DESC:Technical Field of the Invention:

The present invention relates to novel diagnostic kits for detecting genes encoding for ß-Lactamases and Extended Spectrum ß-Lactamases (ESBL). More specifically, it relates to novel diagnostic kits and multiplex real-time polymerase chain reaction method for the detection of extended spectrum ß- lactamases (ESBL).
(ESBLs) represents the most important contributing factor to resistance against ß-
Background of the Invention:

In Gram-negative bacteria, the production of extended spectrum ß-lactamases lactam antibiotics. Theseextended spectrum ß-Lactamases (ESBL) producing bacteriahave the ability tohydrolyze various types of the newer ß-lactam antibiotics, including extended-spectrum cephalosporins of the 3rd and 4th generation (e.g. cefotaxime, ceftriaxone, ceftazidime) and monobactums (e.g. aztreonam) which have been assessed as “critically important antimicrobials” by the World Health Organization (WHO).This has resulted in increased morbidity, mortality, higher cost of treatment and longer hospital stay. The ESBL producing Enterobactericeae have been marked as a “serious” threat by Centre for Disease Control (CDC). Currently, the predominant ESBL gene families encountered in India are CTX-M, TEM, SHV and OXA-10/11 genes. Also, ESBL producers usually exhibit decreased susceptibility to numerous other antibiotics. Therefore, early characterization of ESBL is critical for patient management.
The detection techniques currently used for the identification of ESBL producers are culture-based tests that are time consuming and not completely reliable. These tests may give improper or inconclusive results based on the species of the pathogen. A few molecular tests are known but they can detect ESBL from only one or two types of gram-negative bacteria.
The Applicants have developed a novel kit that enables rapid detection of the most prevalent and commonly encountered ESBL in a single tube multiplex real-time PCR (polymerase chain reaction) assay. The Applicants have further provideda multiplex real-time PCR method to detect at least one of the genes encoding for the ESBL and reduce the detection time by detecting and classifying four different kinds of ESBL in a single assay so that subsequent antibiotic treatment can be initiated at an early stage.

Summary of the Invention:
Accordingly, the present invention provides a novel kit comprising primer-probe setsfor detecting from a sample at least one gene encoding for extended spectrum ß-lactamases by a multiplex real-time polymerase chain reaction assay.
In another aspect, the present invention provides a method using a kit comprising primer-probe sets for detecting at least one gene encoding for extended spectrum ß-lactamasesby a multiplex real-time polymerase chain reaction assay.

Detailed description of the Invention:
For earlier detection of outbreaks and minimizing the spread of resistant bacteria, the availability of rapid diagnostic methods to detect resistance genes is also significantly important. Determination of susceptibility or resistance using classical culture-based phenotypic tests is the general method used in clinical microbiological laboratories, but this procedure is time consuming and can easily not detectESBL production by gram negative bacteria owing to variable levels of enzyme expression and the poor specificity of some antibiotic combinations [Okeke, I. N., et al. Diagnostics as essential tools for containing antibacterial resistance. Drug Resist. Updat. 14, 95-106 (2011); Swayne, R., Ellington, M. J., Curran, M. D., Woodford, N. & Aliyu, S. H. Utility of a novel multiplex TaqMan PCR assay for metallo-ß-lactamase genes plus other TaqMan assays in detecting genes encoding serine carbapenemases and clinically significant extended-spectrum ß-lactamases. Int. J. Antimicrob. Agents 42, 352-356 (2013)]. On the other hand, implementation of molecular-based diagnostic methods can easily overcome these limitations and can increase the speed and accuracy of detecting resistance genes, which is important for both infection control and therapeutic options in hospital and community settings [Okeke, I. N., et al. Diagnostics as essential tools for containing antibacterial resistance. Drug Resist. Updat. 14, 95-106 (2011)]. However, previously developed methods for ESBL gene detection are restricted to the identification of more carbapenemases than ESBL genes and a molecular diagnostic method for detecting all clinically-important ESBL genes is not available.
The terms "complement" and "complementary," as used herein, refer to a nucleic acid that is capable of hybridizing to a specified nucleic acid molecule under stringent hybridization conditions. Thus, a specified DNA molecule is typically "complementary" to a nucleic acid if hybridization occurs between the specified DNA molecule and the nucleic acid. If the specified DNA molecule hybridizes to the full length of the nucleic acid molecule, then the specified DNA molecule is typically a "full-length complement." "Complementary," further refers to the capacity of purine and pyrimidine nucleotides to associate through hydrogen bonding in double stranded nucleic acid molecules. The following base pairs are complementary: guanine and cytosine; adenine and thymine; and adenine and uracil.
Real-time polymerase chain reaction, also called quantitative Polymerase Chain Reaction (qPCR) or kinetic Polymerase Chain Reaction, is a laboratory technique based on the principle of PCR. This technique is used to amplify a targeted DNA sequence by use of hydrolysis probes that are short oligonucleotides that have a fluorescent reporter dye attached to the 5' end and a quencher dye to the 3' end. Real-time PCR is carried out in a thermal cycler with the capacity to illuminate each sample with a beam of light of at least one specified wavelength and detect the fluorescence emitted by the excited fluorophore. The thermal cycler is also able to rapidly heat and chill samples, thereby taking advantage of the physicochemical properties of the nucleic acids and DNA polymerase.
The PCR process generally consists of a series of temperature changes that are repeated 25 – 50 times. These cycles normally consist of three stages: the first, at around 95 °C, allows the separation of double chain of the nucleic acid; the second, at a temperature of around 50-60 °C, allows the binding of the primers with the DNA template; the third, at between 68 - 72 °C, facilitates the polymerization carried out by the DNA polymerase [Rychlik W, Spencer WJ, Rhoads RE (1990). "Optimization of the annealing temperature for DNA amplification in vitro". Nucleic Acids Res. 18 (21): 6409–6412]. Due to the small size of the fragments the last step is usually omitted in this type of PCR as the enzyme is able to increase their number during the change between the alignment stage and the denaturing stage. In addition, in four step PCR the fluorescence is measured during short temperature phase lasting only a few seconds in each cycle, with a temperature of, for example, 80 °C, in order to reduce the signal caused by the presence of primer dimers when a non-specific dye is used[http://gene-quantification.org/biochemica-3-2000.pdf]. The temperatures and the timings used for each cycle depend on a wide variety of parameters, such as: the enzyme used to synthesize the DNA, the concentration of divalent ions and deoxyribonucleotides (dNTPs) in the reaction and the bonding temperature of the primers [Joseph Sambrook & David W. Russel (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press].
A DNA-binding dye binds to all double-stranded (ds) DNA in PCR, causing fluorescence of the dye. An increase in DNA product during PCR therefore leads to an increase in fluorescence intensity measured at each cycle.
In real-time PCR with dsDNA dyes the reaction is prepared as usual, with the addition of fluorescent dsDNA dye. Then the reaction is run in a real-time PCR instrument, and after each cycle, the intensity of fluorescence is measured with a detector; the dye only fluoresces when bound to the dsDNA (i.e., the PCR product). This method has the advantage of only needing a pair of primers to carry out the amplification, which keeps costs down; multiple target sequences can be monitored in a tube by using different types of dyes.
Fluorescent reporter probes detect only the DNA containing the sequence complementary to the probe; therefore, use of the reporter probe significantly increases specificity, and enables performing the technique even in the presence of other double stranded DNA. Using different-coloured labels, fluorescent probes can be used in multiplex assays for monitoring several target sequences in the same tube. The specificity of fluorescent reporter probes also prevents interference of measurements caused by primer dimers, which are undesirable potential by-products in PCR. However, fluorescent reporter probes do not prevent the inhibitory effect of the primer dimers, which may depress accumulation of the desired products in the reaction.
The method relies on a DNA-based probe with a fluorescent reporter at one end and a quencher of fluorescence at the opposite end of the probe. The close proximity of the reporter to the quencher prevents detection of its fluorescence; breakdown of the probe by the 5' to 3' exonuclease activity of the Taq polymerase breaks the reporter-quencher proximity and thus allows unquenched emission of fluorescence, which can be detected after excitation with a laser. An increase in the product targeted by the reporter probe at each PCR cycle therefore causes a proportional increase in fluorescence due to the breakdown of the probe and release of the reporter.
Any of a variety of fluorescent reporter dye may be used in the method of the presentinvention, including but not limited to FAM, HEX, JOE, YAK, TET, CalFluor, TexRed, Cy5, Cy5.5 and the like.
The kit and method of the present invention can detect a wide variety of genes encoding for ESBL such as SHV, TEM, CTX-M, OXA 10/11, PER, VEB-1, BES-1, GES, BES, TLA, SFO, and IBC and which are found in a wide range of geographic locations.
The ESBL that can be detected by the kit of the present invention may be from the genera of any of a wide variety of gram-negative bacteria including, but not limited to, Salmonella, Escherichia coli, Klebsiella and Shigella, Proteus, Enterobacter, Serratia, Citrobacter, and the like.
The sample used for the detection of the genes encoding for the ESBL in accordance with the kits of the present invention, may be a bacterial culture or serum or blood of a patient. If bacterial culture is used, a single colony can be used, from which the DNA is extracted, and the PCR is performed. If blood sample is used, 200 microlitre of blood can be used for DNA extraction and the same can be used for Real-Time PCR. Hence, the sample volume used varies depending upon the type of sample used.
While the invention has been illustrated and described in detail in the foregoing description, the same is to be understood as illustrative and not restrictive in character, it being understood that only preferred embodiments have been shown and described and that all changes and modifications that come within the scope of the following claims and equivalents are desired to be protected.

Example 1 –
Standards and strains used:
Klebsiella pneumoniae ATCC BAA-2146™ and Klebsiella pneumoniae ATCC BAA-1144™ were used as standards. Phenotypically confirmed ESBL isolates were used for clinical evaluation of the multiplex PCR kit.
DNA extraction:
Genomic DNA was extracted as per the method of HiPurA™ Bacterial Genomic DNA Purification Kit.
The primers and probes used for detection of the genes encoding for the ESBL are given in Table 1 below.
Table 1:
Sr. No. Primer/Probe Name Sequence
1. SHV Forward Primer
TCCCATGATGAGCACCTTTAAA

2. SHV Reverse Primer
TCCTGCTGGCGATAGTGGAT

3. SHV Probe
FAM-TGCCGGTGACGAACAGCTGGAG-BHQ1

4. CTX-M Forward Primer
CGGGCRATGGCGCARAC

5. CTX-M Reverse Primer
TGCRCCGGTSGTATTGCC

6. CTX-M Probe
HEX-CCARCGGGCGCAGYTGGTGAC-BHQ1

7. TEM Forward Primer
ATTATCCCGTRTTGACGCCG

8. TEM Reverse Primer
AAAAGCGGTTAGCTCCTTCGGT

9. TEM Probe
Cal Fluor Red 610-CAGTGCTGCCATAACCATGAGTGA-BHQ2

10. OXA-10/11 Forward Primer
AAATCCTGGTGTCGCATGGT

11. OXA-10/11 Reverse Primer
TAGCCACCAATGATGCCCTC

12. OXA-10/11 Probe
Cy5-ATTCCCACCAAAATCATGGA-BBQ

13. Internal Control Forward Primer
CGGCGTGAGTATGATTCTCAAA

14. Internal Control Reverse Primer
ATGAGCAGACACGCAGCTTTT

15. Internal Control Probe
Cy5.5-AAAAGTCTACGTTCACCACGCGCCAAA-BHQ3

Example 2: Real-time PCR amplification

The master mix preparation included 3 µL 25mM MgCl22, 2 µL of 10mM dNTP Mix, 0.2 µL 5U Taq polymerase, 2.5 µL 10X PCR Buffer and 0.9 µL primer-probe mix of TEM, SHV, CTX-M and OXA-10/11 each from Table 1 above. A 0.6 µL of Internal Control Primer-Probe Mix and 2 µL Internal Control template was added to the reaction mixture to detect the failure of amplification in cases where the target sequence were not amplified. A volume of 5 µL was added as template in the reaction with reaction volume made upto 25 µL using Molecular Biology Grade Water for PCR. The cycling conditions were 95°C for 10 minutes, 95°C for 15 seconds, Annealing and Extension 60°C for 30 seconds for 40 cycles. The channels used were FAM, HEX, CAL Fluor Red 610, Cy5 and Cy5.5. The reactions were processed in InstaQ 96 Real-Time PCR System.

Example 3 – Interpretation of data
Klebsiella pneumoniae ATCC® BAA-2146™ showed amplification for SHV, CTX-M and TEM in FAM, HEX and Cal Fluor Red 610 channels respectively while Klebsiella pneumoniae ATCC® BAA-1144™ showed amplification for OXA-10/11 in Cy5 channel. The ESBL isolates were positive for either one or more ESBL gene by the multiplex PCR assay. The presence or absence of a signal in the Cy5.5 channel is not relevant for the validity of the test run due to competition between the test template and Internal Control template.

Example 4 – Comparison with conventional methods of identification
A comparison of the Real-Time PCR for the rapid detection of the ESBL genes i.e. TEM, SHV, CTX-M and OXA-10/11 in a one-step reaction was performed against phenotypic methods.
A collection of 68 Enterobacteriaceae clinical isolates were blindly subjected to Disc Diffusion (DD) test, E-Test and multiplex qPCR assay for ESBL identification.
Of the 68 isolates tested, 92.65% (n=63/68) were ESBL positive by phenotypic and genotypic methods. Of this, only 70.59% (n=48/68) were ESBL positive by phenotypic tests. Significant finding was identification of 22.06% (n=15/68) of isolates as ESBL positive by the multiplex qPCR assay that were negative by phenotypic assays. A total of 118 ESBL genes were identified of which TEM gene was observed in 42.37% of isolates. Ten genotypes were identified as single or combination of these genes. The multiplex qPCR assay showed 100% sensitivity as compared to E-test (76.19%) and DD test (61.90%) with 100% specificity. ,CLAIMS:We claim,
1. A novel kit for detecting genes encoding for extended spectrum ß-lactamases from a sample, the said kit comprising primer-probe sets that can be simultaneously used to perform a multiplex real-time polymerase chain reaction for detecting at least one gene from extended spectrum ß-lactamases.

2. A kit of claim 1, wherein the genes encoding for the extended spectrum ß-lactamases may be at least one gene selected from SHV, TEM, CTX-M, and OXA-10/11.

3. A kit of claim 1, wherein the extended spectrum ß-lactamases may be present in gram negative bacteria selected from Salmonella, Escherichia coli, Klebsiella and Shigella, Proteus, Enterobacter, Serratia, Citrobacter.

4. A kit of claim 1, wherein the said kit enables rapid detection of the extended spectrum ß-lactamases in a single tube multiplex real-time polymerase chain reaction assay.

5. A method for detecting genes encoding for extended spectrum ß-lactamases from a sample, the said method comprising,a) contacting the primer/probe sets for four genes encoding for extended spectrum ß-lactamases with the DNA or RNA extracted from a sample, b) conducting a real-time PCR amplification reaction, and c) detecting at least one of the genes encoding for the extended spectrum ß-lactamases.