[DESCRIPTION]
[invention Title]
NOVEL BACILLUS SUBTILIS
[Technical Field]
[01] The present invention relates to a novel Bacillus
subtilis CJMPB150 (KCCM11268P) strain, and a probiotic
formulation comprising the same.
[Background Art]
[02] Recently, international grain prices have risen due
to an increase in demand for grains caused by production of
bio-fuels and economic growth of emerging nations, a
decrease in farm lands, soaring crude oil prices, and the
like. A rise in the international grain prices causes a
rise in domestic assorted feed prices, thereby incurring
damage to managing livestock farm. For this reason, in
order to stimulate growth of livestock and use feed grains
efficiently, researches into probiotics, prebiotics, enzyme
products, and the like have been actively conducted.
[03]
[04] In general, a large amount of digestion-resistant
carbohydrates, that is, cellulose, hemicellulose, and
lignin is contained in feed grains. The digestion-
resistant carbohydrates interrupt functions of a digestive
system, for example, suppress digestion, and cause loose
feces or dysentery in livestock. In order to solve this

problem, various feed enzyme products for decomposing the
digestion-resistant carbohydrates have been widely used.
[05] Cellulase capable of hydrolyzing cellulose and
xylanase decomposing lignin and xylan, which is a main
component of hemicellulose, have been widely used as feed
additive enzymes. It has been known that these enzymes
contribute to promoting the composting of livestock
excretions (Taeil Kim et al, Korean Journal of Microbiology,
35 (4) :277-282, 1999) in addition to increasing intestinal
availability of grain feed in livestock to improve
efficiency of feed (Beguin and Aubert, FEMS Microbiol., Rev.
13:25-58, 1994).
[06] Mannanase is an enzyme decomposing a material
containing mannan, which is a main component configuring
hemicellulose. Soybean protein is used as livestock feed
for pork, chicken, and the like, and mannanase allows non-
ruminant animal to easily metabolize the soybean meal by
decomposing galactan among carbohydrates, which become an
energy source.
[07]
[08] Recently, an effort to utilize strains producing the
enzymes as described above as probiotics has been attempted.
[09] The probiotics means a concept including microbes
assisting in a balance of intestinal microflora, microbes
having an antibiotic activity and/or an enzyme activity,

and products produced by the microbes (Fuller, R., J. Appl.
Bacterid., 66 (5) : 365-378, 1989).
[10]
[11] The prior arts associated with the probiotics as
described above are as follows.
[12] A Bacillus sp. 79-23 strain producing neutral
cellulase has been disclosed in Korean Patent No. 10-
0318554, and a Bacillus licheniformis DK42 strain (KACC
.91410P) secreting cellulase and xylanase has been disclosed
in Korean Patent No. 10-1062309. In addition, Bacillus
amyloliquefaciens B4 strain (KCTC 18083P) having enzyme
activities of amylase, protease, cellulase, and lipase has
been disclosed in Korean Patent No. 10-0426930.
[13] However, bacillus strains secreting cellulase and/or
xylanase have been disclosed in the prior arts as described
above, but a strain comprehensively secreting all of
cellulase, xylanase, and mannanase or a technology for a
probiotic formulation using the same is not disclosed yet.
[14]
[Disclosure]
[Technical Problem]
[15] An embodiment of the present invention provides a
Bacillus subtilis CJMPB150 (KCCM11268P) strain having
excellent complex digestive enzyme production capacity,
acid resistance, and bile resistance.

[16] An embodiment of the present invention provides a
culture product of the Bacillus subtilis CJMPB150
(KCCM11268P) strain.
[17] Further, An embodiment of the present invention
provides a probiotic formulation, a feed additive, and feed
containing the Bacillus subtilis CJMPB150 (KCCM11268P)
strain or a culture product thereof.
[Technical Solution]
[18] According to an embodiment of the present invention,
there is provided a Bacillus subtilis CJMPB150 (KCCM11268P)
strain having excellent complex digestive enzyme production
capacity, acid resistance, and bile resistance.
[19]
[20] According to another embodiment of the present
invention, there is provided a culture product of the
Bacillus subtilis CJMPB150 (KCCM11268P) strain.
[21] According to another embodiment of the present
invention, there is provided a probiotic formulation
containing the Bacillus subtilis CJMPB150 (KCCM11268P)
strain or the culture product thereof.
[22] According to another embodiment of the present
invention, there is provided a feed additive containing the
probiotic formulation as described above.
[23] According to another embodiment of the present
invention, there is provided a feed containing the feed

additive described above.
[Advantageous Effects]
[24] The present invention provides a probiotic
formulation, a feed additive, and feed containing a novel
Bacillus subtilis CJMPB150 (KCCM11268P) strain having
excellent complex digestive enzyme production capacity,
acid resistance, and bile resistance or a culture product
thereof. Therefore, efficiency of feed for livestock may be
improved due to improvement of digestibility in livestock,
a balance in intestinal microflora may be maintained,
and/or the antibiotic activity may be improved, thereby
making it possible to contribute to the development of the
livestock industry.
[Description of Drawings]
[25] FIG. 1 shows an electron microscope photograph of a
Bacillus subtilis CJMPB150 (KCCM11268P) strain according to
the present invention.
[26] FIG. 2 shows a graph representing growth capacity of
two candidate strains depending on time in Example 1.
[27] FIG. 3 shows a photograph representing a digestive
enzyme - activity of the Bacillus subtilis CJMPB150
(KCCM11268P) according to the present invention.
[28] FIG. 4 shows a graph representing a survival rate
when the Bacillus subtilis CJMPB150 (KCCM11268P) according
to. the present invention was treated with artificial

gastric juice or artificial bile juice.
[29] FIG. 5 shows a graph representing digestibility of
feed according to Example 6.
[30] FIG. 6 shows a photograph representing the presence
or absence of a hemolysis of the Bacillus subtilis CJMPB150
(KCCM11268P) according to the present invention.
[31] FIG. 7 shows a 16s rDNA nucleotide sequence of the
Bacillus subtilis CJMPB150 (KCCM11268P) according to the
present invention.
[32]
[Best Mode]
[33] Hereinafter, the present invention will be described
in detail. Since contents that are not described in the
present specification may be sufficiently recognized and
inferred by those skilled in the art or similar art, a
description thereof will be omitted.
[34]
[35] In one aspect of the present invention, there is
provided a novel isolated Bacillus subtilis CJMPB150
(KCCM11268P, hereinafter, 'CJMPB150') strain.
[36]
[37] The CJMPB150 morphologically corresponds to Gram-
positive bacillus (see FIG. 1) and as a result of analyzing
a 16s rDNA nucleotide sequence (SEQ ID No: 1, FIG. 7), the
CJMPB150 is a strain having homology of 99% with Bacillus

subtilis.
[38] The CJMPB150 was deposited in Korean Culture Center
of Microorganisms (361-221, Hongje 1-dong, Seodaemun-gu,
Seoul) deposited under an accession number KCCM11268P on
March 22, 2012.
[39]
[40] The CJMPB150 has complex digestive enzyme production
capacity.
[41] Examples of digestive enzyme capable of being
produced by the CJMPB150 may include one or more selected
from a group consisting of cellulase, xylanase, . and
mannanase, protease, amylase, and lipase.
[42] Specifically, the CJMPB150 may produce all of
cellulase, xylanase, mannanase, protease, amylase, and
lipase.
[43]
[44] The CJMPB150 has excellent heat resistance.
[45] Specifically, an endospore formation rate of the
CJMPB150, cultured at 37°Cand 200 rpm for 24 hours and then
heat-treated at 95°Cfor 10 minutes, may be specifically 80%
or more, and further specifically 85% or more.
[46] In addition, an endospore formation rate of the
CJMPB150 cultured at 37°Cand 200 rpm for 48 hours and then
heat-treated at 95*Cfor 10 minutes may be specifically 100%.
[47] Since the endospore has resistance against an extreme

environment such as ultraviolet rays, a low temperature, a
dry and/or high pressure condition as well as a high
temperature condition, the higher the endospore formation
rate, the higher a survival rate of the strain.
[48]
[49] The CJMPB150 has excellent acid resistance.
[50] Specifically, a survival rate of the CJMPB150
cultured the CJMPB150 in a medium containing artificial
gastric juice for 3 hours may be specifically 80% or more.
The medium containing artificial gastric juice was prepared
by adding 1% (w/v) pepsin to a solution and adjusted at pH
2.5.
[51] The CJMPB150 has excellent bile resistance.
[52] Specifically, a survival rate of the CJMPB150
cultured in a medium containing artificial bile juice
containing 1% (w/v) pancreatin for 3 hours may be
specifically 80% or more.
[53]
[54] The novel isolated CJMPB150 strain according to the
present invention may be cultured by a general method for a
Bacillus strains. Specifically, the CJMPB150 may be
cultured in a culture temperature range of 20 to 40°Cfor 12
hours to 4 days.
[55]
[56] According to another aspect of the present invention,

there is provided a culture product of the CJMPB150.
[57] The culture product is a concept including a culture
medium or culture solution in which the CJMPB150 strain was
cultured and a culture resultant obtained in the culture
medium or the culture solution. Besides, the culture
product may contain or not contain the CJMPB150 strain.
[58] A type of the culture product is not particularly
limited, but may be a type generally used in the art. For
example, the culture product may be a liquid or solid,
specifically may be in an original state of the culture
product, or a concentrated or dried form thereof.
[59]
[60] Culture Medium
[61] As a medium for culturing the CJMPB150 according to
the present invention, a natural medium or synthetic medium
may be used.
[62] A carbon source of the medium is not particularly
limited, and carbon sources known in the art may be used.
A non-restrictive example of the carbon source may include
glucose, sucrose, dextrin, glycerol, starch, or the like.
One or a mixture of at least two thereof may be used.
[63] A nitrogen source of the medium is not particularly
limited, and nitrogen sources known in the art may be used.
A non-restrictive example of the nitrogen source may
include peptone, a meat extract, a yeast extract, dried

yeast, a soybean, an ammonium salt, nitrate, other organic
or inorganic nitrogen-containing compounds, or the like.
One or a mixture of at least two thereof may be used.
[64] An inorganic salt contained in the medium is not
particularly limited, and inorganic salts known in the art
may be used. A non-restrictive example of the inorganic
salt may include magnesium, manganese, calcium, iron,
potassium, and the like. One or a mixture of at least two
thereof may be used.
[65] Amino acid, vitamin, nucleic acid, and/or other
components capable of being generally contained in a
culture medium may be additionally added in the medium for
culturing the CJMPB150 according to the present invention.
[66]
[67] Culture Solution
[68] A culture solution of the CJMPB150 strain according
to the present invention may be a culture solution or a
solution obtained by removing a " culture supernatant from
the culture solution and/or concentrating the culture
solution. The CJMPB150 strain may be contained in the
culture solution.
[69] A composition of the culture solution is not
particularly limited, but may additionally contain a
component having a synergy effect on growth of Bacillus as
well as components generally known to be required for

culturing Bacillus strain. This composition may be easily
selected by those skilled in the art.
[70] The culture solution may be in a liquid or dried
state.
[71] A drying method of the culture solution is not
particularly limited, and drying methods generally used in
the art may be used. As a non-restrictive example of the
drying method, there is an air drying method, natural
drying method, a spray drying method, a freeze-drying
method, or the like. One or a combination of two or more
of these methods may be used.
[72]
[73] According to another aspect of the present invention,
there is provided a probiotic formulation containing the
CJMPB150 (KCCM11268P) strain or a culture product thereof.
[74] The probiotics means a microbe or a component thereof
having a beneficial effect on health of a host such as
human, animal, or the like. It is known that the probiotics
settles in the digestive tract wall of the host and serves
to suppress settlement of other harmful bacteria or
propagation of pathogenic bacteria, and beneficial
digestive enzymes produced by the probiotics support
absorption and a use of nutrients.
[75] The probiotic formulation according to the present
invention may contain the CJMPB150 strain and/or the

culture product thereof.
[76] The probiotics according to the present invention may
contain the CJMPB150 strain at an amount of spcifically 5 x
104 to 5 x 1010 CFU/ml, more specifically 1 x 106 to 1 x 109
CFU/ml.
[77]
[78] The probiotic formulation according to the present
invention may further contain a pharmaceutically acceptable
carrier and be formulated together with the carrier.
[79] The term "pharmaceutically acceptable carrier" as
used herein means a carrier or a diluent that does not
stimulate living organism nor inhibit biological activity
and properties of an administered compound.
[80] As a carrier capable of being used in the probiotic
formuation formulated into a liquid-phase solution, an
example of the carrier sterilized or suitable for a living
body may. include normal saline, sterile water, buffered
saline, an albumin injection solution, a dextrose solution,
a maltodextrin solution, glycerol, or the like. One or a
mixture of at least two thereof may be used, and if
necessary, other general additives such as an antioxidant,
a buffer solution, a bacteriostatic agent, and/or the like,
may be added.
[81] In addition, a diluent, a dispersant, a surfactant, a
binder, and/or a lubricant are additionally added thereto,

so that the probiotic product may be formulated into an
injection such as an aqueous solution, a suspension, an
emulsion, or the like, a pill, a capsule, a granule, or a
tablet.
• [82] .
[83] An oral formulation containing the probiotic
formulation according to the present invention as an active
component is not particularly limited, and formulations for
oral administration known in the art may be used. As a
non-restrictive example of the oral formulation, there may
be tablets, troches, lozenge, aqueous or oily suspensions,
prepared powder or granules, emulsions, hard or soft
capsules, syrups, elixirs, or the like.
[84] In order to formulate the probiotic formulation into
the tablet, the capsule, or the like, the formulation may
further contain a binder such as lactose, saccharose,
sorbitol, mannitol, starch, amylopectin, cellulose, or
gelatin, an excipient such as dicalcium phosphate, a
disintegrant such as corn starch or sweet potato starch, a
lubricant such as magnesium stearate, calcium stearate,
sodium stearyl fumarate, or polyethylene glycol wax, or the
like. In the case of the capsule formulation, the
formulation may additionally contain a liquid carrier such
as fatty oil.
[85]

[86] According to another aspect of the present invention,
there is provided a feed additive containing the probiotic
formulation.
[87] The probiotic formulation containing the CJMPB150
strain according to the present invention and/or the
culture product thereof may be prepared in a form of a feed
additive and then mixed with livestock feed or directly-
added to the feed.
[88] A type of the feed additive is not particularly
limited, but the feed additive may be specifically, in a
liquid or dried state, and more specifically, in a dried
powder form.
[89] A drying method is not particularly limited, and
drying methods known in the art may be used. As a non-
restrictive example of the drying method, there is an air
drying method, a natural drying method, a spray drying
method, a freeze-drying method, or. the like. One or a
combination of two or more of these methods may be used.
[90]
[91] The feed additive may additionally contain other
additives capable of improving preservability of feed.
[92] The additive capable of being additionally added to
the feed additive according to the present invention is not
particularly limited, and additives known in the art may be
used. As a non-restrictive example of the additive, there

are a binder, an emulsifier, a preservative, and the like,
which are added in order to prevent quality of the feed
additive from being deteriorated; amino acids, vitamins,
enzymes, flavoring agents, non-protein nitrogen compounds,
silicates, buffers, extractants, oligosaccharides, and the
like, which are added in order to increase efficiency of
the feed additive. Otherwise, the additive may further
include a feed mixing agent, or the like. One or a mixture
of at least two thereof may be used.
[93]
[94] The probiotic formulation or feed additive according
to the present invention may be administered alone to
animals or be combined with other feed additives in an
eatable carrier. In addition, the feed additive may be
directly mixed with top dressing or livestock feed,
administered in an oral formulation separately with the
feed, or combined with another component and then
administered.
[95]
[96] According to another aspect of the present invention,
there is provided a feed containing the feed additive.
[97] The feed according to the present invention may
contain the feed additive at a content of specifically 0.05
to 10 parts by weight, more specifically 0.1 to 1 parts by.
weight based on 100 parts by weight of the feed. In the

above-mentioned range, the feed may effectively promote
digestibility of livestock, thereby making it possible to
increase efficiency of the feed.
[98] A component of the feed according to the present
invention is not particularly limited and may be a
component known in the art. As a non-restrictive example
of the component of the feed, there are vegetable
components such as grains, roots and fruits, food
processing byproducts, algaes, fibers, fats, starches,
cucurbitaceaes, grain byproducts, and the like, and animal
components such as proteins, inorganic materials, fats,
minerals, single cell proteins, animal planktons, or fish
meal, and the like. One or a mixture of at least two
thereof may be used.
[99]
[100] An example livestock in which the probiotic
formulation, the' feed additive, or the feed according to
the present invention may be used includes livestock such
as beef, milk cows, calves, pigs, piglets, sheep, goats,
horses, rabbits, dogs, cats, and the like, and poultry such
as chickens, laying hens, domestic fowls, cocks, ducks,
geese, turkeys, quails, or the like, but is not limited
thereto.
[101]
[102] Hereinafter, the present invention will be described

in detail through Examples. However, these Examples are
only to illustrate the present invention, and a scope of
the present invention is not limited thereto.
[103]
[104] Example 1
[105] Isolation of Bacillus subtilis CJTyiBP150 Strain
[106] (1) preparation of Sample and Isolation of Strain
[107] Samples derived from soy bean and various fermented
soybean products, which are traditional Korean food, were
prepared. The prepared samples were diluted step by step,
spread onto a brain heart infusion (BHI) solid medium
(Difco, USA) containing 3% sodium chloride, and then
cultured at 37°Cfor 24 hours.
[108] Strains isolated from each of the samples were
grouped depending on results obtained by observing colonies.
The selected colony was re-isolated by a method of
transferring and culturing the selected colony in a new
medium three times, and the purely cultured strains were
put into a medium containing 20% glycerol and preserved at
-70°Cor less.
[109]
[110] (2) Selection of Strain Having Excellent Enzyme
Activity
[111] In order to select strains having a complex digestive
enzyme activity, enzyme activity evaluation of the isolated

strains derived from fermented soybean product was
performed on three enzymes, protease, cellulase, and
amylase. Specifically The enzyme activity evaluation was
performed by measuring the enzyme activity depending on a
degree of formation of a clear zone using a medium
containing a substrate corresponding to each of the enzymes.
[112] About 200 strains were primarily selected based on
the results of the digestive enzyme activity in a culture
solution state, and secondarily digestive enzyme secretion
activity of culture supernatants the culture solution was
analyzed as time passed.
[113]
[114] 1) Extraction of Crude enzyme Solution
[115] After culturing the selected strains in a BHI liquid
medium for 24 hours and 48 hours, supernatants were
extracted by centrifugation of culture medium at 4 °C and
13,000rpm for 5 minutes. A degree of decomposition of
substrate was analyzed using the culture solution as a
crude enzyme solution and a medium containing a respective
substrate corresponding to each of the enzymes.
[116]
[117] 2) Protease Activity
[118] A yeast malt medium (Yeast extract 3g/f, Malt extract
3g/«, Peptone 5g/f, Dextrose 10g/tr Agar 20g/f; Difco, USA,
hereinafter, 'YM medium' ) containing 2% skim milk (Sigma,

USA) was prepared. .After spotting 1.5fd of each of the
extracted crude enzyme solutions onto the substrate medium,
a reaction was performed at 30°Cfor 15 hours, and then the
enzyme activity was measured by a degree of formation of a
clear zone.
[119]
[120] 3) Cellulase Activity
[121] A YM medium containing 1% carboxyl methyl cellulose
(CMC) substrate was prepared. After spotting 1.5pJt of each
of the extracted crude enzyme solutions onto the substrate
medium, a reaction was performed at 37 °C for 15 hours.
Thereafter, the reactant was stained using 0.2% Congo red
aqueous solution for 30 minutes, and then decolorized using
1M NaCl aqueous solution. The enzyme activity was measured
by a degree of formation of a clear zone generated by
decomposition of the substrate around the crude enzyme.
[122]
[123] 4) Amylase Activity
[124] A YM medium containing 1% soluble starch substrate
was prepared. After spotting 1.5fjJl of each of the
extracted crude enzyme solutions onto the substrate medium,
a reaction was performed at 37°Cfor 15 hours. The reactant
was stained using an aqueous solution containing 0.1% I2
and 2% KI, and then the enzyme activity was measured by a
degree of formation of a clear zone generated by

decomposition of the substrate around the crude enzyme.
[125]
[126] 19 strains having the excellent digestive enzyme
activity were selected as shown in the following Table 1
based on results of the secondary evaluation. Among them,
Strain Nos. 150 and 470 had the excellent complex digestive
enzyme activity in the culture solution and the supernatant
were finally selected as candidate strains.
[127] The following Table 1 shows digestive enzyme
producibility of the secondarily selected strains.
[128] [Table 1]


[130] Evaluation of growth capacity was performed on the
two candidate strains having excellent complex digestive
enzyme production capacity. Each of the strains was
cultured in a BHI liquid medium at 37°Cand 200 rpm for 15
hours. After the culture solution (0.1%) was inoculated
into 100ml of a BHI liquid medium and cultured at 37°Cfor
10 and 24.hours, each of the culture solution was spread on
a BHI solid medium, and cell was counted.
[131] The result is shown in FIG. 2, and it may be
confirmed that the strain No. 150 had more excellent growth
capacity among the two candidates when culturing the
strains for 24 hours,.
[132] Therefore, the strain No. 150 having excellent
complex digestive enzyme production capacity and growth
capacity was finally selected and named CJMPB150.
[13.3 ]
[134] Example 2
[135] Digestive Enzyme Activity of Selected CJMPB150 Strain
[136] In order to confirm that the CJMPB150 has digestive
enzyme secretion activity, digestive enzyme activities for
xylanase, mannanase, and lipase as well as protease,
cellulose, amylase were evaluated.
[137]
[138] 1) Extraction of Crude enzyme Solution
[139] After culturing the selected strain CJMPB150 in a BHI

liquid medium for 24 hours and 48 hours, supernatants were
extracted by centrifugation of culture medium at 4 °C and
13,000rpm for 5 minutes. A degree of decomposition of
substrate was analyzed using the culture solution as a
crude enzyme solution and a medium containing a respective
substrate corresponding to each of the enzymes.
[140]
[141] 2) Xylanase Activity
[142] A YM medium containing 1% xylan was prepared. After
spotting 1.5/^ of the crude enzyme solution onto the
substrate medium, a reaction was performed at 37°Cfor 15
hours. Thereafter, the reactant was stained using 0.2%
congo red aqueous solution for 30 minutes, and then
decolorized using 1M NaCl aqueous solution. Next, the
enzyme activity was measured by a degree of formation of a
clear zone.
[143]
[144] 3) Lipase Activity
[145] A YM medium containing 1% tricaprylin was prepared.
After spotting 1.5pJi of the extracted crude enzyme solution
onto the substrate medium, a reaction was performed at 37 °C
for 15 hours, and then the enzyme activity was measured by
a degree of formation of a clear zone.
[146]
[147] 4) Mannanase Activity

[148] A substrate medium (Yeast extract 3g/i, Peptone 5g/f,
KH2PO4 lg/t, Agar 20g/l, pH 5) containing 1% mannan (locust
bean gum, Sigma, USA) was prepared. After spotting 1.5fd
of the extracted crude enzyme solution onto the substrate
medium, a reaction was performed at 37°Cfor 24 hours, and
then the enzyme activity was measured by a degree of
formation of a clear zone.
[149]
[150] The digestive enzyme activity of the CJMPB150 was
shown in the following Table 2 and FIG. 3.
[151] [Table 2]

[152]
[153] As shown in Table 2 and FIG. 3, the CJMPB150 secreted
all of the six digestive• enzymes such as xylanase,
mannanase, and lipase as well as protease, cellulase, and
amylase at an excellent level.
[154]
[155] Example 3
[156] Investigation of morphological and Biochemical
Properties of CJMPB150 Strain and Identification thereof
[157] (1) Investigation of Morphological and Biochemical
Properties
KL-58]. In order to identify the CJMPB150 strain finally

selected as the strain having excellent complex digestive
activity, morphological and biochemical investigation was
performed. As the morphological property, it was confirmed
that the CJMPB150 strain was Gram-positive bacillus (FIG.
1). In addition, a sugar fermentation pattern of the
CJMPB150 strain was analyzed using API 50 CHB system
(Biomerieux, France) to analyze the biochemical properties.
[159] The following Table 3 shows a result of analyzing the
sugar fermentation pattern of the CJMPB150 strain.
[160] [Table 3]


[161] In Table 3, the symbol y + ' indicates positive, the
symbol ,-'" indicates negative, and the control group is a
test group that does not have the substrate.
[162] It was confirmed from the results shown in Table 3
that the CJMPB150 strain had homology of 97.8% with
Bacillus subtilis.

[163]
[164] (2) Identification of CJMPB150 Strain
[165] In order to more accurately identify the CJMPB150
strain, a molecular phylogenetic method using a DNA
nucleotide sequence was performed.
[166] For nucleotide sequence analysis, a 16s rDNA gene was
amplified using a polymerase chain reaction (PCR) premix
(Bioneer, Korea) and universal primers 27F
(5'AGAGTTTGATCCTGGCTCAG3' : SEQ ID No: 2) and 1492R
(5'GGTTACCTTGTTACGACTT 3': SEQ ID No: 3). A total amount of
reaction solution was set to 20ld, and PCR was performed at
94°Cfor 1 minute, 56°Cfor 1 minute, and 72°Cfor 1 minute,
for 30 cycles. Then, the amplified DNA nucleotide sequence
was analyzed. The analyzed 16s rDNA nucleotide sequence of
the C.JMPB150 strain is represented by a sequence of SEQ ID
No: 1 (FIG. 7).
[167]
[168] As a result of the analysis, the strain was
identified to have homology of 99.9% with Bacillus subtilis.
[169] The Bacillus subtilis CJMPB150, which is a novel
microbe according to the present invention identified as
described above, was deposited in Korean Culture Center of
Microorganisms (361-221, Hongje 1-dong, Seodaemun-gu, Seoul)
under accession number KCCM11268P on March 22, 2012.
[170]

[171] Example 4
[172] Endospore Formation Capacity of CJMPB15Q Strain
[173] Bacillus forms endospores for survival under stress
such as depletion of one or more of necessary nutrients, or
the like. Since the endospores have resistance against
extreme conditions such as ultraviolet rays, a high
temperature, low temperature drying and high pressure, or
the like, formation of the endospores is important for
maintaining a survival rate of bacillus. Therefore, the
Bacillus subtilis CJMPB150 was cultured for a long period
of time, and endospore formation capacity thereof was
confirmed.
[174] The strain (0.1%) was inoculated into a BHI liquid
medium and cultured at 37°Cand 200 rpm for 24 and 48 hours.
The culture solution at each time was spread on a BHI solid
medium, and a total cell was counted. In addition, a
culture solution heat-treated at 95 °C for 10 minutes was
spread on a BHI agar medium, and the number of endospores
was counted.
[175] The following Table 4 shows results of measuring the
number of endospores.


[177]
[178] As shown in Table 4, it may be confirmed that when
the CJMPB150 was cultured for 24 hours, an endospore
formation rate was about 88%, and when the CJMPB150 was
cultured for 48 hours, the endospore formation rate was
100%.
[179] Therefore, since the Bacillus subtilis CJMPB150
according to the present invention has an excellent
endospore formation capacity when cultured for 24 hours or
more, so that the Bacillus subtilis CJMPB150 as probiotics
may maintain a high survival rate in digestive systems of
animals.
[180]
[181] Example 5
[182], Acid Resistance and Bile Resistance of CJMPB150
Strain
[183] A probiotic strain needs to have resistance against
gastric juice and bile juice that are strong acidity in
order arrive at intestines from oral intake. For this
reason, in order to confirm whether or not the Bacillus
subtilis CJMPB150 can be applied as a probiotic strain,
acid resistance and bile resistance were evaluated.
[184]
[185] (1) Acid Resistance and Artificial Gastric Juice
Resistance

[186] Artificial gastric juice was prepared by adding
1%(w/v) pepsin (Sigma, USA) to 0.05M sodium phosphate
solution adjusted at pH 2.5 using HC1.
[187] After the CJMPB150 strain was cultured in a BHI
liquid medium at 37 °C and 200 rpm for 24 hours,
centrifugation was performed at 13,000 rpm for 5 minutes.
Next, the supernatant was removed and the bacterial
component was collected. Then, the artificial gastric
juice was added thereto at the same amount as that of the
supernatant and cultured at 37°Cfor 3 hours. After culture,
the resultant was spread on a BHI medium and cell was
counted, so that acid resistance and artificial gastric
juice resistance were evaluated.
[188]
[189] (2) Artificial Bile Juice Resistance
[190] Artificial bile juice was prepared by adding 1%(w/v)
pancreatin (Sigma, USA) to 0.05M sodium phosphate solution
and sterilizing. Then sterile 10%(w/v) oxagall (Difco Co.)
solution was added so as to have a content of 1% (v/v) of
the medium, and the artificial bile juice was adjusted to
pH at 6.8.
[191] After cultured in the artificial gastric juice of (1)
for 3 hours, the CJMPB150 strain was centrifuged at 13,000
rpm for 10 minutes. The supernatant was removed, and the
bacterial component was collected. Then, the artificial

bile juice was added thereto at the same amount as that of
the supernatant and cultured at 37°Cfor 24 hours. After
culture, the resultant was spread on a BHI medium and cell
was counted, so that acid resistance and artificial bile
juice resistance were evaluted.
[192] The results of evaluating acid resistance, the
artificial gastric juice resistance, and the artificial
bile juice resistance were shown in FIG. 4.
[193]
[194] As shown in FIG. 4, when the CJMPB150 was treated
with the artificial gastric juice (pH 2.5) for 2 hours, a
survival rate was about 83%, and when the CJMPB150 was
treated with the artificial gastric juice and then treated
with the artificial bile juice for 24 hours, the survival
rate of 83% was also maintained.
[195] Therefore, it was confirmed that the Bacillus
subtilis CJMPB150 according to the present invention had a
high survival rate even though it was treated with a series
of the artificial gastric juice and the artificial bile
juice, so that the Bacillus subtilis CJMPB150 may be useful
as a probiotic strain.
[196]
[197] Example 6
[198] -In Vitro Digestibility of Feed Containing CJMPB150
[199] In order to confirm whether or not the Bacillus

subtilis CJMPB150 having excellent complex digestive enzyme
production capacity may increase a digestibility under the
same condition as that in the intestines, digestibility of
the feed was investigated.
[200] The Bacillus subtilis CJMPB150 (0.1%) was mixed with
lOg of standard feed (feed prepared by mixing corn (50%),
soybean meal (30%), wheat (10%), bran (5%), and distiller's
dried grain (5%) with each other) , and 125ml of phosphate
buffer (pH 6.0) was added thereto and titrated to pH 2
using 3M HC1. Then, 2ml of pepsin (20mg/ml) solution was
added thereto and reacted at 38°Cand 200 rpm for 2 hours.
[201]
[202] After the reaction for 2 hours, 50ml of phosphate
buffer (pH 6.8) was added thereto and titrated to pH 6.8
using 3M NaOH. Thereafter, 2ml of pancreatin (50mg/ml)
solution was added thereto and cultured at 38°Cand 200 rpm
for 18 hours.
[203] After culture, the remaining feed after digestion was
filtered using a filter paper (Whatman No.541) and dried in
oven at 135 °C. A dried weight thereof was measured, and
digestibility of the feed was calculated according to the
following Equation 1. ■
[2.04]
[205] [Equation 1]
[206] Digestibility of Feed (%) = {(Dried Weight before

Reaction - Dried Weight after Reaction)/(Dried Weight
before Reaction)}X100
[207]
[208] The measured digestibility of the feed was shown in
Table 5 and FIG. 5.
[209] [Table 5]

[210]
[211] As shown in Table 5 and FIG. 5, when the CJMPB150 was
added to the feed, the digestibility was increased by about
2.2% as compared to the control group (test group in which
the CJMPB150, the enzyme, or the like, was not added), and
the enzyme (mannanase, 1%) was added to the feed, the
digestibility was increased by about 1.6% as compared to
the control group. Therefore, it was confirmed that the
Bacillus subtilis CJMPB150 according to the present
invention may increase digestibility of the feed and
replace the enzyme, which is a feed additive.
[212]
[213] Example 7
[214] Stability of CJMPB150 Strain
[215] In order to confirm stability of CJMPB150, p-
hemolysis was investigated. p-hemolysis was an action of
hemolyzing red blood cells by producing phospholipase in

harmful bacterial to hydrolyze phospholipids supplied by
the red blood cells.
[2167 In order to confirm hemolysis by the Bacillus
subtilis CJMPB150, tryptic soy agar (TSA, Difco, USA)
containing 5% sheep blood (Kisan Biotech, Korea) was
prepared. The strain was streaked on the prepared blood
agar medium and then cultured at 37°Cfor 24 hours. Then,
as a result of confirming the presence or absence of
hemolysis, it was confirmed that hemolysis did not occur as
shown in FIG. 6.
[217]

[CLAIMS]
[Claim 1]
A Bacillus subtilis CJMPB150 strain having complex
digestive enzyme production capacity, acid resistance, and
bile resistance, which has been deposited under an
accession number KCCM11268P.
[Claim 2]
A culture product of the Bacillus subtilis CJMPB150
Strain of claim 1.
[Claim 3]
A probiotic formulation comprising the Bacillus
subtilis CJMPB150 (KCCM11268P) Strain of claim 1 or the
culture product of the strain of claim 2.
[Claim 4]
A feed additive comprising the probiotic formulation
of claim 3.
[Claim 5]
A feed comprising the feed additive of claim 4.