Title of Invention: IMP production method using the new polypeptide, and this

Art

[1]

The present application relates to a novel protein variant, the microorganism producing 5'-inosinate and 5'-inosinate method increases the discharge method using the same comprising the same having a 5'-inosinate emptying.

[2]

BACKGROUND

[3]

One of the nucleic acid-based materials 5'-inosinate (5'-inosine monophosphate; hereinafter IMP) has been used in various fields as an intermediate material of the nucleic acid metabolic pathway, food, drugs and other medical uses such as, 5'-guanylate (5 '-guanine monophosphate; with less GMP) is a substance widely used as a seasoning for foods or food additives. IMP, but known that the beef flavor by itself, and information known to enhance the flavor of the mono sodium glutamate (MSG), such as GMP becoming a immature nucleic acid-based seasoning.

[4]

A method of producing the IMP is a method of decomposing ribonucleic acid extracted from yeast cells by the enzymatic method (Japanese Patent Publication No. 1614/1957 call) with a chemical phosphorylation of inosine produced by fermentation (Agri. Biol. Chem ., 36, there are 1511 (1972), etc.) and a method for culturing a microorganism producing IMP and recovering the IMP directly in the culture medium or the like. How are currently the most widely used of these methods is a method using a microorganism capable of producing direct IMP.

[5]

On the other hand, in the natural state, enzymes like substrate specificity of the activity, stability, and optical isomers that are required for the industrial utilization is always different to improve the suitable enzyme in use for the purpose does not indicate optimum properties through such variations in the amino acid sequence attempts have been made. Among them, examples of rational design (rational design) and partial mutation (site-directed mutagenesis) methods of enzyme applied to improve the enzyme function. However, in many cases, the lack of information about the structure of the target enzyme or structure-correlation function It has the disadvantage that it can be effectively applied to relationships unclear. There it is also reported methods to try to improve the orientation of the enzyme through evolution for screening the enzymes for the desired trait from the mutated enzyme libraries built from a random mutation of the gene (directed evolution) ways to improve the activity.

[6]

Detailed Description of the Invention

SUMMARY

[7]

In order to produce a high yield of the IMP to a method of directly producing IMP by fermentation of microorganisms of the IMP and the exhaust it must be made smoothly. To achieve this purpose inventors have conducted extensive studies, as well as hayeoteul identify the protein involved neunge IMP discharged, thereby completing the present application by the excavation protein variants having higher IMP emptying

[8]

Problem solving means

[9]

One object of the present application is to provide a mutant protein for discharging the 5'-inosinate.

[10]

Another object of the present application is to provide a polynucleotide encoding the protein variants of the present application.

[11]

It is another object of the present application is to provide a vector comprising a polynucleotide of the present application.

[12]

It is another object of the present application is to provide a microorganism producing 5'-inosinate which comprises a vector of the protein variants and the application of the present application.

[13]

It is another object of the present application includes the steps of: culturing a microorganism of the genus Corynebacterium in a medium the present application; And to provide a 5'-inosinate prepared recovering the 5'-inosinate in the microorganism or the culture medium.

[14]

It is another object of the present application is to provide a method of increasing the discharge, 5'-inosinate which comprises a step of enhancing in Corynebacterium spp a 5'-inosinate emission protein of the present application.

[15]

Effects of the Invention

[16]

When using a protein variant to discharge the IMP of the present application, culture of the genus Corynebacterium microorganism producing 5'-inosinate, 5'-inosinate is possible to produce a high yield.

[17]

Best Mode for Carrying Out the Invention

[18]

If it described in detail below. On the other hand, each of the descriptions and embodiments disclosed in this application may be applied to other embodiments and description of each. That is, any combination of various elements disclosed in the present application within the scope of the present application. In addition, it is impossible to see that the scope of the present application limited by the specific description technology.

[19]

[20]

One aspect of the present application for achieving the above object is to provide a mutant protein for discharging the 5'-inosinate.

[21]

Term in this application, the terms "protein for discharging the 5'-inosinate" is 5'-inosinate (5'-inosine monophosphate; IMP) means a protein that participates in discharged outside the cell. For purposes of this application the terms may be used interchangeably as the IMP protein having a discharge capacity, discharge IMP protein, the protein having a 5'-inosinate emptying, 5'-inosinate exhaust protein. Specifically, the proteins can be expressed in ImpE, and more specifically can be represented by ImpE1, or ImpE2. More and more particularly, to discharge the 5'-inosinate protein of the present application is not intended to be, but may represent ImpE2, limited. In addition, the proteins may be derived from genus Corynebacterium, in particular may be a Corynebacterium origin varnish letting stay, but is not limited thereto.

[22]

The proteins can be the amino acid sequence set forth in SEQ ID NO: 2, or a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2. However, the sequence that has the same activity as the protein, including, but not limited to, those skilled in the art of the known database NCBI to obtain sequence information, etc. GenBank. In addition, IMP emission protein of the present application is SEQ ID NO: 2 and the SEQ ID NO: 2 and comprises an amino acid sequence having at least 80%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity which may be the protein. In addition, having such homology or identity if the amino acid sequence shown efficacy corresponding to the protein, with some sequences do proteins having deleted, modified, substituted or added in the amino acid sequence can be used as a protein of the present application will be apparent.

[23]

That is, even if in the present application are described as "protein consisting of a specific SEQ ID NO: Amino Acid Sequence", a protein comprising the amino acid sequence set forth in a particular SEQ ID number, or a protein with the same or equivalent activity consisting of the amino acid sequence of the SEQ ID NO: If the case has, with some sequences do protein having a deletion, modification, substitution, conservative substitutions or added in the amino acid sequence may be used in the present application will be apparent. For example, with the application of the protein variant, and the same or equivalent activity, which, if the amino acid sequences before and after additional sequence that does not change the function of the protein, the mutations may occur naturally, their potential mutations (silent mutation) or not intended to exclude the conservative substitution, it is apparent that within the scope of the present application, even if having more such sequences or mutations.

[24]

The term in the present application, "homology (homology) 'or' identity (identity)" means the degree to each other relating to the two given amino acid sequence or nucleotide sequence and can be expressed as a percentage.

[25]

Terms homology and identity can often be used interchangeably.

[26]

A conserved (conserved) polynucleotide or sequence homology or identity of polypeptides can be used with the default gap penalties established by the program that is determined by the standard arrangement algorithm used. In practice, it has a homology or (homologous) or the same (identical) sequences are generally sequences in whole or in full in the middle or high stringent conditions (stringent conditions) - at least 50% of the length, 60%, 70%, 80% or it may be a hybrid by at least 90%. Hybridization is also considered a polynucleotide containing a degenerate codons instead of the codons in the polynucleotide.

[27]

Whether any two polynucleotide or polypeptide sequence of the has the homology, similarity or identity include, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: by using the default parameters as in 2444 may be determined using known computer algorithms such as the "FASTA" program. Alternatively, only the needles of the EMBOSS package program, as is done in (EMBOSS: 276-277: The European Molecular Biology Open Software Suite, Rice et al, 2000, Trends Genet 16..) (Version 5.0.0 or later) needle-only-flavor (Needleman-Wunsch) algorithm (.. Needleman and Wunsch, 1970, J. Mol Biol 48: 443-453) can be determined is used. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED,.] Academic Press, San Diego, 1994, and [CARILLO ETA /.] (1988) SIAM J Applied Math 48: 1073 contains) for example, you can use the BLAST, ClustalW or the National Center for Biotechnology information database to determine the homology, similarity or identity.

[28]

Polynucleotides or polypeptides of homology, similarity or identity, e.g., Smith and Waterman, Adv. Appl. Math (1981) 2: 482, as is known in, e.g., Needleman et al. (1970), J Mol Biol.48: can be determined by using the GAP computer program, such as 443 compares the sequence information. In summary, GAP program defines a value obtained by dividing the total number of symbols in the shorter of the two sequences from the number, the arrangement similar to sign (i.e., nucleotides or amino acids). The default parameters for the GAP program include: (1) one binary comparison matrix (1 and ratio to the identity-by containing a value of 0 for identity) and Schwartz and Dayhoff, eds, Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: the weighted comparison matrix of 6745 (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) addition of 0.10 penalty for each symbol in each gap, and the penalty of 3.0 for each gap (or gap opening penalty 10, gap extension penalty 0.5); And (3) may include no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" represents the relevance (relevance) between the sequences.

[29]

Function of the term "mutant (variant)" is one or more amino acids are conservative substitutions (conservative substitution), and / or listed sequences above in a modification (modification) (the recited sequence) differs from one, the proteins in the present application ( It refers to a polypeptide that functions) or characteristics (properties) are maintained. Variant polypeptides differ from the sequence (identified sequence) identified by the number of amino acid substitution, deletion or addition. Such variants may generally be to be identified and modifying the one of the above polypeptide sequences and evaluating the properties of the modified polypeptide. That is, the ability of the variant may or can be increased compared to the original protein (native protein), it does not change, or decreases. Moreover, some variants may comprise an N- terminal leader sequence or makjeon domain (transmembrane domain) and at least one part is removed, such variants. Other variants may include a variant part is removed from the N- and / or C- terminus of the mature protein (mature protein).

[30]

The term "conservative substitution (conservative substitution)" in this application is meant a substitution with another amino acid that has the structural and / or chemical properties similar to the amino acid. The variant may, for conservative substitutions can have more than one instance, while still retaining at least one biological activity. These amino acid substitutions can occur usually based on the similarity in residues in polarity, charge, solubility, hydrophobic, hydrophilic and / or amphiphilic (amphipathic nature). For example, the positively charged (basic) amino acids in an amount includes with Al, lysine, and histidine; Charged (acidic) amino acids are negatively contains glutamic acid, and are Vaart; The aromatic amino acids include phenylalanine, tryptophan and tyrosine, and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, proline, glycine and tryptophan.

[31]

In addition, the variant may comprise a deletion or addition of amino acids having a minimal impact on the properties of the polypeptide, and the secondary structure. For example, polypeptide translation may after (post-translationally) signal of the N- terminal protein involved in the previous (transfer) of the protein (or leader) sequence and the conjugate - at the same time (co-translationally) or translation. In addition, the polypeptides can be conjugated with other sequences, or linker determine the polypeptide to be purified, or synthesized.

[32]

Specifically, the protein variants for discharging the 5'-inosinate of the present application in the N- terminus of the amino acid sequence of SEQ ID NO: 2, 123 amino acid and 243 amino acid, 387 amino acid and 405 amino acid and 413 amino acid or 458th one or more amino acids selected from the group consisting of amino acid can be a variant protein having an amino acid sequence replaced by another amino acid, but is not limited thereto.

[33]

For example, the protein variants having a 5'-inosinate emptying of the present application is substituted with a substituted (F123C), a 243 amino acid valine in the 123 amino acid N- terminal of the amino acid sequence of SEQ ID NO: 2 with a cysteine ​​(I243V) , by Leo Nin a 387 amino acid used substituted (S387T), 405 amino acid is tyrosine substituted (F405Y), Leo Nin is 413 beonjjyae amino write substituted (M413T), substituted (N458K) to the 458th amino acid lysine, or It is a protein variant for discharging the 5'-inosinate having the amino acid sequence of the substitutions are combined, but not limited to this. More specifically, the mutant protein having the 5'-inosinate emptying is SEQ ID NO: 73, 74, 75, 76, 77, 78, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, amino acid sequence having 153 or 155, or the at least 80%, 90%, 95 It may be a%, 96%, 97%, 98%, or 99% of proteins having an amino acid sequence having a homology. Further, if the protein having such a homology with the amino acid sequence shown efficacy corresponding to the protein, with some sequences do proteins having deleted, modified, substituted or added in the amino acid sequence can be used as a protein of the present application, it is obvious .

[34]

In addition, protein variants for discharging the 5'-inosinate of the present application further SEQ ID NO: 2 with another amino acid in the second amino acid N- terminal of the amino acid sequence substitutions, optionally substituted with a different amino acid 64th amino acids, or the substitution combination consisting of the amino acid sequence, it may be a protein variant for discharging the 5'-inosinate. Specifically, the protein variants for discharging the 5'-inosinate of the present application is substituted for the second amino acid is isoleucine at the N- terminus of the amino acid sequence of SEQ ID NO: 2 in addition, substituted with the 64th amino acid is glutamate or aspartate, or the consisting of substituted combinations amino acid sequence, it may be a protein variant for discharging the 5'-inosinate.

[35]

The "another amino acid substitution" is not limited if the amino acid with another amino acid before substitution. For example, the other amino acids if the second amino acid from the N- terminus of the amino acid sequence of SEQ ID NO: 2 is replaced with other amino acids is not limited if the amino acid other than valine, 64th amino acid in this case is replaced by another amino acid wherein the other amino acid is not limited if the amino acid other than glycine.

[36]

[37]

Another aspect of the present application is to provide a vector comprising a polynucleotide or polynucleotides of the present application coding for the protein variants of the present application.

[38]

Term in this application, the terms "polynucleotide" refers to a nucleotide monomer (monomer) is DNA or RNA strands over a predetermined length of a polymer (polymer) of the nucleotide chain resulted in a long shape by a covalent bond.

[39]

A polynucleotide of the present application the codon degeneracy (codon degeneracy) to the SEQ ID NO: 73, 74, 75, 76, 77, 78, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119 by, Translate to 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143 and protein of the protein or the homology consisting of the amino acid sequence of 145, 147, 149, 151, 153 or 155 can polynucleotides can also be included, which is obvious. For example, a polynucleotide of the present application is SEQ ID NO: 79, 80. 81, 82, 83, 84, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154 or 156 and the number of days a polynucleotide sequence having the nucleotide sequence, more specifically SEQ ID NO: 79, 80. 81, 82, 83, 84, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154 or 156 may be a polynucleotide consisting of the nucleotide sequence of. Also, which may be prepared from a known gene sequence probe, for example, by Hydride Chemistry under the complementary sequences and stringent conditions to all or a portion of the nucleotide sequence, SEQ ID NO: 73, 74, 75, 76, 77, 78, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 145, 147, 149, 151, if the sequence encoding the protein having the activity of a protein having an amino acid sequence of 153 or 155 may be included without limitation.

[40]

Refers to conditions that permit the specific hybridization between the "stringent condition" is a polynucleotide. These conditions are described in detail in the literature (e.g., J. Sambrook et al., Above). For example, the high homology gene each other, more than 40%, specifically, by at least 90%, more specifically at least 95%, more specifically 97% or more, and particularly particularly genes having at least 99% homologous between the hybridization, more than condition homology do not hybridize with each other low gene, or the conventional 60 ℃ washing conditions of Southern hybridization, 1XSSC, 0.1% SDS, specifically 60 ℃, 0.1XSSC, 0.1% SDS specifically, as in the salt concentration and temperature corresponding to 68 ℃, 0.1XSSC, 0.1% SDS, 1 time, and specifically may be exemplified by conditions under which washing twice or three times.

[41]

Hybridization Although the mismatch (mismatch) between the base be possible depending on the stringency of hybridization, though, requires that the two nucleic acids having a complementary sequence. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, this application can also, as well as similar to the nucleic acid sequence substantially complementary to an isolated nucleic acid fragment comprising the sequence throughout.

[42]

Specifically, a polynucleotide having a homology can be detected using hybridization conditions comprising a hybridization step at Tm value of 55 ℃ using the above-described conditions. Further, the Tm value can be 60 ℃, 63 ℃ or 65 ℃. However, it is not limited to, it can be properly adjusted by those skilled in the art according to the purpose.

[43]

Appropriate stringency for hybridizing polynucleotide is dependent on the degree of complementarity and the length of the polynucleotide and variables are well known in the art (see Sambrook et al., Supra, 9.50-9.51, 11.7-11.8).

[44]

A polynucleotide encoding an amino acid sequence of the protein having a 5'-inosinate emptying herein is impE2 may be a gene, explains the polynucleotide is as described above.

[45]

A polynucleotide encoding a mutant protein having a 5'-inosinate emptying in this application also as previously described.

[46]

The term "vector" as used in this application refers to a DNA preparation containing the nucleotide sequence of the polynucleotide encoding the desired protein operably linked to suitable control sequences so as to express the desired protein in a suitable host. The control sequences may include any operator sequence, sequences that control the termination of the sequence, and a transcription and translation encoding a suitable mRNA ribosome-binding site for regulating the promoter, such that transcription can initiate transcription. Vector may then be transformed into a suitable host cell, replicate independently of the host genome, or functions, may be integrated into the genome itself.

[47]

Vector used in the present application as long as it can replicate in a host cell is not particularly limited, it is possible to use any vector known in the art. Examples of the normal vector to be used may be a naturally occurring or recombinant plasmid of the state, cosmid, virus and bacteriophage. For example, the phage vector or course as mid vector may be used. PWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, etc. Charon4A, and Charon21A, pBR series, pUC system, pBluescriptII system as plasmid vector It may be used based pGEM, pTZ-based, such as pCL and pET-based system. Specifically, it may be used pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vector or the like.

[48]

With a polynucleotide via a vector for cell insertion mutations within the chromosome of a polynucleotide encoding a protein of interest in the chromosome in one example it can be replaced. Insertion into the chromosome of the above polynucleotides is any method known in the art, for example, but may be made by homologous recombination, but is not limited to this. It may further comprise a selectable marker (selection marker) to determine the chromosomal insertion. Selectable marker is designed to determine whether the insertion of the transformant screening the transformed cells with a vector, that is, the target nucleic acid molecule, drug resistance, nutritional requirement, given the selectable phenotype such as expression of the resistance or the surface protein on cytotoxic agent markers that can be used. Since the selective agent in a process environment (selective agent) survive only cells expressing a selectable marker, or reflect a different phenotype, it may be selected for transformed cells.

[49]

[50]

As one more aspect of the present application, the present application provides a microorganism containing or producing, 5'-inosinate which comprises a polynucleotide or vector of the present application coding for the protein variants of the present application the protein variants of the present application do. Specifically, the microorganism of the present application may be a microorganism which is produced by the transformed with a vector comprising a polynucleotide encoding the protein variants of the present application is not limited thereto.

[51]

The term "transgenic" in this application is meant to allow the protein to the polynucleotide encoding the expression by introducing a vector comprising a polynucleotide encoding the target protein in the host cell in a host cell. If the transformed polynucleotide can be as long as expression in a host cell, is inserted in the chromosome of the host cell may be located, or include both of these positions in addition to the chromosome, or no matter what. In addition, the polynucleotides include DNA and RNA encoding the target protein. The polynucleotide so long as it can be expressed is introduced into a host cell, it does not matter whether it is to be introduced in any form. For example, the polynucleotide may be introduced into a host cell in the form of there is expressed by itself in an expression cassette (cassette expression) gene construct containing all the elements required. The expression cassette may include a promoter that is normally operably linked to the polynucleotide (promoter), a transcription termination signal, ribosome binding site and translation termination signal. The expression cassette may be an expression vector form a self-replicable. In addition, the polynucleotide is introduced into a host cell in the form of itself, and may be, which is possibly connected with the operation sequence necessary for the expression in a host cell, and the like.

[52]

In addition, it means that the term "operably linked to" the promoter sequence and the gene rea sequence to initiate and mediate the transcription of the polynucleotide encoding the target protein of the present application in the above is operatively connected to.

[53]

As used in this application, "microorganism producing 5'-inosinate" is, naturally 5'-inosinate microorganism with producing ability, or no 5 'to the parent strain capability of 5'-inosinate producing ability and / or discharge - refers to the ability of micro-organisms give inosinate production capacity and / or emissions. Microorganism which produces the 5'-inosinate in this application may be used interchangeably with a microorganism having a 5'-inosinate microorganism or emptying to discharge the 5'-inosinate.

[54]

Microorganism producing the above is 5'-inosinate, including protein variants for discharging the 5'-inosinate of the present application, contain a polynucleotide encoding the mutant protein, or comprising a polynucleotide encoding the protein variants is transformed with the vector can comprise a host cell or microorganism capable of expressing the protein variant. Specifically, the microorganism of the present application Escherichia ( Escherichia ) genus, Serratia marcescens ( Serratia ), An air Winiah ( Erwinia ) genus, Enterobacter bacteria ( Enterobacteria ) genus, Salmonella ( Salmonella ) genus Streptomyces ( Streptomyces ) in , Pseudomonas ( Pseudomonas ) genus Brevibacterium ( Brevibacterium ) in or Corynebacterium ( Corynebacterium may contain the microorganism strain, etc.) in which, the microorganism of the present application more particularly may be a microbial genus Corynebacterium .

[55]

The term "genus Corynebacterium to produce 5'-inosinate (the genus in the description of Corynebacterium ) microorganism" refers to a genus Corynebacterium microorganisms that have 5'-inosinate production capacity through the wild-type or mutant . More specifically, the present application to produce 5'-inosinate genus Corynebacterium microorganism having the ability to, or is a gene is inserted or enhance the activity of a gene inherent weakness related to the wild-type strain itself, or outside the production mechanism in a 5'-inosinate improved 5'-inosinate may be a Corynebacterium spp have the production capacity. More specifically the genus Corynebacterium microorganism having a 5'-inosinate producing ability in the present application comprises a polynucleotide comprising a mutant protein for discharging the 5'-inosinate of the present application, or encoding it, or the protein variants is transformed with a vector comprising a polynucleotide encoding, and may be improved 5'-inosinate producing ability the microorganism of the genus Corynebacterium have a. The "enhanced 5'-inosinate producing ability The microorganism of the genus Corynebacterium have a" may be a pre-change transfected parent strain or non-modified microorganism 5'-inosinate enhanced microbial production capability more. The "non-modified microorganism, is a vector including a polynucleotide encoding a microorganism, or protein variants for discharging the 5'-inosinate which does not include the mutant protein for discharging the wild-type strain or itself, the 5'-inosinate traits can be a non-transformed microorganism.

[56]

In one embodiment of the present application, the microorganisms of the present application adenylate succinate synthase (adenylosuccinate synthetase) and / or IMP dehydrogenase (IMP dehydrogenase) is added to the genus Corynebacterium microorganism weakening in the activity of a one can

[57]

This application genus Corynebacterium microorganisms specifically Corynebacterium glutamicum ( of Corynebacterium glutamicum ), Corynebacterium ammoniagenes's Ness ( of Corynebacterium ammoniagenes ), Brevibacterium lactose flops momentum ( Brevibacterium lactofermentum ), Brenna thinning Te Solarium Plastic pan ( Brevibacterium flavu m), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Corynebacterium epi syeonseu ( Corynebacterium efficiens ) or Corynebacterium stay Yorkshire varnish ( Corynebacterium stationis) may be a, so It is not limited.

[58]

[59]

This application is also a one aspect, provides a 5'-inosinate manufacturing method comprising culturing a microorganism of the genus Corynebacterium to produce a 5'-inosinate of the present application in the medium.

[60]

Specifically, the method of the present application may further comprise the step of recovering the 5'-inosinate in a culture medium of the microorganism, or the application of the present application.

[61]

In the method of the present application, the method comprising culturing the microorganism, it can be not specifically limited, known batch culture method, the continuous culture method, performed by a fed-batch culture method. At this time, the culture conditions, particularly for but not limited to, a basic compound to an appropriate pH using: (phosphoric acid or sulfuric acid for example) (for example, pH 5 to 9, in particular (for example, sodium hydroxide, potassium hydroxide or ammonia) or an acidic compound may be adjusted to pH 6 to 8, most specifically at pH 6.8), oxygen or oxygen-containing gas mixture is introduced to the culture to maintain the aerobic conditions. The culture temperature is 20 to 45 ℃, specifically, can be maintained for 25 to 40 ℃, but can be cultured for about 10 to 160 hours, without being limited thereto. The 5'-inosinate produced by the culture can be secreted into the culture medium or remains in the cell.

[62]

In addition, the medium for the culture to be used per a carbon source and a carbohydrate (such as glucose, sucrose trehalose, lactose, fructose, maltose, know three, starch and cellulose), maintenance, and fat (such as soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (for example, glycerol and ethanol) and organic acids (e.g. acetic acid) can be used by using individually or mixed, such as, but , but it is not limited thereto. The nitrogen source may include nitrogen-containing organic compounds (e.g., peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean bakbun and urea), or inorganic compounds (e.g., ammonium ammonium ammonium sulfate, chloride, phosphate, ammonium carbonate and ammonium nitrate), but it can be used by using individually or mixed, such as, but not limited thereto. Although the source of the phosphate can be individually used, or a mixture of monobasic potassium phosphate, potassium susoyi, such as the corresponding sodium-containing salts to, but is not limited thereto. In addition, the culture medium and other metal salts (such as magnesium sulfate or iron sulfate), essential amino acids, and growth, such as vitamins can include a promoting material.

[63]

The method for recovering the 5'-inosinate produced in the incubation step of the present application can be by using a suitable method known in the art according to the culture method to collect the desired 5'-inosinate from the culture broth. For example, this can be used centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc., it can be recovered from the culture medium or the desired 5'-inosinate microorganism by using the appropriate method known in the art.

[64]

In addition, the recovery step may comprise a purification step, may be performed using a suitable method known in the art. Thus, the 5'-inosinate which number of the microorganism may be a fermentation broth containing the purified form or a 5'-inosinate.

[65]

[66]

This application is yet another one embodiment, provides for the production of 5'-inosinate composition comprising a polynucleotide of the present application 5'-inosinate exhaust protein or encoding the variants.

[67]

The compositions of the present application may include, without limitation, a structure capable of operating the polynucleotide further. In the composition of the present application, the polynucleotide may be of a type that is included in the vector able to express a gene operably linked to the introduced in a host cell.

[68]

In addition, the composition may further comprise any suitable excipients commonly used in compositions for the production of 5'-inosinate. Such excipients include, for example, preservatives, wetting agents, dispersing agents, suspending agents, or the like, but a buffer, a stabilizer or isotonic agent, and the like.

[69]

[70]

This application is yet another one embodiment, provides a 5'-inosinate, for the production of increased production, the genus Corynebacterium microorganism of the protein variants of the present application.

[71]

This application is yet another one embodiment, provides a genus Corynebacterium microorganism SEQ ID NO: 2 in the amino acid sequence of the increased discharge, 5'-inosinate which comprises a step of enhancing the activity of the protein method consisting in. Specifically, the substitution of protein activity, consisting of the amino acid sequence of SEQ ID NO: 2 are enhanced by substitution, the 243 amino acid amino acid different from the 123 amino acid N- terminal of the amino acid sequence of SEQ ID NO: 2 with other amino acids, 387th substituted with a different amino acid, amino acid 405 is substituted with other amino acids, 413th amino acid is substituted with another amino acid, amino acid 458 is substituted with another amino acid, or a 5'-inosinate discharge proteins the substitutions are made of a combination of the amino acid sequence introducing a mutant to the genus Corynebacterium microorganism may be carried out, applying or inclusion. the term "5'-inosinate exhaust protein," "5'-inosinate exhaust protein variants" and "Corynebacterium spp "it is as described above.

[72]

This application is yet another one embodiment, provides, for the production of protein variants of the present application, Corey four 5'-inosinate emissions increase in tumefaciens spp.

[73]

Mode for the Invention

[74]

It is described in more detail by the following Examples in the present application. However, these examples are for explaining the present application by way of example and, not necessarily the scope of the present application limited by these embodiments, it will be apparent to those skilled in the art of the present application.

[75]

[76]

Example 1: Excavation IMP exhaust protein

[77]

[78]

For the Corynebacterium involved in the IMP emissions to just identified a protein Corynebacterium Nice Stay Yorkshire ( of Corynebacterium stationis was manufactured's genomic DNA library of) ATCC6872.

[79]

Since the genus Corynebacterium wild strains were, making CJI0323 strain ATCC6872 comes with IMP producing ability to not produce the IMP, or even produce IMP since very only be a very small amount is produced, to confirm the IMP producing ability . Using ATCC6872 to genomic DNA library of the strain was carried out making CJI0323 the screening membrane protein involved in the IMP discharge. Specific experiments are as follows.

[80]

[81]

Example 1-1: IMP production strains Screening Day CJI0323

[82]

ATCC6872 in order to produce a state of producing the IMP ATCC6782-derived in a phosphate buffer (pH7.0) or citrate buffer (pH5.5) 10 7 ~ 10 8 are suspended in cell / ml. Here by the UV processing was mutagenic to for 20 ~ 40 minutes at room temperature or 32 ℃. Washed with 0.85% sodium chloride solution twice, and by diluting the material to confer resistance on a minimal medium containing 1.7% agar in a culture medium containing an appropriate concentration to give a smear after colony. Culturing individual colonies in a nutrient medium and was cultured for 24 hours in a seed medium. 3-4 days incubation resulting in a fermentation medium, the product IMP accumulated in the culture were selected for the best colony. In order to produce a high concentration of IMP production state Arne non-requirement, guanine leakage type, lysozyme sensitivity, 3,4-dihydro-proline-resistant, streptomycin resistant, azetidine carboxylic acid-resistant, tear-resistant proline, serine aza-resistant, sulfamic guanidine resistance, norvaline resistance, tri meto was carried out the above process in order to impart resistance in sequence for each material Supreme, the tolerance for the material was given and the final selection excellent CJI0323 IMP producing ability. In Table 1 are shown by comparing the degree of resistance against CJI0323 ATCC6872.

[83]

TABLE 1
characteristic ATCC6872 CJI0323
Adenine requirement Biyo configuration Requirement
Guanine leakage type Biyo configuration Leak-type
Lysozyme sensitivity 80 ug / ml 8 ug / ml
3,4-dihydro-proline-resistant 1000 ug / ml 3500 ug / ml
Streptomycin resistant 500 ug / ml 2000 ug / ml
Azetidine carboxylic acid tolerance 5 mg/ml 30 mg/ml
Thiazol-proline-resistant 10 ug / ml 100 ug / ml
Aza-serine-resistant 25 ug / ml 100 ug / ml
Guanidine preached tolerance 50 ug / ml 200 ug / ml
Norvaline resistance 0.2 mg/ml 2 mg/ml
Mezzo-resistant tree Supreme 20 ug / ml 100 ug / ml

[84]

- minimal medium: Glucose 2%, sodium 0.3%, phosphoric acid of claim 1, potassium 0.1%, the second 0.3% potassium phosphate, 0.3% magnesium sulfate, calcium chloride 10mg / l, ferrous sulfate 10mg / l, zinc sulfate 1mg / l, manganese chloride 3.6mg / l, L- cysteine ​​20mg / l, calcium pantothenate 10mg / l, thiamine hydrochloride 5mg / l, biotin, 30ug / l, adenine 20mg / l, guanine 20mg / l, pH7.3

[85]

[86]

- nutrient medium: peptone 1%, meat 1%, 0.25% sodium chloride, yeast extract, 1%, 2% agar, pH 7.2

[87]

[88]

- seed medium: glucose 1%, peptone 1%, meat 1%, 1% yeast extract, 0.25% sodium chloride, adenine 100mg / l, guanine 100mg / l, pH 7.5

[89]

[90]

- a fermentation medium 0.1% sodium glutamate, 1% ammonium chloride, 1.2% magnesium sulfate, 0.01% calcium chloride, ferrous sulfate 20mg / l, manganese sulfate 20mg / l, zinc sulfate 20mg / l, copper sulfate 5mg / l, L- Cysteine ​​23mg / l, was added to be alanine 24mg / l, nicotinic acid 8mg / l, biotin 45㎍ / l, thiamine hydrochloride 5mg / l, adenine 30mg / l, phosphoric acid (85%) of 1.9%, 2.55% glucose, 1.45% of fructose by using .

[91]

[92]

Example 1-2: CJI0323 entry into force of the potency test

[93]

Species after the diameter of the medium dispensed in 2ml 18mm test tube and pressure sterilization, respectively inoculated and cultured for 24 hours with shaking at 30 ℃ temperature and CJI0323 ATCC6872 was used as a seed culture. After dispensing the fermentation broth 29ml in 250ml Erlenmeyer flask for shaking and sterilized 15 minutes at 121 ℃ pressurized temperature, and inoculated with the seed culture 2ml were cultured for 3 days. The culture conditions were controlled as a rotation speed 170rpm, temperature 30 ℃, pH 7.5.

[94]

After the completion of the culture was measured by the method for production of IMP using HPLC (LC20A SHIMAZDU), culture results are shown in Table 2 below.

[95]

TABLE 2
Strain name IMP (g/L)
ATCC6872 0
CJI0323 9.52

[96]

The CJI0323 strain and Corynebacterium by naming a Nice Stay Yorkshire CN01-0323 deposit date of 11 July 2017 on international deposit under the Budapest Treaty on microorganisms organization Conservation Center Korea (Korean CultureCenter of Microorganisms, KCCM) given an accession number KCCM12151P received.

[97]

[98]

Example 1-3: Excavating emissions protein

[99]

It was added for further IMP in the minimum by the addition of a 1.7% agar medium was established screening criteria showing the growth decrease (growth inhibition) of CJI0323 strain. ATCC6872 to transform the genomic library plasmid with electroporation to CJI0323 strains and (van der Rest et al. 1999), were selected colonies are grown in a reduced release the added medium conditions excess IMP. The nucleotide sequence from the sequencing technique to obtain the plasmid from selected colonies was analyzed. This was identified from a membrane protein 1 species involved sikineunde release the reduced growth in excess of the added IMP conditions.

[100]

Corynebacterium Solarium of said one type of membrane protein is the amino acid sequence of SEQ ID NO: 2, and SEQ ID NO: 4 nucleotide sequence: was identified to be (NCBI GenBank NZ_CP014279, WP_066795121, MFS transporter). The film was known as MFS transporter protein, but did not confirm a definite function, and further features of the IMP emissions is not known. In the present application it was named as ImpE2 (WT).

[101]

[102]

Example 2: ImpE1, ImpE2 Identification

[103]

[104]

Example 2-1: impE1, impE2 OK

[105]

The film was confirmed that the gene construct of SEQ ID NO: 4 in the NCBI to find out the functions of the protein ImpE2 (NCBI GenBank: NZ_CP014279, WP_066795121 , MFS transporter). impE2 is (SEQ ID NO: 4) ORF start of 7bp thereof impE2 other genes, located upstream in the: product was confirmed to be superimposed (NCBI GenBank NZ_CP014279, WP_066795119, transcriptional regulator) and 7bp. impE2 the protein encoded from the gene and the gene is located on the upstream is still did not resolve the function, in the application it was named as ImpE1 (WT) (amino acid sequence and the base sequence of SEQ ID NO: 3, SEQ ID NO: 1).

[106]

[107]

Example 2-2: impE1 or impE2 deficient vector production

[108]

If carried sikyeoteul defect in Examples 1 and IMP-producing strain or the ImpE1 ImpE2 that involved in releasing a growth reduction due to the sympathetic IMP through 2-1, to produce a defect vector for each gene in order to ensure that reduced emission capability IMP It was.

[109]

Gene segments to produce a vector was obtained via a PCR ATCC6872 to the genomic DNA as a template.

[110]

Specifically, the impE1 PCR for the SEQ ID NOS: 5, 6 primers and SEQ ID NO: 7, 8 primers, impE2 PCR for was used for SEQ ID NO: 9 and 10 primers and SEQ ID NO: 11 and 12 primers (Table 3).

[111]

TABLE 3
SEQ ID NO: primer Sequence (5'-3 ')
5 impE1 cup 1 GCTCTAGACGAGAAAGCTAAAGCCGGTGA
6 impE1 cup-2 GTTTTTAGCTACCATTGTTACACCCCGTGCAAGTTT
7 impE1 cup-3 GCACGGGGTGTAACAATGGTAGCTAAAAACTCCACC
8 impE1 cup-4 GCTCTAGAAATAGTTGGGGAAGTCCACTC
9 impE2 header-1 GCTCTAGACTTGGATGACCTGGTGGAAAA
10 impE2 header-2 CTTGGAGAAAATTTCCTACCATTCCAGTCCTTTCGT
11 impE2 header-3 GGACTGGAATGGTAGGAAATTTTCTCCAAGGGAAAT
12 impE2 header-4 GGACTAGTGGATTGTGTTGACGCACGATG
65 impE1E2 cup-2 CTTGGAGAAAATTTCTGTTACACCCCGTGCAAGTTT
66 impE1E2 cup-3 GCACGGGGTGTAACAGAAATTTTCTCCAAGGGAAAT

[112]

At this time, using primer (s) in the National Institutes of Health Gene Bank (NIH GenBank) Corynebacterium stationis (ATCC6872) genes: was prepared on the basis of information on the (NCBI Genbank NZ_CP014279) and the surrounding nucleotide sequence. PCR conditions were carried out for 5 min denaturation at 94 ℃, and then repeat 25 1 minutes 72 ℃ 94 ℃ 30 cho denaturation, 52 ℃ 3 bun annealing, polymerization time, polymerization at 72 ℃ 5 minutes of reaction. Subjected to SEQ ID NO: 5 and Primer 6, SEQ ID NO: 7 and nested polymerase chain reaction, the amplified gene impE1 two fragments using the primer as a template to 8 were obtained polynucleotide template of 1.8 kbp. A fragment of the obtained gene was digested with a restriction enzyme XbaI. T4 ligase pDZ of the line was cut using a kinase to XbaI restriction enzyme to the gene fragment (the Republic of Korea Patent No. 10-0924065 and International Publication Patent No. 2008-033001) was cloned in a vector to prepare a pDZ- △ impE1. In addition, SEQ ID NO: 9 and 10 primers with the amplified impE2 gene fragment and SEQ ID NO: 11 and amplified using the primers 12 impE2 was subjected to nested PCR with the two gene fragments as the template to obtain a template polynucleotide of the 1.7kbp . A fragment of the obtained gene as a XbaI restriction enzyme was cut out, speI. The T4 ligase was cloned into pDZ vector of the line cut by the kinase to the XbaI restriction enzyme to the gene fragment, to prepare a pDZ- △ impE2.

[113]

[114]

Example 2-3: impE1, impE2 integrated deficient vector production

[115]

A gene encoding a protein involved in the release of growth reduction due to the IMP impE1 and impE2 because two superimposed gene may need to be adjusted at the same time. Thus impE1 and impE2 were all to produce a defective vector.

[116]

impE1 and impE2 PCR was performed with primers SEQ ID NO: 5 and 65 and SEQ ID NO: 66 and 12 primers. At this time, using primer Corynebacterium stay Yorkshire varnish (ATCC6872) gene (s) in the National Institutes of Health Gene Bank (NIH GenBank): was prepared on the basis of information on the (NCBI Genbank NZ_CP014279) and the surrounding nucleotide sequence. SEQ ID NO: 5 and amplified using the primers 65 impE1 gene fragment and SEQ ID NO: 66 and amplified using the primers 12 impE2 subjected to nested PCR with the two gene fragments as the template and was obtained by the polynucleotide template of 2.0kbp. A fragment of the obtained gene was digested with XbaI, respectively, speI. The T4 ligase was cloned into pDZ vector of the line cut by the kinase to the XbaI restriction enzyme to the gene fragment, to prepare a pDZ- △ impE1E2.

[117]

[118]

Example 2-4: impE1, impE2 deficient production strain

[119]

Carried out after the transformation into the two kinds as in the electroporation method 1 kinds of plasmids prepared in Example 2-3 to each CJI0323 prepared in Example 2-2 (Appl Microbiol.Biotechnol (1999) 52:.. 541- 545 transfection method used), the strain by the recombinant vector is inserted into a chromosome of a homologous sequence according to was screened in medium containing kanamycin (kanamycin) 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Gene defect if the final transformed strains was confirmed by performing PCR using SEQ ID NO: 5, 8, and SEQ ID NO: 9, 12, and SEQ ID NO: 5 and 12 primer pairs.

[120]

The selected strain is CJI0323_ △ impE1, named CJI0323_ impE2 △, △ CJI0323_ impE1E2 and to evaluate the production performance of the IMP of the strain.

[121]

[122]

Species to the diameter of the medium dispensed in 2ml 18mm test tube, and sterilized after pressing, CJI0323, CJI0323_ △ impE1, CJI0323_ △ impE2, CJI0323_ △ inoculated impE1E2 24 hours with shaking at 30 ℃ temperature culture was used as seed culture. After dispensing the fermentation broth 29ml in 250ml Erlenmeyer flask for shaking and sterilized 15 minutes at 121 ℃ pressurized temperature, and inoculated with the seed culture 2ml were cultured for 3 days. The culture conditions were controlled as a rotation speed 170rpm, temperature 30 ℃, pH 7.5.

[123]

By a method using HPLC After the completion of the culture was measured production of IMP, culture results are shown in Table 4 below.

[124]

TABLE 4
Strain name IMP (g/L)
CJI0323 9.52
CJI0323_ △ impE1 1.92
CJI0323_ △ impE2 1.88
CJI0323_ △ impE1E2 1.80

[125]

At this time, the parent strain of Corynebacterium stay Yorkshire varnish CJI0323 the result of a comparison within the IMP accumulation medium, as shown in the above Table 4 CJI0323_ △ impE1, CJI0323_ △ impE2, CJI0323_ △ impE1E2 strains IMP contrast CJI0323 under the same conditions confirmation of that the concentration decreases about 8g / L and it was confirmed that the ImpE1, ImpE2 the proteins involved in the IMP discharge.

[126]

[127]

Example 3: Production of IMP state CJI0323 impE1, impE2 determine the nucleotide sequence

[128]

[129]

For CJI0323 strains to high concentration IMP produced in the above Example 1, there is a possibility that improves performance IMP discharge to produce a high concentration of IMP. Therefore, the strain CJHB impE1, impE2 was undertaken to determine whether the variation of. Polymerization with the chromosomal DNA of CJI0323 chain reaction method was amplified by (the "PCR method" referred to). Specifically, first, in SEQ ID NO: 13 and 14 primers (Table 5) 1 minutes denaturation at 58 ℃ 30 chogan combined, for 2 minutes at 72 ℃ Taq DNA polymerase in 94 ℃ using the chromosomal DNA of the CJI0323 as the template the conditions of polymerizing fragments of about 2.8kb base pairs was amplified by PCR method to repeat 28 times.

[130]

Table 5
SEQ ID NO: Primers people Sequence (5'-3 ')
13　 impE1E2 seqF GAACGGAGTCATCTCCTTTGC
14　 impE1E2 seqr CCAAACGCTCTGCAAGAAACTG

[131]

Analysis of the nucleotide sequence it the same primers results, compared to the nucleotide sequence of the wild-type ATCC6872, impE1 was confirmed that the 490th nucleotide in g of the gene is substituted with a. This means that the variation of the 164th amino acid, glutamic acid ImpE1 protein is substituted with lysine. Also, impE2 the fourth nucleotide of the gene g is replaced by a ( impE1 means that the 666th nucleotides of the gene g substituted with a), the 191st nucleotides of g was found that is substituted with a. This means that the second amino acid is replaced with the isoleucine of valine (corresponding to the 222 th amino acids of the protein ImpE1), the 64th amino acid of the protein is substituted at glycine ImpE2 as glutamic acid.

[132]

ImpE1 nucleotides CJI0323 strain impE1_CJI0323 (SEQ ID NO: 87), protein ImpE1_CJI0323 designated as (SEQ ID NO: 85), and the CJI0323 strain impE2 nucleotides impE2_CJI0323 (SEQ ID NO: 88), protein was named ImpE2_CJI0323 (SEQ ID NO: 86).

[133]

[134]

Example 4: impE1, impE2 mutation restored

[135]

[136]

Example 4-1: impE1 or impE2 variation vector restore production

[137]

In the IMP producing strain CJI0323 strain in Example 3 impE1, impE2 result confirming whether a variation of impE1 1 to more, impE2 was confirmed that contains two mutations on. CJI0323 strains because strain producing the IMP with a high concentration is likely to be variations of the mutation improves the IMP emptying. Therefore, after restoration of a wild-type ImpE without a natural variation, the following experiment was conducted in order to confirm the protein variant has the further higher than that excavation IMP emptying.

[138]

To produce a vector restoring the wild type strain of Corynebacterium Natural Stay Yorkshire varnish ( Corynebacterium stationis ) it was performed by a PCR the ATCC6872 as a template. SEQ ID NO: 89 and amplified using the primers 90 impE1impE2 was treated with a restriction enzyme, a gene fragment of a XbaI, and cloned into the XbaI restriction enzyme located in the pDZ vector to prepare a pDZ-impE1E2 (WT).

[139]

[140]

Example 4-2: impE1 or impE2 mutant strain produced restore

[141]

Carried out after the transformation into electroporation method a first plasmid prepared in Example 4-1 in CJI0323 (Appl Microbiol.Biotechnol (1999) 52:.. Transfection method by using 541-545), recombination of homologous sequences the strain vector is inserted into the chromosome by screening was in medium containing kanamycin (kanamycin) 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Whether mutation restoration of the final transformed strains was confirmed by performing PCR using SEQ ID NO: 89 and 90 primers and sequenced. Since the production strain was named CJI0323_impE1E2 (WT).

[142]

[143]

Example 5: impE2 variation excavation

[144]

[145]

To the third embodiment of the excavation to the mutant has a higher discharge capacity than selecting a mutant having the highest of the three kinds of excavation mutation 5'-inosinate emptying through the results, and was carried out the following experiments.

[146]

[147]

Example 5-1: impE1E2 variation highest 5'-inosinate mutation screening with emptying of the

[148]

The natural wild-type strain of Corynebacterium stay Yorkshire varnish to produce a vector of the E164K mutation alone ImpE1 (Corynebacterium stationis) to ATCC6872 as a template to SEQ ID NO: 91 and 92 primers and SEQ ID NO: 93 and 94 primers were used. Subjected to SEQ ID NO: 91 and amplified using 92 primer E164K-1 gene fragment and SEQ ID NO: 93 and nested polymerase chain reaction, two of E164K-2 gene amplification using 94 primer fragment as a template and a polynucleotide template in the 1.8 kbp It could be obtained. A fragment of the obtained gene was digested with a restriction enzyme XbaI. The T4 ligase was cloned into pDZ vector of the line cut by the kinase to the XbaI restriction enzyme to the gene fragment, to prepare a pDZ-impE1 (E164K).

[149]

To the ATCC6872 as a template to produce a vector of ImpE2 V2I single mutation it was used to SEQ ID NO: 91 and 95 primers and SEQ ID NO: 96 and 94 primers. Of SEQ ID NO: 91 and a 1.8kbp subjected to V2I-1 gene fragment and SEQ ID NO: 96 and nested PCR with the two V2I-2 gene amplification using the 94 primers amplified fragments as a template using the primer 95 to a template polynucleotide It could be obtained. A fragment of the obtained gene was digested with a restriction enzyme XbaI. The T4 ligase was cloned into pDZ vector of the line cut by the kinase to the XbaI restriction enzyme to the gene fragment, to prepare a pDZ-impE2 (V2I).

[150]

Due to the ATCC6872 template to produce a vector of the G64E mutation alone ImpE2 was used to SEQ ID NO: 91 and 97 primers and SEQ ID NO: 98 and 94 primers. SEQ ID NO: 91 and 97, the primer G64E-1 gene fragment and SEQ ID NO: 98 and a primer 94 1.8kbp polynucleotide template by carrying out the nested polymerase chain reaction amplified the two fragments G64E-2 gene as a template with amplification using It could be obtained. A fragment of the obtained gene was digested with a restriction enzyme XbaI. The T4 ligase was cloned into pDZ vector of the line cut by the kinase to the XbaI restriction enzyme to the gene fragment, to prepare a pDZ-impE2 (G64E).

[151]

TABLE 6
SEQ ID NO: primer Sequence (5'-3 ')
89 impE1E2 WT F GCTCTAGAGAACGGAGTCATCTCCTTTGC
90 impE1E2 WT R GCTCTAGACCAAACGCTCTGCAAGAAACTG
91 impE1 164K-1 GCTCTAGACTTGGATGACCTGGTGGAAAA
92 impE1 164K-2 CTGGGGCGCGTTGTTTTTCAGGATGCTCCCGAAGACG
93 impE1 164K-3 AACAACGCGCCCCAGAATTGG
94 impE1 164K-4 GCTCTAGAAATAGTTGGGGAAGTCCACTC
95 impE2 V2I 2 TGGAGTTTTTAGCTATCATTCCAGTCCTTTCGTGTAA
96 impE2 V2I 3 TAGCTAAAAACTCCACCCCAA
97 impE2 G64E-2 CCGAAAATCATCTGCTCCAAAGAGCTCATCAGCATGG
98 impE2 G64E-3 GCAGATGATTTTCGGTTCCGC

[152]

CJI0323_impE1E2 (WT) after switching exemplary transfection the three kinds of plasmids prepared in Example 4-2, the strain (Appl Microbiol.Biotechnol (1999) 52:.. 541-545 transformed by the conversion method used), recombination of homologous sequences the strain vector is inserted into the chromosome by screening was in medium containing kanamycin (kanamycin) 25 mg / L. The selected primary isolates was further carried out secondary cross (cross-over). Whether the final transfected gene mutation introduction of the transition strain was confirmed by performing PCR using SEQ ID NO: 13 and 14 primers and sequenced. The selected strain was named CJI0323_impE1 (E164K), CJI0323_impE2 (V2I), CJI0323_impE2 (G64E).

[153]

The Corynebacterium Stay Yorkshire Nice CJI0323_impE1 (E164K), Corynebacterium Stay Yorkshire Nice CJI0323_impE2 (V2I) and Corynebacterium Stay Yorkshire Nice CJI0323_impE2 (G64E) isolates the international deposit agency Conservation Center Korea microorganisms under the Budapest Treaty (Korean accession to 2 dated 11 January 2018, the Culture Center of Microorganisms, KCCM) and were each given an accession number KCCM12359P, KCCM12360P and KCCM12361P.

[154]

Species after the diameter of the medium 2ml dispensed into 18mm test tube and pressure sterilization, CJI0323_impE1E2 (WT), CJI0323_ impE1 (E164K), CJI0323_ impE2 (V2I), CJI0323_ impE2 (G64E) was inoculated for 24 hours with shaking at 30 ℃ temperature cultured species It was used as culture medium. After dispensing the fermentation broth 29ml in 250ml Erlenmeyer flask for shaking and sterilized 15 minutes at 121 ℃ pressurized temperature, and inoculated with the seed culture 2ml were cultured for 3 days. The culture conditions were controlled as a rotation speed 170rpm, temperature 30 ℃, pH 7.5.

[155]

We measured the production of IMP by the method using HPLC After the completion of the culture, culture results are shown in the following table 7.

[156]

Table 7
Strain name IMP (g/L)
CJI0323 9.52
CJI0323_impE1E2(WT) 2.32
CJI0323_ impE1(E164K) 2.57
CJI0323_ impE2 (V2I) 3.11
CJI0323_ impE2(G64E) 3.27

[157]

It was confirmed that the three types of mutations involved in the IMP discharged respectively as the result of which is production of IMP CJI0323_impE2 (G64E) was confirmed that the most high.

[158]

[159]

Example 5-2: impE2 mutant amino acid substituted for the insertion vector production

[160]

Showing the highest discharge capacity of 5'-inosinate inosinate enhanced production capability typical three kinds of variations through the results impE2 to identify the positions of the importance of (G64E), impE2 replacing the 64th amino acid in the amino acid sequence of a different amino acid mutagenic vector was prepared for.

[161]

ImpE2 (G64E) vector production process for introducing mutations are as follows.

[162]

Based on the reported polynucleotide sequence Corynebacterium stay Yorkshire varnish to remove the chromosomal gene of CJI0323, by using this, the primer pair SEQ ID NO: 15, respectively of SEQ ID NO: 16-33 as the template the gene via polymerase chain reaction to give a fragment. PCR was carried out for 5 min denaturation at 94 ℃, after repeated bun 72 ℃ 94 ℃ 30 cho denaturation, 55 ℃ 30 cho annealing, polymerization 20 times, in 72 ℃ polymerization 5 min. As a result, to obtain a polynucleotide of the 18 kinds of 1kbp.

[163]

Next Corynebacterium stay Yorkshire varnish to remove the chromosomal gene of CJI0323, using the SEQ ID NO: 34 and each of the pair of primers of SEQ ID NOS: 35-52, respectively, a gene fragment was obtained by polymerase chain reaction. PCR was carried out for 5 min denaturation at 94 ℃, after repeated bun 72 ℃ 94 ℃ 30 cho denaturation, 55 ℃ 30 cho annealing, polymerization 20 times, in 72 ℃ polymerization 5 min. As a result, to obtain a polynucleotide of the 18 kinds of 1kbp.

[164]

Subjected to overlap extension PCR using the two fragments as the template obtained by the result to obtain the polynucleotide template of 18 kinds of 2kbp. Was cut to a fragment of the obtained gene with a restriction enzyme XbaI an after T4 ligase connected to the pDZ vector of the line was cut using a kinase to XbaI restriction enzyme to the gene fragment is transformed into E. coli DH5α containing kanamycin (25mg / L) dl It was plated on the LB solid medium.

[165]

The primers used for the vector construction sequence information is given in Table 8.

[166]

Table 8
SEQ ID NO: Primers people Sequence (5'-3 ')
15　 XbaI-impE2 64 1F GGGTCTAGAAAAGAGCTTAAGGCAGCTGCT
16　 impE2 64-R 1R GAAAATCATCTGGCGCAAAGAGCTCAT
17 impE2 64-H 1R GAAAATCATCTGGTGCAAAGAGCTCAT
18 impE2 64-D 1R GAAAATCATCTGGTCCAAAGAGCTCAT
19 impE2 64-K 1R GAAAATCATCTGCTTCAAAGAGCTCAT
20 impE2 64-S 1R GAAAATCATCTGGGACAAAGAGCTCAT
21 impE2 64-T 1R GAAAATCATCTGGGTCAAAGAGCTCAT
22 impE2 64-N 1R GAAAATCATCTGGTTCAAAGAGCTCAT
23 impE2 64-Q 1R GAAAATCATCTGCTGCAAAGAGCTCAT
24 impE2 64-C 1R GAAAATCATCTGGCACAAAGAGCTCAT
25 impE2 64-P 1R GAAAATCATCTGTGGCAAAGAGCTCAT
26 impE2 64-A 1R GAAAATCATCTGAGCCAAAGAGCTCAT
27 impE2 64-V 1R GAAAATCATCTGGACCAAAGAGCTCAT
28 impE2 64-I 1R GAAAATCATCTGGATCAAAGAGCTCAT
29 impE2 64-L 1R GAAAATCATCTGCAGCAAAGAGCTCAT
30 impE2 64-M 1R GAAAATCATCTGCATCAAAGAGCTCAT
31 impE2 64-F 1R GAAAATCATCTGGAACAAAGAGCTCAT
32 impE2 64-Y 1R GAAAATCATCTGGTACAAAGAGCTCAT
33 impE2 64-W 1R GAAAATCATCTGCCACAAAGAGCTCAT
34 XbaI-impE2 64 2R GGGTCTAGACGGTCAATGAAGTCTCAACGG
35 impE2 64-R 2F ATGAGCTCTTTGCGCCAGATGATTTTC
36 impE2 64-H 2F ATGAGCTCTTTGCACCAGATGATTTTC
37 impE2 64-D 2F ATGAGCTCTTTGGACCAGATGATTTTC
38 impE2 64-K 2F ATGAGCTCTTTGAAGCAGATGATTTTC
39 impE2 64-S 2F ATGAGCTCTTTGTCCCAGATGATTTTC
40 impE2 64-T 2F ATGAGCTCTTTGACCCAGATGATTTTC
41 impE2 64-N 2F ATGAGCTCTTTGAACCAGATGATTTTC
42 impE2 64-Q 2F ATGAGCTCTTTGCAGCAGATGATTTTC
43 impE2 64-C 2F ATGAGCTCTTTGTGCCAGATGATTTTC
44 impE2 64-P 2F ATGAGCTCTTTGCCACAGATGATTTTC
45 impE2 64-A 2F ATGAGCTCTTTGGCTCAGATGATTTTC
46 impE2 64-V 2F ATGAGCTCTTTGGTCCAGATGATTTTC
47 impE2 64-I 2F ATGAGCTCTTTGATCCAGATGATTTTC
48 impE2 64-L 2F ATGAGCTCTTTGCTGCAGATGATTTTC
49 impE2 64-M 2F ATGAGCTCTTTGATGCAGATGATTTTC
50 impE2 64-F 2F ATGAGCTCTTTGTTCCAGATGATTTTC
51 impE2 64-Y 2F ATGAGCTCTTTGTACCAGATGATTTTC
52 impE2 64-W 2F ATGAGCTCTTTGTGGCAGATGATTTTC

[167]

After the screening of colonies transformed with a vector conversion gene is inserted object by PCR using a plasmid extraction method known commonly obtained was obtained a plasmid Plasmid information are given in Table 9.

[168]

Table 9
number Plasmid people
1 PDZ-64R impE2
2 PDZ-64H impE2
3 PDZ-64D impE2
4 PDZ-impE2 64K
5 PDZ-64S impE2
6 PDZ-64T impE2
7 PDZ-64N impE2
8 PDZ-64Q impE2
9 PDZ-64C impE2
10 PDZ-64P impE2
11 PDZ-64A impE2
12 PDZ-64V impE2
13 PDZ-64I impE2
14 PDZ-64L impE2
15 PDZ-impE2 64M
16 PDZ-64F impE2
17 PDZ-impE2 64Y
18 PDZ-64W impE2

[169]

[170]

Example 5-3: Comparison of the amino acid positions mutated ImpE2 64 times to produce a strain produced 5'-inosinate and substituted with another amino acid function of the mutant

[171]

Example 3-1 to a side of 18 kinds of vectors for introduction prepared in the transformed Corynebacterium stay Yorkshire varnish CJI0323 and the strain by the recombinant vector is inserted into a chromosome of a homologous sequence is kanamycin (kanamycin) 25 mg / L were selected in a medium containing. The selected primary isolates was further carried out secondary cross (cross-over). Whether the final transfected gene mutation introduction of the transition strain was confirmed by performing PCR using SEQ ID NO: 13 and 14 primers and sequenced. Strain due to the inserted mutant of them as follows: Table 10.

[172]

[Table 10]
number Strain name
1 CJI0323::impE2(G64R)
2 CJI0323::impE2(G64H)
3 CJI0323:impE2(G64D)
4 CJI0323::impE2(G64K)
5 CJI0323::impE2(G64S)
6 CJI0323::impE2(G64T)
7 CJI0323::impE2(G64N)
8 CJI0323::impE2(G64Q)
9 CJI0323::impE2(G64C)
10 CJI0323::impE2(G64P)
11 CJI0323::impE2(G64A)
12 CJI0323::impE2(G64V)
13 CJI0323::impE2(G64I)
14 CJI0323:impE2(G64L)
15 CJI0323::impE2(G64M)
16 CJI0323::impE2(G64F)
17 CJI0323:impE2(G64Y)
18 CJI0323::impE2(G64W)

[173]

Example 2 and cultured in the same manner and analyzed for the concentration of 5'-inosinate therefrom (Table 11).

[174]

[Table 11]
5'-inosinate production levels of impE2 mutation (g / L)
Strain Average 5'-inosinate
CJI0323_impE1E2(WT) 2.32
CJI0323_impE1(E164K)_impE2(V2I) 4.24
CJI0323::impE2(G64R) 4.42
CJI0323::impE2(G64H) 5.14
CJI0323::impE2(G64D) 11.53
CJI0323::impE2(G64K) 8
CJI0323::impE2(G64S) 5.7
CJI0323::impE2(G64T) 5.52
CJI0323::impE2(G64N) 5.9
CJI0323::impE2(G64Q) 4.8
CJI0323::impE2(G64C) 5.9
CJI0323::impE2(G64P) 4.75
CJI0323::impE2(G64A) 4.58
CJI0323::impE2(G64V) 4.56
CJI0323::impE2(G64I) 5.89
CJI0323::impE2(G64L) 5.6
CJI0323::impE2(G64M) 4.3
CJI0323::impE2(G64F) 5.89
CJI0323::impE2(G64Y) 4.6
CJI0323::impE2(G64W) 4.76

[175]

As the result, all of the mutant strain has been increased ability compared to IMP production CJI0323_impE1E2 (WT), the impE2 64 times of position variation could be confirmed that the relevant location variations affecting the IMP emptying increase in ImpE protein. In particular, it was increased by 172% from the 64th amino acid mutation CJI0323_impE1 (E164K) _impE2 (V2I) strains do not have a case where the 64th amino acid in the amino acid sequence of ImpE2 glycine is substituted with another amino acid from glutamic acid Tate asphalt. In addition, 5'-inosinate was the wild-type strain CJI0323_impE1E2 contrast enhancement or 397% (WT) restores the ability of production, it was confirmed that the increase of 20% compared to CJI0323.

[176]

[177]

Example 6: Using artificial mutations law impE mutant library

[178]

[179]

More vector library For the first cross-chromosomal insert in the following manner to obtain the protein variants with high IMP emptying was produced.

[180]

Example 5-3 of the strain CJI0323 :: impE2 (G64D) found to have the highest IMP emptying results in impE2 targeting was to perform Error-prone PCR. CJI0323 :: G64D and held in order to introduce a mutation in the amino acid sequence after the 64th amino acid in impE2 a base substitution mutation from the base sequence of 193rd to about 130bp down stream sequences are randomly introduced into impE gene variants (1.6 kbp ) to obtain. Error-prone PCR was done using the Diversify PCR Random MutagenesisKit (Clontech), CJI0323 :: impE2 (G64D) the genomic DNA as a template of SEQ ID NO: 53 and SEQ ID NO: 54 primer pair (Table 12) using the polymerase through a chain reaction to obtain a gene fragment

[181]

[Table 12]
SEQ ID NO: Primers people Sequence (5'-3 ')
53　 Impe lib F CAGATGATTTTCGGTTCCGCTC
54 Impe lib R GACCGAGACAAAAACGCCAAACG

[182]

Was allowed variation is introduced from 0 to 3.5 dogs per 1kb the amplified gene fragment, PCR was 5 min denaturation at 94 ℃, 94 ℃ 30 cho denaturation, 60 ℃ 30 cho annealing, 72 ℃ 1 minutes 36 seconds 30 times repeating the polymerization one was then performed for 5 minutes polymerization at 72 ℃. As a result, to obtain a polynucleotide of the 1.6 kbp. The amplified gene fragment was connected using the pCR2.1-TOPO TA cloning kit (Invitrogen) to pCR2.1-TOPO vector, and transformed into E. coli DH5α kanamycin (25mg / L) were plated on the LB solid medium containing. After transfection selection of the conversion 20 colonies species obtained plasmid was confirmed that the variation in different locations as a result of 3.5 mutations / kb frequency analysis of the polynucleotide sequence introduced. Taking the approximately 20,000 transformed E. coli colony was extracted plasmid, and named it as pTOPO_impE library.

[183]

[184]

Example 7: impE library vector is inserted into the screening strains

[185]

[186]

Example 6 strains producing the manufactured pTOPO_impE library vector in a high concentration in the IMP CJI0323 :: impE2 then transformed to the electroporation method (G64D), and plated on a nutrient medium containing kanamycin 25mg / L mutant gene is has secured the inserted strain 10,000 colonies, each colony to CJI0323 :: impE2 (G64D) / pTOPO_impE (mt) was named 1 to CJI0323 :: impE2 (G64D) / pTOPO_impE (mt) 10000.

[187]

[188]

- nutrient medium: peptone 1%, meat 1%, 0.25% sodium chloride, yeast extract, 1%, 2% agar, pH 7.2

[189]

[190]

- seed medium: glucose 1%, peptone 1%, meat 1%, 1% yeast extract, 0.25% sodium chloride, adenine 100mg / l, guanine 100mg / l, pH 7.5

[191]

[192]

- a fermentation medium 0.1% sodium glutamate, 1% ammonium chloride, 1.2% magnesium sulfate, 0.01% calcium chloride, ferrous sulfate 20mg / l, manganese sulfate 20mg / l, zinc sulfate 20mg / l, copper sulfate 5mg / l, L- Cysteine ​​23mg / l, was added to be alanine 24mg / l, nicotinic acid 8mg / l, biotin 45㎍ / l, thiamine hydrochloride 5mg / l, adenine 30mg / l, phosphoric acid (85%) of 1.9%, 2.55% glucose, 1.45% of fructose by using .

[193]

[194]

10,000 colonies obtained by this pressing each sterile seed medium was inoculated in 200㎕ in 96 deep well plate microplate shaker (Microplate shaker (TAITEC)) 30 ℃ temperature using, seed culture and incubated 24 hours with shaking at 1200rpm It was used. After dispensing a pressurized sterile fermentation medium 290㎕ in 96 deep well plate by 20㎕ seed culture inoculated and in the same manner as in the above conditions and incubated 72 hours with shaking.

[195]

After the completion of the culture in order to analyze the production of 5'-inosinate produced in the culture supernatant was transferred to a 96 well UV-plate 3㎕ Pipette 197㎕ distilled water. Next, a microplate reader using a (Microplate reader), 30 cho shaking and, 25 ℃, measuring the absorbance at a wavelength of 270nm by spectrophotometer metadata and control CJI0323 :: impE2 (G64D) increased by over 10% compared to the absorbance of the strains for the absorbance of the visible and selected a mutant strain of 50 colonies. Other colonies are exhibited similar absorbance or decreased compared to the control group.

[196]

The selected 50 strains was performed with 5'-inosinate production confirmed by absorbance measurements in the same manner as described above repeatedly, CJI0323 :: impE2 (G64D) strain compared to the parent 5'-inosinate were selected four kinds of strains improved production capability.

[197]

[198]

Example 8: impE2 confirmed mutation screening libraries Note 5'-inosinate production capacity

[199]

[200]

And to compare the ability of a 5'-inosinate produce four kinds of strains selected in Example 7, the culture was analyzed in the following ways: a culture solution ingredient.

[201]

It was inoculated to the same seed medium as in Example 2 in 5ml pressurized sterile 18mm diameter test tube, and 24 hours with shaking at 30 ℃ temperature culture was used as seed culture. Example 2 and then dispense the same fermentation broth 29ml in 250ml Erlenmeyer flask for shaking and sterilized 15 minutes at 121 ℃ pressurized temperature, and inoculated with the seed culture and incubated 2ml 4 to 5 days. The culture conditions were controlled as a rotation speed 170rpm, temperature 30 ℃, pH 7.5. The production of 5'-inosinate by the method using HPLC After the completion of culture was measured.

[202]

Was of the 50 strains selected for 5'-inosinate strain of the upper four kinds of performing the cultivation, and repeating analysis, the analysis of 5-inosinate concentrations are given in Table 13.

[203]

[Table 13]
Selected CJI0323 :: impE2 (G64D) / pTOPO_impE (mt) 5'- inosinate production level (g / L)
Strain Average 5'-inosinate
CJI0323::impE2(G64D) 11.53
CJI0323::impE2(G64D)/pTOPO_impE(mt)-627 13.47
CJI0323::impE2(G64D)/pTOPO_impE(mt)-3605 12.96
CJI0323::impE2(G64D)/pTOPO_impE(mt)-6765 13.17
CJI0323::impE2(G64D)/pTOPO_impE(mt)-9997 12.70

[204]

5'-inosinate concentration analysis, four kinds selected note 5'-inosinate concentration is confirmed that the CJI0323 :: impE2 (G64D) increased up to 17% compared to strain.

[205]

[206]

Example 9: the screening impE2 of mutant impE2 confirmed mutation

[207]

[208]

4 of the strains selected in Example 8 impE2 to determine the mutagenic in impE2 the polynucleotide sequence of the mutant was analyzed. The PCR was performed using SEQ ID NO: 13 and SEQ ID NO: 14 primer pairs to determine the polynucleotide sequence.

[209]

The securing each variant impE2 was performed a polynucleotide sequence analysis of the gene fragment. impE2 SEQ ID NO: 4 or a (WT) impE2 was compared to the polynucleotide sequence of SEQ ID NO: 100 (CJHB101 :: G64D), confirmed the amino acid sequence of the variant ImpE2 through it. ImpE2 variation information of the amino acid sequence of the selected strains are given in Table 14.

[210]

[Table 14]
4 kinds of amino acid mutations selected impE2
Strain impE2 amino acid mutations
CJI0323::impE2(G64D)/pTOPO_impE(mt)-627 impE2 (S387T, M413T, N458K)
CJI0323::impE2(G64D)/pTOPO_impE(mt)-3605 impE2(F123C)
CJI0323::impE2(G64D)/pTOPO_impE(mt)-6765 impE2(I243V)
CJI0323::impE2(G64D)/pTOPO_impE(mt)-9997 impE2(F405Y)

[211]

[212]

Example 10: impE2 vector construction for introducing chromosomal mutations

[213]

[214]

The embodiment identified in Example 9 impE2 was prepared vector capable of introducing them on the chromosome to identify the mutation effects applied, the production process is as follows.

[215]

impE2 (G64D) million were produced containing mutations of the vector library, except Table 14 variations. Specifically, four to Corey bacterium to remove the chromosomal gene of the stay Solarium Yorkshire varnish ATCC6872, SEQ ID NO: 56 and SEQ ID NO: 57, 59, 61, using a pair of primers of 63 was obtained, respectively, a gene fragment by the polymerase chain reaction. After the conditions of the PCR method is for 5 minutes at 94 ℃ denaturation, 94 ℃ 30 cho denaturation, 55 ℃ 30 cho annealing, after repeating 72 ℃ 1 bun polymerization 20 times, the PCR fragment was carried out for 5 minutes polymerization at 72 ℃ It was obtained.

[216]

To the chromosome of the selected four kinds as the template using the primer pair SEQ ID NO: 58, 60, 62, 64 and SEQ ID NO: 55, a gene fragment was obtained by polymerase chain reaction. Conditions of the PCR method is 5 min denaturation at 94 ℃, 94 ℃ 30 cho denaturation, 55 ℃ 30 seconds annealing, 72 ℃ Repeat 1.5 minutes polymerization 20 times, by performing for 5 minutes polymerization at 72 ℃ PCR to obtain a fragment. A fragment of a gene obtained by performing a nested polymerase chain reaction, the two fragments as the template was digested with restriction enzyme XbaI. T4 ligase and transformed into and then using the kinase coupled to the gene in which the alignment control pDZ digested with XbaI restriction enzyme fragment (Republic of Korea Patent No. 10-0924065 and No. International Publication Patent No. 2008-033001) vector E. coli DH5α and kanamycin (25mg / L) were plated on the LB solid medium containing dl.

[217]

Next, the cost of the selected mutant three kinds of mutations are integrated impE2 (S387T, M413T, N458K) the ATCC6872 in order to produce a single disparity vector for identifying a single mutant effect as the template of SEQ ID NO: 56 and SEQ ID NO: 67, 69, using a pre-immersion pair 71 respectively to give a gene fragment by the polymerase chain reaction. Followed by the sequence number ATCC6872 as a template and SEQ ID NO: 55 times 68, 70, 72 using the single primer pair to obtain a gene fragment, respectively via the polymerase chain reaction. A gene fragment obtained by performing nested polymerase chain reaction, the two fragments of the production as a template was treated with restriction enzyme XbaI. After T4 ligase connected to the pDZ vector was cut by using a kinase with XbaI restriction enzyme to the gene fragment is transformed into E. coli DH5a and was plated on LB solid medium containing kanamycin is included.

[218]

[Table 15]
SEQ ID NO: Primers people Sequence (5'-3 ')
55 impE mt - R CATCTAGACCGAGACAAAAACGCCAAACG
56 impEW mt - 1 GCTCTAGACCGCGGATAACGTCGGCATTA
57 impEW ttk - 2 CATCCACCACAAAGCAAACGC
58 impEW ttk - 3 CTTTGTGGTGGATGACCCAGATGACCGTTGAGACTT
59 impEW C - 2 AAATGGAGATACCTGAGATGT
60 impEW C - 3 CAGGTATCTCCATTTGCGTTATTGGCTCGACGCTCG
61 impEW v - 2 GGCCGCAAAACCCATCCAGTC
62 impEW v - 3 ATGGGTTTTGCGGCCGTCGCAATCACGACCAGCACC
63 impEW and - 2 ATACAAGGAAGCGAACTCCGA
64 impEW Y - 3 TTCGCTTCCTTGTATACGGTGTCGGCTTGGGCTTTG

[219]

After selecting the conversion colonies transfected with the vector the gene is inserted object by PCR using a commonly known plasmid extraction were obtained The plasmid of the plasmid impE2 according to the variation inserted into pDZ-impE2 (S387T, M413T, N458K ), it was named pDZ-impE2 (F123C), pDZ -impE2 (I243V), pDZ-impE2 (F405Y), pDZ-impE2 (S387T), pDZ-impE2 (M413T), pDZ-impE2 (N458K).

[220]

[221]

Example 11: Preparation of wild-type impE1 , impE2 based impE2 mutagenic strains produced 5'-inosinate and producing ability compared

[222]

[223]

A vector pDZ-impE2 (S387T, M413T, N458K) for the introduction of new mutations, pDZ-impE2 (F123C), pDZ-impE (I243V), pDZ-impE2 (F405Y), 4 jong prepared in Example 10 step 2 ditto conducted through chromosome recombination example 4 the 5'-inosinate producing strain of Corynebacterium of the stay Yorkshire CJI0323 varnish prepared in impE1E2 that was transformed to a restored CJI0323_impE1E2 (WT) to the WT. Then on the chromosome through a polynucleotide sequence analysis impE2 were selected for the strain variation is introduced, respectively CJI0323_impE1E2 (WT) _impE2 (S387T, M413T, N458K), CJI0323_impE1E2 (WT) _impE2 (F123C), CJI0323_impE1E2 (WT) _impE2 (I243V ), it was named CJI0323_impE1E2 (WT) _impE2 (F405Y) .

[224]

The Corynebacterium stay Yorkshire varnish CJI0323_impE1E2 (WT) _impE2 (F123C), Corynebacterium stay Yorkshire varnish CJI0323_impE1E2 (WT) _impE2 (I243V) and Corynebacterium stay Yorkshire varnish CJI0323_impE1E2 (WT) _impE2 (F405Y) strains accession to the international deposit under the Budapest Treaty on microorganisms organization Conservation Center Korea (Korean Culture Center of microorganisms, KCCM) 2 dated 11 January 2018 and were each given an accession number KCCM12362P, KCCM12363P and KCCM12365P.

[225]

Of Example 7 and cultured in the same manner, from which analyzed the concentration of 5'-inosinate, to measure the concentration after incubation time of 48 hours (Table 16).

[226]

[Table 16]
impE2 mutagenic attention 5'-inosinate production concentration (g / L)
Strain Average
5'-inosinate
CJI0323_impE1E2(WT) 2.32
CJI0323_impE1E2(WT)_impE2(S387T, M413T, N458K) 3.35
CJI0323_impE1E2(WT)_impE2(F123C) 2.62
CJI0323_impE1E2(WT)_impE2(I243V) 2.74
CJI0323_impE1E2(WT)_impE2(F405Y) 2.90

[227]

4 kinds of new mutants are compared to 5'-inosinate concentration CJI0323_impE1E2 (WT) It was verified that the increase up to 44%. IMP increased production due to ImpE protein variants of the present application can be interpreted as very meaningful.

[228]

[229]

Example 12: CJI0323 :: impE2 (G64D) based impE2 mutagenic strains produced 5'-inosinate and producing ability compared

[230]

[231]

For the introduction of new mutant prepared in Example 10 vector pDZ-impE2 (S387T, M413T, N458K), pDZ-impE2 (F123C), pDZ-impE (I243V), pDZ-impE2 (F405Y) 5'-inosinate the four kinds of producing strain of Corynebacterium stay Yorkshire varnish CJI0323 :: in impE2 (G64D) was transformed via a homologous chromosomal recombination step 2. After that the polynucleotide sequence was analyzed by screening a strain impE2 mutation is introduced on the chromosome by, inserted impE2 CJI0323 :: impE2 (G64D) _impE2 (S387T, M413T, N458K) according to the variation, CJI0323 :: impE2 (G64D) _impE2 (F123C), was named CJI0323 :: impE2 (G64D) _impEp ( I243V), CJI0323 :: impE2 (G64D) _impE2p (F405Y).

[232]

Example 7 were cultured in the same manner as, and analyzed the concentration of 5'-inosinate therefrom (Table 17).

[233]

[Table 17]
impE2 mutagenic attention 5'-inosinate production concentration (g / L)
Strain Average 5'-inosinate
CJI0323::impE2(G64D) 11.53
CJI0323 :: impE2 (G64D) _impE2 (S387T, M413T, N458K) 13.47
CJI0323::impE2(G64D)_impE2(F123C) 12.90
CJI0323::impE2(G64D)_impE2(I243V) 13.17
CJI0323::impE2(G64D)_impE2 (F405Y) 12.70

[234]

4 kinds of new mutants are CJI0323 :: impE2 (G64D) compared to 5'-inosinate concentration was confirmed that the maximum increase of 17%. IMP increased production due to ImpE protein variants of the present application can be interpreted as very meaningful.

[235]

Next, the manufacturing cost pDZ-impE2 (S387T, M413T, N458K), pDZ-impE2 (F123C), pDZ-impE (I243V), pDZ-impE2 (F405Y), pDZ-impE2 (S387T), pDZ-impE2 (M413T ), alone or in combination of seven of the vector pDZ-impE2 (N458K), it was transformed to CJI0323_impE1E2 (WT) strain and CJI0323 :: impE2 (G64D) strain. The production strain is CJI0323_impE1E2 (WT) _impE2 (S387T), CJI0323_impE1E2 (WT) _impE2 (M413T), CJI0323_impE1E2 (WT) _impE2 (N458K), CJI0323_impE1E2 (WT) _impE2 (F123C, I243V, S387T, F405Y, M413T, N458K)) CJI0323 :: impE2 (G64D) _impE2 (S387T), CJI0323 :: impE2 (G64D) _impE2 (M413T), CJI0323 :: impE2 (G64D) _impE2 (N458K), CJI0323 :: impE2 (G64D) _impE2 (I243V, S387T, M413T , N458K), CJI0323 :: impE2 (G64D) _impE2 (S387T, F405Y, M413T, N458K), CJI0323 :: impE2 (G64D) _impE2 (I243V, S387T, F405Y, M413T, N458K), CJI0323 :: impE2 (G64D) _impE2 was named (F123C, S387T, M413T, N458K), CJI0323 :: impE2 (G64D) _impE2 (F123C, I243V, S387T, F405Y, M413T, N458K), was measured for 5'-inosinate producing ability in the same manner as described above ( Table 18).

[236]

The Corynebacterium stay Yorkshire varnish CJI0323_impE1E2 (WT) _impE2 (S387T), Corynebacterium stay Yorkshire varnish CJI0323_impE1E2 (WT) _impE2 (M413T) and Corynebacterium stay Yorkshire varnish CJI0323_impE1E2 (WT) _impE2 (N458K) strains accession to the international deposit under the Budapest Treaty on microorganisms organization Conservation Center Korea (Korean Culture Center of microorganisms, KCCM) 2 dated 11 January 2018 and were each given an accession number KCCM12364P, KCCM12366P and KCCM12367P.

[237]

[Table 18]
5'-inosinate production levels of impE2 mutation alone and in combination introduced strain (g / L)
Strain Average 5'-inosinate
CJI0323_impE1E2(WT) 2.32
CJI0323::impE2(G64D) 11.52
CJI0323_impE1E2(WT)_impE2(S387T) 2.7
CJI0323_impE1E2(WT)_impE2(M413T) 3.1
CJI0323_impE1E2(WT)_impE2(N458K) 3.0
CJI0323_impE1E2(WT)_impE2(F123C, I243V, S387T, F405Y, M413T, N458K) 4.7
CJI0323 :: impE2 (G64D) -_ impE2 (S387T) 12.94
CJI0323::impE2(G64D)-_impE2 (M413T) 13.0
CJI0323::impE2(G64D)-_impE2(N458K) 13.1
CJI0323::impE2(G64D)-_impE2(I243V, S387T, M413T, N458K) 13.6
CJI0323::impE2(G64D)-_impE2(S387T, F405Y, M413T, N458K) 13.7
CJI0323::impE2(G64D)-_impE2(F123C, S387T, M413T, N458K) 13.82
CJI0323::impE2(G64D)-_impE2(I243V, S387T, F405Y, M413T, N458K), 14.0
CJI0323::impE2(G64D)-_impE2(F123C, I243V, S387T, F405Y, M413T, N458K) 14.27

[238]

As shown in Table, impE2 (S387T), impE2 (M413T), impE2 (N458K) mutation alone was increased up to 33.6 %% compared to the wild type, both the introduction of new mutant combinations 5'-inosinate concentrations up to 102.5% increase was confirmed that also CJI0323 producing 5'-inosinate :: impE2 (G64D) when the sole introduction of a new mutant strain was increased ability IMP discharge as shown in Table 17 and Table 18, introduction of a combination of the two If, it was confirmed to have a higher IMP emptying. In particular CJI0323 :: impE2 (G64D) if the strain variation and mutation is novel both integrated, the IMP concentration was increased by 515% compared to the wild-type was confirmed that the contrast increased by about 24% CJI0323 :: impE2 (G64D). The novel mutations discovered in the present invention have increased capability alone IMP also discharged, when introduced into a combination thereof, it was identified as having a higher IMP emptying.

[239]

[240]

Example 13: State-based wild IMP production impE2 strengthen

[241]

[242]

Example 13-1: wild IMP production share-based impE2 production introduced mutant strain

[243]

Weakening the activity of succinate synthase (adenylosuccinate synthetase) and IMP dehydrogenase (IMP dehydrogenase) in ATCC6872 as adenylate for the degradation pathways of the IMP to determine the mutagenic in impE2 effect on the wild type of IMP producing strain the strain was produced. The first start codon by changing the second nucleotide from a to t encoding the two enzymes in the nucleotide sequence of each gene purA and guaB was changed. The ATCC6872 in which the expression of the two genes is attenuated strain was named CJI9088. Produced in Example 10 in the manufacture CJI9088 strain pDZ-impE2 (S387T, M413T, N458K), pDZ-impE2 (F123C), pDZ-impE (I243V), pDZ-impE2 (F405Y) vectors alone or in combination electromigration Four transformants by the illustration how the strain by the recombinant vector is inserted into a chromosome of a homologous sequence was selected in medium containing kanamycin 25mg / l. The selected primary isolates was carried out a second cross again. Whether the final transformants transgenic for the conversion strain was confirmed by performing PCR using SEQ ID NO: 13, 14, a pair of primers.

[244]

It was evaluated for IMP producing ability of the fabricated CJI9088 and CJI9088_impE2 (S387T, M413T, N458K), CJI9088_impE2 (F123C), CJI9088_impE2 (I243V), CJI9088_impE2 (F405Y), CJI9088_impE2 (F123C, I243V, S387T, F405Y, M413T, N458K) strains . We measured the production of IMP by the method using HPLC After the completion of the culture, culture results are shown in the following table 19.

[245]

[Table 19]
Strain name IMP (g/L)
CJI9088 0.52
CJI9088_impE2 (S387T, M413T, N458K) 3.75
CJI9088_impE2(F123C) 0.94
CJI9088_impE2(I243V) 1.07
CJI9088_impE2(F405Y) 1.21
CJI9088_impE2(F123C, I243V, S387T, F405Y, M413T, N458K) 4.32

[246]

Confirming the accumulation of IMP resulting culture medium, it was confirmed that the increase of the parental strain CJI9088 IMP producing ability compared to 80% or more, up to 730%. Therefore, IMP increased production due to ImpE protein variants of the present application can be interpreted as very meaningful.

[247]

From the above description, those skilled in the filed will appreciate that this application without changing the technical spirit or essential features may be embodied in other specific forms. In this regard, the embodiments described above are only to be understood as exemplary rather than limiting in all aspects. The scope of the present application should be construed as the meaning and scope, and all such modifications as derived from the equivalent concepts of the following claims rather than the foregoing description within the scope of the present application.

[248]

[249]
Claims

[Claim 1]

In the N- terminus of the amino acid sequence of SEQ ID NO: 2 amino acid 123 is substituted with cysteine, replaced with the 243 amino acid valine, substituted with non-Leo the 387th amino acid used, 405 amino acid tyrosine is substituted, write the 413 amino acid Leo non-substituted, amino acid 458 is substituted with lysine, the protein or variant in which the substitution is made of a combination of the amino acid sequence, a 5'-inosinate discharge.

[Claim 2]

The method of claim 1, wherein the protein variant to discharge the 5'-inosinate is the second amino acid is substituted with another amino acid, the 64th amino acid is an amino acid different from the N- terminus of the amino acid sequence of SEQ ID NO: 2 further substituted, or the substituted consisting of a combination of amino acid sequences, protein variants for discharging the 5'-inosinate.

[Claim 3]

The polynucleotide encoding the mutant protein of claim 1.

[Claim 4]

The vector comprising the polynucleotide of paragraph 3.

[Claim 5]

Mutant protein of claim 1, paragraph 3 of the polynucleotide or the genus Corynebacterium microorganism producing 5'-inosinate which comprises a 4 of the vector.

[Claim 6]

The method of claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium stay Yorkshire varnish ( Corynebacterium stationis) of 5'-inosinate genus Corynebacterium microorganism to produce.

[Claim 7]

The method of claim 5, wherein the genus Corynebacterium microorganism succinate synthase (adenylosuccinate synthetase) or IMP dehydrogenase (IMP dehydrogenase) is added to produce a 5'-inosinate by weakening the activity of a adenylate the genus Corynebacterium microorganisms.

[Claim 8]

5'-inosinate manufacturing method of claim 5 genus Corynebacterium microorganism comprising the step of culturing in a culture medium.

[Claim 9]

10. The method of claim 8, wherein the method, 5'-inosinate method further comprising the step of recovering the 5'-inosinate in the microorganism or the culture medium.

[Claim 10]

The method of claim 8, wherein said microorganism of the genus Corynebacterium is Corynebacterium stay Yorkshire varnish ( Corynebacterium stationis) of 5'-inosinate method.

[Claim 11]

Paragraph 1 protein, the genus Corynebacterium 5'-inosinate for the purpose of increasing the production of microbial mutants.

[Claim 12]

The genus Corynebacterium, the method increases the discharge of 5'-inosinate, which in a microorganism comprising the step of enhancing the activity of a protein consisting of the amino acid sequence of SEQ ID NO: 2.

[Claim 13]

Protein of claim 1, the genus Corynebacterium 5'-inosinate, for the production of the discharge increase in the microbial mutants.