Abstract: The present invention relates to a method of increasing oil content in Euphorbiaceae family members and other latex bearing plant species such as Atrophy species via Agro bacterium-mediated transformation with a glycerol 3-phosphate acyl transferases. Furthermore, the present invention relates to a method of plant modification to express genes, related to oil biosynthesis and to the plants produced using this method.
1. A method for the genetic transformation of vegetative plant explants using Agrobacterium species harbouring a plant transformation vector encoding lysophosphatidic acid acyl transferase.
2. A method for increasing the oil content of an oil-producing plant, comprising: transforming plant with a nucleotide sequence so that plant expresses an enzyme that catalyzes the transfer of a fatty acid from acyl-CoA to a lysophosphatidic acid for the production of Phosphatidic Acid (PA), wherein said enzyme comprises SEQ ID NO. 1, and wherein the oil content of plant has been increased relative to a plant that has not been transformed.
3. The method according to claim 1, wherein said nucleotide sequence comprises SEQ ID NO. 1.
4. The method according to claim 1, wherein said nucleotide sequence is that of yeast.
5. The method according to claim 4, wherein said nucleotide sequence is from Saccharomyces cerevisiae
6. An isolated nucleotide sequence encoding for an enzyme that catalyzes the transfer of a fatty acid from acyl-CoA to a lysophosphatidic acid for the production of phosphatidic acid, wherein said nucleotide sequence encodes an enzyme having an amino acid sequence comprising SEQ ID NO. 2.
7. A transgenic plant, comprising a genome containing the nucleotide sequence according to claim 4, wherein said nucleotide sequence is transferred by recombinant DNA technology.
8. The transgenic plant according to claim 7, wherein said plant is selected from Euphorbiaceae family.
9. The transgenic plant according to claim 8, wherein said plant is Jatropha species.
10. The transgenic plant according to claim 9, wherein said nucleotide sequence is expressed under the control of constitutive promoter or other inducible or tissue specific promoter.
11. A method for increasing the oil content of an oil-producing plant, comprising: transforming said plant with a nucleotide sequence comprising SEQ ID NO. 1 so that said plant expresses an enzyme and catalyzes the transfer of a fatty acid from acyl-CoA to lysophophatidic Acid for the production of Phosphatidic Acid (PA), said enzyme comprising an amino acid sequence of SEQ ID NO. 2, and wherein the oil content of said plant has been increased relative to a plant that has not been transformed.
FIELD OF INVENTION:
The present invention relates of a method of increasing oil content in Euphorbiaceae family members and other latex bearing plant species such as Jatropha species via Agrobacterium-mediated transformation with a lysophosphatidic acid acyl transferase. Further more the present invention relates to a method of plant modification to express genes, related to oil biosynthesis and to the plants produced using this method.
BACKGROUND OF THE INVENTION:
Jatropha has been extensively studied as a medicinal plant around the world. Its healing properties include the treatment cancer, abortifacient, anodyne, antiseptic, cicatrizant, depurative, diuretic, emetic, hemostat, lactagogue, narcotic, purgative, rubefacient, styptic, vermifuge, and vulnerary, physic nut is a folk remedy for alopecia, anasorca, ascites, bums, carbuncles, convulsions, cough, dermatitis, diarrhea, dropsy, dysentery, dyspepsia, eczema, erysipelas, fever, gonorrhea, hernia, incontinence, inflammation.
Its oil has been used for illumination, for soap manufacture, candles, as an adulterant for edible oil. The seed contains 38% fat (Duke and Atchley 1983) and about 18% protein, making it a good source of oil and it cake a useful biomass for agricultural applications. While its origins are attributed to Central and South American centres of diversity, endemic lines have been found in Madagascar and it is also found in Brazil, Fiji, India and South East Asia. It is easily propagated from seeds and by cuttings making it a popular fencing plant. Seed yields have been estimated at 6-8 Toimes/Ha and oil yields at 2100-2800 litres of fuel oil/ha.
While Jatropha has been used traditionally as a medicinal plant and as an oilseed crop for domestic uses, its exploitation on modem industrial scales is only recently being taken up, particularly because Jatropha is a very hardy species that can be used to reclaim degraded terrains. In other words, the need to plant Jatropha as a means to recover degraded land has drawn attention to this species and more specifically to its oil content.
Jatropha curcas is a tropical plant species, which has been ignored by the scientific community in spite of its promising utilities. As of January 2008 only around 200 gene sequences from Jatropha species have been identified and very little is known about these.
Certain multi-purpose trees such as Jatropha can grow well in wasteland with very little input. Currently the oil content in this species ranges around 30-38% at laboratory scale analyses and 25-30% at industrial scales. The increase of oil yields in this crop would make its planting much more attractive to farmers. Simultaneously wastelands would start to bear economic value, environmental improvements with reductions in atmospheric carbon dioxides, uses of cleaner fuels and reductions in soil erosion.
PRIOR ART
As fatty acid biosynthesis is a highly regulated process, the molecular tweaking of the components of this pathway do not result in significant increases in oil content. The assembly of triglycerides, however, may be driven towards the forward direction by appropriately tweaking enzymes involved in the esterification of fatty acids to the 3 hydroxyls of glycerol. One of the most efficient enzymes in driving this process is glycerol-3-phosphate acyltransferase (GPAT). Jain and coworkers over-expressed the safflower plastidic GPAT and the E. coli GPAT as cytosolic, plastidic and endomembranous proteins. While Arabidopsis seeds transformed with the empty vector were indistinguishable from the wild type control, all GPAT over-expressors showed significant increases in oil content, in some cases upto 22 % using the cytosol-localized GPAT. The E. coli GPAT increased the oil content upto 15 %. As Arabidopsis is an oilseed (though not a commercially planted one), it serves as a good model to increase the oil content in an oilseed such as Jatropha in the absence of other data from Jatropha itself. Similar results have been obtained with the Arabidopsis diacylglycerol acyltransferase (DAGAT). In totality, it is expected of Jatropha transgenically expressing the safflower GPAT and/ or the Arabidopsis DAGAT to have a higher total triglyceride content than the wild type to the extent of 20-25 % and a low free fatty acid content.
Triacylglycerol Biosynthetic organelles
In seeds, oil or triacylglycerols (TAG) are thought to be assembled within the confines of the endoplasmic reticulum (ER), as oil bodies that bud out of the ER membrane. The oil is stored inside the oil body, which is limited by a monolayer of phospholipid decorated with oleosin, the major protein of oil bodies. The acyl groups of the phospholipid are oriented towards the lumen of the oil body, thus dispersed in the TAG contents of the oil body. Oil bodies retain their integrity and are prevented from coalescing during seed desiccation by the oleosin protein (Lacey et al, 1998). The identification of TAG biosynthetic enzymes such as glycerol-3-phosphate acyltransferase (GPAT) and diacylglycerol acyltransferase (DAGAT) in microsomal membrane fractions strengthen the idea that oil bodies originate from the ER. Further TAGs can be synthesized in vitro from microsomes isolated from developing seeds. TAG biosynthesis in a generalized plant cells however may also occur in the mitochondrion and the chloroplast (for review Kaup et al 2002).
Plastidic Fatty Acid Biosynthesis
In plant cells, fatty acids such as palmitic and stearic are synthesized in the chloroplast in an ACP bound manner by a fatty acid synthase. Stearic acid is then desaturated to oleic acid by stearyl-ACP desaturase. Palmitic and stearic acids are esterified to G3P to result in phophatidic acid or hydrolysed to free fatty acids. These are further esterified with coenzyme A to yield the fatty acyl CoA which is exported to the cytosol. Plastidic phosphatidate is further esterified to yield monogalactosyl diacylglycerol, digalactosyl diacylglycerol, sulfoquinovosyl diacyl glycerol and phosphatidylglycerol (Murata and Tasaka, 1997, Voelker and Kinney, 2001).
GPAT and its overexpression
While all GPATs have been shown to esterify fatty acids to the sn-1 position of G3P, the enzyme does not differentiate between fatty acid chain lengths and both CI6 and CI8 fatty acids are incorporated in the sn-l position. It is postulated that the loss of a particular GPAT is compensated for by the increase of other members of the family to esterify the pool of fatty acyl CoA to G3P. Earlier work by Kunst et al (1988) had shown that Arabidopsis mutants deficient in the plastidic GPAT do not suffer from a lack of plastidic lipids as the cytosolic lipid biosynthesis pathway compensates for the loss of the plastidic pathway.
The over-expression of GPAT in plants has shown very promising results from an oil biosynthesis point of view. Murata and coworkers (1997) demonstrated that the over-expression of the squash plastidic GPAT increases the incorporation of palmitic acid at the sn-\ position of phosphatidylglycerol from 16% to 31%. In contrast the Arabidopsis gene, reduces the incorporation of palmitic acid from 16% to 12% indicating a clear chain length preference for enzymes of different sources. In both of these systems, the total oil content was not significantly affected. Further Zheng et al (2003) reported that AtGPATl from Arabidopsis is highly expressed in developing seeds, indicating a significant role in seed oil production.
The exploitation of GPAT, as a means of increasing seed oil content, was studied by Jain and co-workers (2000). While the plastidic and ER localized enzymes resulted in 20-23 % increases in total oil content, the cytosolic localization increased to oil content by 26 to 29%. It is postulated that the lysophosphatidic acid (LPA), the product of GPAT, is transported into the ER lumen for fiirther esterification into phosphatidic acid (PA) and finally triacyl glycerol.
Sn-2 Acylation: LP A AT
The conversion of LPA to TAG occurs via intermediates such as PA and diacylglycerol (DAG). The esterification of LPA to PA has been studied in plants initially with a goal to engineer the type of fatty acid esterifies at the srj-2 position. Zou et al (1997) determined that SLCl-1, a mutant acyl transferase that suppresses a genetic defect in long-chain sphingolipid biosynthesis, encoded an sn-2 acyl transferase capable of acylating oleoyl-LPA with long chain fatty acyl CoAs such as 18:1, 22:1 and 24:0. They further speculated, that when expressed in plants such as Arabidopsis, this enzyme should have a significant role in oil biosynthesis. The successful transformation of Arabidopsis with this gene under control of the cauliflower mosaic virus 35S promoter lead to increases in oil content up to 24 % with incorporation of long chain fatty acids at the sn-2 position.
PDAT and DAGAT: the final step
The last and most specific step in TAG assembly is mediated by PDAT (phospholipid: diacylglycerol acyltransferase) or by DAGAT (Diacylglycerol acyltransferase) (Dahlqvist et al, 2000). While the former transfers a fatty acid from a phospholipid donor such as lecithin to diacylglycerol to yield TAG, the latter uses a fatty acyl CoA to acylate the sn-3 position of DAG. The over-expression of the Arabidopsis PDAT has not demonstrated any significant increases in seed oil yield (Stahl et al 2004). Jako et al (2004) demonstrated that the transformation of wild type Arabidopsis vdth DAGAT driven by a napin promoter results in transgenic lines expressing upto 25% more seed oil than the wild type and the vector alone control. They also reported that the seed weight increased in the transgenic lines, though the seed weight was not proportional to the oil content of the seeds. Interestingly, the fatty acid composition of the oil did not vary very much, indicating that an increased production of seed oil through transgenic DAGAT-based methods, does not change the quality of the oil and just the quantity. These results clearly verified studies previously conducted by Bouvier-Nave et al (2000), who had transformed tobacco with the Arabidopsis DAGAT and obtained a 7-fold increase in leaf oil content. It is to be noted that Bouvier-Nave used a constitutive 35S promoter to drive the transgene and had not used a model oilseed plant to test the transgene.
Jatropha oil biosynthetic genes
As very little work has been previously carried out on Jatropha molecular biology, very little information is available on TAG biosynthesis in Jatropha at a molecular level. Qing and coworkers and Luo and coworkers at the Sichuan University, Sichuan, China have isolated the Jatropha diacylglycerol acyltransferase, the deltal2-fatty acid desaturase and the stearoyl-ACP desaturase. It is well known that the oil of Jatropha is composed of oleic acid (43.1%), linoleic acid (34.3%), stearic acid (6.9%) and palmitic acid (4.2%). The biochemistry of the biosynthetic pathway and the players involved are yet to be deciphered. It may be postulated that the key enzymes described earlier in this text have identical roles in Jatropha.
Jatropha and Transgenic oil increase
While a lot of research has gone into the enhancement of oil content in field crops such as Brassica, and soyabean, very little, if none at all, research has been carried out on woody plant species. Key limitations have been the lack of suitable transformation protocols and the time taken to seed (approximately 4 years). Further very little is known on the effects of enhanced triglyceride biosynthetic activity on the source-sink relationship between the tree (source) and the seed (sink). Few such studies have been carried out in general and even fewer in trees. In sunflower, the yield of oil per meter square increases with seed number per meter square upto a limit of 7500 seeds/m2 to a level of 200 gW of oil. Beyond this level there is no appreciable increase in oil as the rate of seed yield increases (Ruiz et al 2006). Increases in oil content therefore must be achieved without increasing seed yield. As few studies of this nature have been carried out in Jatropha, there is little information to suggest the success of this approach.
SUMMARY OF THE INVENTION:
The present invention relates of a method of increasing oil content in Euphorbiaceae family members and other latex bearing plant species such as Jatropha species via Agrobacterium-mediated transformation with a lysophosphatidic acid acyl transferase. Further more the present invention relates to a method of plant modification to express genes, related to oil biosynthesis and to the plants produced using this method. This is the first method of transgenic oil enhancement in Jatropha species.
BRIEF DESCRIPTION OF THE DRAWINGS:
Figure 1: Binary plasmid with a lysophosphatidic acid acyl transferase (LPAT) gene under the control of constitutive promoter CaMv 35S.
Figure 2: Different stages in the development of transformation and regeneration of Jatropha with lysophosphatidic acid acyl transferase (LPAT) gene under the control of constitutive promoter CaMv 35S.
Figure 3: PCR confirmation of the Jatropha transgenics with lysophosphatidic acid acyl transferase (LPAT) gene under the control of constitutive promoter CaMv 35S using gene specific primers.
DETAILED DESCRIPTIONS OF THE INVENTION:
The invention comprises the sequential steps of a) explant isolation, b) explant infection with Agrobacterium tumefaciens c) infected explant culture on regeneration media d) rooting of renegerants e) hardening and transfer to greenhouse.
The invention makes use of plant hormones, natural or synthetic, broadly classified into the group comprising auxins and cytokinins. The invention makes use of specific media comprising plant nutrients and other media components. The invention makes use of laboratory Agrobacterium strains. The invention makes use of lysophosphatidic acid acyl transferase gene for oil enhnacement. The invention makes use of selection markers such as antibiotics and other markers. The invention makes use of plant explants comprising stem, petiole, and leaf explants.
Example 1
The LP AT gene is cloned downstream of a 35 S cauliflower mosaic virus promoter and terminated with a NOS terminator, all operably linked (Figure 1).
Surface sterilization and callus induction
The fresh and young leaf segments were excised from plants of Jatropha curcas growing in the green house. The explants were washed with running tap water for 5min. The explants were treated with 70% Ethanol for 5min and 3.0% Bavisten for 30min then 0.1% mercuric chloride for 5 min. Subsequently these explants were surface sterilized with 70% commercial bleach and added 4-5 drops of Tween -20 for 20min in the laminar hood. These explants were thoroughly washed with sterile distilled water 7-8 times and dried on sterile blotting paper. The dried explants were cultiured on callusing medium containing MS + 2.0mg/l 2,4-D + 5.0mg/l BAP and incubated in dark place for three weeks. These calli were again sub-cultured on same media for three more weeks for further growth of callus. The proliferated embryogenic calli were cut into 2.5mm in size pieces and placed on regenerated media containing MS + 5.0mg/l BAP + 3.0mg/l lAA for 3-4 weeks. After 3 weeks, these were again sub-culture on same fresh medium for multiplication of shoots. The multiplied shoots were transformed to elongation media (MS+ 0.5mg/l GA3) for elongation of shoots. The elongated shoots were transformed to rooting medium containing MS + 5.0mg/l IBA.
Bacterial culture preparation
Two to three days before of transformation, the Agrobacterium containing LPAAT encoding plasmid were streaked and cultured on YEP solid media containing kanamycin as antibiotic. The bacterial culture was incubated at 28°C for 2 days.
Transformation
The bacteria grown in YEP solid media were resuspended in YEP liquid media and OD600 of about 0.5 was adjusted to prior to transformation. The resuspended bacteria were left for 4-5 hours at room temperature for reaching the OD of 0.5. The suspension mixture was transferred to a larger container and the leaf explants were added and kept for 30min with shaking the explants at the intervals l0min each in laminar flow. After 30 min, the explants were removed and blotted and dried on sterile filter paper. The 6-7 explants were plated on each petri plate and co-cultivated for 3 days with the said Agrobacterium in line in culture room (25°C).
Washing of explants
After 3 days of co-cultivation, the explants were removed and washed with sterile water + 250mg/l Cefotaxime for 30min by shaking the flask for l0min each and added fresh solution for three times. After 30min, these explants were removed from solution and blotted and dried on sterile filter paper for lOmin. The dried explants were transformed to callusing media containing MS+ 2.0mg/l 2,4-D +5.0mg/l BAP+ 20.0mg/l hygromycin and incubated in dark place for three weeks.
Selection of transgenic plants
The explant or calli were transferred to fresh callusing media containing MS + 2.0mg/l 2,4-D+ 5.0mg/l BAP + 20.0mg/l hygromycin and incubated for four weeks for production of hygromycin resistance calli. Due to selection pressure, the calli will become light to dark brown during this period. The small transgenic hygromycin resistant calli started to proliferate after three to four weeks on selection medium. The proliferating calli were transferred to regeneration medium containing MS + 5.0mg/l BAP + 3.0mg/l lAA + 20.0mg/l hygromycin for 3 weeks. The greenish calli were sub-cultured on same fresh medium for 3 more weeks and it will again sub-culture on same fresh media for three weeks for multiplication shoots. The multiplied shoots were transferred to elongation medium containing MS + 5.0mg/l BAP + 3.0mg/l lAA + 0.5mg/l GA3 + 20.0mg/l hygromycin and incubated for 3 weeks. The elongated shoots were transferred to rooting medium containing MS + 5.0mg/l IBA+ 20.0mg/l hygromycin (Figure 2). These rooted plants were transferred to MS+ 5.0mg/l IBA (Liquid media) for hardening the roots. The hardened plants were transferred to polycups containing a mixture of (1:1) soil and vermiculate and covered with polythene covers were completely withdrawn after 4-5 weeks. The well-developed plants were transferred to pots and transferred to green house for further growth of plants.
Confirmation of lysophosphatidic acid acyl transferase (LPAT) gene in transformed Jatropha:
DNA extraction from Jatropha samples by Qiagen kit method:
1. The sample material was disrupted (<100 mg wet weight or < 20 mg lyophilized tissue) using the tissue rupture, the tissue lyser, or a mortar and pestle.
2. To this 400 μl buffer API and 4 1 Rnase A was added and vortexed and incubated for 10 min at 65°C. The tubes were inverted 2 -3 times during incubation.
3. Then 130μl buffer AP2 was added mixed and incubated for 5 min on ice.
4. The lysate was centrifuged for 5 min at 20,000 X g (14,000 rpm)
5. The lysate was pipette into a QIAshredder mini spin column in a 2 1 collection tube and centrifuged for 2 min at 20,000 X g (14,000 rpm).
6. The flow-through fraction was transferred into a new tube without disturbing the pellet. Then 1.5 volumes of buffer AP3/E was added and mixed by pipetting.
7. 650μl of the mixture was transferred into a Dneasy mini spin column in a 2 ml collection tube. Centrifuged for 1 min at >6000 X g (>8000 rpm). Flow-through discarded. This step was repeated with the remaining sample.
8. The spin column was placed into a new 2 ml collection tube. Added 500 µl Buffer AW, and centriftiged for 1 min at >6000 X g. Flow-through discarded.
9. Added another 500 μl Buffer AW. Centrifuged for 2 min at 20,000 X g.
10. Removed the spin column from the collection tube carefully so the column does not come into contact with the flow-through.
11. Transferred the spin column to a new 1.5 ml or 2 ml microcentrifuge tube, and added 100 |il Buffer AE for elution. Incubated for 5 min at room temperature. Centrifuged for 1 min at >6000 X g. Repeated this step.
Confirmation by FCR with gene specific primers:
The Genomic DNA isolated from the transgenic Jatropha (LPAT) were confirmed by PCR with gene specific primers.
Forward primer: 5'- GAGGTCCGTGTTGGTCGTACTGGCG - 3'
Reverse primer: 5' - GACATCGTTGCTAATGCTGACAG - 3'
PCR was set up using the above-mentioned primers and the reaction setup as detailed below:
The PCR amplified the LP AT gene in the transgenic plant samples while there was no amplification seen in the non-transformed (wild type) Jatropha samples. This confirmed the successful transformation of Jatropha with the lysophosphatidic acid acyl transferase (LPAT) gene (Figure 3).
We Claim:
1. A method for the genetic transformation of vegetative plant explants using Agrobacterium species harbouring a plant transformation vector encoding lysophosphatidic acid acyl transferase.
2. A method for increasing the oil content of an oil-producing plant, comprising: transforming plant with a nucleotide sequence so that plant expresses an enzyme that catalyzes the transfer of a fatty acid from acyl-CoA to a lysophosphatidic acid for the production of Phosphatidic Acid (PA), wherein said enzyme comprises SEQ ID NO. 1, and wherein the oil content of plant has been increased relative to a plant that has not been transformed.
3. The method according to claim 1, wherein said nucleotide sequence comprises SEQ ID NO. 1.
4. The method according to claim 1, wherein said nucleotide sequence is that of yeast.
5. The method according to claim 4, wherein said nucleotide sequence is from Saccharomyces cerevisiae
6. An isolated nucleotide sequence encoding for an enzyme that catalyzes the transfer of a fatty acid from acyl-CoA to a lysophosphatidic acid for the production of phosphatidic acid, wherein said nucleotide sequence encodes an enzyme having an amino acid sequence comprising SEQ ID NO. 2.
7. A transgenic plant, comprising a genome containing the nucleotide sequence according to claim 4, wherein said nucleotide sequence is transferred by recombinant DNA technology.
8. The transgenic plant according to claim 7, wherein said plant is selected from Euphorbiaceae family.
9. The transgenic plant according to claim 8, wherein said plant is Jatropha species.
10. The transgenic plant according to claim 9, wherein said nucleotide sequence is expressed under the control of constitutive promoter or other inducible or tissue specific promoter.
11. A method for increasing the oil content of an oil-producing plant, comprising: transforming said plant with a nucleotide sequence comprising SEQ ID NO. 1 so that said plant expresses an enzyme and catalyzes the transfer of a fatty acid from acyl-CoA to lysophophatidic Acid for the production of Phosphatidic Acid (PA), said enzyme comprising an amino acid sequence of SEQ ID NO. 2, and wherein the oil content of said plant has been increased relative to a plant that has not been transformed.
| # | Name | Date |
|---|---|---|
| 1 | 247-CHE-2008 FORM-5 31-01-2008.pdf | 2008-01-31 |
| 2 | 247-CHE-2008 FORM-3 31-01-2008.pdf | 2008-01-31 |
| 3 | 247-CHE-2008 FORM-1 31-01-2008.pdf | 2008-01-31 |
| 4 | 247-CHE-2008 CORRESPONDENCE OTHERS 31-01-2008.pdf | 2008-01-31 |
| 5 | 247-CHE-2008 DESCRIPTION (PROVISIONAL) 31-01-2008.pdf | 2008-01-31 |
| 6 | 247-CHE-2008 FORM-2 27-01-2009.pdf | 2009-01-27 |
| 7 | 247-CHE-2008 FORM-1 27-01-2009.pdf | 2009-01-27 |
| 8 | 247-CHE-2008 DRAWINGS 27-01-2009.pdf | 2009-01-27 |
| 9 | 247-CHE-2008 CORRESPONDENCE OTHERS 27-01-2009.pdf | 2009-01-27 |
| 10 | 247-CHE-2008 SEQUENCE LISTING 27-01-2009.pdf | 2009-01-27 |
| 11 | 247-CHE-2008 DESCRIPTION (COMPLETE) 27-01-2009.pdf | 2009-01-27 |
| 12 | 247-CHE-2008 CLAIMS 27-01-2009.pdf | 2009-01-27 |
| 13 | 247-CHE-2008 ABSTRACT 27-01-2009.pdf | 2009-01-27 |
| 14 | 247-CHE-2008 CORRESPONDENCE OTHERS 30-01-2012.pdf | 2012-01-30 |
| 15 | 247-CHE-2008 FORM-18 30-01-2012.pdf | 2012-01-30 |
| 16 | 247-CHE-2008 CORRESPONDENCE OTHERS 03-09-2014.pdf | 2014-09-03 |
| 17 | 247-CHE-2008-Correspondence-230915.pdf | 2015-09-25 |
| 18 | 247-CHE-2008_EXAMREPORT.pdf | 2016-07-02 |