Sign In to Follow Application
View All Documents & Correspondence

Novel Dna Constructs Composition And Methods To Control Phytopathogens

Abstract: ABSTRACT NOVEL DNA CONSTRUCTS COMPOSITION AND METHODS TO CONTROL PHYTOPATHOGENS The present invention discloses novel DNA construct composition to provide strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogen in host plant. The DNA construct composition comprises ofat least one novel RNAi construct, at least one promoter and at least one transcriptional terminator so designed to produce RNAi gene construct to down-regulate pathogen specific gene target by way of RNAi mediated gene silencing and consequently inhibiting growth of phytopathogen. The RNAi gene constructs are designed for both single gene targets and multi-gene targets. This invention also discloses method of preparing novel DNA construct and the method to control phytopathogens.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
21 April 2015
Publication Number
48/2017
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
remfry-sagar@remfry.com
Parent Application
Patent Number
Legal Status
Grant Date
2023-11-29
Renewal Date

Applicants

METAHELIX LIFE SCIENCES LTD.
Plot No. 3, KIADB 4th Phase Bommasandra, Bangaluru - 560099 Karnataka, India

Inventors

1. AGARWAL, Sandhya
C/o Metahelix Life Sciences Limited, Plot no. 3, KIADB 4th Phase, Bommasandra, Bangaluru - 560099, India
2. SHIVAPPA, Sarala
C/o Metahelix Life Sciences Limited, Plot no. 3, KIADB 4th Phase, Bommasandra, Bangaluru - 560099, India
3. SAMPATH, Mukundan
C/o Metahelix Life Sciences Limited, Plot no. 3, KIADB 4th Phase, Bommasandra, Bangaluru -560099, India
4. MOHANDOSS, Sheba Jennifer
22 TAUNTSA Nagar, Bommanampalayam, Coimbatore - 641046, India
5. SARANGI, Rinku Ranjan
C/o Mr. B. K. Sarangi Chandrasekhar Nagar, Building: SBI Town Branch, Post: Rajendra College, Balangir, Orissa - 767002, India
6. VAIRAMANI, Ramanathan
C/o Metahelix Life Sciences Limited, Plot no. 3, KIADB 4th Phase, Bommasandra, Bangaluru - 560099, India
7. KOTTARAM KRISHNADAS, Narayanan
C/o Metahelix Life Sciences Limited, Plot no. 3, KIADB 4th Phase, Bommasandra, Bangaluru - 560099, India
8. PRASANNAKUMAR, Kammaragattae Vaishanava
C/o Metahelix Life Sciences Limited, Plot no. 3, KIADB 4th Phase, Bommasandra, Bangaluru - 560099, India

Claims

1. Novel DNA construct composition to provide strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogen in host plant wherein said DNA construct composition comprises ofat least one novel RNAi construct, at least one promoter and at least one transcriptional terminator said novel DNA construct being designed in a manner capable of producing dsRNA to down-regulate pathogen specific gene target by way of RNAi mediated gene silencing and consequently inhibiting growth of phytopathogen, Wherein said RNAi gene constructs are designed for single gene targets and multi-gene targets.

2. The novel DNA construct composition as claimed in claim 1 wherein said single gene targets are SEQ ID 25 to SEQ ID 29.

3. The novel DNA construct composition as claimed in claim 1 wherein said multi-gene targets are SEQ ID 30 to SEQ ID 34

4. The novel DNA construct composition as claimed in claim 1 wherein said promoter is Metahelix proprietary chimeric promoter

5. The novel DNA construct composition as claimed in claim 1 wherein said phytopathogen is such as Magnaporthe.

6. The novel DNA construct composition as claimed in claim 1 wherein said host plant genome is selected from rice, wheat, rye, barley, pearl millet.

7. Method of preparing novel DNA construct to provide strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogen in plants wherein said composition comprising the steps of : (a) identifying target gene from total genomic DNA from at least one field isolates of phytopathogen, (b) obtaining target gene fragment of predetermined size range from said target gene, (c) amplifying said target gene fragments of step (b) to obtain amplicons, (d) designing primers with specific restriction sites for directional cloning of said amplicons into at least one vector (e) preparing at least one RNAi gene construct (f) preparing at least one binary RNAi vector from one or more said RNAi gene constructs (g) mobilizing said binary RNAi vectors into Agrobacterium sp to obtain transformed Agrobacterium (h) transformation of said host plant using said transformed Agrobacterium. wherein said DNA construct is capable of producing RNA interference to down-regulate pathogen specific gene target by RNAi mediated gene silencing and inhibiting growth of phytopathogen

8. The method of preparing novel DNA construct as claimed in claim 7 wherein said target gene fragment from total genomic DNA of pathogen is obtained using the method comprising the steps of : (a) isolating total genomic DNA from at least one field isolates of phytopathogen; (b) selecting at least one target gene from said isolated total genomic DNA; (c) sequence alignment of the said target gene of step (b) against host plant genome sequence to eliminate target gene fragments of predetermined size showing not more than specific range of continuous sequence similarity with said host plant genome; (d) selecting and isolating target gene fragments of step (c) not exhibiting said continuous sequence similarity within specific range; (e) amplifying said isolated target gene fragments of step (d) to obtain amplicons.

9. The method of preparing novel DNA construct as claimed in claim 7 wherein preparation of said RNAi gene Construct comprises the steps of (a) Cloning of said target gene fragment in sense orientation (5’ to 3’) (b) cloning of spacer - bean catalase intron and (c) cloning of said target gene fragment in anti-sense orientation (3’to 5’), thus making a hairpin structure or RNAi construct.

10. The method of preparing novel DNA construct as claimed in claim 7 wherein said binary RNAi vectors are pMH878 and pMH883.

11. The method of preparing novel DNA construct as claimed in claim 7 wherein said predetermined size of said target gene fragment ranges from 150 bp to 400 bp.

12. The method of preparing novel DNA construct as claimed in claim 8 wherein said specific range of continuous sequence similarity is less than 10bp to 20bp.

13. A method to control phytopathogens wherein said method comprises the steps of (a) selecting target genes from at least one phytopathogen, (b) selecting target gene fragments of sizes ranging from 150bp to 400bp from said target genes of step (a), (c) aligning said target gene fragments of step (b) against host plant genome sequence to eliminate continuous sequence similarity of said target gene fragments with said host plant genome, (d) amplifying said target gene fragments of step (c) to obtain amplicons, (e) designing primers with specific restriction sites for directional cloning of said amplicons into at least one vector, (f) preparing at least one RNAi gene construct, (g) preparing at least one binary RNAi vector from one or more said RNAi gene constructs, (h) mobilizing said binary RNAi vectors into Agrobacterium sp to obtain transformed Agrobacterium, (i) transformation of said host plant using said transformed Agrobacterium, (j) conversion of positive transgenic events to homozygous plant population wherein said positive transgenic event harbours DNA construct generating RNA interference to down-regulate pathogen specific gene target by RNAi mediated gene silencing and inhibiting growth of said phytopathogen.

Specification

DESC:FIELD OF THE INVENTION
The present invention relates to novel DNA constructs composition and methods to control phytopathogens. More specifically, the present invention relates to method for controlling phytopathogens by silencing the gene expression in said phytopathogens using RNAi (RNA Interference) technology.

BACKGROUND OF THE INVENTION
Pests cause extensive crop damage worldwide leading to huge economic losses and significant drop in the crop yields. Cereals such as rice, wheat and barley are staple food for one half of the world's population making diseases of such crops of special concern. Magnaporthe grisea is a major fungal phytopathogen causing a devastating disease called blast, which usually affects the most important cereals such as rice, wheat and barley.

Blast was first reported in Asia more than three centuries ago and is now present in over 85 countries. It is highly adaptable to different environmental conditions and can be found in irrigated lowland, rain-fed upland, or deep water rice fields. The yield loss may be as high as 75% or more depending upon the growing conditions. Rice blast is one of the most widespread diseases which cause significant crop losses throughout India, South East Asia and South America.

Blast is presently controlled using resistant cultivars or by application of fungicides. However, resistant cultivars may have a limited field life, due to evolution of newly virulent forms of the fungus. Fungicide resistance is also of concern and there is a considerable need for novel methods offering robust management of blast in terms of durability and pathogen spectrum.
Novel approaches to control blast diseases in plants are essential to harmonize existing strategies, and extend the efficiency of available resistance genes. RNA interference or "RNAi" is a technique of sequence-specific down-regulation of gene expression (also referred to as "gene silencing" or "RNA-mediated gene silencing") initiated by double-stranded RNA (dsRNA) that is complementary in sequence to a region of the target gene to be down-regulated (Fire, A. Trends Genet. Vol. 15,358-363, 1999; Sharp, P. A. Genes Dev. Vol. 15, 485-490, 2001).Over the last few years, RNA interference (RNAi) has become a well established technique.

In general, RNAi comprises contacting the organism with a double-stranded RNA fragment (generally either as two annealed complementary single-strands of RNA or as a hairpin construct) having a sequence that corresponds to at least part of a gene to be down-regulated (the "target gene"). General description of the RNAi technique is given in WO99/32619 (Carnegie Institute of Washington), International application WO 99/53050 (Benitec), and to Fire et al., Nature, Vol. 391, pp. 806-811, February 1998. These studies confirm that RNA interference pathways are active in a number of organisms including fungi. Since discovery of RNAi based gene silencing in fungi, it has become a powerful tool for functional analysis of genes (Dang et al., 2011; Eukaryotic Cell 10(9): 1148–1155) in fungi.

RNAi induced gene silencing is widely characterized in eukaryotic organisms including various fungi to down regulate any gene of interest. Down regulation is by 21-25 bases siRNA, which are generated by processing of dsRNA designed from the target gene. Expression of dsRNA in host plants targeting essential genes of a pathogen feeding on host, restricts pathogen growth/establishment on host system. The concept known as ‘Host Induced Gene Silencing’ (HIGS), has emerged as an alternate strategy to design pathogen resistant plants (Panwar et al., 2013).
A method to alleviate plants from fungal pests, whereby the intact fungal cell(s) when in contact with dsRNA from outside the fungal cells, showed growth inhibition, was described by Marc Van et al. (US2006/0247197).

Delebarra et al.(WO 2013/050410) demonstrated inhibition of fungus development, growth and pathogenicity by down regulation of saccharopine dehydrogenase gene, expressed in transgenic host plants.

One of the bottlenecks of HIGS is the selection of appropriate target gene/gene fragments of pathogen for down regulation. The target gene down regulation by dsRNA or siRNA should induce sufficient inhibition of pathogen growth, up to a level which can be commercially used to obtain resistance in host, without any deleterious effect on host growth or yield potential. One such target gene is Con7 from Magnaporthe grisea. Found to be essential for appresorium formation and in planta growth, Con7 encodes a transcription factor required for transcription of several disease related genes of Magnaporthe grisea (Odenbach et. al., 2007).

RNA interference which is facilitated by siRNA can be derived from gene constructs expressing dsRNA delivered directly to fungal cells through plasmids or to plant cells where the generated siRNA are absorbed by fungal cells, once fungus attacks such transgenic plants. This ability of fungal cells to take-up siRNA fragments generated in host plants can be exploited to design plants resistant to phytopathogenic fungi by targeting fungal genes responsible for pathogenicity.

Making practical use of this phenomenon, the present invention describes fungus specific novel DNA sequences which can be designed to follow RNAi pathway in a plant system in a manner that the fungus such as Magnaporthe is not able to establish in case of an attack on such plants. The present invention describes novel gene fragments that confers strain non-specific tolerance in plants against blast fungus and thereby overcome the limitations of the existing state-of-the-art.

OBJECT OF THE INVENTION
The main object of present invention is to provide novel DNA constructs composition to obtain disease resistant plants.

Another object of present invention is to identify suitable DNA fragments to control blast fungus.

Yet another object of the present invention is to provide method for controlling fungal infection of plants by silencing the gene expression in fungi using RNAi technology.

Yet another object of the present invention is to provide strain non-specific or race non-specific tolerance against blast fungus.

Yet another object of present invention is to provide methods to control blast fungus.

SUMMARY OF THE INVENTION
Accordingly, the present invention relates to novel DNA constructs composition and methods to control blast fungus. The present invention also relates to method for controlling fungal infection of plants by silencing the gene expression in fungi using RNAi (RNA Interference) technology.

Unlike conventional breeding for resistance, the present invention is not based on the specific virulence and avirulence genes interactions and thus provides durable race and/or strain non-specific resistance.

The invention relates to area of agricultural biotechnology wherein novel DNA constructs confer strain non-specific and/or race non-specific tolerance against blast fungus.

Magnaporthe grisea is the causative agent of blast. As the fungus is constantly evolving, the available measures for developing resistance are not sufficient and need supplementation with new techniques. The major target genes of the present invention are the genes involved in virulence, pathogenicity, establishment and proliferation of fungus inside host system and membrane transporters providing resistance against host resistance machinery.

Gene fragments of sizes ranging from approximately 150bp to 400bp are selected from fungal genome such as from Magnaporthe as the target genes. These gene fragments target the pathogen but not the host plant genome. The gene construct have been designed for plant species, including but not limited to, rice, barley, wheat where in target gene fragments do not show biologically significant similarity with host plant genome.

Specific RNAi gene cassettes have been designed either with the gene fragment from single gene called single gene targets or with the gene fragments from many genes together called multi-gene targets. While single gene target aims silencing one gene at a time, multi-gene targets induce silencing of the whole class of the target at a time.

The non-limiting list of various silencing gene targets (RNAi targets) that have been selected for the experiment are provided in Table below:
Table 1: Silencing gene targets (RNAi targets) from Magnaporthe
No. Target Gene/s Single/multiple gene target
1 NTH1 Single
2 Serine/Threonine Phosphatase Single
3 Telomere protection protein Single
4 Hex1 Single
5 Con7 Single
6 Chitin Synthase Multiple
7 Cation/membrane Transporters Multiple
8 Multi-drug resistance (MDR) genes/ABC transporters Multiple
9 Membrane transporters/MDLB Multiple
10 Multi-drug resistance (MDR)/Iron Homeostasis Multiple

The Table 2 below provides a list of primers used in the course of the present invention.

Table 2:
Target gene fragment Primer name Primer sequence F/R
Con7 601 CGAGCTCACATGCATTTCGCTGGTCTC F
Con7 602 CGGGATCCCCGTTCAAACCTCAAGATGC R
Con7 603 GGGGTACCAACATGCATTTCGCTGGTCT F
Con7 604 CGGGATCCGGTTGGACTCCTGCTTCAAA R
Nth1 605 GGGGTACCTGCGGATAAGCCCGATATAC F
Nth1 606 GCGTCGACAGGCTCGTGTCGAATCTTGT R
Hex1 607 CGAGCTCCTTCTAACCGACCCGCTTTAG F
Hex1 608 CGGGATCCCCTGCTGCCGTGGAGGACA R
Hex1 609 GGGGTACCCTTCTAACCGACCCGCTTTA F
Hex1 610 CGGGATCCATTAAGCCAGCAAAGCAAAA R
Serine threonine phosphatase 611 GGGGTACCGATAGCAGCACCGATGCAA F
Serine threonine phosphatase 612 GCGTCGACCATCCAGTCATTCTTGGAGGA R
Telomere protection protein 613 GGGGTACCCCCAGAGAGGATCAAAGTCG F
Telomere protection protein 614 GCGTCGACGTTCAGGTTCGCCTCGTAGT R
Chitin synthase- chs1 615 GGGGTACCGTCTCGGATGGTCGTGAAAA F
Chitin synthase- chs1 616 CCCTCGAGCATCTGGCAGGGGACAATAC R
Chitin synthase- chs2 617 CCCTCGAGATCTCCCTCGCCATTTCAG F
Chitin synthase- chs2 618 CCCAAGCTTTGGTGGCATAACGTTTCAGA R
Chitin synthase- chs3 619 CCCAAGCTTCACCACGGCGCATATTTAC F
Chitin synthase- chs3 620 GGAATTCGGCGTCGAGAAGTACACAGA R
Chitin synthase- chs4 621 GGAATTCACAACACCTTCCGCCTGTC F
Chitin synthase- chs4 622 AACTGCAGGAGGAAGTGTATGTGTTGATCGAG R
Chitin synthase- chs5 623 AACTGCAGACCTCGGTCTCGACAACAAC F
Chitin synthase- chs5 624 CGGGATCCGCGTCGACACGAGCATGTTCCCAAGC R
Multi-drug resistance/Fe homeostasis 635 CCCTCGAGCGAAATCGACGTCAAATGGT F
Multi-drug resistance/Fe homeostasis 636 CCCAAGCTTGTCTGGGAGACGGTTGATGA R
Multi-drug resistance/Fe homeostasis 637 CCCAAGCTTGGCCTCACCAGAGGTCTCAA F
Multi-drug resistance/Fe homeostasis 638 GGAATTCCGTCGTCGGGTCGTAGAA R
Multi-drug resistance/Fe homeostasis 639 GGAATTCCGAGTCGACCTCGGCCTTGGA F
Multi-drug resistance/Fe homeostasis 640 CGGGATCCTCATAATAGTGCCCCTTGCTG R
Membrane transporters/MDLB 641 GGGGTACCGCGTCTCAGCACGCTACC F
Membrane transporters/MDLB 642 CCCTCGAGATGCCACATCTCCATCCTTC R
Membrane transporters/MDLB 643 CCCTCGAGCTATTTCCGCATGGTGCAG F
Membrane transporters/MDLB 644 CCCAAGCTTTTGTACCTGACGACGGACTG R
Membrane transporters/MDLB 645 CCCAAGCTTGTTTCCTTGCGACGAGGTG F
Membrane transporters/MDLB 646 GGAATTCGCACTCGGTGTCGTAGCC R
Multi-drug resistance (MDR) genes/ABC transporters 649 GGGGTACCCGGCTCCTTTACTGGCTACA F
Multi-drug resistance (MDR) genes/ABC transporters 650 CCCTCGAGACAACCACCACAAGGCGATA R
Multi-drug resistance (MDR) genes/ABC transporters 651 CCCTCGAGATGGACACAAGCGGCTATTT F
Multi-drug resistance (MDR) genes/ABC transporters 652 CCCAAGCTTGTTGCCTTGCCATCCTTATC R
Multi-drug resistance (MDR) genes/ABC transporters 653 CCCAAGCTTAAACCTCATGGGCTATCCTG F
Multi-drug resistance (MDR) genes/ABC transporters 654 GGAATTCCACCATTGCGCTCAAAGTAGT R
Multi-drug resistance (MDR) genes/ABC transporters 655 ACAGGCTGCAGACCATCC F
Multi-drug resistance (MDR) genes/ABC transporters 656 GGAATTCGCTGAGATTTGACCCTCTC R
Tubulin Sense 853 GGATCCTAATACGACTCACTATAGGG GTGCCGGTATGGGTACTCTG F
Tubulin Sense 854 TGTCGTACAGAGCCTCGTTG R
Tubulin antisense 855 GGATCCTAATACGACTCACTATAGGG TGTCGTACAGAGCCTCGTTG F
Tubulin antisense 856 GTGCCGGTATGGGTACTCTG R
Rice actin1 1042 CTGTCTTCCCCAGCATTGTC F
Rice actin 1 1043 TAGGATGTTCAAACATGATTCCAT R
* Foot Note :F = Forward Primer; R= Reverse Primer

In one of the many embodiments of the invention, different gene constructs have been designed with various gene sequences as mentioned above and rice transgenic events have been generated using rice immature embryos. The resultant transgenic events have been stabilized to obtain homozygous population. Homozygous population is subjected to whole plant bioassay to screen the events tolerant to rice blast.

The RNAi machinery produces small interfering RNA (siRNA) in the transformed rice plants, which are very specific to target genes such as the Magnaporthe genes. When the fungus attacks the transformed plants having said novel gene fragments, the siRNA which are already present in the host, travel to the pathogen and silence either one gene (single gene target) or many genes (multi-gene targets) together. The pathogen thus is not able to establish and proliferate inside the plant system and plant shows a resistance reaction.

STATEMENT OF THE INVENTION
Novel DNA construct composition to provide strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogen in host plant. The DNA construct composition comprises ofat least one novel RNAi construct, at least one promoter and at least one transcriptional terminator. The novel DNA construct is designed in a manner capable of producing double stranded RNA (dsRNA) to down-regulate pathogen specific gene target by way of RNAi mediated gene silencing and consequently inhibiting growth of phytopathogen. The RNAi gene constructs are designed for both single gene targets and multi-gene targets.

This invention also discloses method of preparing novel DNA construct to provide strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogen in plants which include identifying target gene from total genomic DNA from at least one field isolate of phytopathogen, obtaining target gene fragment of predetermined size range from the target gene, amplifying the target gene fragments to obtain amplicons, designing primers with specific restriction sites for directional cloning of said amplicons into at least one vector, preparing at least one RNAi gene construct, preparing at least one binary RNAi vector from one or more RNAi gene constructs, mobilizing said binary RNAi vectors into Agrobacterium sp to obtain transformed Agrobacterium, mediating transformation of said plant using said transformed Agrobacterium.

The DNA construct so formed is capable of producing RNA interference to down-regulate pathogen specific gene target by RNAi mediated gene silencing and inhibiting growth of phytopathogen. The binary RNAi vectors are pMH878 and pMH883.

The invention also discloses a method to control phytopathogens using the above method where the transformed Agrobacterium mediates transformation of host plant. The positive transgenic events are converted to homozygous plant population. The positive transgenic event down-regulates pathogen specific gene target by RNAi mediated gene silencing and inhibits growth of the phytopathogen.

BRIEF DESCRIPTION OF DRAWINGS
Fig. 1: collectively depicts the diagrammatic representation of vector construction of pMH878. Fig. 1A depicts the vector construction of pMH722. Fig. 1B depicts the vector construction of pMH729. Fig. 1C depicts the binary vector construction of pMH878 by modification of basic binary vector pMH210.
Fig. 2: collectively depicts the diagrammatic representation of vector construction of pMH883. Fig. 2A depicts the vector construction of pMH656. Fig. 2B depicts the vector construction of pMH734, Fig. 2C depicts the vector construction of pMH737, Fig. 2D depicts the vector construction of pMH738, Fig. 2E depicts the vector construction of pMH788, Fig. 2F depicts the vector construction of pMH808, Fig. 2G depicts the vector construction of pMH811, Fig. 2H depicts the vector construction of pMH671, Fig. 2I depicts the binary vector construction of pMH883 by modification of basic binary vector pMH210.
Fig. 3A: Gel image of 200bp dsRNA
Fig. 3B: Gel image of siRNA generated from dsRNA
Fig. 3C: Multi-well plate showing fungal growth inhibition upon incubation with in-vitro generated siRNA.
Fig. 4: A picture showing differential disease reaction by negative check (Co-39) and transgenic events.
Figure 5: Multi-sequence alignment of Con7 gene fragments from six Magnaporthe strains showing 100% similarity
Fig. 6A: Multi-sequence alignment of chitin synthase 1 (XM_361671) gene fragments from six Magnaporthe strains showing 100% similarity
Fig. 6B: Multi-sequence alignment of chitin synthase 2 (XM_ 363876) gene fragments from six Magnaporthe strains showing 100% similarity
Fig. 6C: Multi-sequence alignment of chitin synthase 3 (XM_364706) gene fragments from six Magnaporthe strains showing 100% similarity.
Fig. 6D: Multi-sequence alignment of chitin synthase 4 (XM_001403947) gene fragments from six Magnaporthe strains showing 100% similarity.
Fig. 6E: Multi-sequence alignment of chitin synthase 5 (XM_001403948) gene fragments from six Magnaporthe strains showing 100% similarity.
Fig. 7: Gel image showing reverse transcriptase PCR results.

DETAILED DESCRIPTION OF THE INVENTION WITH ILLUSTRATIVE EXAMPLES

The present invention discloses a novel DNA construct composition capable of providing strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogens. The DNA construct composition of the present invention is capable of being expressed in a transgenic plant cell.

The present invention further provides a method to control phytopathogens. The method comprises the steps of target gene selection i.e. identification of gene of interest from said phytopathogen, isolation of specific gene fragments of specific size range, amplification of said gene fragments and associating said gene fragments with an appropriate promoter, cloning of said specific gene fragments into a vector, thereby making specific RNAi constructs. The RNAi constructs thus obtained are transferred into plant causing plant transformation.

Target gene selection:
Target genes are selected from at least one phytopathogen. Said phytopathogen is blast fungus such as but not limited to Magnaporthe sp. The selection of target gene is based on their involvement in virulence, pathogenicity, establishment and proliferation of fungus inside plant system. From each said target gene, gene fragments of sizes ranging from 150bp to 400bp are selected as given in SEQ. ID 1 to SEQ. ID 24 (Table 3). Said gene fragments within the sizes ranging from 150-400bp are referred to herein as target gene fragments.

Table 3: Target gene fragment sequence obtained from selected target gene: SEQ. ID 1 to SEQ. ID 24
Target gene NCBI accession no. Target gene fragment SEQ. ID
Con7 DQ985585.1 Sequence 1: aacatgcatttcgctggtctcagcaacccgagcgccactgctgtgagggtttattgtatcatggcatacgatcttataagaggtttcgcacgcgcgatacttttagtccctaatgtctctggggtgtttgcttctttttttctttattctctgtttgccttatttattttctgttttgtgttttttctcttgtctcgcttatggtatttttttggcagctcctttggaaccagtactatttttttactagttttccactgaaggaagcatctgttatgaggatgcatcttgaggtttgaacggtcgggatgggtagagacaatgggatggatgacataaaggttttgaagcaggagtccaacc
Hex1 MGG_02696 Sequence 2: cttctaaccgacccgctttagtcgtcgccatgaccgagaccggtgatgtcaagcagaacctgcccgtcagcgagcagtccaacctctacgagcgcctccagcgcgctttcgagtctggccgtggcagcgtccgtgccctcgtcgtcagcgacaacggccgtgagcttgtctgcgacatggctgtcctccacggcagcaggctgtagatgcactctctagctctaaacctagatagatgtcttttgctttgctggcttaat
Nth1 AY148092.1 Sequence 3: tgcggataagcccgatatacgcctggatgtcgttgagcttcccgagactattactcccgagtatgtcgtcggcatcaacaaagccccgggtcttcttgccgtggacatggaagagactgtggaccccaagaccggggagagggtcatgagcggtcgtccattcgtcgttcctggcggtcgcttcaacgagctgtacggctgggacagctacatggagtctctcggtctccttgttaacgacaaggtctacctggccaagtccatggtcttgaacttctgcttctgtatcaagcactatggaaaaatcttgaacgccactaggtcttactacctttgccgatcccagccgccattcctcactgatatggctctgcgcgtctacgacaagattcgacacgagcct
Serine/Threonine Phosphatase XM_360611 Sequence 4: gatagcagcaccgatgcaacggccgccacccgcgccttcaccaacagtgccagtaaccccaccaaagccgcagtcaacggcgctgcgcccacgcgcaacgtccttgtgatcaccgccgacgagctatacacgagcacatttgtcggcgaaggtcccatttccaaaataaccgacgatgagcgacggatggttgtcgagatgctgaacccggagcagtcaacgcagaagctacgcaagaacgagcagtcctatatagtaaatcgcggtcagggtgtcgtccgatatgacttggtgcagttgcccagcaacgaccccattgaggatgatcacgccgagaagatcgtcgaggttcccgatggatcgcagccgtcctccaagaatgactggatg
Telomere protection protein XM_367136 Sequence 5: tgggtccgctttcaaaacgtgcatattaagcctggaaaaaatgggattaacttggagggctttctgcgccaagaccagaaatacccagagaggatcaaagtcgaaatactcgaggacaacgattcacgtctcaaagatgttctgcgtcgcaagcaagaatacgagaaatcaaacaagcgcaaaaacccgcaccaccacaaccctcgagttgctcaacaagctcaagtacggcaaggaccagatcctactaggggaaaggaacagcgccttggggagacgtccgccgaaaacagtaatcagcgacgaaagaggc
Chitin synthase XM_361671 Sequence 6: gtctcggatggtcgtgaaaagatccatcctcggacgctcgatgcactggccgctatgggcgtttaccagcacggcattgccaagaactacgtcaaccagaaagccgttcaagcccacgtctatgagtatactactcaggtgtcgcttgacgctgatttaaagttcaaaggtgccgagaagggtattgtcccctgccagatg
Chitin synthase XM_ 363876 Sequence 7: atctccctcgccatttcagaatgactatggtgtttcgtcgggctaccagggcgcaatgggcggccacgcagacgacggcttccccattggcggcggagacccccagcaaggccacccctacgataccgaggacagctgggtgcagcgccagaaccccaacgccgctccccagggtggtggtctgaaacgttatgccacca
Chitin synthase XM_364706 Sequence 8: caccacggcgcatatttacgagtacaccacccaaatcggcatggctctcaagaacgatgtagttcagctcttgccacgccagcagcctgtgcagcttctgttctgcctcaaggagaacaaccagaagaagatcaactctcacaggtggttcttctctgcatttggccgcgttctgaacccaaacatctgtgtacttctcgacgcc
Chitin synthase XM_001403947 Sequence 9: acaacaccttccgcctgtcggcggcaacggtggtgcacacacgcagccttcgctacccgcgctgcccgcccatcttcagtccgacacgcacctcacggggcatcttgccagccgattccacgtcagtctgccaaccgccaaactatcttcccacgccttcatctcgatcaacacatacacttcctc
Chitin synthase XM_001403948 Sequence 10: acctcggtctcgacaacaacgctgctcaacgccattcacaacatctatctcgcgtctcagccctaccgcttggatgcagggaccagtctggttgtcaacacgtggctcacagctacgcaggccgggcctgacggagaggtcggaggtactgttgacccggccctcgcagcacgagcttgggaacatgctcgt
Cation/membrane Transporter XM_359887 Sequence 11: gtagctgttcccgagggacttccactggctgtcacacttgcactggcatttgccaccacccgcatgaccaaggacaacaacctcgttcgcgttctgagggcttgcgagacgatgggaaacgcgactaccatctgttcagacaagaccggaaccttgacacaaaacaagatgacagtcgttgccaccactctcgggacttctc
Cation/membrane Transporter XM_365047 Sequence 12: cgacgtcgtatcaatccagagaactagccgaggacttctcctacttgacggcaagcgaaaccgctacgcgattacaaacttcgttaactcatggcctcacggctaccgaagcgttgcgacgacagcaagaccatgggctcaacgagatcccacacgaacctccagaaccgctttggttgcgcttcattggtcagttcaaggaaccgt
Cation/membrane Transporter XM_365372 Sequence 13: gcaagaaaaactccgacgacgctgtcgtccgagtttcgggccagtccaacgaaccgctgtcccgtccgatccacgccctcacagtcgcccaattcctcgaggagatcaagggcgacgccgaagatggcctcaagccggaggaggccaagaggcgcctggagcagtacggcaacaatgactttggcgagggcgagggcgtctctgccatcaagatttt
Cation/membrane Transporter AY026257 Sequence 14: caaaggctccaagcaaagagtctcttgcgaccgacattgagcccgggaacccaccaacagcacccaggcaagttggtgccagacaacgcgcaagcgattggttcgccaaagtctcccaagaggggttattccataaacctctacctccctcaaaggatggtcgccatgttcccataagatttgcgggaagccaggacggcgacaaagctact
Multi-drug resistance (MDR) genes/ABC transporters XM_363748 Sequence 15: cggctcctttactggctacaggcctctgctggaccttggccatggatatctcagcgcaaccgccgacacgaaacagcctctttgcggaaacgccgagggatggggcccgctcagcccattccgatatgactttacaccttgctttatcgacgtatgggtggcttcagtagccgtcttcggcctcatctttgggcctatcgccttgtggtggttgt
Multi-drug resistance (MDR) genes/ABC transporters XM_360372 Sequence 16: atggacacaagcggctatttagaggcctcgatagccgtggctggcctctcgcttatcaccgcactcagcacacccgccataaaaaatgtcgcaatccgctccaggagcattcccggaagtgattccacgtcttcctccttgccttacgtcgaagccgcgggccacgtgtatctctacgaggataaggatggcaaggcaac
Multi-drug resistance (MDR) genes/ABC transporters AFO32443 Sequence 17: aaacctcatgggctatcctggacctgctcgaaaagctcaccaagagcggacaagcaattctctgcactatccaccagccgtccgccatgctattccaacgtttcgaccggctcttgttcctagccaagggcggaaaaacggtttactttggcgatattggcgaaaactccaagatcatgacggactactttgagcgcaatggtg
Multi-drug resistance (MDR) genes/ABC transporters XM_369440 Sequence 18: cgctgagatttgaccctctcgcaaccgaaggccctggctgaccgtctgccgctacaaggccgtcttcgcccgtggcctccaccatctttgcaaacagcccattggaatccctgatcagagtctcccagcagcccacctggacgatcctcccctcgtccatcacgacaatcttgtcatagtcccggatggt
Membrane transporters/MDLB XM_370318 Sequence 19: gcgtctcagcacgctaccggcgaaggcgcccacgtcatttttaggcctggggaaccggttcagctcgccatcgggcgtcctgcgacgattctcgacgactcaaacgccatggaagcagtctgttaaggagacgagcctgcaagatgattcgcgggaagatggcaaggcgctggagaacgcggaagctaagaaggatggagatgtggcat
Membrane transporters/MDLB XM_001413121 Sequence 20: ctatttccgcatggtgcaggcgcagaggctctccaagatgtcggccgcggccgagggcgacgacgacggcgtggagggcggcgctgcgaaatcggtcgacagctccgacgacgaaggcaacaagcgaggtgttggcgtcgagggcgatgccgccatggacgatgtggcgcagatgcagtccgtcgtcaggtacaa
Membrane transporters/MDLB XM_364125 Sequence 21: gtttccttgcgacgaggtggcggtggtgccgcaggacagcgcgctgttcgacggcacggtgcgcttcaacgtggggctgggggcgcggccgggccgcgaggccaccgacgccgagatcgaggaggcctgccgcctggccaacctgcacgacaccatcgtcgggacgctgccccgcggctacgacaccgagtgc
Multi-drug resistance (MDR)/Iron Homeostasis XM_001404089 Sequence 22: cgaaatcgacgtcaaatggtggcgcaaccagataggcctggttcagcaagacaatgtgctcttcaacacgacaatttacaaaaacgtcgagcatgggctgatcggcacgctgtgggagcatgagagcgacgagaaaaaggccatgctgattgagactgcatgccgggatgcgtttgccgacgagttcatcaaccgtctcccagac
Multi-drug resistance (MDR)/Iron Homeostasis XM_365137 Sequence 23: ggcctcaccagaggtctcaaaccgccgcgcgcgcccgcagagcacgccgcaggctttgccgcagggccaggccgagtcgggacacgttctagaaagtccctcgagatcaaacgcggccaattcgtcgcgctggtcggcgcctcgggctgcggcaagtccaccatcatcgcgatgctggagcgcttctacgacccgacgacg
Multi-drug resistance (MDR)/Iron Homeostasis XM_365646 Sequence 24: cgagtcgacctcggccttggattccgagtcggagagggtcgtgcaggcggctctggacgccgccgccaagggccgcaccaccatcgccgtcgcgcaccgcctgagcaccgtgcaaaaggcccatgtgatctttgtgttggaccagggccgcgtggtggagagcgggacgcaccaggagctgatgcgcagcaaggggcactattatga

Using BLAST tool available at NCBI, each said target gene fragment is aligned against at least one plant genome sequence to identify said target gene fragment sequence similarity with said host plant genome sequence. The target gene fragments showing less than 10 bp to 20 bp continuous sequence similarity with said host plant genome are selected.

Gene constructs development:
Total genomic DNA has been isolated from two field isolates of Magnaporthe, collected from Almora district of Uttarakhand and Nellore district of Tamil Nadu. From said DNA, five different single gene fragments have been selected for amplification. Target gene fragments within the size range from 150 bp to 400 bp obtained from said five selected single gene fragments have been amplified from both the strains of Magnaporthe followed by amplicons sequencing. Sequencing results showed no difference in the sequences of target gene fragments obtained from said Almora strain and said Nellore strain. Total genomic DNA from said Almora strain has been used further in all experiments, related to gene constructs development.

Gene construct designing commenced with PCR amplification of said target gene fragment obtained from said selected total genomic DNA. Primers were designed with specific restriction sites for directional cloning of said target gene fragment into a vector. Cloning of said target gene fragment in sense orientation (5’ to 3’) was followed by cloning of spacer - bean catalase intron and further cloning of said target gene fragment in anti-sense orientation (3’to 5’), thus making a hairpin structure or RNAi construct.

Separate gene constructs or RNAi gene constructs are designed for single gene target and multi-gene targets.

When said RNAi gene constructs are designed with the gene fragment obtained from single target gene, they are referred to as ‘single gene targets’. Said single gene targets are aimed to silencing of one gene at a time. Only those target genes are selected for single gene silencing which are shown to be indispensable for fungus survival inside a host system. SEQ ID 25 to Seq ID 29 of the present invention have been identified as the hairpin sequences of single gene targets.

When said RNAi gene constructs are designed with the gene fragments obtained from many genes together in single gene cassette, they are referred to as ‘multi-gene targets’ (Table 1). ‘Multi gene targets’ are selected from different classes of membrane transporters which protect fungus against plant resistance machinery. Various genes from one class of multi-gene targets are first aligned by multiple sequence alignment, followed by identification of conserved domains, if present, and further construction of dendrogram. At-least four targets representing widely related genes are selected from one class, targeting silencing of entire class, simultaneously. For cloning of multi-gene targets, said target gene fragments obtained from different genes are cloned sequentially, in sense orientation, followed by insertion of bean catalase intron as spacer and further cloning of all said target gene fragments in anti-sense orientation. Sequences from SEQ. ID 30 to SEQ. ID 34 of the present invention have been identified as the hairpin sequences of multi-gene targets.

Hairpin loop sequences of single gene targets and multi-gene targets are given below:
Hairpin loop sequences of Single gene targets:
Con7- SEQ. ID25:
aacatgcatttcgctggtctcagcaacccgagcgccactgctgtgagggtttattgtatcatggcatacgatcttataagaggtttcgcacgcgcgatacttttagtccctaatgtctctggggtgtttgcttctttttttctttattctctgtttgccttatttattttctgttttgtgttttttctcttgtctcgcttatggtatttttttggcagctcctttggaaccagtactatttttttactagttttccactgaaggaagcatctgttatgaggatgcatcttgaggtttgaacggtcgggatgggtagagacaatgggatggatgacataaaggttttgaagcaggagtccaaccggatccccgttcaaacctcaagatgcatcctcataacagatgcttccttcagtggaaaactagtaaaaaaatagtactggttccaaaggagctgccaaaaaaataccataagcgagacaagagaaaaaacacaaaacagaaaataaataaggcaaacagagaataaagaaaaaaagaagcaaacaccccagagacattagggactaaaagtatcgcgcgtgcgaaacctcttataagatcgtatgccatgatacaataaaccctcacagcagtggcgctcgggttgctgagaccagcgaaatgcatgtt
Hex1- SEQ. ID 26:
Cttctaaccgacccgctttagtcgtcgccatgaccgagaccggtgatgtcaagcagaacctgcccgtcagcgagcagtccaacctctacgagcgcctccagcgcgctttcgagtctggccgtggcagcgtccgtgccctcgtcgtcagcgacaacggccgtgagcttgtctgcgacatggctgtcctccacggcagcaggctgtagatgcactctctagctctaaacctagatagatgtcttttgctttgctggcttaatggatcccctgctgccgtggaggacagccatgtcgcagacaagctcacggccgttgtcgctgacgacgagggcacggacgctgccacggccagactcgaaagcgcgctggaggcgctcgtagaggttggactgctcgctgacgggcaggttctgcttgacatcaccggtctcggtcatggcgacgactaaagcgggtcggttagaag
Nth1- SEQ. ID27:
tgcggataagcccgatatacgcctggatgtcgttgagcttcccgagactattactcccgagtatgtcgtcggcatcaacaaagccccgggtcttcttgccgtggacatggaagagactgtggaccccaagaccggggagagggtcatgagcggtcgtccattcgtcgttcctggcggtcgcttcaacgagctgtacggctgggacagctacatggagtctctcggtctccttgttaacgacaaggtctacctggccaagtccatggtcttgaacttctgcttctgtatcaagcactatggaaaaatcttgaacgccactaggtcttactacctttgccgatcccagccgccattcctcactgatatggctctgcgcgtctacgacaagattcgacacgagcctgtcgacggttctgtaactatcatcatcatcatagacacacgaaataaagtaatcagattatcagttaaagctatgtaatatttacaccataaccaatcaattaaaaaatagatcagtttaaagaaagatcaaagctcaaaaaaataaaaagagaaaagggtcctaaccaagaaaatgaaggagaaaaactagaaatttaccctgtagggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtcgacaggctcgtgtcgaatcttgtcgtagacgcgcagagccatatcagtgaggaatggcggctgggatcggcaaaggtagtaagacctagtggcgttcaagatttttccatagtgcttgatacagaagcagaagttcaagaccatggacttggccaggtagaccttgtcgttaacaaggagaccgagagactccatgtagctgtcccagccgtacagctcgttgaagcgaccgccaggaacgacgaatggacgaccgctcatgaccctctccccggtcttggggtccacagtctcttccatgtccacggcaagaagacccggggctttgttgatgccgacgacatactcgggagtaatagtctcgggaagctcaacgacatccaggcgtatatcgggcttatccgca
Serine/Threonine Phosphatase- SEQ. ID28:
gatagcagcaccgatgcaacggccgccacccgcgccttcaccaacagtgccagtaaccccaccaaagccgcagtcaacggcgctgcgcccacgcgcaacgtccttgtgatcaccgccgacgagctatacacgagcacatttgtcggcgaaggtcccatttccaaaataaccgacgatgagcgacggatggttgtcgagatgctgaacccggagcagtcaacgcagaagctacgcaagaacgagcagtcctatatagtaaatcgcggtcagggtgtcgtccgatatgacttggtgcagttgcccagcaacgaccccattgaggatgatcacgccgagaagatcgtcgaggttcccgatggatcgcagccgtcctccaagaatgactggatggtcgacggtatcgataagcttgatatcgaattcctgcagcccgggggatccctacagggtaaatttctagtttttctccttcattttcttggttaggacccttttctctttttatttttttgagctttgatctttctttaaactgatctattttttaattgattggttatggtgtaaatattacatagctttaactgataatctgattactttatttcgtgtgtctatgatgatgatgatagttacagaaccgtcgaccatccagtcattcttggaggacggctgcgatccatcgggaacctcgacgatcttctcggcgtgatcatcctcaatggggtcgttgctgggcaactgcaccaagtcatatcggacgacaccctgaccgcgatttactatataggactgctcgttcttgcgtagcttctgcgttgactgctccgggttcagcatctcgacaaccatccgtcgctcatcgtcggttattttggaaatgggaccttcgccgacaaatgtgctcgtgtatagctcgtcggcggtgatcacaaggacgttgcgcgtgggcgcagcgccgttgactgcggctttggtggggttactggcactgttggtgaaggcgcgggtggcggccgttgcatcggtgctgctatc
Telomere protection protein- SEQ. ID29:
tgggtccgctttcaaaacgtgcatattaagcctggaaaaaatgggattaacttggagggctttctgcgccaagaccagaaatacccagagaggatcaaagtcgaaatactcgaggacaacgattcacgtctcaaagatgttctgcgtcgcaagcaagaatacgagaaatcaaacaagcgcaaaaacccgcaccaccacaaccctcgagttgctcaacaagctcaagtacggcaaggaccagatcctactaggggaaaggaacagcgccttggggagacgtccgccgaaaacagtaatcagcgacgaaagaggcgtcgacggtatcgataagcttgatatcgaattcctgcagcccgggggatcccctacagggtaaatttctagtttttctccttcattttcttggttaggacccttttctctttttatttttttgagctttgatctttctttaaactgatctattttttaattgattggttatggtgtaaatattacatagctttaactgataatctgattactttatttcgtgtgtctatgatgatgatgatagttacagaaccgtcgacgcctctttcgtcgctgattactgttttcggcggacgtctccccaaggcgctgttcctttcccctagtaggatctggtccttgccgtacttgagcttgttgagcaactcgagggttgtggtggtgcgggtttttgcgcttgtttgatttctcgtattcttgcttgcgacgcagaacatctttgagacgtgaatcgttgtcctcgagtatttcgactttgatcctctctgggtatttctggtcttggcgcagaaagccctccaagttaatcccattttttccaggcttaatatgcacgttttgaaagcggaccca

Hairpin loop sequences of Multi-gene targets:
Chitin synthase- SEQ. ID30:
gtctcggatggtcgtgaaaagatccatcctcggacgctcgatgcactggccgctatgggcgtttaccagcacggcattgccaagaactacgtcaaccagaaagccgttcaagcccacgtctatgagtatactactcaggtgtcgcttgacgctgatttaaagttcaaaggtgccgagaagggtattgtcccctgccagatgctcgagatctccctcgccatttcagaatgactatggtgtttcgtcgggctaccagggcgcaatgggcggccacgcagacgacggcttccccattggcggcggagacccccagcaaggccacccctacgataccgaggacagctgggtgcagcgccagaaccccaacgccgctccccagggtggtggtctgaaacgttatgccaccaaagcttcaccacggcgcatatttacgagtacaccacccaaatcggcatggctctcaagaacgatgtagttcagctcttgccacgccagcagcctgtgcagcttctgttctgcctcaaggagaacaaccagaagaagatcaactctcacaggtggttcttctctgcatttggccgcgttctgaacccaaacatctgtgtacttctcgacgccgaattcacaacaccttccgcctgtcggcggcaacggtggtgcacacacgcagccttcgctacccgcgctgcccgcccatcttcagtccgacacgcacctcacggggcatcttgccagccgattccacgtcagtctgccaaccgccaaactatcttcccacgccttcatctcgatcaacacatacacttcctcctgcagacctcggtctcgacaacaacgctgctcaacgccattcacaacatctatctcgcgtctcagccctaccgcttggatgcagggaccagtctggttgtcaacacgtggctcacagctacgcaggccgggcctgacggagaggtcggaggtactgttgacccggccctcgcagcacgagcttgggaacatgctcgtgtcgacggttctgtaactatcatcatcatcatagacacacgaaataaagtaatcagattatcagttaaagctatgtaatatttacaccataaccaatcaattaaaaaatagatcagtttaaagaaagatcaaagctcaaaaaaataaaaagagaaaagggtcctaaccaagaaaatgaaggagaaaaactagaaatttaccctgtagggatccgcgtcgacacgagcatgttcccaagctcgtgctgcgagggccgggtcaacagtacctccgacctctccgtcaggcccggcctgcgtagctgtgagccacgtgttgacaaccagactggtccctgcatccaagcggtagggctgagacgcgagatagatgttgtgaatggcgttgagcagcgttgttgtcgagaccgaggtctgcaggaggaagtgtatgtgttgatcgagatgaaggcgtgggaagatagtttggcggttggcagactgacgtggaatcggctggcaagatgccccgtgaggtgcgtgtcggactgaagatgggcgggcagcgcgggtagcgaaggctgcgtgtgtgcaccaccgttgccgccgacaggcggaaggtgttgtgaattcggcgtcgagaagtacacagatgtttgggttcagaacgcggccaaatgcagagaagaaccacctgtgagagttgatcttcttctggttgttctccttgaggcagaacagaagctgcacaggctgctggcgtggcaagagctgaactacatcgttcttgagagccatgccgatttgggtggtgtactcgtaaatatgcgccgtggtgaagctttggtggcataacgtttcagaccaccaccctggggagcggcgttggggttctggcgctgcacccagctgtcctcggtatcgtaggggtggccttgctgggggtctccgccgccaatggggaagccgtcgtctgcgtggccgcccattgcgccctggtagcccgacgaaacaccatagtcattctgaaatggcgagggagatctcgagcatctggcaggggacaatacccttctcggcacctttgaactttaaatcagcgtcaagcgacacctgagtagtatactcatagacgtgggcttgaacggctttctggttgacgtagttcttggcaatgccgtgctggtaaacgcccatagcggccagtgcatcgagcgtccgaggatggatcttttcacgaccatccgagac
Cation/membrane Transporter- SEQ. ID31:
gtagctgttcccgagggacttccactggctgtcacacttgcactggcatttgccaccacccgcatgaccaaggacaacaacctcgttcgcgttctgagggcttgcgagacgatgggaaacgcgactaccatctgttcagacaagaccggaaccttgacacaaaacaagatgacagtcgttgccaccactctcgggacttctcctcgagcgacgtcgtatcaatccagagaactagccgaggacttctcctacttgacggcaagcgaaaccgctacgcgattacaaacttcgttaactcatggcctcacggctaccgaagcgttgcgacgacagcaagaccatgggctcaacgagatcccacacgaacctccagaaccgctttggttgcgcttcattggtcagttcaaggaaccgtaagcttgcaagaaaaactccgacgacgctgtcgtccgagtttcgggccagtccaacgaaccgctgtcccgtccgatccacgccctcacagtcgcccaattcctcgaggagatcaagggcgacgccgaagatggcctcaagccggaggaggccaagaggcgcctggagcagtacggcaacaatgactttggcgagggcgagggcgtctctgccatcaagattttgaattccaaaggctccaagcaaagagtctcttgcgaccgacattgagcccgggaacccaccaacagcacccaggcaagttggtgccagacaacgcgcaagcgattggttcgccaaagtctcccaagaggggttattccataaacctctacctccctcaaaggatggtcgccatgttcccataagatttgcgggaagccaggacggcgacaaagctactctgcaggtcgacggttctgtaactatcatcatcatcatagacacacgaaataaagtaatcagattatcagttaaagctatgtaatatttacaccataaccaatcaattaaaaaatagatcagtttaaagaaagatcaaagctcaaaaaaataaaaagagaaaagggtcctaaccaagaaaatgaaggagaaaaactagaaatttaccctgtagggatcccccgggctgcagagtagctttgtcgccgtcctggcttcccgcaaatcttatgggaacatggcgaccatcctttgagggaggtagaggtttatggaataacccctcttgggagactttggcgaaccaatcgcttgcgcgttgtctggcaccaacttgcctgggtgctgttggtgggttcccgggctcaatgtcggtcgcaagagactctttgcttggagcctttggaattcaaaatcttgatggcagagacgccctcgccctcgccaaagtcattgttgccgtactgctccaggcgcctcttggcctcctccggcttgaggccatcttcggcgtcgcccttgatctcctcgaggaattgggcgactgtgagggcgtggatcggacgggacagcggttcgttggactggcccgaaactcggacgacagcgtcgtcggagtttttcttgcaagcttacggttccttgaactgaccaatgaagcgcaaccaaagcggttctggaggttcgtgtgggatctcgttgagcccatggtcttgctgtcgtcgcaacgcttcggtagccgtgaggccatgagttaacgaagtttgtaatcgcgtagcggtttcgcttgccgtcaagtaggagaagtcctcggctagttctctggattgatacgacgtcgctcgaggagaagtcccgagagtggtggcaacgactgtcatcttgttttgtgtcaaggttccggtcttgtctgaacagatggtagtcgcgtttcccatcgtctcgcaagccctcagaacgcgaacgaggttgttgtccttggtcatgcgggtggtggcaaatgccagtgcaagtgtgacagccagtggaagtccctcgggaacagctac
Multi-drug resistance (MDR) genes/ABC transporters- SEQ. ID32
cggctcctttactggctacaggcctctgctggaccttggccatggatatctcagcgcaaccgccgacacgaaacagcctctttgcggaaacgccgagggatggggcccgctcagcccattccgatatgactttacaccttgctttatcgacgtatgggtggcttcagtagccgtcttcggcctcatctttgggcctatcgccttgtggtggttgtctcgagatggacacaagcggctatttagaggcctcgatagccgtggctggcctctcgcttatcaccgcactcagcacacccgccataaaaaatgtcgcaatccgctccaggagcattcccggaagtgattccacgtcttcctccttgccttacgtcgaagccgcgggccacgtgtatctctacgaggataaggatggcaaggcaacaagcttaaacctcatgggctatcctggacctgctcgaaaagctcaccaagagcggacaagcaattctctgcactatccaccagccgtccgccatgctattccaacgtttcgaccggctcttgttcctagccaagggcggaaaaacggtttactttggcgatattggcgaaaactccaagatcatgacggactactttgagcgcaatggtggaattccgctgagatttgaccctctcgcaaccgaaggccctggctgaccgtctgccgctacaaggccgtcttcgcccgtggcctccaccatctttgcaaacagcccattggaatccctgatcagagtctcccagcagcccacctggacgatcctcccctcgtccatcacgacaatcttgtcatagtcccggatggtctgcaggtcgacggttctgtaactatcatcatcatcatagacacacgaaataaagtaatcagattatcagttaaagctatgtaatatttacaccataaccaatcaattaaaaaatagatcagtttaaagaaagatcaaagctcaaaaaaataaaaagagaaaagggtcctaaccaagaaaatgaaggagaaaaactagaaatttaccctgtagggatcccccgggctgcagaccatccgggactatgacaagattgtcgtgatggacgaggggaggatcgtccaggtgggctgctgggagactctgatcagggattccaatgggctgtttgcaaagatggtggaggccacgggcgaagacggccttgtagcggcagacggtcagccagggccttcggttgcgagagggtcaaatctcagcggaattccaccattgcgctcaaagtagtccgtcatgatcttggagttttcgccaatatcgccaaagtaaaccgtttttccgcccttggctaggaacaagagccggtcgaaacgttggaatagcatggcggacggctggtggatagtgcagagaattgcttgtccgctcttggtgagcttttcgagcaggtccaggatagcccatgaggtttaagcttgttgccttgccatccttatcctcgtagagatacacgtggcccgcggcttcgacgtaaggcaaggaggaagacgtggaatcacttccgggaatgctcctggagcggattgcgacattttttatggcgggtgtgctgagtgcggtgataagcgagaggccagccacggctatcgaggcctctaaatagccgcttgtgtccatctcgagacaaccaccacaaggcgataggcccaaagatgaggccgaagacggctactgaagccacccatacgtcgataaagcaaggtgtaaagtcatatcggaatgggctgagcgggccccatccctcggcgtttccgcaaagaggctgtttcgtgtcggcggttgcgctgagatatccatggccaaggtccagcagaggcctgtagccagtaaaggagccg
Membrane transporters/MDLB- SEQ. ID33:
gcgtctcagcacgctaccggcgaaggcgcccacgtcatttttaggcctggggaaccggttcagctcgccatcgggcgtcctgcgacgattctcgacgactcaaacgccatggaagcagtctgttaaggagacgagcctgcaagatgattcgcgggaagatggcaaggcgctggagaacgcggaagctaagaaggatggagatgtggcatctcgagctatttccgcatggtgcaggcgcagaggctctccaagatgtcggccgcggccgagggcgacgacgacggcgtggagggcggcgctgcgaaatcggtcgacagctccgacgacgaaggcaacaagcgaggtgttggcgtcgagggcgatgccgccatggacgatgtggcgcagatgcagtccgtcgtcaggtacaaaagcttgtttccttgcgacgaggtggcggtggtgccgcaggacagcgcgctgttcgacggcacggtgcgcttcaacgtggggctgggggcgcggccgggccgcgaggccaccgacgccgagatcgaggaggcctgccgcctggccaacctgcacgacaccatcgtcgggacgctgccccgcggctacgacaccgagtgcgaattcctgcaggtcgacggttctgtaactatcatcatcatcatagacacacgaaataaagtaatcagattatcagttaaagctatgtaatatttacaccataaccaatcaattaaaaaatagatcagtttaaagaaagatcaaagctcaaaaaaataaaaagagaaaagggtcctaaccaagaaaatgaaggagaaaaactagaaatttaccctgtagggatcccccgggctgcaggaattcgcactcggtgtcgtagccgcggggcagcgtcccgacgatggtgtcgtgcaggttggccaggcggcaggcctcctcgatctcggcgtcggtggcctcgcggcccggccgcgcccccagccccacgttgaagcgcaccgtgccgtcgaacagcgcgctgtcctgcggcaccaccgccacctcgtcgcaaggaaacaagcttttgtacctgacgacggactgcatctgcgccacatcgtccatggcggcatcgccctcgacgccaacacctcgcttgttgccttcgtcgtcggagctgtcgaccgatttcgcagcgccgccctccacgccgtcgtcgtcgccctcggccgcggccgacatcttggagagcctctgcgcctgcaccatgcggaaatagctcgagatgccacatctccatccttcttagcttccgcgttctccagcgccttgccatcttcccgcgaatcatcttgcaggctcgtctccttaacagactgcttccatggcgtttgagtcgtcgagaatcgtcgcaggacgcccgatggcgagctgaaccggttccccaggcctaaaaatgacgtgggcgccttcgccggtagcgtgctgagacgc
Multi-drug resistance (MDR)/Iron Homeostasis- SEQ. ID34:
cgaaatcgacgtcaaatggtggcgcaaccagataggcctggttcagcaagacaatgtgctcttcaacacgacaatttacaaaaacgtcgagcatgggctgatcggcacgctgtgggagcatgagagcgacgagaaaaaggccatgctgattgagactgcatgccgggatgcgtttgccgacgagttcatcaaccgtctcccagacaagcttggcctcaccagaggtctcaaaccgccgcgcgcgcccgcagagcacgccgcaggctttgccgcagggccaggccgagtcgggacacgttctagaaagtccctcgagatcaaacgcggccaattcgtcgcgctggtcggcgcctcgggctgcggcaagtccaccatcatcgcgatgctggagcgcttctacgacccgacgacggaattccgagtcgacctcggccttggattccgagtcggagagggtcgtgcaggcggctctggacgccgccgccaagggccgcaccaccatcgccgtcgcgcaccgcctgagcaccgtgcaaaaggcccatgtgatctttgtgttggaccagggccgcgtggtggagagcgggacgcaccaggagctgatgcgcagcaaggggcactattatgactgcaggtcgacggttctgtaactatcatcatcatcatagacacacgaaataaagtaatcagattatcagttaaagctatgtaatatttacaccataaccaatcaattaaaaaatagatcagtttaaagaaagatcaaagctcaaaaaaataaaaagagaaaagggtcctaaccaagaaaatgaaggagaaaaactagaaatttaccctgtagggatcccccgggctgcagtcataatagtgccccttgctgcgcatcagctcctggtgcgtcccgctctccaccacgcggccctggtccaacacaaagatcacatgggccttttgcacggtgctcaggcggtgcgcgacggcgatggtggtgcggcccttggcggcggcgtccagagccgcctgcacgaccctctccgactcggaatccaaggccgaggtcgactcggaattccgtcgtcgggtcgtagaagcgctccagcatcgcgatgatggtggacttgccgcagcccgaggcgccgaccagcgcgacgaattggccgcgtttgatctcgagggactttctagaacgtgtcccgactcggcctggccctgcggcaaagcctgcggcgtgctctgcgggcgcgcgcggcggtttgagacctctggtgaggccaagcttgtctgggagacggttgatgaactcgtcggcaaacgcatcccggcatgcagtctcaatcagcatggcctttttctcgtcgctctcatgctcccacagcgtgccgatcagcccatgctcgacgtttttgtaaattgtcgtgttgaagagcacattgtcttgctgaaccaggcctatctggttgcgccaccatttgacgtcgatttcgctcgag

The gene constructs are designed for single gene targets and multi-gene targets. The gene construct design comprises of amplification of specific target gene fragment with primers which are designed with restriction sites towards 5’ and 3’ends in that order. Thereafter the amplicons are cloned in a preferred cloning vector within the preferred restriction sites in sense orientation to create a plasmid. This process is repeated till a new plasmid of preferred hairpin orientation is created.

Example 1:
The single gene construct designing for con7 RNAi vector pMH878 is depicted in Fig. 1. Amplification of 363 bp target gene fragment with primer nos. 603 and 604, which are designed with restriction sites KpnI and BamHI towards 5’ and 3’ends, respectively. Additional 61 bp towards 3’end of the amplicon serve as a spacer in RNAi construct. Said 363 bp amplicon in cloned in pMH45 which is a basic cloning vector within KpnI and BamHI restriction sites in sense orientation. The plasmid thus created is named as pMH722 (Fig.1A).

Amplification of 302 bp target gene fragment with primer nos. 601 and 602 (Table 2) are designed with BamHI and SacI restriction sites at 5’ and 3’ ends, respectively. Said 302 bp amplicon is cloned in said pMH722 within BamHI and SacI in antisense orientation and results in a hairpin structure. The plasmid thus created is named as pMH729 (Fig. 1B).

Restriction of said hairpin structure from pMH729 as KpnI and SacI fragment and ligation to similarly digested binary vector pMH210, under Metahelix proprietary chimeric promoter (patent no. 260535) and NOS 3’UTR, resulted in vector which was named as pMH878 (Fig. 1C). pMH878 is a binary vector, ready to mobilize to Agrobacterium. Said pMH210 is a binary vector with hygromycin as plant selectable marker. Vector contains a promoter and 3’UTR, where any gene of interest can be cloned.

Example 2:
The multi-gene construct designing for chitin synthase RNAi vector pMH883 is depicted in Fig. 2.
Chitin synthase RNAi construct is designed with five different target gene fragments, targeting simultaneous silencing of all known chitin synhthase genes in Magnaporthe. Abbreviated as chs, chitin synthase gene fragments are amplified from Magnaporthe genomic DNA. Chitin synthase1 or chs1, a 201bp fragment is amplified using primers no. 615 and 616 (Table 2), designed with KpnI and XhoI restriction sites. Amplicon thus obtained are cloned at similarly digested cloning vector pMH45 in sense orientation and resulting vector is named as pMH656 (Fig. 2A).

Second, third, fourth and fifth gene fragments named as chs2 (Fig. 2B), chs3 (Fig. 2C), chs4 (Fig. 2D) and chs5 (Fig. 2E) are amplified by using 617/618, 619/620, 621/622 and 623/624 primers, respectively (Table 2) and result into vector construction of pMH734, pMH737, pMH738, pMH788, respectively. Amplicon sizes of chs2, chs3, chs4 and chs5 are 200bp, 205bp, 186bp and 192bp, respectively. Each amplicon is cloned sequentially in pMH656 by making use of specific restriction sites. Final vector containing all the five gene fragments, in sense orientation between KpnI and BamHI restriction sites is named as pMH788 (Fig. 2E).Bean catalase intron is cloned between SalI and BamHI sites of pMH788, as a spacer to obtain plasmid named as pMH808 (Fig. 2F).

KpnI/ BamHI fragment from pMH788 is digested and ligated to similarly digested basic cloning vector pMH022, where these sites are complementary, resulting in anti-sense orientation of targeted five fragments. The resultant plasmid is named as pMH811 (Fig. 2G).

KpnI/SacI fragment of pMH811, representing five gene fragments in reverse orientation is eluted and ligated to KpnI/SacI digested pMH808. Resultant plasmid named as pMH671 (Fig. 2H), harbours all five gene fragments between KpnI/SacI sites in sense and antisense orientation, separated by bean catalase intron spacer.

Hairpin structure from pMH671 (Fig. 2H), digested as KpnI/SacI fragment is ligated between chimeric promoter and NOS 3’UTR of pMH210 and is named as pMH883 (Fig. 2I). Said pMH883 is a binary vector ready to mobilize to Agrobacterium.

Both the plasmids pMH878 and pMH883 are deposited at MTCC, IMTECH Chandigarh under Budapest treaty, IDA.

Agrobacterium mobilization of binary RNAi vectors:
Binary RNAi vectors harbouring RNAi constructs, such as but not limited to pMH878 and pMH883 are mobilized to Agrobacterium by standard techniques. One of the non-limiting Agrobacterium strain is Agrobacterium strain EHA105. Said mobilization of the binary RNAi vector into the Agrobacterium is carried out by tri-parental mating with the help of a helper plasmid pRK2013.

Example 3:
In one of the examples, said binary RNAi vectors are streaked on petri plates containing culture medium. Non-limiting example of one of the culture medium is LB medium comprising the composition of tryptone 10g/L, yeast extract 5g/L and sodium chloride 2.5g/L, pH 7.0, supplemented with 50mg/L kanamycin sulphate. Culture medium of same composition is also used to streak said helper strain. Both, said binary RNAi vectors and said helper strain are grown overnight at 370C.

Agrobacterium is streaked on a culture medium, such as but not limited to, AB medium comprising the composition of Glucose 5g/L added with AB salts- Ammonium Chloride 1g/L, Magnesium sulfate, heptahydrate 0.3g/L, Potassium chloride 0.150g/L, Calcium chloride dihydrate 0.010g/L, Ferrous sulfate, heptahydrate 0.0025g/L and AB buffer- Potassium phosphate, dibasic 3g/L, Sodium dihydrogen phosphate 1g/L, pH7.0 after autoclaving and supplemented with rifampicin 10mg/L and grown for 48h at 280C.

For said tri-parental mating single colony from each of the three cultures viz. said binary RNAi vector, said helper strain and said Agrobacterium strain are mixed together on LB plate without any antibiotic and is incubated for 4 to 5 hrs at room temperature, followed by streaking on AB medium supplemented with 50mg/L kanamycin sulphate and rifampicin 10mg/L. These plates are incubated at 280C for 2 to 3 days. Now the transformed Agrobacterium colonies are selected by their ability to grow on selective medium containing kanamycin sulphate and rifampicin.

Confirmation of transformation of Agrobacterium is done by PCR and further by restriction digestion with enzymes specific to transformed binary vector harbouring RNAi construct. Each transformed Agrobacterium strain is given a specific ID and stored at -800C in 20% sterilized glycerol. Agrobacterium transformation is followed by plant transformation and event generation.

siRNA mediated fungal growth inhibition test:
When cultured with siRNA, said fungal hyphae up-take siRNA along with other nutrients from culture medium. Inside the cells of said fungal hyphae, siRNA down regulate specific gene target by RNAi mediated gene silencing and inhibit fungal growth. Proof of concept has been showcased with siRNA generated by 200bp dsRNA, targeting silencing of beta tubulin gene.

The dsRNA (double stranded RNA) is prepared in vitro followed by generation of siRNA. When homogenous blast fungal hyphae are cultured with said siRNA, specific to the fungal genes, the growth of fungal hyphae is inhibited. This process comprises of three steps viz.,
(a) in vitro preparation of dsRNA and siRNA,
(b) generation of homogenous fungal culture
(c) incubation of fungal hyphae or mycelia with siRNA followed by data recording.

(a) in vitro preparation of dsRNA and siRNA:
The fungal genomic DNA such as the Magnaporthe genomic DNA is used to run two separate PCR reactions to anchor T7 promoter with target DNA template at 5’ ends, generating sense and anti-sense templates with T7 promoter. Primers numbered 853 and 854 are used to generate sense template, while primers numbered 855 and 856 have generated anti-sense template. Further to templates generation, dsRNA is obtained following in vitro transcription and annealing of in vitro generated RNA strands using Megascript RNAi Kit (Ambion) as per supplier’s instructions (Fig. 3A). Said dsRNA is digested to siRNA by RNAse III treatment (Fig. 3B). Said dsRNA is treated with ShortCut Rnase III (NEB), wherein the reaction of 20µl, 2µg dsRNA is converted completely to siRNA (21 to 25nucleotides) using 2.6 units of enzyme with an incubation of 30 min at 370C. The reaction is stopped by EDTA, followed by ethanol precipitation of siRNA and dissolution in sterilized RNase free water.

(b) Generation of homogenous fungal culture:
The fungal mycelial bit from an actively growing culture of fungus such as Magnaporthe is inoculated in a culture broth and incubated for specific period at specific conditions to obtain mycelia/hyphae of uniform size.

For example, 50ml of PDB-potato dextrose broth (potato infusion 200g/L, dextrose 20g/L, pH 7.0) is inoculated with a mycelial bit from an actively growing culture of Magnaporthe and incubated for 48h at room temperature with continuous shaking at 180rpm. After 48h, the culture is filtered through autoclaved muslin cloth and 10 ml of filtrate is used to inoculate another 50ml of potato dextrose broth medium and grown at 280C for 24hrs with constant shaking. After 24hrs, the culture is dispensed in oak ridge tubes, vortexed and filtered through autoclaved Whatman no. 3 filter paper. Mycelia/hyphae thus obtained have uniform size ranging from 0.01 to 0.03mm.

(c) Incubation fungal hyphae or mycelia with siRNA followed by data recording.
Experiment is conducted in 96 well plates. Before, addition of siRNA to fungal culture, fungal hyphae are allowed to grow in multiwell plate in PDB for 2hrs at 280C with 180rpm. PDB without fungal culture and without siRNA is used as control. Magnaporthe culture without siRNA is also used as control. siRNA is added at two concentrations - 1µg/well and 2µg/well. As shown in figure 3, the well no. 1-3 displays Magnaporthe culture incubated with 1µg siRNA/well, well no. 4-6 shows Magnaporthe culture incubated with 2µg siRNA/well, well no. 7-16 shows Magnaporthe culture without siRNA and well no. 17-20 shows culture medium without Magnaporthe culture or siRNA.

The Plates are maintained at 280C, with constant shaking at 180rpm for 24hrs. 24hrs incubation of fungal hyphae with siRNA results in fungal growth inhibition (Fig. 3C).

It is observed that tubulin siRNA are effective to inhibit growth at both the concentrations of 1µg and 2µg per well. Experimental control, where no siRNA are added with fungal culture, have not shown any kind of growth inhibition/retardation. This provides a clear indication that fungal hyphae up-take siRNA available in the medium outside fungal cells. It also indicates up-take of siRNA targeting a gene important for fungus survival shall lead to fungal growth inhibition.

Rice transformation:
Agrobacterium tumefaciens mediated rice transformation is carried out. In the experiments said rice transformation is carried out with five single gene constructs and five multi-gene constructs, using rice immature embryos as explants.

Agrobacterium culture is revived from deep freezer on AB minimal medium, supplemented with 100 µM acetosyringone, 50mg/L kanamycin sulphate and 10mg/L rifampicin. Culture is grown till it reached to optical density of 1 at 600nm and is used for co-cultivation with rice genotype IR58025B immature embryos. Rice immature embryos are obtained from panicles 14-16 days post-anthesis. Co-cultivation with Agrobacterium for 15 min is followed by embryogenic callus induction and selection on MS medium supplemented with hygromycin (50mg/L), 2,4-D (2mg/L), BAP (0.1mg/L) and cefotaxime (250mg/L).

For callus induction, culture plates are incubated at 260C ±20C in dark for five weeks. For regeneration, actively growing callus is transferred to MS medium supplemented with kinetin (3mg/L), NAA (2mg/L) and hygromycin (50mg/L) and is incubated in dark at 260C ± 20C for five days followed by transfer to light with 16hrs photoperiod. Shoots are developed from calli showing greening. Shoot proliferation is obtained by transferring individual shoots to culture bottles containing same medium as for regeneration, and incubated in dark at 260C ± 20C. Rooting is induced on shoots on ½ MS medium containing hygromycin 50 mg/L. Complete plantlet is ready after 15-20 days of transfer to rooting medium.

For hardening, plantlets are transferred to small plastic cups containing potting mix and incubated in growth room for a week to 15 days, followed by transfer to bigger pots in green house. Events identity is maintained by a specific code for gene construct and plant number. Due to stringent selection on hygromycin, all of the transgenic events growing on selective regeneration/rooting medium are found to be positive with respect to the specific transgene or RNAi target.

Conversion of transgenic events to homozygous population:
Transgenic events thus obtained are tested for disease reaction against fungus such as Magnaporthe using whole plant assay. A uniform, homozygous population is pre-requisite for whole plant assay. Segregating population of generated events across ten RNAi gene constructs, are converted to homozygous population by consecutive selection on hygromycin (50 mg/L) containing medium for three generations and seed bulking. To segregate out nulls, sixty seeds per event are sown on ½ MS medium supplemented with 50 mg/L hygromycin with appropriate controls. For each event, transgenic seeds are cultured on ½ MS medium supplemented with hygromycin (50mg/L) while non-transgenic and transgenic seeds cultured on ½ MS medium without hygromycin served as controls. Seedlings of transgenic events growing on medium supplemented with hygromycin, represented hemizygous or homozygous nature. Five such seedlings are transferred to green house for seed harvesting. Bulk harvesting is done followed by repetition of same process of hygromycin based null elimination for two more generations. Seeds harvested after three such cycles, represent a homozygous line. Homozygous population thus obtained from 236 events across ten constructs, is used for whole plant assay against plant disease such as rice blast disease.

Whole Plant assay:
Whole plant assay against phytopathogen such as rice blast is done by spraying in vitro generated fungal spores such as Magnaporthe spores on 20-25 days old nursery stage seedlings. Experiment is conducted during Kharif season in three replications, consecutively for three years to observe repeatability of the data. This is a two step process comprising the steps of:
(i) in vitro sporulation and
(ii) nursery generation, disease inoculation and scoring:

(i) In vitro sporulation:
For in vitro spores generation, Magnaporthe cultures are maintained for 10 days at room temperature on oat meal agar (oat meal 15g/L and agar 12.0g/L, pH 7.0) medium, supplemented with kanamycin sulphate 50mg/L. From cultures, mycelia are scraped in water and filtered through small pore sized tea strainer to remove fungal debris. Spores concentration is adjusted to 1x105 spores/ml for nursery inoculation. Approximately, 250ml spores suspension is sprayed on a nursery bed of size 3m x 1m.

(ii) Nursery generation, disease inoculation and scoring:
Nursery generation for blast assay is initiated by making small beds of approximately 3m x 1m size. Dense population of susceptible check (Co-39) is sown all around four sides of the beds, as well as after every five test entries to facilitate disease spread. 60-70 seeds from each event are sown in 50cm rows perpendicular to the border rows. ‘Tetep’, a genotype which shows resistant reaction to the disease is used as positive check and sown with test entries. Experiment is conducted in three replications. 20-25 days old nursery is spray inoculated with Magnaporthe spores at evening hours. After spray, entire bed is covered with polyethylene sheet, over-night to maintain high relative humidity. Polyethylene sheet is removed during day time. High humidity is maintained by repeated water spray on nursery till disease is scored. Scoring is done 20-25 days after spray inoculation, depending upon disease severity on susceptible check. Scoring is done using Standard Evaluation System (SES, IRRI, 1996) on a scale of 0-9, where zero represents resistance, without showing any incidence of disease and nine represents complete susceptibility towards disease, with more than 75% leaf affected area and rapidly coalescing greyish lesions with brown and yellow margins. A disease score of five shows 4-10% of leaf affected area with small (1-2mm) eye shaped lesions with grey centre and brown- yellow margins. According to SES, a score from 0-3 represents highly resistant entries, while entries with consistent rating, between 4 and 6 have a good level of quantitative resistance. Varied disease response is seen across events generated by different gene constructs (Table 4, Fig. 4).

Whole plant assay is repeated three times, consecutively for three years to observe repeatability of assay results. Disease score repeatability is observed within replication of each experiment and also across three experiments. Events with average scoring ranging between 1-5 are selected for further analysis.
Table4: Disease score of selected events from whole plant disease assay
Gene Construct Event ID Disease score
Con7 1027507 3
Con7 1029118 3
NTH 1020802 5
NTH 1020804 5
NTH 1020811 4
NTH 1020805 5
NTH 1020806 5
NTH 1020809 5
NTH 1020810 5
Chitin synthase 1028523 4
Chitin synthase 1028528 4
Chitin synthase 1028529 4
Chitin synthase 10285106 5
Chitin synthase 10285114 5
Chitin synthase 10285111 4
Chitin synthase 10285113 3
Chitin synthase 10285102 7
Multi-drug resistance (MDR)/Iron Homeostasis 1029208 5
Tetep 0
Co-39 9
IR58025B non transgenic control 8

Broad spectrum or strain non-specific resistance:
The resistance reaction obtained by RNAi constructs is broad spectrum or non-specific to Magnaporthe strains. Pure strains of blast affected rice samples are isolated from the field collections by culturing samples on oat meal agar medium followed by single spore isolation. Three strains causing leaf blast and another three strains causing neck blast are selected randomly from different locations/disease hot spots in India. Strains isolated from leaf blast affected samples are coded as APHD01, KNGL02and CHSR01. Neck blast strains collected from disease affected rice panicles are coded as KNSA01, CHMA01 and JHPO01. Genomic DNA is isolated from said selected strains using CTAB method. Said genomic DNA is used as template for PCR amplification of target gene fragments representing con7 and five different chitin synthase genes using specific primers mentioned above for gene cloning experimentations (Table 2). The amplicons thus obtained are sequenced and aligned using multiple sequence alignment. Alignments showed exactly similar sequences of gene fragments with 100% similarity from all six strains (Fig 5 and Fig 6A to 6E). Since target sequences are same from different strains of the fungus, strain non-specificity of the present resistance strategy is clearly established.

Analysis of hairpin RNA from transgenic events:
RNAi induced gene silencing involves siRNA production from any double stranded RNA. RNAi gene construct designed specifically with sense and anti-sense DNA strands leads to formation of RNA hairpin structure after transcription. As RNA hairpin structure is a double stranded RNA, it becomes unstable and is chopped into smaller fragments or siRNA by RNAi machinery. Non-detection of a hairpin transcript in reverse transcriptase-PCR reaction indicates degradation of hairpin RNA into siRNA. An experiment is conducted to find out degradation of RNA hairpin from a few transgenic events of Con7.

Total RNA is extracted from leaves of four randomly selected transgenic events representing Con7 gene construct. RNA is extracted according to manufacturer’s instructions using RNeasy Plant Mini Kit from QIAGEN (cat no. 74903). QIAGEN one step RT PCR Kit (cat no. 210210) is used to set up reverse transcriptase and PCR reactions. Rice house-keeping gene actin1 is used to normalize the RT PCR reactions. Reactions are conducted with exactly same concentration of RNA (600ng) for actin1 as well as Con7 amplifications. PCR reactions were conducted with primers no. 1042/1043 for actin1 and 603/604 for Con7 amplifications. Results, as shown fig. 7, clearly display reduction in Con7 transcripts (Fig. 7- lanes 14, 15 and 16), when compared with amplicons obtained from actin 1 transcripts (fig. 7- lanes 6, 7 and 8). This in turn gives indication of RNAi mediated silencing of Con7 hairpin structure or production of Con7 siRNA in selected transgenic events.As presented in figure 7, lanes 1-8 represent reverse transcriptase PCR amplicons with actin1 primers, amplicon size 540bp (lane 1: water control, lane 2: non-transgenic control, lane 3: transgenic DNA control, lanes 5-8: amplicons from Con7 four events, using 600ng RNA in each event). Further, lanes 9-16 represent reverse transcriptase PCR amplicons with Con7 primers, amplicon size 363bp (lane 9: water control, lane 10: non-transgenic control, lane 11: transgenic DNA control, lanes 13-16: amplicons from Con7 four events, using 600ng RNA in each event).
,CLAIMS:We claim:

1. Novel DNA construct composition to provide strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogen in host plant wherein said DNA construct composition comprises ofat least one novel RNAi construct, at least one promoter and at least one transcriptional terminator
said novel DNA construct being designed in a manner capable of producing dsRNA to down-regulate pathogen specific gene target by way of RNAi mediated gene silencing and consequently inhibiting growth of phytopathogen,
Wherein said RNAi gene constructs are designed for single gene targets and multi-gene targets.

2. The novel DNA construct composition as claimed in claim 1 wherein said single gene targets are SEQ ID 25 to SEQ ID 29.

3. The novel DNA construct composition as claimed in claim 1 wherein said multi-gene targets are SEQ ID 30 to SEQ ID 34

4. The novel DNA construct composition as claimed in claim 1 wherein said promoter is Metahelix proprietary chimeric promoter

5. The novel DNA construct composition as claimed in claim 1 wherein said phytopathogen is such as Magnaporthe.

6. The novel DNA construct composition as claimed in claim 1 wherein said host plant genome is selected from rice, wheat, rye, barley, pearl millet.

7. Method of preparing novel DNA construct to provide strain non-specific and/or race non-specific broad spectrum tolerance against phytopathogen in plants wherein said composition comprising the steps of :
(a) identifying target gene from total genomic DNA from at least one field isolates of phytopathogen,
(b) obtaining target gene fragment of predetermined size range from said target gene,
(c) amplifying said target gene fragments of step (b) to obtain amplicons,
(d) designing primers with specific restriction sites for directional cloning of said amplicons into at least one vector
(e) preparing at least one RNAi gene construct
(f) preparing at least one binary RNAi vector from one or more said RNAi gene constructs
(g) mobilizing said binary RNAi vectors into Agrobacterium sp to obtain transformed Agrobacterium
(h) transformation of said host plant using said transformed Agrobacterium. wherein said DNA construct is capable of producing RNA interference to down-regulate pathogen specific gene target by RNAi mediated gene silencing and inhibiting growth of phytopathogen

8. The method of preparing novel DNA construct as claimed in claim 7 wherein said target gene fragment from total genomic DNA of pathogen is obtained using the method comprising the steps of :
(a) isolating total genomic DNA from at least one field isolates of phytopathogen;
(b) selecting at least one target gene from said isolated total genomic DNA;
(c) sequence alignment of the said target gene of step (b) against host plant genome sequence to eliminate target gene fragments of predetermined size showing not more than specific range of continuous sequence similarity with said host plant genome;
(d) selecting and isolating target gene fragments of step (c) not exhibiting said continuous sequence similarity within specific range;
(e) amplifying said isolated target gene fragments of step (d) to obtain amplicons.

9. The method of preparing novel DNA construct as claimed in claim 7 wherein preparation of said RNAi gene Construct comprises the steps of
(a) Cloning of said target gene fragment in sense orientation (5’ to 3’)
(b) cloning of spacer - bean catalase intron and
(c) cloning of said target gene fragment in anti-sense orientation (3’to 5’), thus making a hairpin structure or RNAi construct.

10. The method of preparing novel DNA construct as claimed in claim 7 wherein said binary RNAi vectors are pMH878 and pMH883.

11. The method of preparing novel DNA construct as claimed in claim 7 wherein said predetermined size of said target gene fragment ranges from 150 bp to 400 bp.

12. The method of preparing novel DNA construct as claimed in claim 8 wherein said specific range of continuous sequence similarity is less than 10bp to 20bp.

13. A method to control phytopathogens wherein said method comprises the steps of
(a) selecting target genes from at least one phytopathogen,
(b) selecting target gene fragments of sizes ranging from 150bp to 400bp from said target genes of step (a),
(c) aligning said target gene fragments of step (b) against host plant genome sequence to eliminate continuous sequence similarity of said target gene fragments with said host plant genome,
(d) amplifying said target gene fragments of step (c) to obtain amplicons,
(e) designing primers with specific restriction sites for directional cloning of said amplicons into at least one vector,
(f) preparing at least one RNAi gene construct,
(g) preparing at least one binary RNAi vector from one or more said RNAi gene constructs,
(h) mobilizing said binary RNAi vectors into Agrobacterium sp to obtain transformed Agrobacterium,
(i) transformation of said host plant using said transformed Agrobacterium,
(j) conversion of positive transgenic events to homozygous plant population
wherein said positive transgenic event harbours DNA construct generating RNA interference to down-regulate pathogen specific gene target by RNAi mediated gene silencing and inhibiting growth of said phytopathogen.

Documents

Application Documents

# Name Date
1 Form 3-signed.pdf 2015-05-19
2 Form 2-signed.pdf 2015-05-19
3 2044-CHE-2015 POWER OF ATTORNEY 29-06-2015.pdf 2015-06-29
4 2044-CHE-2015 FORM-5 29-06-2015.pdf 2015-06-29
5 2044-CHE-2015 FORM-1 29-06-2015.pdf 2015-06-29
6 2044-CHE-2015 CORRESPONDENCE OTHERS 29-06-2015.pdf 2015-06-29
7 OTHERS [21-04-2016(online)].pdf 2016-04-21
8 Drawing [21-04-2016(online)].pdf 2016-04-21
9 Description(Complete) [21-04-2016(online)].pdf 2016-04-21
10 REQUEST FOR CERTIFIED COPY [22-04-2016(online)].pdf 2016-04-22
11 2044-CHE-2015-OTHERS-250416.pdf 2016-07-20
12 2044-CHE-2015-FORM 18 [14-02-2019(online)].pdf 2019-02-14
13 2044-che-2015-Annexure [15-02-2019(online)].pdf 2019-02-15
14 2044-CHE-2015-RELEVANT DOCUMENTS [06-08-2020(online)].pdf 2020-08-06
15 2044-CHE-2015-FORM-26 [06-08-2020(online)].pdf 2020-08-06
16 2044-CHE-2015-FORM 13 [06-08-2020(online)].pdf 2020-08-06
17 2044-CHE-2015-PA [19-05-2021(online)].pdf 2021-05-19
18 2044-CHE-2015-FORM-26 [19-05-2021(online)].pdf 2021-05-19
19 2044-CHE-2015-ASSIGNMENT DOCUMENTS [19-05-2021(online)].pdf 2021-05-19
20 2044-CHE-2015-8(i)-Substitution-Change Of Applicant - Form 6 [19-05-2021(online)].pdf 2021-05-19
21 2044-CHE-2015-Response to office action [08-06-2021(online)].pdf 2021-06-08
22 2044-CHE-2015-FER.pdf 2021-10-17
23 2044-CHE-2015-OTHERS [12-01-2022(online)].pdf 2022-01-12
24 2044-CHE-2015-FER_SER_REPLY [12-01-2022(online)].pdf 2022-01-12
25 2044-CHE-2015-CORRESPONDENCE [12-01-2022(online)].pdf 2022-01-12
26 2044-CHE-2015-COMPLETE SPECIFICATION [12-01-2022(online)].pdf 2022-01-12
27 2044-CHE-2015-CLAIMS [12-01-2022(online)].pdf 2022-01-12
28 2044-CHE-2015-RELEVANT DOCUMENTS [11-01-2023(online)].pdf 2023-01-11
29 2044-CHE-2015-POA [11-01-2023(online)].pdf 2023-01-11
30 2044-CHE-2015-FORM 13 [11-01-2023(online)].pdf 2023-01-11
31 2044-CHE-2015-FORM-26 [12-01-2023(online)].pdf 2023-01-12
32 2044-CHE-2015-US(14)-HearingNotice-(HearingDate-04-10-2023).pdf 2023-09-07
33 2044-CHE-2015-Correspondence to notify the Controller [29-09-2023(online)].pdf 2023-09-29
34 2044-CHE-2015-Written submissions and relevant documents [18-10-2023(online)].pdf 2023-10-18
35 2044-CHE-2015-Sequence listing [18-10-2023(online)].txt 2023-10-18
36 2044-CHE-2015-Written submissions and relevant documents [19-10-2023(online)].pdf 2023-10-19
37 2044-CHE-2015-Sequence listing [19-10-2023(online)].txt 2023-10-19
38 2044-CHE-2015-PatentCertificate29-11-2023.pdf 2023-11-29
39 2044-CHE-2015-IntimationOfGrant29-11-2023.pdf 2023-11-29

Search Strategy

1 searchE_14-07-2021.pdf

ERegister / Renewals

3rd: 19 Jan 2024

From 21/04/2017 - To 21/04/2018

4th: 19 Jan 2024

From 21/04/2018 - To 21/04/2019

5th: 19 Jan 2024

From 21/04/2019 - To 21/04/2020

6th: 19 Jan 2024

From 21/04/2020 - To 21/04/2021

7th: 19 Jan 2024

From 21/04/2021 - To 21/04/2022

8th: 19 Jan 2024

From 21/04/2022 - To 21/04/2023

9th: 19 Jan 2024

From 21/04/2023 - To 21/04/2024

10th: 19 Jan 2024

From 21/04/2024 - To 21/04/2025

11th: 28 Feb 2025

From 21/04/2025 - To 21/04/2026