHM Mab. These values were closed to that obtained for the mouse Mab 7C10 (KD: 0.86 ± 0.14 nM) Table 2.
TABLE 2 : Kinetic rate constants and equilibrium dissociation constant for the interaction of inGF-IR with a series of immobilized monoclonal antibodies
(Table Removed)Rate constants ka and kd were determined for each data set by using the global fitting algorithm described in the BIA evaluation 3.1 software and based on a 1:1 Langmuir binding model without incorporating a mass transport term. Quality of the global fitting to the experimental data is indicated by the x,2 value. * The 95% confidence intervals of the kinetic rates were calculated using the formula SE = o/31/2x 2.920.
** The confidence intervals of the kd were calculated using the formula SE(KD) = [SE(ka) x kd + ka x SE(kd)j / ka2.
Example 2: Comparison of the effect of 7C10 and of tamoxifen on the in vivo growth of the tumor MCF-7
With the aim of determining the effectiveness of the treatment by the antibody 7C10 in the context of estrogen-dependent cancer of the breast, 7C10 was compared with the tamoxifen compound currently used for the treatment of mammary carcinoma in the context of developed forms with local and/or metastatic progression and in the context of the prevention of recurrences (see VIDAL 2000, pages 1975-1976).
In hormone-dependent cancers of the breast, a significant correlation exists between the expression of the receptors for estrogens (ER) and that of the IGF-IR (Surmacz E. et al., Breast Cancer Res. Treat., Feb., 47(3):255-267, 1998). Furthermore, it seems that the estrogens (E2) act in synergy with IGF1 (sometimes written IGF-I or IGFI) in order to stimulate cell proliferation. It has in effect been shown that a treatment with E2 increases by approximately 10 times the mRNA level of IGF-IR as well as the expression level of the protein (Lee A.V. et al., Mol. Endocrinol., May, 13(5):787-796, 1999). Tins increase is manifested by a significant increase in the phosphorylation of the IGF-IR. In addition, the E2 significantly stimulates the expression of IRS-1 ("IRS-1" for "Insulin Receptor Substrate-1") winch is one of the substrates of the phosphorylated IGF-IR.
Tamoxifen has been widely used for many years in hormone therapy for the treatment of patients suffering from E2-dependent breast cancers (Forbes J.F., Semin. OncoL, Feb., 24 (1st Suppl. l):Sl-5-Sl-19, 1997). Tins molecule enters into competition with the estradiol and ininbits the attachment of tins to its receptor (Jordan V.C., Breast Cancer Res. Treat., 31(l):41-52, 1994). It has in addition been demonstrated that tamoxifen is capable of ininbiting the IGF-IR-dependent proliferation by ininbiting the expression of the receptor and its phosphorylation (Guvakova M. A. et al., Cancer Res., July 1, 57(13):2606-2610, 1997). These data as a wliole seem to indicate that IGF-IR is an important mediator of the proliferation induced ~by the E2/ER interaction.
The long-term use of tamoxifen is associated with a significant increase in the risk of endometrial cancer (Fisher et al., J. of National Cancer Institute, 86, 7:527-537, 1994; VIDAL 2000, 1975-1976) and of collateral recurrence of E2-independent cancer of the breast (Li C.I. et al., J. Natl. Cancer Inst., July 4, 93(13):1008-1013, 2001). In tins
context, a comparison of the in vivo antitumor effect of the antibody 7C10 and of tamoxifen has been carried out on the MCF-7 model so as to determine the part of the activity connected with IGF-IR in the mediated ER proliferation. In order to do tins, 7.106 MCF-7 cells were implanted sc (subcutaneously) in nude mice, 24 hours after implantation in these same mice of a grain of estradiol with prolonged release (0.72 nig/tablet liberated over 60 days), indispensable for the establishment of any E2-dependent human rumor in tins animal species. Five days after tins implantation, the tumors are measured and groups of 6 mice are formed. These groups are treated respectively with 1) the 7C10 antibody injected ip (intraperitoneally) at a rate of 250 jμg/mouse, twice per week, 2) 10 [ig of tamoxifen taken in PBS containing 3% of hydroxypropyl-cellulose (HPC) ip or 3) the solvent in winch the tamoxifen is taken up (hydroxypropylcellulose). The tamoxifen is administered daily for 4 weeks except at the weekend. The mice treated with the MAb 7C10 likewise daily receive an injection of PBS with 3% HPC. A study was previously carried out in order to verify that the solvent alone is without influence on the tumor growth.
The results presented in figure 7 shown that the MAb 7C10 is capable of significantly ininbiting the growth of the tumor MCF-7 in vivo (the asterisks (*) correspond to the comparison control group/7C10 group in a t-test). In a surprising fasinon, the antibody 7C10 seems to be significantly more efficacious than tamoxifen for the ininbition of the tumor growth (the circles (°) correspond to the comparison tamoxifen group/7C10 group in a t-test) sμggesting that tins type of treatment by MAB might be substituted for treatment with tamoxifen.
Example 3: Demonstration of the antitumor activity of the MAb 7C10 in vivo on human tumors of different origins
a) In vivo activity of the antibody 7C10 in 4 tumor models In order to generalize the activity of the 7C10 antibody to other rumors expressing the receptor for IGF1, 7C10 was tested in vivo in an androgen-independent model of tumor of the prostate DU145 (likewise written DU-145), in an SKES-1 osteosarcoma model, in a model of non-small cell tumor of the lung A549 and in a model of pancreatic cancer BxPC3. The protocol is comparable to that described above for MCF-7 and the results presented in figures 8A to 8D show a significant activity of
tins MAB in the 4 tumor models. The activity observed in the model of tumor of the prostate is to be noted very particularly inasmuch as the single chain scFv of the MAB 1H7 is without activity in an androgen-independent model of tumor of the prostate (Li et al., 2000).
b) In vivo activity of the antibody 7C10 in an orthotopic model A549 The conventional xenograft models as described above do not allow the study of drμgs on metastatic dissemination. In effect, the tumors implanted s.c. (subcutaneously) remain localized at the sight of injection and are therefore not really a reflection of the situation in man. In order to evaluate our antibody in a model closer to reality, the A549 cells were implanted in an intrapleural location. Tins model, winch is well described (Clin. Cancer Res., 2000, Jan. 6(1):297-304) allows a metastatic dissemination close to that observed in man to be observed, with mediastinal, pulmonary, cardiac and vertebral metas-tases. In the study winch was carried out, 106 A549 cells were injected intrapleurally into female nude mice. 7 days after implantation, the mice were divided into 2 batches of 22. One of these batches received a challenge dose of 500 /jg/mouse and was then treated twice per week at a rate of 250 /ig of 7C10/dose. The second batch was treated according to the same scheme with the control isotype 9G4. Figure 31 shows a significant extension of survival in the mice treated with the MAB 7C10 indicating that tins antibody is capable of having an action on metastatic dissemination.
Example 4: Comparison of the MAb 7C10 with navelbine In vivo:, effect of a coadministration of the two treatments
Navelbine is a chemotherapy compound indicated in non-small cell cancer of the lung and in metastatic cancer of the breast. The comparative study of 7C10 and of navelbine and the possible synergy between the two products was studied on the tumor model A549. For tins study, 5.106 A549 cells were grafted subcutaneously on the right flank of the mouse. Five days after the cell graft, the tumors are measurable and the treatments with MAb and/or navelbine are commenced. The MAb dose is always 250 jμg/dose/mouse, twice per week, intra-peritoneally. Concerning navelbine, it will be administered at the maximum dose tolerated by the mouse or 10 mg/lcg, intraperitoneally. For tins treatment three injections will be carried out at intervals of 7 days. During the coadministrations, the two products are mixed before injection.
The results presented in figure 9 show in a surprising fasinon that, in tins model, the antibody 7C10 is as active as the conventional treatment with navelbine. A very significant synergy of the two products is likewise observed with five mice out of seven not having measurable tumors on day 72.
Example 5: Study of the in vitro ininbition of the IGF2-induced growth of the MCF-7 tumors
As indicated above, IGF-IR is overexpressed by numerous tumors but it has furthermore been described that in a good part of the cancers of the breast and of the colon especially, the proliferation signal is given to tins receptor via IGF2 (sometimes written IGF-II or IGFII). It is therefore essential to ensure that the MAb 7C10 is likewise capable of ininbiting the IGF2 growth induced on the MCF-7 tumor in vitro, in order to do tins, cells were inoculated into 96-well plates, deprived of fetal calf serum and stimulated by the addition of 200 ng of IGF2 per ml, final concentration, of medium, in the presence and in the absence of the MAb to be tested introduced at a concentration of 10 /tg/ml. The results presented in figure 10 show that IGF2, like IGFl, significantly stimulates the growth of MCF-7 cells. The addition of a control isotype, 9G4, remains without effect on tins stimulation. As already described by De Leon et al. (Growth Factors, 6:327-334, 1992), no effect is observed during the addition of the MAb oIR3. On the other hand, 7C10 totally ininbits the growth induced by IGF2. Its activity is significantly better than that of 1H7.
Example 6: Biological activity of the cinmeric 7C10 (C7C10) and humanized (h7C10) antibodies 7C10
a) 7C10/C7C10 and 7C10/h7C 10 comparison on the MCF-7 model in vitro The cinmeric form of the MAb 7C10 and the purified humanized form 1 (written here 7H2HM) were tested in vitro in the MCF-7 model as described above. The results presented respectively in figures 11 and 12 show that these two forms have perfectly preserved their properties of ininbiting the IGFl-induced growth of the MCF-7 tumor.
To determine the ICso values of the h7C10 antibody a dose range of antibodies from various batches has been tested in vitro in the IGFl induced proliferative assay.
The results described in Figure 56 demonstrate that all the tested batches are comparable and display and ICso value close to 0.3 nM. These data are in agreement with the kd values determined by Biacore analysis and described at the end of example 1.
To determine the ICso values of the h7C10 antibody a dose range of antibodies from various batches has been tested in vitro in the IGF2 induced proliferative assay. The results described in Figure 60 demonstrate that all the tested batches are comparable and display and ICso value close to 0.3 nM. These ICso values are close to the one obtained in the IGF1 induced proliferative assay described above.
b) Comparative effect of the MAb 7C10 and h7C10 on the transduction of the
signal induced by the attachment of IGF 1 to its receptor
The activity of the ininbition of the IGF1 growth induced in vitro on the line MCF-7 oμght to be the translation of an ininbition of the transduction of the signal mediated by IGF1 during the attachment of the MAb 7C10 to the receptor. In order to verify tins hypothesis, MCF-7 cells were incubated with or without IGF1, in the presence or in the absence of the antibodies to be tested. After a short incubation time, the cells were lyzed, the /3 chain immunoprecipitated and the phosphorylation of tins subunit estimated with the aid of an antiphosphotyrosine kinase antibody. The results presented in figure 13 show that the attachment of the 7C10 or of the h7C10 significantly ininbits the phosphorylation of the /? subunit of IGF-IR contrary to an irrelevant murine (9G4) or human antibody (written IgGl on the scheme).
c) Involvement of the 7H2HM antibody in the mechanisms of ADCC
The ininbition of the transduction of the signal described above in paragraph b) is the principal mechanism of action involved in the biological activity of the antibodies 7C10 and 7H2HM. It is, however, probable that during its administration in man, the antibody 7H2HM, of isotype IgGl, is capable of inducing cell lysis by a mechanism of ADCC type (Antibody Dependent Cellular Cytotoxicity). In order to verify tins point, NIC (Natural Killer) cells coming from the peripheral blood of human donors are placed in the presence of A549 or MCF-7 cells previously incubated for 4 hours with 10 fJLg of 7H2HM antibody per 5.10s cells and labeled with 51Cr (50 jμg). In tins experiment, herceptin (written h4D5 on figures 32A and 32B) is used as an experiment positive control. Figures 32A to 32D show that, as expected, herceptin induces a significant
ADCC on the two cells A549 and MCF-7 (see respectively figures 32A and 32B). 7H2HM is likewise capable of inducing an ADCC on the A549 cells (see figure 32C), but tins phenomenon is of smaller amplitude on the MCF-7 cells (see figure 32D).
Regarding the present example, it would be evident for a man skilled in the art to test, in the same way, other effector functions such as, for example, CDC.
d) Effects of the antibodies 7C10 and 7H2HM on the cell cycle
The ininbition of the cell growth observed in vitro on the line MCF-7 should be manifested by an effect on the cell cycle. In order to reply to tins question, 4.105 cells are inoculated into 6-well plates. 24 hours after inoculation, the calf serum is removed and IGF1 added in the presence or in the absence of the antibodies to be tested. After incubation for 24 hours, the cells are recovered for the study of the cell cycle. Figure 33B demonstrates the effect of IGF1 on the entry into the cycle and the growth of the MCF-7 cells compared with the entry into the cycle and the growth of the MCF-7 cells in the absence of IGF1 (see figure 3 3A). After addition of the growth factor, a significant decrease in the GO/G1 phase (from 88.2% to 56.3%) to the benefit of the S (from 7.8% to 31%) and G2/M (from 4% to 12.7%) phases is observed. During the addition of the antibodies 7C10 and 7H2HM (see figure 33C), a significant ininbition of the entry into the cycle is observed, in it is to be noted that the murine antibody and its humanized homolog have a comparable activity on the cell cycle. The oIR3, introduced as a positive control, seems slightly less active than the 7C10 and the 7H2HM in tins test. The antibody 9G4 used as a control isotype is without effect on the cell cycle.
e) Comparative activity in vivo of the antibodies 7C10 and 7H2HM on the
model A549
in order to confirm the activity of the humanized antibody 7H2HM in vivo, the latter was compared with 7C10 in the model of non-small cell tumor of the lung A549. Tins experiment was carried out exactly as described above except for the dose of antibody winch is 125 jttg/dose twice per week in place of 250 ^tg/dose twice per week and that of the fact of the nonavailability of great quantities of 7H2HM. The antibody 9G4 was used as an isotype control for 7C10 and an irrelevant human immunoglobulin of isotype IgGl (below called ingGI) was used as a control for the humanized antibody 7H2HM.
Figure 34A shows that there are no significant differences between the 9G4 and ingGI control curves. As expected, a significant ininbition of the tumor growth is observed with the murine antibody 7C10. Concerning the humanized antibody 7H2HM, the activity observed is of exactly the same intensity as that observed with its murine counterpart. Tins data, in addition to the observations described above in vitro, indicates that the humanization has not modified the properties of the antibody generated. On the other hand, in the xenograft models in the mouse, the activity of the humanized antibody seems to be integrally connected with a mechanism of ininbition of the transduction of the signal. In effect, if an ADCC part was in play in the ininbition of the tumor growth in the Nude mouse, a difference oμght to be observed between the activity of the murine and humanized antibodies.
An in vivo experiment was likewise carried out on the MCF-7 breast tumor model and shows that, as expected, the antibody 7H2HM is perfectly comparable with the murine antibody 7C10 for the ininbition of the growth of tins tumor in vivo (figure 34B).
f) Demonstration of a synergy between the 7H2HM and navelbine
The protocol described in example 4 was repeated with the aim of reproducing the results obtained with 7C10 with its humanized homolog: the antibody 7H2HM.
The results presented in figures 35A and 35B show that, as in the case of 7C10, a significant synergy is demonstrated between the humanized antibody 7H2HM and navelbine.
g) Effect of the antibodies 7C10 and 7H2HM on the apoptosis of MCF-7 cells
in vitro
As indicated above, IGF-IR is capable of conferring protection against apoptosis when it is overexpressed on the surface of cells. Furthermore, it has been demonstrated in these examples that the antibodies 7C10 and 7H2HM were capable of potentiating an active compound in chemotherapy, in order to test the power of the antibodies 7C10 and 7H2HM to induce apoptosis, and to explain in part their synergy potential with the chemotherapy, experiments were conducted on the MCF-7 cells in the presence or in the absence of doxorubicin, a medicament known to induce the apoptosis of tins cell line in vitro, in these experiments, the MCF-7 cells are inoculated at 2.104/cm2 in Petri dishes and cultured for 24 h in RPMI without phenol red supplemented with 10% of
Table 4 for light chains). These primers were compiled from a large number of mouse antibody sequences found in the databanks (Jones S.T. et al., Bio/Technology 9:88-89, 1991). The primers corresponding to the 3' ends hybridize in the constant regions of the heavy chains (Cin domain of the subclass IgGl, not far from the V-C junction, MHC-1 primer Table 5) and light chains (Kappa domain not far from the V-C junction, MKC primer Table 5).
TABLE 3: Oligonucleotide primers for the 5' region of the variable domains of the heavy chains of mouse immunoglobulin (MHV) ("MHV" for "Mouse Heavy Variable")
MHV-1: 5' ATGAAATGCAGCTGGGTCATSTTCTT 3' (SEQ ID No. 13)
MHV-2: 5' ATGGGATGGAGCTRTATCATSYTCTT 3' (SEQ ID No. 14)
MHV-3: 5' ATGAAGWTGTGGTTAAACTGGGTTTT 3' (SEQ ID No. 15)
MHV-4: 5' ATGRACTTTGGGYTCAGCTTGRT 3' (SEQ ID No. 16)
MHV-5: 5' ATGGACTCCAGGCTCAATTTAGTTTT 3' (SEQ ID No. 17)
MHV-6: 5' ATGGCTGTCYTRGSGCTRCTCTTCTG 3' (SEQ ID No. 18)
MHV-7: 5' ATGGRATGGAGCKGGRTCTTTMTCTT 3' (SEQ ID No. 19)
MHV-8: 5'ATGAGAGTGCTGATTCTTTTGTG 3' (SEQ ID No. 20)
MHV-9: 5' ATGGMTTGGGTGTGGAMCTTGCTATT 3' (SEQ ID No. 21)
MHV-10: 5' ATGGGCAGACTTACATTCTCATTCCT 3' (SEQ ID No. 22)
MHV-11: 5' ATGGATTTTGGGCTGATTTTTTTTATTG 3' (SEQ ID No. 23)
MHV-12: 5' ATGATGGTGTTAAGTCTTCTGTACCT 3' (SEQ ID No. 24)
NB KEY: R=A/G,Y=T/C,W=A/T,K=T/G,M=A/C,S=C/G.
TABLE 4: Oligonucleotide primers for the 5' region of the variable domains of kappa (light) chains of mouse immunoglobulin (MKV) ("MKV" for "Mouse Kappa Variable")
MKV-1: 5' ATGAAGTTGCCTGTTAGGCTGTTGGTGCT 3' (SEQ ID No. 25)
MKV-2: 5' ATGGAGWCAGACACACTCCTGYTATGGGT 3' (SEQ ID No. 26)
MKV-3: 5' ATGAGTGTGCTCACTCAGGTCCT 3' (SEQ ID No. 27)
MKV-4: 5' ATGAGGRCCCCTGCTCAGWTTYTTGG 3' (SEQ ID No. 28)
MKV-5: 5' ATGGATTTWCAGGTGCAGATTWTCAGCTT 3' (SEQ ID No. 29)
MKV-5A: 5' ATGGATTTWCARGTGCAGATTWTCAGCTT 3' (SEQ ID No. 30)
MKV-6: 5' ATGAGGTKCYYTGYTSAGYTYCTGRG 3' (SEQ ID No. 31)
MKV-7: 5' ATGGGCWTCAAGATGGAGTCACA 3' (SEQ ID No. 32)
MKV-8: 5' ATGTGGGGAYCTKTTTYCMMTTTTTCAAT 3' (SEQ ID No. 33)
MKV-9: 5' ATGGTRTCCWCASCTCAGTTCCTT 3' (SEQ ID No. 34)
MKV-10: 5' ATGTATATATGTTTGTTGTCTATTTC 3' (SEQ ID No. 35)
MKV-11: 5' ATGGAAGCCCCAGCTCAGCTTCTCTT 3' (SEQ ID No. 36) MKV-12A: 5' ATGRAGTYWCAGACCCAGGTCTTYRT 3' (SEQ ID No. 37) MKV-12B: 5' ATGGAGACACATTCTCAGGTCTTTGT 3' (SEQ ID No. 38) MKV-13: 5' ATGGATTCACAGGCCCAGGTTCTTAT 3' (SEQ ID No. 39) NB KEY: R=A/G,Y=T/C,W=A/T,K=T/G,M=A/C,S=C/G.
TABLE 5: Oligonucleotide primers for the 3' ends of the mouse vh and vl genes
Light chain (MKC):
5' ACTGGATGGTGGGAAGATGG 3' (SEQ ID No. 40)
Constant region of the mouse Kappa domain:
ADAAPTVSIFPPSS (SEQ ID No. 41) GCT GAT GCT GCA CCA ACT GTA TCC ATC TTC CCA CCA TCC AGT(SEQ ID No. 42)
II Ml IN III Ml III Ml
(MKC) CC ATC TTC CCA CCA TCC AGT (SEQ ID No. 43)
Heavy chain (MHC-1)
5' CCAGTGGATAGACAGATG 3' (SEQ ID No. 44)
Cin domain of mouse gamma-1 (IgGl subclass):
AKTTPPSVYPL (SEQ ID No. 46)
GCC AAA ACG ACA CCC CCA TCT GTC TAT CCA CTG (SEQ ID No. 45)
Ml III III III Ml III III
(MHC-1) CCC CCA TCT GTC TAT CCA CTG (SEQ ID No. 47)
Example 8: Sequences of immunoglobulins cloned from the mouse hybridoma 7C10
By following the amplification strategy described above, PCR products corresponding to the variable regions of the heavy (VH) and light (VL) chains were cloned by using the "pGEM®-T Easy Vector Systems" (Promega). For 7C10 VL, PCR products were obtained with the MKC primer in combination with the MKV1 and MKV2 primers. For 7C10 VH, PCR products were obtained with the MHC-1 primer in combination with the MHV8 and MHV12 primers. A thoroμgh sequencing of the PCR products cloned in the pGem-T easy vectors revealed two different sequences for the light chain and one unique sequence for the heavy chain.
a) Variable region isolated from the oligo MKV1
The DNA sequence obtained is characteristic of a variable region of functional Ig. Tins novel sequence is therefore presumed to be that coding for 7C10 VL. The DNA (SEQ ID Nos. 48 and 50) and amino acid (SEQ ID No. 49) sequences of the cDNA coding for 7C10 VL are represented in figure 14.
b) Variable region isolated from the oligo MKV2
The gene coding for tins light chain comes from an aberrant mRNA transcript winch is present in all the standard fusion partners derived from the original MOPC-21 tumor of winch the mouse myeloma Sp2/Oagl4, winch was used in order to produce the 7C10 hybridoma, is part. Tins sequence contains an aberrant recombination between the V and J genes (deletion of four nucleotide bases involving a change in the reading frame) and a mutation of the invariable cysteine in position 23 to tyrosine. These changes sμggest that tins light chain would be nonfunctional althoμgh nevertheless transcribed to messenger RNA. The DNA sequence of tins pseudo light chain is not shown.
c) Variable region isolated from the oligos MHV8 and MHV12
The DNA sequences obtained with these two oligos are identical, apart from the sequence encoded by the oligo itself. Tins sequence is a novel sequence coding for a functional heavy chain presumed to be that of the monoclonal antibody 7C10. The DNA (SEQ ID Nos. 51 and 53) and amino acid (SEQ ID No. 52) sequences of the cDNA coding for 7C10 VH are represented in figure 15.
Example 9: Construction of cinmeric mouse-man genes
The cinmeric antibody 7C10 was constructed so as to have the mouse 7C10 regions VL and VH connected to the human constant regions kappa and gamma-1, respectively. Oligos were used in order to modify the 5' and 3' ends of the sequences flanking the DNA coding for 7C10 VL and VH in order to allow their cloning in vectors for expression in mammalian cells. These vectors use the strong promoter HCMV in order effectively to transcribe the heavy and light chains of the cinmeric antibody 7C10. On the other hand, these vectors likewise contain the replication origin of SV40 allowing an effective replication of the DNA and, as a consequence, as a transitory expression of the proteins in cos cells.
Example 10: Expression and evaluation of the recognition activity of the IGF1 receptor of the cinmeric antibody 7C10
The two plasmids containing the DNA coding for the cinmeric 7C10 antibody were cotransfected in cos-7 cells (ATCC number CRL-1651) in order to study the transitory expression of the recombinant antibody. After incubation for 72 hours, the culture medium was removed, centrifμged in order to eliminate the cell debris and analyzed by the ELISA technique for the production of human IgGl (see Example 16) and the recognition of the receptor for IGF1 (see Example 17).
The ELISA tests for measurement of concentrations of human IgGl/Kappa showed that the expression of the cinmeric antibody 7C10 in the cos-7 cells was between 300 and 500 ng/mm, winch is comparable to the values obtained with the majority of antibodies.
The ELISA tests for recognition of the receptor for IGF1 show that the cinmeric antibody recognizes it specifically and with a good relative avidity (see figures 3A, 3B and 3C). Tins provides the functional proof that the good VH and VL of the 7C10 antibody have been identified. In addition, tins cinmeric form of 7C10 appears as being an indispensable tool in the evaluation of the affinity of the humanized forms.
Example 11: Molecular modeling of the variable regions of the mouse antibody 7C10
in order to assist and to refine the humanization process by "CDR grafting", a
molecular model of the VL and VH regions of the mouse antibody 7C10 was constructed. The model is based on the crystallograpinc structure of the heavy chain 1AY1 and of the light chain 2PCP.
Example 12: Process of humanization by CDR grafting of the variable region of the light chain of the antibody 7C10 (7C10 VL)
a) Comparison of the amino acid sequence of 7C10 VL with all the known
mouse VL sequences
As a preliminary step to humanization by CDR grafting, the amino acid sequence of 7C10 VL was first compared with all the mouse VL sequences present in the databank of Kabat (Internet address: ftp ://ftp. ebi. ac.uk/pub/ database/kabat/fasta_format/, last update of data dates from 1999). 7C10 VL has thus been identified as belonging to the subgroup II of the Kappa light chains as defined by Kabat et al. (In Sequences of proteins of immunological interest (5th edn.), NIH publication No. 91-3242, US Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, 1991). The VL regions of monoclonal antibodies of mice having a sequence identity ranging up to 95% have been identified (DRB1-4.3 (SEQ ID No. 55): 95% and C94-5B11'CL (SEQ ID No. 56): 95%, see figure 17). In order to attempt to identify the out of the ordinary residues in the 7C10 VL sequence, the amino acid sequence of 7C10 VL (SEQ ID No. 54) was aligned with the consensus sequence of the subgroup II of the mouse kappa chains (SEQ ID No. 57) as defined by Kabat (see figure 17).
In the Kabat position number 3, the valine (V) normally present in the subgroup II of the Kappa light chains according to Kabat (71%) is replaced by a leucine (L). A leucine in tins position is not rare since it is found, for example, in DRB 1-4.3 and C94-SBU'CL. According to the molecular model, tins residue does not seem to play a particular role. Consequently, the conservation of tins residue in the humanized form will not be envisaged.
In the Kabat position number 7, the threonine (T) normally present in the subgroup II of the Kappa light chains according to Kabat (66%) is replaced by an iso-leucine (I). An isoleucine in tins position is relatively rare since it is only found 15
times among all the mouse VL sequences known and never among human VL sequences. The molecular model shows that tins residue (17) points toward the surface of the molecule but does not contact the CDRs (the residue of a CDR winch is the closest would be the arginine in Kabat position number 42). In addition, it does not seem very probable that tins residue 17 directly contacts the antigen. Consequently, the conservation of tins residue in the humanized form will not be envisaged, at any rate at first.
In the Kabat position number 77, the arginine (R) normally present in the subgroup II of the Kappa light chains according to Kabat (95.5%) is replaced by a serine (S). A serine in tins position is not rare.
b) Comparison of the amino acid sequence of 7C10 VL with all the known
human VL sequences
In order to identify the best human candidate for the "CDR grafting", the Kappa VL region of human origin having the greatest homology possible with 7C10 VL was soμght. To tins end, the amino acid sequence of mouse kappa 7C10 VL was compared with all the human Kappa VL sequences present in the database of Kabat. Mouse 7C10 VL had the greatest sequence homology with the human kappa VL regions of subgroup II as defined by Kabat et al. (1991). VH regions of monoclonal antibodies of human origin have been identified having a sequence identity ranging up to 75.9% (GM607 (SEQ ID No. 58), see figure 18) over the whole of the 112 ammo acids composing the variable region. A germinal line of human origin, DPK15/A19 (SEQ ID No. 59), having a sequence identity of 76% (see figure 18) was also identified, GM607 (Klobeck et al., 1984). GM607 was therefore chosen as a human sequence receptive of CDRs (according to the definition of Kabat) of mouse 7C10 VL. By comparing the GM607 sequences with that of the consensus sequence of the human subgroup II (SEQ ID No. 60) (figure 18), no particular residue in the framework regions (Rch) could be identified, indicating by the same fact that GM607 was a good candidate for CDR grafting.
c) Humanized versions of 7C10 VL
The following stage in the humanization process consisted in joining the CDRs of mouse 7C10 VL to the framework regions (Rch) of the human light chain selected,
GM607 (Klobeck et al., 1984). At tins stage of the process, the molecular model of the mouse Fv regions of 7C10 is particularly useful in the choice of the mouse residues to be conserved as being able to play a role either in the maintenance of the tridimensional structure of the molecule (canonical structure of the CDRs, VH/VL interface, etc.) or in 5 the binding to the antigen, in the Rchs, each difference between the mouse (7C10 VL) and human (GM607) amino acids was examined scrupulously (see Table 6). in addition, the particular residues in the mouse sequence 7C10 VL winch were identified (see example 12.a) were taken into account if needed.
in the first version humanized by "CDR grafting" of 7C10 VL, human 1, a
10 single change in the framework regions (Rch) of GM607 was carried out. Tins change concerns the residue 2 (nomenclature of Kabat) situated in Rch 1. Tins residue enters in effect into the composition of the canonical structure of the CDR 1 of 7C10 VL and could therefore be critical for maintaining tins loop in its good conformation. The valine present in tins position in the mouse 7C10 VL sequence is thus conserved in tins same
15 position in the humanized form (see Table 6 and figure 19 for the amino acid sequence (SEQ ID No. 61) and figure 20 for the DNA sequence (SEQ ID Nos. 62 and 64) and the amino acid sequence comprising the peptide signal (SEQ ID No. 63).
in the second version humanized by "CDR grafting" of 7C10 VL, human 2, no change in the Rchs of the human light chain GM607 has been made. All the residues of
2 0 the Rchs are thus of human origin including the residue 2 winch has therefore been mutated in order to replace the valine present in mouse 7C10 VL by an isoleucine found in tins same position in the human light chain GM607 (see Table 6 and figure 19 for the amino acid sequence (SEQ ID No. 65) and figure 21 for the DNA sequence (SEQ ID Nos. 66 and 68) and the amino acid sequence comprising the peptide signal (SEQ ID
2 5 No. 67)). Tins human form 2 is therefore totally humanized (apart from, of course, CDRs themselves) since all the residues of the Rchs are those of the light chain of human origin, GM607.
TABLE 6: Alignment of the amino acid sequences leading to the design of the remodeled human 7C10 vl regions(Table Removed)
Legend: The first column (Kabat) indicates the position of the amino acid residue according to Kabat et al. (1991); the second column (#) indicates the position of the amino acid residue in the regular sequence; the tinrd column (FR or CDR) was made in order easily to identify the segments of the skeleton (FR1, FR2, FR3 and FR4) and the CDR segments (CDR1, CDR2 and CDR3) ("CDR" for "Complementarity-Determining Region") with the three CDRs separating the four FRs; the fourth column (Mouse light
chain 7C10) represents the amino acid sequence (SEQ ID No. 54) of the vl region of mouse antibody 7C10; the fifth column (Human germinal line DPK15/A19) represents the amino acid sequence (SEQ ID No. 59) of the kappa II human V light chain of the germinal line; the sixth column (GM607) represents the amino acid sequence (SEQ ID No. 58) of the vl region of the human antibody GM607; the seventh and eighth columns (remodeled human 7C10 1 and 2) represent the amino acid sequences of the humanized 1 and 2 antibody 7C10 VL (respectively SEQ ID Nos. 61 and 65). "*" indicates the parts of the canonical structure of the CDR loop such as defined by Chotina et al. (Nature, 342, 877-883,1989).
Example 13: Process of humanization by CDR grafting of the variable region of the heavy chain of the antibody 7C10 (7C10 VH)
a) Comparison of the amino acid sequence of 7C10 VH with all of the known
mouse VH sequences
As a preliminary stage in humanization by CDR grafting, the amino acid
sequence of 7C10 VH was first compared with all the mouse VH sequences present in
the Kabat databank (Internet address: ftp://ftp.ebi.ac.uk/
pub/database/kabat/fasta_format/, last update of data dates from 1999). 7C10 VH has thus been identified as belonging to the subgroup I(A) of the heavy chains as defined by Kabat et al. (1991). VH regions of mouse monoclonal antibodies having a sequence identity ranging up to 90.5% were identified (AN03'CL (SEQ ID No. 70), see figure 22). Li order to attempt to identify the out of the ordinary residues in the sequence of 7C10 VH, we aligned the amino acid sequence of 7C10 VH (SEQ ID No. 69) with the consensus sequence (SEQ ID No. 71) of the subgroup I(A) of the mouse heavy chains as defined by Kabat (see figure 22).
Residue 17 (Rabat's numbering), Thr for the consensus sequence of subgroup I(A) and Ser in 7C10 VH, is located on the surface of the molecule with respect to the interface with the constant region. Tins residue does not seem to be important.
Residue 27 (Rabat's numbering), Asp for the consensus sequence of subgroup I(A) and Tyr in 7C10 VH, is a canonical residue for the CDR 1. Tyr in tins position is not rare and is probably critical for maintaining CDR 1 in its good conformation.
Residue 84 (Kabat's numbering), Thr for the consensus sequence of the
subgroup I(A) and Asn in 7C10 VH. Asn was found 93 times in mouse VH and 3 times in human VH. According to the molecular model, it is a surface residue remote from the paratope.
The numbering of the amino acids is that of Kabat et al. (1991). The residues in the framework regions (apart from CDRs) winch differ between 7C10 VH and Kabat mouse subgroup I(A) are underlined. AN03'CL represents the sequence of the heavy chain of a mouse antibody (access number in the Kabat databank is P001289).
b) Comparison of the amino acid sequence of 7C10 VH with all of the known
human VH sequences
In order to identify the best human candidate for the "CDR grafting", the VH region of human origin having the greatest possible homology with 7C10 VH was soμght. To tins end, the amino acid sequence of mouse 7C10 VH was compared with all the human VH sequences present in the Kabat databank. Mouse 7C10 VH had the greatest sequence homology with the human VH regions of the subgroup II as defined by Kabat et al. (1991). VH regions of monoclonal antibodies of human origin were identified having a sequence identity ranging up to 67.3% (human VH FURl'CL (SEQ ID No. 73, see figure 23) over the whole of the 98 amino acids encoded by the variable gene (that is to say apart from CDR3 and region J). A germinal line of human origin, 4.22 VH IV (Sanz et al., 1989), having a sequence identity of 68.4%, according to the same criteria as for VH FURl'CL, was also identified (human Germ-line (SEQ ID No. 74), see figure 23). The sequence encoded by the germinal line 4.22 VH IV was chosen as a human sequence receptive of the CDRs (according to the definition of Kabat) of mouse 7C10 VH rather than VH FURl'CL because in comparing the sequences of 4.22 VH IV and VH FUR1 'CL with that of the consensus sequence of the human subgroup II (human Kabat sg II (SEQ ID No. 72), see figure 23 and table 7), no atypical residue in the framework regions (Rch) could be identified for 4.22 VH IV althoμgh the presence of two atypical residues (Gin and Arg in positions 81 and 82A according to the nomenclature of Kabat, respectively) were identified in the sequence encoded by VH FURl'CL.
c) Humanized versions of 7C10 VH
The following stage in the humanization process consisted in joining the CDRs of mouse 7C10 VH to the framework regions (Rch) of the human germinal line 4.22
VH IV (Sanz et al., 1989). At tins stage of the process, the molecular model of the mouse Fv regions of 7C10 is particularly useful in the choice of the mouse residues to be conserved as being able to play a role in the maintenance of the tridimensional structure of the molecule (canonical structure of the CDRs, VH/VL interface, etc.) or in the binding to the antigen (belonging to the paratope). In the Rchs, each difference between the mouse (7C10 VH) and human (4.22 VH IV) amino acids was examined scrupulously (see Table 7). In addition, the particular residues in the mouse 7C10 VH sequence winch had been identified (see Example 8.a) were taken into account if needed.
in the first version of 7C10 VH humanized by "CDR grafting", humanized 1, four changes in the framework regions (Rch) of 4.22 VH IV were carried out (see Table 7, figure 24 for the amino acid sequence (SEQ ID No. 75) and figure 25 for the DNA sequence (SEQ ID Nos. 76 and 78) and the amino acid sequence comprising the peptide signal (SEQ ID No. 77)). These four changes concern:
Residue 30 (Kabat's nomenclature) situated in Rch 1. Tins residue enters in
effect into the structural composition of the CDR1 of 7C10 VH (as defined by
Chotina et al., 1989) and could therefore be critical for maintaining tins loop in
its correct conformation. The Thr present in tins position in the mouse sequence
7C10 VH is therefore conserved in tins same position in the humanized form.
Residue 48 (Kabat's nomenclature) situated in Rch 2. Tins residue is close to the
CDRs, althoμgh according to the molecular model not in direct contact with the
latter, and could influence their ultimate conformation. The metinonine present
in tins position in the mouse sequence 7C10 VH is therefore conserved in tins
same position in the humanized form 1.
Residue 67 (Kabat's nomenclature) situated in Rch 3. Tins residue is close to the CDRs and according to the molecular model could contact Lysine 60 (Kabat's nomenclature) in the CDR 2. The isoleucine present in tins position in mouse sequence 7C10 VH is therefore conserved in tins position in the humanized form 1.
• Residue 71 (Kabat's nomenclature) situated in Rch 3. Tins residue is part of the
canonical structure of the CDR 2 and should therefore be critical for maintaining
tins loop in its correct conformation. The arginine present in tins position in the
mouse sequence 7C10 VH is therefore conserved in tins position in the humanized form 1.
In the second version of 7C10 VH humanized by "CDR grafting", humanized 2, two changes in the framework regions (Rch) of 4.22 VH IV were carried out. These two changes concern the residues 30 and 71 (Kabat's nomenclature), already described in the humanized form 1 (see Table 7, figure 24 for the amino acid sequence (SEQ ID No. 79) and figure 26 for the DNA sequence (SEQ ID Nos. 80 and 82) and the amino acid sequence comprising the peptide signal (SEQ ID No. 81)).
In the tinrd form of 7C10 VH humanized by "CDR grafting", humanized 3, no change in the framework regions (Rch) of 4.22 VH IV was carried out. All the residues of the Rchs are therefore of human origin including the residues 30, 48, 67 and 71 (Kabat's nomenclature) winch have been conserved (see Table 7, figure 24 for the amino acid sequence (SEQ ID No. 83) and figure 27 for the DNA sequence (SEQ ID Nos. 84 and 86) and the ammo acid sequence, comprising the peptide signal (SEQ ID No. 85)). Tins humanized form 3 is therefore totally humanized (apart, of course, from the CDRs themselves as defined by Kabat) since all the residues of the Rchs are those encoded by the VH gene of the germinal line 4.22 VH IV.
TABLE 7: Alignment of the amino acid sequences leading to the design of the remodeled human 7C10 vh regions(Table Removed)
Legend: The first column (Kabat) indicates the position of the amino acid residue according to Kabat et al. (1991); the second column (FR or CDR) was made in order easily to identify the segments of the skeleton (FR1, FR2, FR3 and FR4) and the CDR segments (CDR1, CDR2 and CDR3) with the three CDRs separating the four FRs; the tinrd column (Mouse heavy chain 7C10) represents the amino acid sequence (SEQ ID No. 69) of the VH region of the mouse antibody 7C10; the fourth column (Germinal line 4.22 VH IV) represents the amino acid sequence of the gene 4.22 VH IV (Sanz et al., 1989) (SEQ ID No. 74); the fifth column (human FURl'CL VH, kabat accession number N020619) represents the amino acid sequence (SEQ ID No. 73) [lacuna] IgMK antilamin B of human origin (Mariette et al., 1993); the sixth, seventh and eighth columns (remodeled human 7C10 1, 2 and 3) represent the amino acid sequences of the vh region of remodeled human 7C10 respectively for the versions 1 (SEQ ID No. 75), 2 (SEQ ID No. 79) and 3 (SEQ ID No. 83). "*" indicates the parts of the canonical structure of the CDR loop such as defined by Chotina et al. (1989). Example 14: Construction of the genes coding for the humanized versions 1 of 7C10 VL and VH by assembly of oligonucleotides
a) Principle
The genes (leader peptide + variable regions VDJ for VH or VJ for VK) coding for the humanized variable regions were synthesized by solid-phase assembly on magnetic beads coated with streptavidin. The genes coding for humanized 7C10 VH (445 base pairs) and humanized 7C10 VL (433 base pairs) are constructed by fusing two fragments of DNA owing to the presence of a Kpnl restriction site present in the two sequences and situated almost halfway along the gene (at 200 and 245 nucleotides with respect to the 5' end of the gene for VL and VH, respectively). The two fragments winch are fused together are themselves assembled by an assembly technique winch consists in using phosphorylated oligonucleotides (approximately 30-35 mer) hybridized two by two (one oligo sense and the other antisense, with a homology of approximately 50%) in such a way that they overlap during elongation. A first oligonucleotide biotinylated in the 5' position is attached to the magnetic beads and then the pairs of phosphorylated oligonucleotides are added one by one. The phosphodiester linkage between the juxtaposed phosphorylated oligonucleotides is produced by the enzyme T4 DNA ligase.
-
The genes thus synthesized de novo can be cloned directly (by digestion with restriction enzymes compatible with the expression vector chosen) or amplified by PCR in order to obtain more material as a prelude to directional cloning by enzymatic digestion. The sequence of the gene thus constructed by de novo assembly is then verified by automatic sequencing of the DNA.
b) Experimental protocol of the de novo assembly technique
Oligonucleotides phosphorylated in the 5' position or biotinylated in the 5' position whose concentration was adjusted to 100 pM were ordered from MWG Biotech (see the sequences of the oligonucleotides used in Table 7 for the construction of humanized 7C10 VL, and Table 9 for the construction of humanized 7C10 VH). The oligonucleotides were hybridized in pairs (an equimolar mixture, 500 pmol, of a sense oligo and of an antisense oligo in the buffer T4 DNA ligase is heated to 95°C for 5 minutes and then allowed to cool on the bench to ambient temperature) according to a scheme described in Table 10.
The first biotinylated oligonucleotide is attached to magnetic beads coated with streptavidin (Dynabeads M-280 streptavidin, Dynal product No. 112-05). For tins, 500 pmol of the biotinylated oligonucleotide in a 15 mM NaCl solution are added to 50 fjl of the decanted beads (use of a magnet holder) previously washed twice with 100 fil of TE IX buffer (Tris-EDTA 100X buffer: 1 M Tris-HCl, pH 8, 0.1 M EDTA, Sigma T-9285). After incubation at 37°C for 15 min, the beads are washed twice with the wash buffer (10 mM Tris-HCl pH 7.6,10 mM EDTA and 50 mM NaCl) and the pairs of hybridized oligo-nucleotides are then added one by one. On each readdition of a pair of oligonucleotides, the mixture is heated to 95°C for 5 min and then allowed to cool on the bench to ambient temperature. Once ambient temperature is reached, 2 jttl of 10 U//d T4 DNA ligase (Biolabs) are added and the mixture is incubated for 20 min at 37°C. The beads are then washed (wash buffer) and the following pairs of oligonucleotides are then added in succession.
The last unpaired oligo (antisense) is assembled in the following fasinon. 5 /il of oligo (500 pmol) and 43 /il of T4 DNA ligase buffer are added to the decanted beads, then the mixture is heated to 95°C for 5 min and allowed to cool on the bench to ambient temperature. Once ambient temperature is reached, 2 /il of T4 DNA ligase are added and the mixture is incubated at 37°C for 20 min. The beads are then washed twice
with wash buffer and then twice with TE IX buffer.
The beads can then be conserved at 4°C before proceeding to the cloning and sequencing of the gene assembled de novo.
TABLE 8: DNA sequence of oligonucleotides used for the construction of humanized 7C10 VL 1 by de novo assembly
(Table Removed)TABLE 9: DNA sequence of oligonucleotides used for the construction of humanized 7C10 VH 1 by de novo assembly(Table Removed)
the residues 48 and 67 (according to Kabat's nomenclature) of version 1. Tins directed mutagenesis was carried out with the aid of the system QuikChange™ Site-directed mutagenesis of Stratagene (kit #200518) according to the protocol described by the manufacturer. The construction is carried out in two stages, first the residue 48 on version 1 was mutated with the aid of the pair of primers 7C10HhumanizedlQCM48 sense and antisense (see Table 11) and subsequently tins version mutated at the residue 48 was itself mutated at the residue 67 with the aid of the pair of primers 7C10HhumanizedlQCI67 sense and antisense (see Table 11).
The humanized version 3 of 7C10 VH was obtained by site-directed mutation of the residues 30 and 71 (according to Kabat's nomenclature) of version 2 likewise using the system QuikChange™. Tins construction is carried out in two stages. At first, the residue 30 on version 2 was mutated with the aid of the primers 7C10HhumanizedQCT30 sense and antisense (see Table 11). Subsequently, tins version mutated at the residue 30 was itself mutated at the residue 71 by using the pair of primers 7C10HhumanizedlV67QCR71 sense and antisense (see Table 11).
The humanized version 2 of 7C10 VL was obtained by site-directed mutation of the residue 2 (according to Kabat's nomenclature) of version 1 by using the system QuikChange™. The residue 2 on version 1 was mutated by using the pair of primers 7C10LhumanizedlQCV2 sense and antisense (see Table 11).
Example 16: Transfection of the cos? cells by electroporation
The mammalian expression vectors containing the cinmeric or humanized versions of the heavy and light chains of the antibody 7C10 were tested in cos? cells for the transitory expression of the recombinant antibodies 7C10. The DNA was introduced into the cos cells by electroporation with the aid of a BioRad instrument (Gene Pulsar). The DNA (10 /ig of each vector) is added to aliquots of 0.8 ml of cos cells at a concentration of 1 x 107 cells per ml in PBS buffer (without Ca++ and Mg++). A pulsation of 1900 volts and a capacity of 25 fjiP was delivered. The transfected cos cells are then added to 8 ml of DMEM medium containing 5% of calf serum and incubated at
37°C for 72 hours. The supernatant is then collected, centrifμged in order to eliminate the cell debris and tested by ELISA for the measurement of its concentration of recombinant antibody 7C10 of IgGl/human Kappa type.
Example 17: ELISA method for measuring the concentrations of recombinant antibody IgGl/human Kappa present in the supernatant of the cos transfectants
The supernatants produced by transitory expression in cos7 cells were tested for the presence of 7C10 antibody of IgGl/human Kappa type. For the detection of the IgGl/human Kappa immunoglobulin, 96-well ELISA plates (Maxisorb, Nunc) were
coated with a goat anti-human IgG polyclonal antibody (specific for the gamma Fc fragment, Jackson hnmuno-Research Laboratories ine., #109-005-098). The supernatants of cos cells were diluted in series and added to the coated wells. After incubation for one hour at 37°C and wasinng, a goat anti-human light Kappa chain polyclonal antibody conjμgated to peroxidase (HRP, Sigma, A-7164) was added. After
incubation for 45 minutes at 37°C and wasinng, the TMB substrate (KPL #50-76-04) was added. After incubation for 10 minutes, the reaction was stopped by the addition of 1 M sulfuric acid and the optical density was read at 450 nm. A purified human IgGl/human Kappa immunoglobulin (Sigma, 1-3889) of known concentration was used as a standard reference antibody.
Example 18: ELISA method for determining the recognition activity of 7C10 recombinant antibodies of human IgGl/Kappa type on the receptor for IGF1 (IGF-IR)
The cos7 culture supernatants were tested for their capacity to recognize IGF-IR
by an ELISA method. 96-well ELISA plates (Dynex Immulon 2KB) were coated with 100 iA per well of a solution of PBS containing 0.31 ng//tl of IGF-IR (Human Insulin-Like Growth Factor I soluble Receptor, R & D Systems, #391-GR) by incubation for one night at 4°C. After wasinng with PBS containing 0.05% Tween 20, the plates were saturated by the addition of a solution of PBS containing 0.5% gelatin solution and
incubation at 37°C for 1 hour. After three washes with PBS, the samples of cos supernatants to be tested, previously diluted in series in PBS containing 0.1% gelatin and 0.05% Tween 20, were added to the plates. After incubation at 37°C for 1 hour
followed by three washes (PBS containing 0.05% Tween 20), an anti-human IgG antibody (specific for the Fc fragment) conjμgated to peroxidase (HRP, Jackson Immune-Research Laboratories Inc., #109-035-098) was added (dilution to 1/5000 in PBS containing 0.1% gelatin and 0.05% Tween 20). After incubation for 45 minutes at 37°C and 3 washes (PBS containing 0.05% Tween 20), the TMB substrate (KPL #50-76-04) was added. After incubation for 10 minutes, the reaction was stopped by addition of 1 M sulfuric acid and the optical density was read at 450 nm.
Example 19: Determination of the recognition activity of IGF1-R by different versions of the humanized 7C10 antibody by "CDR grafting"
At first, we compared the recognition activity of humanized forms 1 of the heavy and light chains of 7C10 for the IGF-IR with respect to the cinmeric form. Figure 28 shows the results of an ELISA test of recognition of the IGF-IR (see Example 18) from supernatants of the cos7 cells whose concentration of IgG 1/human Kappa had been previously determined by ELISA (see Example 17). The titration curves of the four recombinant antibodies tested overlap perfectly indicating that their relative affinities for IGF-IR are very similar. It is therefore concluded from tins that the humanized form 1 of 7C10, composed of the humanized light chain 1 (1 single mouse residue present in the framework regions) in combination with the humanized heavy chain 1 (4 mouse residues present in the framework regions), specifically recognizes the IGF-IR and has an affinity very similar to that of the cinmeric antibody (mouse variable regions).
Subsequently, we looked at the influence of the residue 2 (according to Rabat's nomenclature) of the humanized light chain of 7C10 (humanized version 1 versus humanized 2, see figure 19) on the recognition of the IGF-IR. Figure 29 shows the results of the ELISA test for recognition of the IGF-IR (see Example 18) from supernatants of cos7 cells whose concentration of IgGl/human Kappa had been previously determined by ELISA (see Example 17). The two humanized versions 1 and 2 of the light chain had been combined successively with humanized 7C10 VH 1. The titration curves of the two combinations are superimposed indicating that the mutation of residue 2 of the light chain, winch has been changed from one valine in the humanized version 1 to an isoleucine in the humanized form 2, apparently has no
influence on the relative affinity of recognition of the IGF1 receptor. The humanized form 2 of the light chain of 7C10 thus forms one version where no mouse residue (apart from CDRs) has been conserved. Tins version, totally humanized, represents the preferred version of 7C10 VL.
The totally humanized version of the 7C10 light chain (humanized version 2, see above) was tested in combination with the three humanized versions of the heavy chain of 7C10. Figure 30 shows the results of the ELISA test for recognition of the IGF-IR from supernatants of cos7 cells whose concentration of IgGl/human Kappa had been previously determined by ELISA (see Example 17). The titration curves are very similar and virtually overlap with the reference curve corresponding to the cinmeric antibody, indicating that the three humanized versions 1, 2 and 3 of 7C10 VH give an identical relative affinity for IGF-IR when they are combined with humanized 7C10 VL 2. Other ELISA tests conducted in parallel (results not shown) have however revealed that a point mutation of the residue 71 (Kabat's nomenclature) from an arginine (mouse) to a valine (human) involved a small loss of affinity of the corresponding antibody for IGF-IR. It is thus reasonable to tinnk that humanized 7C10 VH 2 has the same relative affinity for IGF-IR as humanized 7C10 VH 1. Tins humanized form 2 will therefore be preferred with respect to the form 1 since it only has two mouse amino acids (residues 30 and 71, see figure 24). The humanized form 3 winch does not have any mouse residue (apart from CDRs) will also be preferred since it only seems to involve a minimal loss of affinity.
In conclusion, it appears that two humanized forms of the antibody 7C10 according to the present invention are particularly preferred. A form constituted by the combination of humanized 7C10 VH 2 (2 conserved mouse residues) with humanized 7C10 VL 2 (no conserved mouse residue) and another form constituted by the combination of humanized 7C10 VH 3 (no conserved mouse residue) with humanized 7C10 VL 2 (no conserved mouse residue). Tins last form constitutes the ultimate humanized version since no mouse residue is present at the same time in the heavy and light chains.
Example 20: Expression of EGFR and of IGF-IR on the surface of A549 cells
The synergy of action obtained by the coadministration of two MABs directed respectively against IGF-IR and EGFR was studied in nude mice carrying a non-small cell lung tumor established by subcutaneous injection (s.c.) of A549 cells (lung carcinoma cell line).
At first, and in order to ensure the presence of the two receptors IGF-IR and EGFR on the surface of the A549 cell before injecting tins into the mouse, labeling for FACS reading of these cells was carried out with, respectively, the murine 7C10 anti-IGF-ffi. MAB (figure 37B) and the murine 225 anti-EGFR MAB (figure 37D). In order to do tins, the cells were saturated for 30 min at 4°C with a solution of PBS 10% PCS (fetal calf serum), washed and then incubated for 30 min at 4°C with the MAB of interest. After 3 new washes, the secondary anti-species antibody coupled to FITC (fiuorescein isotinocyanate) is added. After incubation for 30 min, reading on the FACS (Fluorescence Activated Cells Sorter) is carried out at 520 nm (excitation 488 nm).
The results presented in figures 37A to 37D show that the A549 cells have on their surface a comparable number of receptors for EGF and IGF1. In the two cases, the population is homogeneous with respect to the distribution of each of the receptors. The specificity of the labeling is confirmed by the use of an isotype control (figure 37C). These results validate the use of the A549 cell as a model for the study of a synergy of action on two IGF-IR and EGFR receptors and for the study of a collaboration of these two receptors.
Example 21: Synergy of action of an anti-IGF-IR MAB and of an anti-EGFR MAB coadministered in vivo, in the nude mouse in the context of an antitumor treatment
For tins study, nude mice are grafted s.c. with 5.106 A549 cells. Five days after the cell graft, the tumors are measured and a homogeneous batch of mice in terms of tumor volume is formed. Starting from tins batch, groups of 6 mice are generated at random. These mice will be treated intraperitoneally (i.p.), twice per week with each of the MAB 7C10 and 225 individually at the dose of 250 ptg/mouse or with the two MAB in coadministration. The MAB 9G4 is administered as an experiment isotype control.
The results presented in figure 38 show that each of the antibodies 7C10 and 225 administered alone is capable of inducing a significant decrease in the tumor growth in vivo. It can be noted that the two MAB tested have a comparable activity on the growth of the tumor A549. In a surprising fasinon with respect to the literature, a significant synergy is observed during simultaneous administration of the two MAB (p < or = 0.01 at each of the times of the kinetics in a t-test) sμggesting that a collaboration of the two receptors exists for the optimum growth of a tumor in vivo and that, contrary to the data in the literature, the blockage of one of the two axes does not suffice to totally ininbit the growth mediated by the second.
Example 22: Study of the antitumor activity of the murine antibodies 7C10 and 225 coadministered in mice orthotopically implanted with A549 cells
The use of orthotopic models for the evaluation of the antitumor activity presents a particular interest with respect to the process of metastatic dissemination of a tumor. In order to evaluate the antitumor activity of an antibody mixture directed respectively against IGF-IR and EGFR, 106 A549 cells (non-small cell lung cancer) were implanted in the intrapleural cavity of nude mice. It is to be noted that the consequence of tins type of tumor implantation is a metastatic dissemination similar to that observed in man and leads to the death of the animals. Figure 39 shows that the administration of the antibodies 225 and 7C10 alone allows a comparable and a significant gain in survival to be observed. In a surprising fasinon, the coadministration of these two antibodies increases in a considerable fasinon the survival of the animals sμggesting that tins treatment could have an impact on the metastatic dissemination of the tumor cells.
Example 23: 7C10 and 7H2HM ininbit the phosphorylation of the tyrosine of the 0 chain of IGF-IR and of IRS-I
MCF7 cells are cultured for 24 hours at 5.104 cells/cm2 (75 cm2 plates, COSTAR) in 20 ml of RPMI without phenol red, mixed with 5 mM of glutamine, penicillin/ streptomycin (respectively 100 U/100 /ig/ml) and 10% of fetal calf serum. After three washes in PBS, the cells were incubated for 12 hours in medium (RPMI) without phenol red, devoid of fetal calf serum and mixed with 5 mM of glutamine,
penicillin/streptomycin, bovine serum albumin at 0.5 /ig/ml (Sigma A-8022) and transferrin at 5 jμg/ml (Sigma T8158).
For activation, the cells were first incubated at 37°C for 2 minutes with blocking antibodies (10 jμg/ml) and then IGF1 (Sigma 13769, 50 ng/ml) was added for two additional minutes. The reaction was stopped by aspiration of the incubation medium and the plates were laid on ice. The cells were solubilized by addition of 0.5 ml of lysis buffer (50 mM tris-HCl pH 7.5, 150 mM NaCl, 1% Nonidet P40, 0.5% sodium deoxycholate), mixed with protease ininbitors (1 tablet per 50 ml, Boehringer Ref.: 1697 498), and phosphatase ininbitors (Calbiochem Ref.: 524625 (1/100)). The cells were scraped off and the suspension was recovered and placed on a shaker at 4°C for 1.5 hours. The solutions were centrifμged at 12,000 rpm for ten minutes (4°C) and the protein concentrations of the supernatants were quantified by BCA.
500 jttg of proteins of the cell lysate were mixed with the anti-IGF-IR (Santa cruz Ref.: sc-713) for immunoprecipitation and incubated on the shaker at 4°C for 1.5 hours. The immunoprecipitates were recovered by addition of protein A-agarose (Boehringer Ref.: 1 134 515) and incubated all night on the shaker at 4°C. For the immunoprecipitation of IRS-1, anti-IRS-1 antibodies coupled to agarose beads (Santa cruz Ref.: 559Ac) were used. The agarose beads were washed twice with 1 ml of lysis buffer, twice with a wash buffer 1 (50 mM tris-HCl pH 7.5; 500 mM NaCl; 0.1% Nonidet P40; 0.05% sodium deoxycholate (Boehringer 1 332 597), mixed with protease ininbitors and phosphatase ininbitors) and once with a wash buffer 2 (50 mM tris-HCl; 0.1% Nonidet P40; 0.05% sodium deoxycholate (Boehringer Ref.: 1 332 597), mixed with protease ininbitors and phosphatase ininbitors 1/100). The immunoprecipitates were resuspended in a Laemmli buffer, heated to 100°C for 5 minutes. The supernatants were analyzed by electrophoresis on polyacrylamide SDS gel (8% Novex EC6015). The proteins were transferred to a nitrocellulose membrane followed by either an immunoblot with anti-phosphotyrosine antibodies conjμgated to HRP (upstate Biotechnology 4G10) or beta anti-chain of IGF-IR or anti-IRS-1 (Santa Cruz Ref.: sc 8038) followed by an anti-rabbit antibody conjμgated to HRP. The imprints were revealed by chemiluminescence (Amersham RPN 2209) followed by autoradiography on Kodak X-mat AR films.
Figure 40A represents MCF7 cells nonstimulated (0) or stimulated either with IGF1 (50 ng/ml) alone (0+IGF-I) or combined with monoclonal or humanized anti-IGF-IR antibodies (10 ng/ml) 7C10,1H7, 7H2HM. The antibodies 9G4 or hlgGl are murine or human immunoglobulins of isotype IgGl used as an experiment negative control. The beta chains of the IGF-IR were immunoprecipitated and blotted with phosphorylated anti-tyrosine antibodies. The results obtained show that the monoclonal or humanized anti-IGF-IR 7C10, 1H7 and 7H2HM antibodies ininbit the phosphorylation of the tyrosine of the beta chain of the IGF-IR.
Figure 40B represents MCF7 cells nonstimulated (0) or stimulated either with IGF1 (50 ng/ml) alone (0+IGF-I) or combined with monoclonal or humanized anti-IGF-IR antibodies (10 jμg/ml) 7C10, 1H7, 7H2HM. As described above, the antibodies 9G4 or hlgGl are murine or human immunoglobulins of isotype IgGl used as an experiment negative control. The IRS-1 was immunoprecipitated and blotted with phosphorylated anti-tyrosine antibodies. The results obtained show that the monoclonal antibodies 7C10, 7H2HM and 1H7 ininbit the phosphorylation of the tyrosine of the IRS-1.
Example 24: 7C10 and 7H2HM induces the internalization of the IGF-IR
MCF7 and A549 cells were suspended to 1.107 cells/ml in PBS with 10% of fetal calf serum (FACS buffer). 1.106 cells were incubated for 30 minutes at 37°C with the monoclonal antibodies at 10 jμg/ml (7C10, 7G3, 9G4) or at 20 jμg/ml for 7H2HM. After wasinng, the cells were labeled at 4°C for 30 minutes with a biotinylated anti-IGF-IR (monoclonal antibody 12B1) and finally incubated at 4°C for 30 minutes with a conjμgate of streptavidin-488 alexa Fluor®. The cells were analyzed by FACScan (Becton-Dickinson, Enembogegem, Belgium) with the Cellquest software after elimination of debris.
Figure 41 shows the A549 cells without coloration (1st peak), the A549 cells incubated with 7C10 or 7H2HM (2nd peak) and the A549 cells incubated with an irrelevant mouse or rat IgGl (3rd peak). A decrease by two of the surface expression of the IGF-IR by the cells is seen when the cells have been previously incubated with 7C10or7H2HM.
Example 25: 7C10 and 7H2HM induce the degradation of the IGF-IR
MCF-7 cells were cultured for 24 hours at 10.104 cells/cm2 (75 cm2, Costar) in 15 ml of complete medium. Next, the cultures were washed three times with PBS and incubated for 12 hours with medium devoid of serum. Next, the cells were incubated with cycloheximide at 25 fig/wl alone or with 10 jttg/ml of monoclonal antibody 7C10, 9G4, 7G3 or of IGF1 (50 ng/ml). In certain experiments, before incubation with the monoclonal antibodies, the cells were treated for 1 hour at 37°C with MG-132 (10 fJiM, Calbiochem 474791) in order to ininbit the proteasome activities. After incubation, the cells were washed and solubilized by addition of a lysis buffer. 20 ^g of proteins were analyzed by electrophoresis on polyacrylamide gel at 8% of SDS and transferred to a nitrocellulose membrane followed by a beta anti-chain immunoblot of the IGF-IR such as described further above.
The analysis by Western-blot (figure 42 A) of the integrity of the IGF-IR shows that 7C10 and 7H2HM induce the degradation of the receptor winle the natural ligand does not cause any degradation of the latter. No degradation of the receptor is observed with the 9G4, an irrelevant antibody used as an isotype control. Figure 42B demonstrates, and with respect thereto, that the degradation is ininbited by a proteasome ininbitor MG132 (incubation period of 2 hours).
Comparable results were obtained with the humanized antibody 7H2HM (figure 42C).
Additional experiments using the murin 7C10 Mab have been performed and demonstrate that the degradation of IGF-IR is strongly proteasome dependant as the effect of 7C10 is totally abolished in presence of the proteasome ininbitor MG115 (Figure 57A). Tins property seems to be particular the our antibody as for other anti-IGF-IR described in the literature or in published patents the down-regulation does not occur via the proteasomal pathway (Sachdev et al., Cancer Res. 63:627-635, 2003; Burtrum et al. Cancer Res. 63, 8912-8921, 2003; patent US 2004/0202655 Al (Pharmacia)). In addition to tins degradation pathway, the 7C10 MAb seems to also induce the degradation of IGF-IR via the lysosomal/endosomal pathways as a substantial reduction of down regulation was observed when cells are treated with either methylamine or chloroquine (Figures 57 B and C).
After down-regulation the level of receptor remain significantly low at least for 31 hours (Figure 57D).
Example 26 : Evaluation of 7C10 and h7C10 ability to bind to IGF-IR and hybrid-R.
Example 26.1 : Evaluation of 7C10 and h7C10 ability to imrnunoprecipitate IGF-IR and hybrid-R purified from transfected cells respectively with IGF-IR and IR-A or IGF-IR and IR-B (thereafter referred as R+/TR-A or R+/IR-B
The goal of tins study is to evaluate the ability of 7C10 and h7C10 to imrnunoprecipitate IGF-IR, IR or Hybrid-R.
7C10 and h7C10 are compared to 17-69 (winch recognizes both IGF-IR well and Hybrid-R). Method
The used cells for tins study are listed thereafter:
R+: R- fibroblasts stably transfected with the IGF-IR (IGF-IR) cDNA
R-/IR-A: R- fibroblasts stably transfected with the insulin receptor isoform A (IR-A)
cDNA
R-/IR-B:R- fibroblasts stably transfected with the insulin receptor isoform B (IR-B)
cDNA
R+/IR-A: R- fibroblasts stably co-transfected with the IGF1 and the insulin receptor
isoform A cDNA and, therefore, expressing hybrid receptors A (Hybrid-RsA)
R+/IR-B: R- fibroblasts stably co-transfected with the IGF1 and the insulin receptor
isoform B cDNA and, therefore, expressing hybrid receptors A (Hybrid-RsB)
For the obtention of cellular lysat, cells were solubilized in REP A buffer and 4 mg protein used for immunoprecipitation.
Cell lysates were immuprecipitated as follows: R+ with either 7C10 or h7C10
R+/IR-A and R+/IR-B with either 7C10 or h7C10 or 17-69 R-/IR-A and R-/IR-B with either MA-20 (an anti-IR antibody) or 7C10 or h7C10
Following immunoprecipitation, the pellet was resuspended in 2X sample buffer and subjected to SDS-PAGE (7.5 % polyacrylamide).
Filters were blotted as follows: Filters containing R+ lysates (and therefore only IGF-IR) with an anti-IGF-IR β-subunit (Santa Cruz). Filters containing lysates from all the remaining cells with an antibody anti-IR β-subunit (Santa Cruz). Results
Two independent experiments are shown (Fig. 43 A and Fig. 43 B) Comments
7C10 and h7C10 are equally efficient in immunoprecipitating the IGF-IR
(lanes 1 and 2)
Neither 7C10 nor h7C 10 appreciably immunoprecipitate IR
Both 7C10 and h7C 10 recognizes Hybrid-R.
Example 26-2: Displacement analysis of IGF1 on IGF-IR bv 7C10. h7C10 and 1H7
IGF-IR from R+ cell lysates were immunocaptured in Maxisorb plates coated with 17-69 antibody.
i ry f
I-IGF1 (Fig. 44) was then allowed to bind to immunocaptured receptors in the absence or the presence of increasing concentrations of unlabeled ligand (IGF1 or IGF2) or antibodies (7C10, h7C10, 1H7, 9G4). Results are plotted as percent of maximal specific binding.
Both 7C10 and h7C10 displace labeled IGF1 with a very similar efficiency with ICso values less than 100 nM, and in tins example with ICso of about 1.3 nM and 1.9 nM respectively. By comparison, 1H7 was much less effective with an ICso value up to 100 nM(Fig. 44).
Example 26-3: Displacement analysis of IGF 1 on Hvbrid-RsA bv 7C10. h7C10 and 1H7
Hybrid-RsA from R+/IR-A cell lysates were immunocaptured in Maxisorb plates coated with anti IR antibody 83-7.
125I-IGF1 (Fig. 45) was then allowed to bind to immunocaptured receptors in the absence or the presence of increasing concentrations of unlabeled ligand (IGF1 or IGF2) or antibodies (7C10, h7C10, 1H7, 9G4). Results are plotted as percent of maximal specific binding.
Both 7C10 and h7C10 displace labeled IGF1 with a very similar efficiency with values less than lOOnM, and in tins example of about 2.0 nM for each. By comparison, 1H7 was much less effective with an IC50 value up to 50 nM, preferably up to 100 nM (Fig. 45).
Example 26-4: Displacement analysis of IGF1 on Hvbrid-RsB bv 7C10. h7C10 and 1H7
Hybrid-RsB from R-/IR-B cell lysates were immunocaptured in Maxisorb plates coated with 83-7 antibody.
125I-IGF1 (Fig. 46) was then allowed to bind to immunocaptured receptors in the absence or the presence of increasing concentrations of IGF 1 and IGF2 or antibodies (7C10, h7C10,1H7, 9G4). Results are plotted as percent of maximal binding.
Both 7C10 and h7C10 displace labeled IGF1 with a very similar efficiency with IC50 values less tha 100 nM, and in tins example of about 1.5 and 2.5 respectively. By comparison, 1H7 was much less effective with an ICSO value up to 100 nM (Fig. 46).
EXEMPLE 27: Internalization and degradation studies of the IGF-ER
internalization and degradation studies were analyzed by FACS and western-blot amalysis. internalization studies were performed by FACS analysis using a murine biotinylated anti-IGF-IR monoclonal antibody (Mab) thereafter described as 12B1 MAb and binding to an epitope different from the one recognized by 7C10 and h7C10 antibodies. The 7G3 MAb, a non neutralizing anti-IGF-IR was introduced as negative control. Both antibodies were generated in our laboratory. Confluent MCF-7 cells were trypsinized and 1x106 cells from each cellular suspension was plated in 96-well plates in FACS buffer. Plates were incubated, either with or without 25 μg/ml of cycloheximide (Calbiochem), 30 min at 37°C with either IGF1 (50 ng/ml) or with 10 μg/ml of 7C10, 7G3, h7C10, mlgGl, hlgGl. Cells incubated with FACS buffer alone were used to determine the basal level of expression of the IGF-ER. Then cells were washed twice and 12 μg/nil of biotinylated-12B1 MAb were added to the plate. After 30 min of incubation at 4°C to avoid receptor internalization, cells were washed 3 times at 4°C and stained by addition of a streptavidin Alexa Fluor® 488conjμgate (Molecular Probes Europe BV, Leiden, Netherlands).
Both 7C10 and h7C10 cause a rapid down regulation of the IGF-ER with a maximum after 4 hours of incubation with the antibodies (Table 12). No down regulation was observed when cells were incubated either with IGF1, 7G3 non neutralizing Mab, murine (mlgGl) or human (hlgGl) isotype control. The absence of internalization when cells were incubated with IGF1 is probably due to the rapid recycling of IGF-IR; indeed tins rapid recycling phenomenon is well known by the man skill in the art for tins type of receptor. These results were observed either in presence or in absence of cyclohexemide. Observed results are shown in the following Table 12. Table 12
(Table Removed)Table 12 : Study of antibody induced IGF-IR internalization by FACS analysis
For immnunoblotting experiments 7.5 X 10 cells were plated in 75 cm flasks in 15 ml of complete medium (red phenol-free RPMI and Ham-F12K respectively for MCF-7 and A549 both supplemented with 10% PCS and 1% L-Glutamine). Twenty
four hours after plating, cells were washed 3 times with PBS and incubated for 24 additional hours at 37°C. Then medium was removed and cells incubated either Ih, 4h or 16h at 37°C with 15 ml of serum-free medium with or without antibodies to be tested or with IGF-I. Cells were then harvested and lysed in Tris HC1 buffer pH 7.5,15% NaCl 1M (Sigma), 10% detergent mix (10 mM Tris-HCl, 10% Igepal) (Sigma), 5% sodium deoxycliolate (Sigma), 1 protease ininbitor cocktail complete TM tablet (Roche) and 1% phosphatase ininbitor Cocktail Set II (Calbiochem). For Western blot analysis, equal amount of cell lysates were separated on 10% SDS-PAGE, transferred to nitrocellulose filters, probed with an anti-|3 IGF-IR rabbit polyclonal IgG (Santa Cruz Biotech), revelated with an anti rabbit IgG coupled to the HRP (Amersham Bioscience) and visualized by ECL (Amersham Bioscience).
Figures 47 A and 47B represent the study of antibody induced degradation of the IGF-IR.
For immnuno-blotting analysis (Figures 47A and 47B), experiments were done without cyclohexemide as the above experiment shows that no difference was observed in presence or in absence of tins compound. 7C10 and h7C10 cause a comparable internalization of the IGF-IR in both A549 (A) and MCF-7 (B) cells. In MCF-7 cells the maximal internalization was observed after four hours incubation with 7C10 and h7C10, whereas, for A549 the maximal internalization is observed as earlier as 1 hour. No degradation was observed when cells were incubated either with IGF-I, 7G3 or murine (mlgGl) or human (hlgGl) isotype control.
EXEMPLE 28: Study of the degradation pathway of IGF- IR
7.5 X 106 MCF-7 cells were plated in 75 cm2 flasks in 15 ml of complete medium (red phenol-free RPMI supplemented with 10% PCS and 1% L-Glutamine). Twenty four hours after plating, cells were washed 3 times with PBS and incubated for 24 additional hours at 37°C in 15 ml serum-free medium . Then medium was removed and cells incubated for two hours in 7.5 ml of serum-free medium either containing 30|^M MG115 or DMSO. Then, 7.5 ml of serum-free medium with or without h7C10, hlgGl or IGF1 were added for 4 additionnal hours. Cells were then harvested and lysed in Tris HC1 buffer pH 7.5, 15% NaCl 1M (Sigma), 10% detergent mix (10 mM Tris-HCl, 10% Igepal) (Sigma), 5% sodium deoxycholate (Sigma), 1 protease ininbitor
cocktail complete TM tablet (Roche) and 1% phosphatase ininbitor Cocktail Set II (Calbiochem). For Western blot analysis, equal amount of cell lysates were separated on 10% SDS-PAGE, transferred to nitrocellulose filters, probed with an anti-(3 IGF-IR rabbit polyclonal IgG (Santa Cruz Biotech), revelated with an anti rabbit IgG coupled to the HRP (Amersham Bioscience) and visualized by ECL (Amersham Bioscience). Figure 48 shows the obtained results.
To further characterize the pathway of degration of the h7C10 antibody, cells were incubated 4 hours with either IGF1 or human isotype control (hlgGl) in presence or in absence of the proteasome ininbitor MG115. In the herein described experiment h7C10 induced, a dramatic degradation of the IGF-IR either in presence or in absence of DMSO. No degradation was observed when IGF1 or hlgGl were added. When cells were incubated with 30 uM MG115, no down regulation of the IGF-IR was observed demonstrating that the down regulation of IGF-IR on MCF-7 observed in Figure 2 occurs throμgh the proteasome pathway. Tins property is surprising and of particular interest. Indeed none of the anti-IGF-IR antibody already described for inducing a degradation of the IGF-IR (Malauney EK and al, Cancer Research, 2003; Sachdev D and al, Cancer Research, 2003) involved the proteasome pathway for degradation.
Actually, it has been reported that IGF-IR is internalized and degraded via a lysosome-dependent pathway (Alessi et al., B. Curr. Biol., 1997). In addition, both Mab391 (Hailey et al., Molecular Cancer Therapeutics, 2002) and scFv-Fc (Sachdev et al., Cancer Research, 2003) down regulate IGF-IR by the endocytic pathway.
As a consequence, regarding the present knowledge, it can not be exclude that h7C10 also down regulate, in addition to the proteasome pathway as previously described, via other known and described pathways for anti-IGF-IR antibodies, i.e. lisosome-dependent and/or endocytic pathways.
Such a property, if validated, is of particular interest as it would demonstrate the capacity of the h7C10 to interact with different signalization/degradation pathways, and thus its therapeutic efficacy. Supplementary studies are in progress in order to validate tins hypothesis.
Example 29: Anti-tumoral activity of the murine antibody 7C10 co-administrated with an anti-VEGF antibody on mice orthopically implanted with A549 cells
One million of A549 NSCLC were implanted throμgh the chest wall into the left pleural cavity space of 6 weeks old Swiss nude mice following the protocol described by Klaus-Bertiner et al. (Kraus-Bertiner, L., Jan, M., Guilbaud, N., Naze, M., Pierre, A., and Atassi, G. instology and sensitivity to anticancer drμgs of two human non-small cell lung carcinomas implanted in the pleural cavity of nude mice. Clin. Cancer Res. 6(1):297-304, 20OO). Seven days after the cell injection, mice were treated i.p. with a loading dose of 250 μg of antibodies, and them, twice a week with 125 μg of antibodies. For the combined therapy, antibodies were mixed prior to the injection.
The anti-VEGF antibody used was an IgG2b, clone 26503.11 commercialized by SIGMA. It was described as a neutralizing antibody (Ferrara N. et al., Biochem. Res. Com. 161:851, 1999; Ferrara et al., Endocrinol. Review, 13:18, 1992; Leung D.W. et al., Science 246:1306,1989).
Figure 48 shows that a combined therapy increase dramatically the time survival compared to untreated mice or to mice treated with single therapy.
The T/C°/o are calculated according the following formula, [MEDIAN OF TREATED MICE / MEDIAN OF CONTROL MICE x 100]. The obtained T/C% are about 134% and 144% for the 7C10 and anti-VEF antibody respectively. For the combined treatment 7C10 + anti-VEGF antibodies, the T/C% is 188%.
As a conclusion, similarly to the co-administration of 7C10 + 225 (see example 22), the co-administration of 7C10 + anti-VEGF antibodies increase the mice survival.
Example 30: Production of deoxyvinblastine
4'-R deoxyvinblastine (structure see below Scheme 1) is obtained by ionic reduction of anhydrovinblastine according to a process known to those skilled in the art (Lafitte C et al., Tetrahedron Letters, 1998, Volume 39, pp. 8281-8282).
4'-S deoxyvinblastine, or 4'-S deoxyleurosidine, is obtained by catalytic hydrogenation of anhydrovinblastine according to the technique also known to those skilled in the art (De-Bruyn A. et al., Bulletin of the Belgian Chemical Society, 1983, Volume 92, number 5, pp 485-494). (Figure Removed)
Example 31 : Deacetylation of Vinca dimeric alkaloids
Deoxyvinblastine or deoxyleurosidine is dissolved and stirred for 4 hours at 50°C in 30 ml of methanol containing 1.2 equivalents of sodium methoxide. Tins solution is then poured into ice-cold water in order to precipitate the compound formed. After filtration, wasinng with water and drying under vacuum at 40°C, 4-deacetyldeoxyvinblastine or 4-deacetyldeoxyleurosidine is obtained, with a purity of greater than 95%.
Example 32: Direct coupling of 4'-deoxyvinblastine (4' R) or 4'-deoxyleurosidine (4' S) by reaction of a 4-carboxyhydrazide function on the pre-oxidized anti-IGF-IR antibodies
The 4'-deoxyvinblastine or the 4'-deoxyleurosidine is treated with anhydrous hydrazine in solution in methanol and at ambient temperature. The reaction is monitored by Analytical ingh Performance Liquid Chromatography (HPLC) and, when 95% of the starting alkaloid has reacted, the reaction medium is treated with water in order for the 4'-deoxyvinblastine-3-deacetyl-4-carbohydrazide or the 4'-deoxyleurosidine-3-deacetyl-4-carbohydrazide to be separated by filtration.
After silica gel chromatography and then crystallization, the 4'-deoxyvinblastine-3-deacetyl-4-carbohydrazide or the 4'-deoxyleurosidine-3-deacetyl-4-carbohydrazide is greater than 96% pure.
The anti-IGF-IR antibody is oxidized under cold conditions in a sodium acetate buffer by treatment with sodium meta-periodate. After exclusion chromatography, the oxidized anti-IGF-IR antibody, in solution in an acetate buffer, is treated under cold conditions with the 4'-deoxyvinblastine-3-deacetyl-4-carbohydrazide or the 4'-deoxyleurosidine-3-deacetyl-4-carbohydrazide.
The immunoconjμgate thus obtained is separated from the unconjμgated residual Vinca alkaloid and purified by exclusion chromatography with a phosphate buffer at pH 7.4, and then intensive dialysis. The absence of free Vinca alkaloid is verified by analytical HPLC.
The immunoconjμgate is characterized on an SDS PAGE-type electrophoresis gel (Coomassie blue and/or silver nitrate), by exclusion chromatography (SEC, UV at 280 nm) and by MALDI-TOF mass spectrometry. The mapping of the coupling sites is carried out by means of analysis by liquid chromatography coupled to mass spectrometry (LC MS), subsequent to enzyme digestion (trypsin and PNGase F) (Laguzza et al., J. MED. CHEM., 1989, 32:548).
Example 33: Coupling of the 4'-deoxyvinblastine (4' R) or the 4'-deoxyleurosidine (4' S) to the anti-IGF-IR antibodies by virtue of succinic anhydride
The 3-deacetyl-4'-deoxyvinblastine or the 3-deacetyl-4'-deoxyleurosidine is treated with succinic anhydride in pyridine for 24 hours at 20°C. The reaction is monitored by analytical HPLC and, when 95% of the starting alkaloid has reacted, the reaction medium is treated with water in order to precipitate the 3-deacetyl-4'-deoxyvinblastine hemisuccinate or the 3-deacetyl-4'-deoxyleurosidine hemisuccinate. After filtration and drying, the compound is purified by reverse-phase preparative HPLC using CIS grafted silica and an eluent made up of acetonitrile, methanol and ammonium acetate buffer.
The 3-deacetyl-4'-deoxyviriblastine hemisuccinate or the 3-deacetyl-4'-deoxyleurosidine hemisuccinate is treated with hydroxybenzotriazole and dicyclohexylcarbodiimide in dimethylformamide at ambient temperature for 24 hours and in the presence of a catalytic amount of dimethylaminopyridine. After filtration, the solution is mixed with the anti-IGF-IR monoclonal antibody at pH 8.6 for 4 hours. The immunoconjμgate is separated from the unconjμgated Vinca alkaloid by exclusion chromatography with a phosphate buffer at pH 7.4. Intensive dialysis makes it possible to eliminate the unconjμgated Vinca alkaloid. The immunoconjμgate is characterized by SDS PAGE gel electrophoresis, by exclusion chromatography and by MALDI TOP mass spectrometry. The mapping of the coupling sites is carried out by means of liquid chromatography analysis coupled to mass spectrometry (LC MS), subsequent to enzyme
(trypsin) digestion, compared to a reference tryptic map obtained for the non-derived monoclonal antibody (Schneck et al, Clin. Phannacol. Ther., 1990, 47:36; Rowland et al., Cancer. Immunol. Lnmunother., 1985,19:1).
Example 34: Coupling of the 4'-deoxyvinblastine (4' R) or the 4'-deoxyleurosidine (4' S) on a nitrogen-containing residue of the anti-IGF-IR antibodies by virtue of a disulpinde bridge included in the linkage
The 3-deacetyl-4'-deoxyvinblastine or the 3-deacetyl-4'-deoxyleurosidine is treated, in methylene chloride, at ambient temperature for 24 hours, in the presence of a catalytic amount of dimethylaminopyridine, with a large excess of 3-methyldisulphanylpropanoic acid and a large excess of dicyclohexylcarbodiimide. The reaction medium is treated conventionally and the 3-deacetyl-4'-deoxyvinblastine 3-methyldisulphanylpropanoate or the 3-deacetyl-4'-deoxyleurosidine 3-methyldisulphanylpropanoate is then purified by reverse-phase preparative HPLC using CIS grafted silica and an eluent made up of acetonitrile, methanol and ammonium acetate buffer.
The 3-deacetyl-4'-deoxyvinblastine 3-methyldisulphanylpropanoate or the 3-deacetyl-4'-deoxyleurosidine 3-methyldisulphanylpropanoate is treated with ditinothreitol in a mixture of water and methanol so as to obtain 3-deacetyl-4'-deoxyvinblastine 3-sulphanylpropanoate or 3-deacetyl-4'-deoxyleurosidine 3-sulphanylpropanoate, winch is purified by reverse-phase preparative HPLC using CIS grafted silica and an eluent made up of acetonitrile, methanol and ammonium acetate buffer.
The anti-IGF-IR antibody is derivatized with N-succinimidyl 4-(2-pyridylditino)propanoate (the trade name of winch is SPDP) in a 50 rnM potassium phosphate buffer, pH 6.5, containing 50 mM NaCl and 2 mM EDTA, for 90 minutes. Added to tins solution of antibody thus derivatized is the 3-deacetyl-4'-deoxyvinblastine 3-sulphanylpropanoate or the 3-deacetyl-4'-deoxyleurosidine 3-sulphanylpropanoate dissolved in a minimum of DMSO. After contact for 24 hours, the immunoconjμgate is isolated by exclusion chromatography and is characterized on an SDS PAGE electrophoresis gel, by exclusion chromatography and by MALDI TOP mass spectrometry (Ojima et al., J. Med. Chem., 2002,45:5320).
Example 35: Coupling of the 4'-deoxyvinblastine (4' R) or the 4'-deoxyleurosidine (4' S) to the anti-IGF-IR antibodies by virtue of a terminal hydrazide function carried by a linkage connected to the Vinca alkaloid
The 3-deacetyl-4'-deoxyvinblastine or the 3-deacetyl-4'-deoxyleurosidine is treated, in methylene chloride at ambient temperature for 24 hours, in the presence of a catalytic amount of dimethylaminopyridine, with an excess of methyl monoester of 1,6-hexanedicarboxylic acid and an excess of dicyclohexylcarbodiimide. The reaction medium is treated conventionally and the 3-deacetyl-4'-deoxyvinblastine 3-methoxycarbonyl pentanoate or the 3-deacetyl-4'-deoxyleurosidine 3-methoxycarbonyl pentanoate is then purified by reverse-phase preparative HPLC using CIS grafted silica and an eluent made up of acetonitrile, methanol and ammonium acetate buffer.
The 3-deacetyl-4'-deoxyvinblastine 3-methoxycarbonyl pentanoate or the 3-deacetyl-4'-deoxyleurosidine 3-methoxycafbonyl pentanoate is treated by default with anhydrous hydrazine in solution in methanol at ambient temperature. The reaction is monitored by analytical HPLC and, when 70% of the starting alkaloid has reacted, the reaction medium is evaporated and the 3-deacetyl-4'-deoxyvinblastine 3-hydrazinocarbonyl pentanoate or the 3-deacetyl-4'-deoxyleurosidine 3-hydrazinocarbonyl pentanoate is purified by reverse-phase preparative HPLC using CIS grafted silica and an eluent made up of acetonitrile, methanol and ammonium acetate buffer.
The oxidation of the anti-IGF-IR antibody, the coupling with 3-deacetyl-4'-deoxyvinblastine 3-hydrazinocarbonyl pentanoate or 3-deacetyl-4'-deox3'leurosidine 3-hydrazinocarbonyl pentanoate, the purification and the identification are carried out according to the same techniques as those described in Example 32.
Example 36: Activity, compared in vivo, of the 7C10 and h7C10 antibodies on the A549 and MCF-7 models
in order to confirm the activity of the humanized antibody h7C10 in vivo, the latter was compared with 7C10 in the MCF-7 oestrogen-dependent breast tumor model and in the A549 non-small-cell lung tumor model.
To do tins, 5.106 A549 cells were implanted subcutaneously in nude mice. Five days after tins implantation, the tumors were measured and groups of 6 mice were
formed. These groups were treated, respectively, with 1) the 7C10 antibody injected ip (intraperitoneally) at a rate of 125 ng/dose twice a week; 2) the h7C10 antibody injected under the same conditions as its murine form; 3) PBS (it has been shown previously that murine and human control isotypes do not modify the tumor growth profile compared to treatment of the animals with PBS). In the MCF-7 breast tumor model, a sustained-release oestradiol granule (0.72 mg/tablet released over 60 days) is implanted subcutaneously 24 hours before implantation of the cells. Tins granule is essential to the establishment of any E2-dependent human tumor in tins animal species.
Figures 50 and 51 show, as expected, that significant ininbition of tumor growth is observed with the 7C10 murine antibody. As regards the h7C10 humanized antibody, the activity observed is of exactly the same intensity as that observed with its murine counterpart, whatever the model used. Tins datum indicates that the humanization has not modified the properties of the antibody generated.
Example37: Demonstration of the compared activities of vinblastine, of vincristine, of 4' S deoxyvinblastine and of 4' R deoxyleurosidine
The greater activity of the (4' R) deoxyvinblastine and of the (4' S) deoxyleurosidine was demonstrated in vivo against intravenously-grafted P388 murine leukaemia and compared with the activity of vinblastine and of vincristine tested under the same conditions. The protocol for tins test is described by Kruczynski A. et al., Cancer Chemotherapy and Pharmacology, 1998, volume 41, pages 437 to 447.
To do tins, a total of 1O6 P388 murine leukaemia cells were implanted i.v. in CDF1 mice on day 0. After randomization of the animals in cages for treatment with each alkaloid and control cages, the compounds were administered i.p. on day 1.
Conventionally, the in vivo activity of compounds is expressed by the increase in survival time. The survival time is expressed by the T/C at a dose expressed in mg per kg (mg/kg). The T/C corresponds to the ratio, multiplied by 100, of the median of the survival time of the treated animals to the median of the sundval time of the control animals, IN agreement with the standard criteria of the NCI, a T/C of 120 corresponds to a minimum level for concluding that activity is present.
A T/C of between 120 and 175 makes it possible to conclude that there is significant activity and a T/C above 175 makes it possible to conclude that there is a ingh level of anti-leukaemia activity. A T/C below 75 expresses toxicity of the test compound at the dose administered.
Table 13 below gives the results obtained with a minimum of 7 and a maximum of 15 treated, mice for each group of animals treated with a Vinca alkaloid or for the control group.
Table 13 gives the results of T/C values obtained for each Vinca alkaloid tested. Figures 52 and 53 show the greater anti-leukaemia activity of the 4'R and 4'S deoxyvinblastines compared to vinblastine and vincristine. Table 13
(Table Removed)Example 38: Demonstration of the in vivo antitumor activity of 4' R- and 4' S-deoxyvinblastine conjμgated with IGR-IR antibodies on human tumors of various origins
in order to demonstrate the benefit of addressing the chemotherapy compounds (4' R) and (4' S) deoxyvinblastine (respectively called RDV and SDV in Figure 5) with a humanized antibody directed against IGF-IR, 5.106 A549 non-small-cell lung cancer cells were implanted in a subcutaneous position on the right flank of Swiss Nude mice. Seven days after implantation of the cells, the tumors can be measured and the animals are distributed randomly into 6 groups of 6 mice and treated according to the following protocol:
- h7C10: twice a week at a rate of 250 p,g/dose throμghout the entire duration of the experiment;
RDV and SDV: 4 intraperitoneal injections 7 days apart at the dose of 0.35 mg/kg,
winch corresponds to the dose of each of the compounds present in the conjμgates;
the groups of animals given the chemotherapy compounds coupled to the antibody
receive respectively 0.35 mg/kg of each of the chemotherapy agents and 250 μg/dose of
antibodies. These conjμgates are administered according to the same modes as the
groups given the chemotherapy compounds alone;
the animals of the control batch are given injections of PBS, administered according to
the same frequency.
The weight of the mice and the tumor volume are evaluated twice a week. The tumor volumes are calculated according to the formula: 1/2(length. width. height).
The results are shown in Figure 53.
The animals given only RDV or SDV evolve in the same manner as the control group, winch seems coherent with respect to the optimum doses usually injected for these two compounds, winch are respectively 20 mg/kg and 2.5 mg/kg. Surprisingly, when each of the compounds is coupled to the h7C10 antibody, a very significant ininbition of the tumor growth is observed. Tins ininbition is significantly greater than that observed with the antibody alone, administered at the same concentration.
All these results appear to indicate that targeting of the cells with the h7C10 antibody promotes concentration of the drμg in the cell to be targeted and makes it possible to observe, as a result, significant ininbitions of tumor proliferation at low doses of chemotherapy product, and in particular at doses winch are completely non-toxic in mice, as is demonstrated by the lack of weight loss of the animals (data not communicated).
EXEMPLE 39: In vivo down-regulation of IGF-IR
To confirm if previous in vitro observations (Examples 24 and 25) of down-regulation of IGF-IR levels by 7C10 and h7C10 was one of the mechanisms responsible for ininbition of tumor growth in vivo, the effect of h7C10 on IGF-IR levels in mice with MCF-7 xenograft tumors was tested. Nine mice bearing a xenograft tumor were studied. Tumors were resected from 3 mice before treatment (described as TO in Figure 59). Then 3 mice received i.p. injections of 1 mg of A2CHM and 3 other mice received
i.p. injections of a hlgGl used as isotype control. Six hours after treatment, mice were sacrificed and tumors harvested. Tumor samples were frozen in liquid nitrogen and homogeneized in a lysis buffer. A total of 50 μg of tumor extracts immunoblotted for total IGF-IRb levels. In tins experiment, he cytokeratin 19 (CK19) was immunoblotted with an antibody recognizing specifically the CK19 from MCF-7 cells as control of the amount of tumor protein loaded in each lane. Figure 59 shows that the amount of protein loaded is comparable in all lanes excepted in lane 9 winch could not be considered as interpretable. All MCF-7 xenograft tumors had ingh levels of IGF-IR in non treated mice (lanes 1-3). Six hours after treatment, tumor taken from animals treated with h7C10 had significant down regulation of IGF-IR (lanes 4-6). In two mice winch received the isotype control no changes in the level of IGF-IR were observed witinn tumor tissue (lanes 7 and 8). These results confirm that the down-regulation of IGF-IR is one of the mechanisms involved in the in vivo activity of h7C10.
Example 40: Cell lines with IGF-IR overexpressed and/or abnormally overactivated:
The following cell lines are known as overexpressing and/or displaying overactivated IGF-IR:
Prostate (PCS, DU145),
breast (MCF-7, T47D, BT20, ZR-75-1, MDA-MB-231,
lung (A549, A427, SK-LU-1)
colon (HT29, Colo205, CaCo-2),
thyroid (BC-PAP, FRO, ARO),
ovarian (SK-OV-3),
pancreas (BxPC3, MiaPaCa-2, LN36),
renal, adrenal cancer, sarcomas (SK-ES-1), medulloblastoma (Daoy, TE-
671,D283Med),
retinoblastoma, multiple myeloma (MM-1S, MM-1R), melanoma (SK-MEL-
28)
The level of expression of some of the described cells above can be determined as follow:
To determine the level of expression of IGF-IR on various cell lines, cells were
labeled with 5 μg/ml of 7C10 antibody. 9G4 was used as irrelevant isotype control. Anti-mouse MAb coupled to FITC was used for revelation of the bound 7C10. In parallel, beads from DAKO QIFIKIT bearing quantified amounts of CDS receptors were used for standard curve determination. After FACS analysis, beads yield a MFI. A standard curve relating MFI and receptor number was determined. MFI measured after cell staining with 7C10 was reported on the standard curve and receptor number on each tumor cell line was determined.
Quantification of the number of IGF-IR on tumor cell line surface shows that all the cell lines analyzed express between 1200 to 96000 receptors/cell. Some preferred results are :
IGF-IR (MFIisd)
-JURKAT 1201±833
-PC3 3903±1178
CAKI1 15887±nd
-T29 17102±2210
-A431 18530±2126
LnCAP 19738±1080
-COLO205 23355±5711
-BxPC3 25185±3463
-A549 32179±5418
CAKI 2 42673±693
-MCF-7 96072±2807
Example 41: Cell lines expressing hybrid-R:
The following cell lines are known as overexpressing and/or displaying overactivated hybrid-R and/or IGF-IR (Siddle et al.Horm. Res. 41: 56-65, 1994 ; Lynn Seely et al. Endocrinology. 136: 1635-1641, 1995 and Pandini et al. Clinical Cancer Res. 5:1935-1944. 1999):
Breast cancer (MDA-MB-231, MDA-MB-157, MDA-MB-468, MDA-MB-
453, ZR-75),
thyroid cancer (BC-PAP)
- 137 -
Example 42:
To determine the variation of IGF-IR between normal and tumor tissues, paraffin embedded section of either breast or lung cancer have been stained with a biotinylated-conjμgated anti-IGF-IR monoclonal antibody. The result shown in figure 58 demonstrate that samples from patients with either lung or breast cancer display significantly ingher levels of IGF-IR.
Example 43 : Tumoral Markers
(Table Removed)Table 14
The following non limitative references are incortporated by reference and are describing several preferred markers.
PSA: Anaes, Service des recommendations professionnelles et service evaluation economique, September 2004;
ACE: Fletcher 1986, Carcinoembryonic antigen. Ann. Intern. Med., 104(l):66-73; American Society, 1996, J. Clin. Oncol. 14(10):2S43-77;
- CA19.9: Narimatsu et al., 1998, Cancer Res., 58(3):512-8 ; Vestergaard et
al., 1999, Clin. Chem., 45(1): 54-61;
- CA15.3: Hayes et al., 1986, J. Clin. Oncol., 4(10): 1542-50; Safi et al., 1989,
Int. J. Biol. Markers, 4(4):207-14; Devine et al., 1995, Breast Cancer Res. Treat., 34(3):245-51; Yasasever et al., 1994, Eur. J. Gynaecol. Oncol., 15(l):33-6;
TG: National Academy, 2001, [on-line],
URL:http//www.nacb.org/thyroid_LPMG.htm; Piechaczyk et al., 1989, Clin. Chem., 35(3):422-4; Marquet et al., 1996, Clin. Chem., 42(2):258-62;
- CT: Motte et al., 1988, Clin. Chem. Acta, 174(l):35-54; Niccoli et al., 1997,
J. Clin. Endocrinol. Metab., 82(2):338-41;
- LDH: Meyers et al., 1992, J. Clin. Oncol., 10(1):5-15;
Other genetic markers can be used as, for example (De Vita, Hellman & Rosemberg, "Cancer, Principles and Practice of Oncology", 6th edition, Edition Lippincott Williams & Wilkins, Chapter 26, page 653):
Breast: Her2/NEU/ERBB2 amplification or BRCA1, BRCA2 mutation
Prostate: PSA mRNA
Bladder: TP53 mutation
Colon: KRAS mutation
Kidney: NF1, NF2 mutation.
WE CLAIM:
1. An isolated antibody, or one of its functional fragments, wherein said
antibody or one of its said fragments being characterized in that:
- said antibody is capable of binding to the hybrid-R, isoform(s) A and/or B, and inhibiting the binding of its native ligands, IGF1 and IGF2 and insulin, and
- said isolated antibody comprises a light chain comprising the three complementary determining region CDRs of sequence SEQ ID Nos. 2, 4 and 6, and comprising a heavy chain comprising the three CDRs of sequence SEQ ID Nos. 8, 10 and 12.
2. The antibody as claimed in one of claims 1 to 7, wherein said functional fragment is chosen from the fragments Fv, Fab, F(ab')2, Fab', scFv, scFv-Fc, scFv-CH3, the diabodies, or any pegylated fragments thereof.
3. The antibody, or one of its functional fragments, as claimed in claim 1 or 2, wherein said antibody comprises a light chain of sequence comprising the amino acid sequence SEQ ID No. 54, and in that it comprises a heavy chain of sequence comprising the amino acid sequence SEQ ID No. 69.
4. The antibody or one of its functional fragments, as claimed in claim 3, wherein said antibody is a chimeric antibody and moreover comprises the light chain and heavy chain constant regions derived from an antibody of a species heterologous to the mouse.
5. The chimeric antibody, or one of its functional fragments, as claimed in claim 4, wherein said heterologous species is man.
6. The chimeric antibody, or one of its functional fragments, as claimed in claim 5, wherein the light chain and heavy chain constant regions derived from a human antibody are respectively the kappa or lambda and gamma-1, gamma-2 or gamma-4 region.
7. The antibody or one of its functional fragments, as claimed in claim 1 or 2, wherein said antibody is a humanized antibody and comprises a light chain and a heavy chain in which the skeleton segments FR1 to FR4 of said light chain and/or heavy chain are respectively derived from skeleton segments FR1 to FR4 of human antibody light chain and heavy chain.
8. The humanized antibody, or one of its functional fragments, as claimed in claim 7, wherein said antibody comprises a light chain comprising the amino acid sequence SEQ ID No. 61 or 65, and in that it comprises a heavy chain comprising the amino acid sequence SEQ ID No. 75, 79 or 83.
9. The humanized antibody, or one of its functional fragments, as claimed in claim 7 or 8, wherein said antibody comprises a light chain comprising the amino acid sequence SEQ ID No. 65 and in that it comprises a heavy chain of sequence comprising the amino acid sequence SEQ ID No. 79.
10. The humanized antibody, or one of its functional fragments, as claimed in claim 9, wherein said antibody comprises a light chain comprising the amino acid sequence SEQ ID No. 65 and in that it comprises a heavy chain of sequence comprising the amino acid sequence SEQ ID No. 83.
| # | Name | Date |
|---|---|---|
| 1 | 3807-DELNP-2006-Form-3-(02-07-2010).pdf | 2010-07-02 |
| 2 | 3807-DELNP-2006-Correspondence-Others-(02-07-2010).pdf | 2010-07-02 |
| 3 | 3807-DELNP-2006-Correspondence Others-(12-10-2010).pdf | 2010-10-12 |
| 4 | 3807-DELNP-2006-Claims-(12-10-2010).pdf | 2010-10-12 |
| 5 | 3807-DELNP-2006-Abstract-(12-10-2010).pdf | 2010-10-12 |
| 6 | 3807-delnp-2006-pct-304.pdf | 2011-08-21 |
| 7 | 3807-delnp-2006-pct-301.pdf | 2011-08-21 |
| 8 | 3807-delnp-2006-pct-210.pdf | 2011-08-21 |
| 9 | 3807-delnp-2006-pct-101.pdf | 2011-08-21 |
| 10 | 3807-delnp-2006-gpa.pdf | 2011-08-21 |
| 11 | 3807-delnp-2006-form-5.pdf | 2011-08-21 |
| 12 | 3807-delnp-2006-form-3.pdf | 2011-08-21 |
| 13 | 3807-delnp-2006-form-2.pdf | 2011-08-21 |
| 14 | 3807-delnp-2006-form-18.pdf | 2011-08-21 |
| 15 | 3807-delnp-2006-form-1.pdf | 2011-08-21 |
| 16 | 3807-delnp-2006-drawings.pdf | 2011-08-21 |
| 17 | 3807-delnp-2006-description (complete).pdf | 2011-08-21 |
| 18 | 3807-delnp-2006-correspondence-others.pdf | 2011-08-21 |
| 19 | 3807-delnp-2006-correspondence-others-1.pdf | 2011-08-21 |
| 20 | 3807-delnp-2006-claims.pdf | 2011-08-21 |
| 21 | 3807-delnp-2006-abstract.pdf | 2011-08-21 |
| 22 | 3807-DELNP-2006-Correspondence-Others-(08-10-2012).pdf | 2012-10-08 |
| 23 | 3807-DELNP-2006_EXAMREPORT.pdf | 2016-06-30 |