Sign In to Follow Application
View All Documents & Correspondence

Novel Promoter And Glutathione Producing Method Using Same

Abstract: The present application relates to a novel promoter, a vector comprising same, a microorganism comprising same, and a glutathione producing method using same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
29 June 2022
Publication Number
44/2022
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
maria@lexipcare.com
Parent Application

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu, Seoul 04560

Inventors

1. HA, Cheol Woong
330, Dongho-ro, Jung-gu, Seoul 04560
2. IM, Yeong Eun
330, Dongho-ro, Jung-gu, Seoul 04560
3. YANG, Eun Bin
330, Dongho-ro, Jung-gu, Seoul 04560
4. KIM, Yeonsoo
330, Dongho-ro, Jung-gu, Seoul 04560
5. KIM, Hyung Joon
330, Dongho-ro, Jung-gu, Seoul 04560

Specification

Title of the invention: Novel promoter and glutathione production method using same
technical field
[One]
The present application relates to a novel promoter, a vector comprising the same, a microorganism comprising the same, and a glutathione production method using the same.
[2]
background
[3]
Glutathione (GSH) is an organic sulfur compound most commonly present in cells, and is a tripeptide form in which three amino acids of glycine, glutamate, and cysteine ​​are combined.
[4]
Glutathione exists in the body in two forms: reduced glutathione (GSH) and oxidized glutathione (GSSG). Reduced glutathione (GSH), which is present in a relatively high proportion under normal circumstances, is mainly distributed in the liver and skin cells of the human body. It plays an important role, such as whitening by inhibiting its production (Sipes IG et al, The role of glutathione in the toxicity of xenobiotic compounds: metabolic activation of 1,2-dibromoethane by glutathione, Adv Exp Med Biol. 1986;197:457- 67.).
[5]
Since the amount of glutathione production decreases as aging progresses, the decrease in the production of glutathione, which plays an important role in antioxidant and detoxification action, promotes the accumulation of active oxygen, the main culprit of aging, so it is necessary to supply glutathione from the outside.
[6]
As such, glutathione with various functions has been spotlighted as a material in various fields such as pharmaceuticals, health functional foods, and cosmetics, and is also used in the manufacture of flavor materials, food and feed additives. It is known that glutathione has a great effect of increasing the taste of the raw material and maintaining rich taste, and can be used alone or in combination with other substances to be used as a kokumi flavor enhancer. Usually, Kokumi material has a richer feeling than umami materials such as nucleic acid and MSG, and is known to be produced by decomposition and aging of proteins.
[7]
Although the demand for glutathione that can be used in various fields is increasing, the enzyme synthesis process has not yet been commercialized due to the high production cost. Because industrial production requires a considerable amount of cost, the market is not greatly activated.
[8]
DETAILED DESCRIPTION OF THE INVENTION
technical challenge
[9]
The present application provides a novel promoter, a vector comprising the same, a microorganism comprising the same, and a glutathione production method using the same.
[10]
means of solving the problem
[11]
In the present application, any one or more nucleotides selected from the group consisting of nucleotides 92, 94, 102, 103, 249 and 251 in the polynucleotide sequence of SEQ ID NO: 1 or 2 are substituted with other nucleotides, Promoter activity It provides a polynucleotide having.
[12]
The present application provides a vector comprising a polynucleotide having the above promoter activity.
[13]
The present application relates to a polynucleotide having the promoter activity and a gene encoding a target protein; And it provides a microorganism of the genus Saccharomyces, including any one or more of vectors comprising the same.
[14]
The present application provides a glutathione production method comprising the step of culturing the microorganism in a medium.
[15]
Effects of the Invention
[16]
Since the novel promoter sequence of the present application greatly increases glutathione production, it can be usefully used for high glutathione production.
[17]
Best mode for carrying out the invention
[18]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.
[19]
In addition, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the present application described herein. Also, such equivalents are intended to be covered by this application.
[20]
One aspect of the present application is that any one or more nucleotides selected from the group consisting of nucleotides 92, 94, 102, 103, 249, and 251 in the polynucleotide sequence of SEQ ID NO: 1 or 2 are other nucleotides A substituted, polynucleotide having promoter activity is provided.
[21]
As used herein, the term "polynucleotide" refers to a DNA strand of a certain length or more as a polymer of nucleotides in which nucleotide monomers are connected in a long chain form by covalent bonds.
[22]
As used herein, the term “polynucleotide having promoter activity” refers to a gene to be expressed, that is, near a site where transcription of a target gene including a site to which RNA polymerase or enhancer binds for expression of the target gene. a region of DNA that
[23]
The polynucleotide having promoter activity of the present application may be used as a universal enhancing promoter.
[24]
For example, glutamate-cysteine ​​ligase (Glutamate-cysteine ​​ligase) may be used as a promoter capable of enhancing the expression of a polypeptide having activity. In addition, the polynucleotide may be a polynucleotide involved in increasing the production or production of glutathione. The polynucleotide of the present application may be included without limitation as long as it is a polynucleotide sequence having promoter activity.
[25]
In the present application, the polynucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 may be a sequence capable of serving as a promoter of glutamate-cysteine ​​ligase.
[26]
However, the polynucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2 are representative polynucleotide sequences for indicating the position of mutation, and other corresponding polynucleotide sequences having promoter activity are also included in the sequence capable of introducing mutation. For example, as long as it is a polynucleotide sequence capable of serving as a promoter of glutamate-cysteine ​​ligase or a polypeptide having a corresponding activity, it may be included without limitation in the range of sequences capable of introducing mutations of the present application. have. Accordingly, in such a sequence, when one or more sequences of positions corresponding to 92, 94, 102, 103, 249 and 251 in SEQ ID NO: 1 or 2 are substituted with other nucleotides, unsubstituted Promoters with higher activity than (unmodified) promoter sequences can be provided.
[27]
The nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 can be confirmed in NCBI Genbank, a known database, and is a sequence that can serve as a promoter of the glutamate-cysteine ​​ligase. Sequences corresponding to No. 1 or 2 may be derived from the genus Saccharomyces sp., specifically, may be a sequence of Saccharomyces cerevisiae, but is not limited thereto, and the same activity as the polynucleotide Sequences having a may be included without limitation.
[28]
Polynucleotides having promoter activity in the present application, SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 1 or SEQ ID NO: 2 and at least 70%, 80%, 85%, 90%, 95%, 96%, 97 It may be a polynucleotide sequence in which one or more nucleotides are substituted with other nucleotides including the specific position or a position corresponding thereto in a nucleotide sequence having %, 98%, or 99% or more homology or identity. . Nucleotide sequences with homology or identity may be sequences with less than 100% identity, except for sequences with 100% identity in the above categories.
[29]
On the other hand, even if it is described as 'a polynucleotide having a nucleotide sequence described in a specific SEQ ID NO:' or a 'polynucleotide comprising a nucleotide sequence described in a specific SEQ ID NO' in the present application, it is the same as a polynucleotide consisting of the nucleotide sequence of the corresponding SEQ ID NO: Or, it is apparent that a polynucleotide having a nucleotide sequence in which some sequences are deleted, modified, substituted or added may also be used in the present application, provided that it has the corresponding activity.
[30]
For example, if it has the same or corresponding activity as the polynucleotide, a meaningless sequence is added inside or at the end of the nucleotide sequence of the corresponding SEQ ID NO. It is apparent that also fall within the scope of the present application.
[31]
Homology and identity refer to the degree to which two given nucleotide sequences are related and can be expressed as a percentage.
[32]
The terms homology and identity can often be used interchangeably.
[33]
The sequence homology or identity of a conserved polynucleotide is determined by standard alignment algorithms, and the default gap penalty established by the program used may be used together. Substantially, homologous or identical sequences generally have moderate or high stringency conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire or full-length sequence. It can hybridize under stringent conditions. Hybridization is also contemplated for polynucleotides containing degenerate codons instead of codons in the polynucleotides.
[34]
Whether any two polynucleotide sequences have homology, similarity or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444, using a known computer algorithm such as the "FASTA" program. or, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), The Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [Carillo et al.] (1988) SIAM J Applied Math 48: 1073) For example, BLAST of the National Center for Biotechnology Information Database, or ClustalW, can be used to determine homology, similarity or identity.
[35]
Homology, similarity or identity of polynucleotides is described, for example, in Smith and Waterman, Adv. Appl. Math (1981) 2:482, see, for example, Needleman et al. (1970), J Mol Biol. 48: 443 by comparing the sequence information using a GAP computer program. In summary, the GAP program is defined as the total number of symbols in the shorter of two sequences divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). Default parameters for the GAP program are: (1) a binary comparison matrix (containing values ​​of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps. Thus, as used herein, the term "homology" or "identity" refers to a relevance between sequences.
[36]
In addition, probes that can be prepared from a known gene sequence, for example, a polynucleotide sequence that hybridizes under stringent conditions with a sequence complementary to all or part of the above-described polynucleotide sequence and has the same activity, may be included without limitation. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. Such conditions are described in, e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology. , John Wiley & Sons, Inc., New York). For example, genes having high homology or identity, 40% or more, specifically 70% or more, 80% or more, 85% or more, 90% or more, more specifically 95% or more, More specifically, the conditions under which genes having homology or identity of 97% or more, particularly specifically 99% or more, hybridize with each other and genes with lower homology or identity do not hybridize, or normal Southern hybridization (southern hybridization). hybridization) washing conditions of 60°C, 1XSSC, 0.1% SDS, specifically 60°C, 0.1XSSC, 0.1% SDS, more specifically 68°C, 0.1XSSC, 0.
[37]
Hybridization requires that two nucleic acids have complementary sequences, although mismatch between bases is possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application may also include isolated nucleic acid fragments that are complementary to substantially similar nucleic acid sequences as well as the entire sequence.
[38]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions. In addition, the Tm value may be 60° C., 63° C. or 65° C., but is not limited thereto and may be appropriately adjusted by those skilled in the art depending on the purpose.
[39]
The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementarity, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[40]
The polynucleotide having promoter activity provided in the present application may be one in which promoter activity is enhanced by substituted nucleotides at specific positions in the polynucleotide sequence having promoter activity described above.
[41]
In one embodiment, the polynucleotide having promoter activity of the present application may include a polynucleotide having promoter activity in which one or more nucleotides in the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 are substituted with other nucleotides. Specifically, one or more nucleotides in the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 may be substituted with other nucleotides, and may consist of a polynucleotide having promoter activity. The polynucleotide having the above promoter activity may be used interchangeably with "variant promoter" herein. The mutant promoter may be substituted with other nucleotides at any one or more, two or more, three or more, four or more, five or more, or all six positions at the above positions or their corresponding positions.
[42]
In one embodiment, the polynucleotide having promoter activity is any one or more nucleotides selected from the group consisting of nucleotides 92, 94, 102, 103, 249, and 251 of SEQ ID NO: 1 or 2; It may be a polynucleotide having promoter activity, including substitution with nucleotides.
[43]
The 'other nucleotide' is not limited as long as it is different from the nucleotide before substitution. Taking thymine (T), which is nucleotide 92 of SEQ ID NO: 1, for example, when it is written that "nucleotide 92 in SEQ ID NO: 1 is substituted with another nucleotide", cytosine (C), adenine (A), guanine except thymine (G) means to be substituted. Also, even if not otherwise indicated, when a nucleotide is described as "substituted" in the present application, it means that the nucleotide is replaced with a nucleotide different from the nucleotide before the substitution.
[44]
On the other hand, those of ordinary skill in the art can select the positions corresponding to nucleotides 92, 94, 102, 103, 249, and 251 of SEQ ID NO: 1 or 2 of the present application in any polynucleotide sequence through sequence alignment known in the art. Nucleotides can be identified, and even if not separately described in the present application, when “a nucleotide at a specific position in a specific SEQ ID NO:” is described, it is meant to include “nucleotides at the corresponding position” in any polynucleotide sequence. self-evident Therefore, in any polynucleotide sequence having promoter activity, selected from the group consisting of nucleotides at positions 92, 94, 102, 103, 249 and 251 of the polynucleotide sequence of SEQ ID NO: 1 or 2 Polynucleotide sequences in which any one or more nucleotides are substituted with other nucleotides are also included in the scope of the present application.
[45]
The "92, 94, 102, 103, 249, and 251 positions of SEQ ID NO: 1 or 2" is a promoter activity derived from Saccharomyces cerevisiae CEN KSD-Yc, YJM1450, YJM1401, YJM1307, International Accession No. KCCM12568P A polynucleotide having a If they are written together, they can be displayed as positions -409, -407, -399, -398, -252, and -250 at the top of the ORF, respectively.
[46]
On the other hand, a polynucleotide having promoter activity derived from Saccharomyces cerevisiae CEN.PK1-D, which is a form in which the nucleotide at position 74 (ie, position -74) above the ORF is deleted from the promoter sequence of Saccharomyces cerevisiae CEN KSD-Yc, that is, the sequence In the case of number 1, the above "positions 92, 94, 102, 103, 249, and 251 of SEQ ID NO: 1 or 2" are -408 times, -406 times, -398 times at the top of the ORF, respectively , -397, -251, -249.
[47]
In one embodiment, the polynucleotide having promoter activity in the present application is selected from the group consisting of nucleotides 92, 94, 102, 103, 249, and 251 in the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 Any one or more selected nucleotides may be substituted with other nucleotides.
[48]
Specifically, the polynucleotide having promoter activity in the present application is selected from the group consisting of nucleotides 92, 94, 102, 103, 249, and 251 in the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 Two or more nucleotides may be substituted with other nucleotides.
[49]
Specifically, the polynucleotide having promoter activity in the present application is selected from the group consisting of nucleotides 92, 94, 102, 103, 249, and 251 in the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 4 or more nucleotides may be substituted with other nucleotides.
[50]
Specifically, the polynucleotide may be one in which all six nucleotides 92, 94, 102, 103, 249, and 251 are substituted with other nucleotides in the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
[51]
In one embodiment, the polynucleotide having promoter activity in the present application may be one in which nucleotides 249 and 251 in the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 are substituted with other nucleotides.
[52]
In one embodiment, the polynucleotide having promoter activity in the present application may be one in which nucleotides 92, 94, 102 and 103 are substituted with other nucleotides in the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
[53]
However, it is not limited thereto.
[54]
In one embodiment, in the present application, the polynucleotide having promoter activity is selected from the polynucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2
[55]
92 thymine (T) is substituted with guanine (G), cytosine (C), or adenine (A);
[56]
94 thymine (T) is substituted with guanine (G), cytosine (C), or adenine (A);
[57]
Adenine (A) at position 102 is substituted with guanine (G), cytosine (C), or thymine (T);
[58]
adenine (A) at position 103 is substituted with guanine (G), cytosine (C), or thymine (T);
[59]
substitution of guanine (G) at position 249 with thymine (T), cytosine (C), or adenine (A);
[60]
cytosine (C) at position 251 is substituted with thymine (T), guanine (G), or adenine (A); Or it may include a combination of these substitutions.
[61]
In one embodiment, thymine 92 (T) may be substituted with cytosine (C). It can also be expressed as 92 (T→C) or -409 (T→C), or -408 (T→C) depending on the reference sequence.
[62]
In one embodiment, thymine 94 (T) may be substituted with cytosine (C). It can also be expressed as 94 (T→C) or -407 (T→C), or -406 (T→C) depending on the reference sequence.
[63]
In one embodiment, the 102 adenine (A) may be substituted with cytosine (C). It can also be expressed as 102 (A→C) or -399 (A→C), or -398 (A→C) depending on the reference sequence.
[64]
In one embodiment, the 103rd adenine (A) may be substituted with thymine (T). It can also be expressed as 103 (A→T) or -398 (A→T), or -397 (A→T) depending on the reference sequence.
[65]
In one embodiment, the 249 guanine (G) may be substituted with adenine (A). It can also be expressed as 249 (G→A) or -252 (G→A), or -251 (G→A) depending on the reference sequence.
[66]
In one embodiment, the 251 cytosine (C) may be substituted with thymine (T). It can also be expressed as 251 (C→T) or -250 (C→T), or -249 (C→T) depending on the reference sequence.
[67]
In one embodiment, the polynucleotide having promoter activity in the present application is 92 (T → C), 94 (T → C), 102 (A → C), 103 (A → T), 249 (G → A) and 251 (C→T).
[68]
In one embodiment, the polynucleotide having promoter activity in the present application may include 249 (G→A) and 251 (C→T) substitutions.
[69]
In one embodiment, the polynucleotide having promoter activity in the present application may include 92 (T→C), 94 (T→C), 102 (A→C) and 103 (A→T) substitutions.
[70]
In one embodiment, the polynucleotide having promoter activity in the present application is 92 (T → C), 94 (T → C), 102 (A → C), 103 (A → T), 249 (G → A) and 251 (C→T) may include all substitutions.
[71]
In one embodiment, the polynucleotide having promoter activity in the present application may include any one polynucleotide sequence selected from SEQ ID NOs: 3 to 32. Specifically, the polynucleotide may be composed of any one polynucleotide sequence selected from SEQ ID NOs: 3 to 32, but is not limited thereto.
[72]
As described above, even if it is described as 'a polynucleotide having a nucleotide sequence set forth in a specific SEQ ID NO:' or 'a polynucleotide comprising a nucleotide sequence set forth in a specific SEQ ID NO:' Or, it is apparent that a polynucleotide having a nucleotide sequence in which some sequences are deleted, modified, substituted or added can also be used in the present application, provided that it has the corresponding activity.
[73]
In addition, it is not limited to the above-described embodiment, and various modifications to the polynucleotide sequence may be included in a range that does not significantly reduce promoter activity.
[74]
The polynucleotide having promoter activity of the present application may be used as a promoter.
[75]
The promoter may be located at the 5' site of the transcription initiation site into mRNA.
[76]
The promoter may have increased promoter activity compared to a conventional promoter. That is, it is possible to increase the expression and/or activity of the protein encoded by the target gene as well as the expression of the target gene in the host cell. For the purposes of the present application, the target gene for enhancing expression may be changed depending on the product to be produced, and the promoter may be used as a universal promoter for enhancing the target gene.
[77]
The "target gene" means a gene whose expression is to be controlled by the promoter sequence of the present application for the purpose of the present application. A protein encoded by the target gene may be expressed as a “target protein”, and a gene encoding the “target protein” may be expressed as a “target gene”.
[78]
In addition, the polynucleotide encoding the target protein may vary in the coding region within a range that does not change the polypeptide sequence due to codon degeneracy or considering codons preferred in the organism to express the polynucleotide. Deformation can be made. The description of the polynucleotide sequence is as described above.
[79]
In one embodiment, the target protein may be a polypeptide having glutamate-cysteine ​​ligase activity. That is, the target gene of the promoter may be a gene encoding a polypeptide having glutamate-cysteine ​​ligase activity.
[80]
In the present application, "glutamate-cysteine ​​ligase" means "glutamate-cysteine ​​ligase", "gamma-glutamylcysteine ​​synthetase (GCS)", or "GSH1 protein" Also called enzyme.
[81]
Glutamate-cysteine ​​ligase is known to catalyze the following reactions:
[82]
L-glutamate + L-cysteine ​​+ ATP ↔ gamma-glutamyl cysteine ​​+ ADP + Pi
[83]
It is also known that the reaction catalyzed by the glutamate-cysteine ​​ligase is the first step in glutathione synthesis.
[84]
The amino acid sequence constituting the glutamate-cysteine ​​ligase can be obtained from a known database, GenBank of NCBI. For example, it may be derived from Saccharomyces cerevisiae. As an example, it may be a protein comprising the amino acid sequence of SEQ ID NO: 33, but a sequence having the same activity as the amino acid sequence may be included without limitation.
[85]
In addition, the "polypeptide having glutamate-cysteine ​​ligase activity" of the present application includes not only the wild-type, unmodified or natural form of the glutamate-cysteine ​​ligase, but also variants having the same activity or enhanced activity than this. .
[86]
In the present application, "variant polypeptide" has the same meaning as "variant", in which one or more amino acids are conservatively substituted and/or modified in the recited sequence. It is different from, but refers to a protein in which the functions or properties of the protein are maintained. For example, among the glutamate-cysteine ​​ligases described above, the 86th amino acid from the N-terminus of SEQ ID NO: 33 may be a variant in which an amino acid residue other than cysteine ​​is substituted.
[87]
A variant differs from an identified sequence by several amino acid substitutions, deletions or additions. Such variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the protein and evaluating the properties of the modified protein. That is, the ability of the mutant may be increased compared to that of the native protein. In addition, some variants may include variants in which one or more portions such as an N-terminal leader sequence or a transmembrane domain have been removed. Other variants may include variants in which a portion is removed from the N- and/or C-terminus of the mature protein.
[88]
The term "variant" may include terms such as variant, modified, mutated protein, and mutant (in English, modified, modified protein, modified polypeptide, mutant, mutein, divergent, variant, etc.), and has a mutated meaning. The terms used are not limited thereto. For the purpose of the present application, the mutant may have increased activity of the mutated protein compared to the natural wild-type or unmodified protein, but is not limited thereto.
[89]
As used herein, the term “conservative substitution” means substituting one amino acid for another amino acid having similar structural and/or chemical properties. Such variants may have, for example, one or more conservative substitutions while still retaining one or more biological activities. Such amino acid substitutions may generally occur based on similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathic nature of the residues.
[90]
In addition, variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, the polypeptide may be conjugated with a signal (or leader) sequence at the N-terminus of the protein that is involved in the transfer of the protein either co-translationally or post-translationally. The polypeptide may also be conjugated with other sequences or linkers to enable identification, purification, or synthesis of the polypeptide.
[91]
In the present application, 'substitution with another amino acid' is not limited as long as it is an amino acid different from the amino acid before the substitution. That is, the substitution of 'an amino acid other than cysteine' for cysteine, which is the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 33, can be expressed as "the 86th amino acid is substituted with another amino acid". On the other hand, in the present application, when it is expressed that 'a specific amino acid has been substituted', it is obvious that the amino acid is substituted with an amino acid different from the amino acid before the substitution, even if it is not separately indicated that it is substituted with another amino acid.
[92]
The "glutamate-cysteine ​​ligase variant" of the present application may be described as "a (mutant) polypeptide having glutamate-cysteine ​​ligase activity", "GSH1 variant", and a protein before mutation, a native wild-type polypeptide or an unmodified polypeptide It may be that it can increase glutathione production compared to, but is not limited thereto.
[93]
The variant may be one in which one or more amino acids are substituted with other amino acids in the amino acid sequence of SEQ ID NO: 33. Specifically, the variant may include a mutation in which the amino acid corresponding to the 86th position in the amino acid sequence of SEQ ID NO: 33 is substituted with another amino acid. The other amino acids may be selected from glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, tyrosine, asparagine, glutamate, glutamine, aspartate, lysine, arginine and histidine. .
[94]
In one embodiment, the amino acid corresponding to the 86th position in the amino acid sequence of SEQ ID NO: 33 may be substituted with arginine, but is not limited thereto.
[95]
In the present application, "a variant in which the 86th amino acid is substituted with another amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 33" refers to the N or C terminus of the amino acid sequence of SEQ ID NO: 33, or an amino acid deletion/addition/insertion in the middle, etc. Even if it is described at a position other than position 86 by In addition, as an example of the glutamate-cysteine ​​ligase variant in the present application, a variant in which the 86th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 33 is substituted with another amino acid is described, but the glutamate-cysteine ​​ligase variant of the present application is It is not limited to the variant of the amino acid sequence of SEQ ID NO: 33, and, in any amino acid sequence having glutamate-cysteine ​​ligase activity, the amino acid corresponding to position 86 of the amino acid sequence of SEQ ID NO: 33 is substituted with another amino acid. It is obvious that it is included in the scope of the glutamate-cysteine ​​ligase variants of the present application. The amino acid corresponding to the 86th position of the amino acid sequence of SEQ ID NO: 33 in any amino acid sequence can be identified through various sequence alignment methods known in the art.
[96]
Glutamate-cysteine ​​ligase variant, in which the 86th amino acid is substituted with another amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 33 of the present application, is the amino acid sequence of SEQ ID NO: 33 or 80%, 85%, 90%, 95 It may be a protein comprising an amino acid sequence having at least %, 96%, 97%, 98%, or 99% homology or identity. In addition, if it is an amino acid sequence having such homology or identity and exhibiting efficacy corresponding to the variant, proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added other than position 86 are also included in the scope of the present application. self-evident About homology and identity, it is as above-mentioned.
[97]
A gene encoding a polypeptide having glutamate-cysteine ​​ligase activity of the present application may be referred to as a "GSH1 gene".
[98]
The gene may be derived from yeast. Specifically, it may be derived from Saccharomyces genus, more specifically Saccharomyces cerevisiae. Specifically, it may be a gene encoding the amino acid sequence of SEQ ID NO: 33, but is not limited thereto.
[99]
In the present application, the "GSH1 gene", that is, a polynucleotide encoding a polypeptide having glutamate-cysteine ​​ligase activity, is due to the degeneracy of codons or in consideration of codons preferred in the organism in which the polypeptide is to be expressed, Various modifications may be made to the coding region within a range that does not change the amino acid sequence of the polypeptide.
[100]
Since the polypeptide having glutamate-cysteine ​​ligase activity of the present application also includes a variant sequence, the polynucleotide sequence encoding a protein variant in which the 86th amino acid is substituted with another amino acid in the amino acid sequence of SEQ ID NO: 33 of the present application is also included without limitation. can do.
[101]
In addition, by hybridizing under stringent conditions with a probe that can be prepared from a known gene sequence, for example, a complementary sequence to all or part of the polynucleotide sequence, the amino acid sequence of SEQ ID NO: 33, or amino acid 86 thereof is different Sequences encoding protein variants substituted with may also include without limitation.
[102]
Another aspect of the present application provides a composition for gene expression comprising the polynucleotide having the promoter activity of the present application.
[103]
The composition for gene expression refers to a composition capable of expressing a gene that can be expressed by the polynucleotide having promoter activity of the present application.
[104]
For example, the composition for gene expression includes the polynucleotide having the promoter activity of the present application, and may further include, without limitation, a configuration capable of operating the polynucleotide as a promoter.
[105]
In the composition for gene expression of the present application, the polynucleotide may be in a form included in a vector to express an operably linked gene in an introduced host cell.
[106]
Another aspect of the present application includes a vector including a polynucleotide having the promoter activity, or a gene encoding the polynucleotide and a target protein.
[107]
In one embodiment, the target protein may be a polypeptide having glutamate-cysteine ​​ligase activity.
[108]
As used herein, the term “vector” refers to a DNA preparation containing a polynucleotide sequence encoding a target protein operably linked to a suitable regulatory sequence to enable expression of the target protein in a suitable host.
[109]
For the purposes of the present application, the regulatory sequence may include a polynucleotide having the promoter activity of the present application.
[110]
Meanwhile, the regulatory sequence may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. can After transformation into a suitable host cell, the vector can replicate or function independently of the host genome, and can be integrated into the genome itself.
[111]
The vector used in the present application is not particularly limited, and any vector known in the art may be used. For example, both an integrative yeast plasmid (YIp) and an extrachromosomal plasmid vector are possible as the yeast expression vector.
[112]
The extrachromosomal plasmid vector may include an episomal yeast plasmid (YEp), a replicative yeast plasmid (YRp), and a yeast centromer plasmid (YCp).
[113]
In addition, artificial yeast chromosomes (YACs) can also be used as the vector of the present application.
[114]
As a specific example, available vectors are pESCHIS, pESC-LEU, pESC-TRP, pESC-URA, Gateway pYES-DEST52, pAO815, pGAPZ A, pGAPZ B, pGAPZ C, pGAPa A, pGAPa B, pGAPa C, pPIC3.5K , pPIC6 A, pPIC6 B, pPIC6 C, pPIC6α A, pPIC6α B, pPIC6α C, pPIC9K, pYC2/CT, pYD1 Yeast Display Vector, pYES2, pYES2/CT, pYES2/NT A, pYES2/NT B, pYES2/NT C , pYES2/CT, pYES2.1, pYES-DEST52, pTEF1/Zeo, pFLD1, PichiaPinkTM, p427-TEF, p417-CYC, pGAL-MF, p427-TEF, p417-CYC, PTEF-MF, pBY011, pSGP47, pSGP46 , pSGP36, pSGP40, ZM552, pAG303GAL-ccdB, pAG414GAL-ccdB, pAS404, pBridge, pGAD-GH, pGAD T7, pGBK T7, pHIS-2, pOBD2, pRS408, pRS410, pRS418, pRS420, pRS428, yeast micron A form pRS403, pRS404, pRS405, pRS406, pYJ403, pYJ404, pYJ405 and pYJ406.
[115]
Insertion of the polynucleotide into a chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. It may further include a selection marker (selection marker) for confirming whether the chromosome is inserted. The selection marker is used to select cells transformed with a vector, that is, to determine whether a target nucleic acid molecule is inserted, and confer a selectable phenotype such as drug resistance, auxotrophic resistance, resistance to cytotoxic agents, or expression of surface proteins. markers may be used. In an environment treated with a selective agent, only the cells expressing the selectable marker survive or exhibit other expression traits, so that the transformed cells can be selected. For example, a wild-type polynucleotide in a chromosome can be replaced with a mutated polynucleotide through a vector for intracellular chromosome insertion.
[116]
In the present application, the term "transformation" may refer to introducing a vector including a polynucleotide encoding a target protein into a host cell so that the target protein can be expressed in the host cell.
[117]
The transformed polynucleotide may include all of them regardless of whether they are inserted into the chromosome of the host cell or located outside the chromosome, as long as they can be expressed in the host cell. In addition, the polynucleotide encoding the target protein may include DNA and RNA encoding the target protein. The polynucleotide encoding the target protein may be introduced in any form as long as it can be expressed and introduced into a host cell. For example, the polynucleotide encoding the target protein may be introduced into a host cell in the form of an expression cassette, which is a gene construct including all elements necessary for self-expression.
[118]
The expression cassette may include a promoter operably linked to a polynucleotide encoding the target protein, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. In addition, the polynucleotide encoding the target protein may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[119]
In addition, as used herein, the term “operably linked” means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein of the present application and the gene sequence are functionally linked.
[120]
For the purposes of the present application, the promoter may be a polynucleotide having the promoter activity of the present application.
[121]
The method for transforming the vector of the present application includes any method of introducing a nucleic acid into a cell, and may be performed by selecting a suitable standard technique as known in the art depending on the host cell. For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method and the like, but is not limited thereto.
[122]
Another aspect of the present application provides a microorganism comprising a polynucleotide having promoter activity of the present application, a polynucleotide comprising a gene encoding the polynucleotide and a target protein, or a vector comprising the same.
[123]
The target protein may be a polypeptide having glutamate-cysteine ​​ligase activity. The polynucleotide having the promoter activity of the present application, the target protein, the polypeptide having the glutamate-cysteine ​​ligase activity, and the vector are as described above.
[124]
The microorganism may be yeast, specifically, may be a microorganism of the genus Saccharomyces. More specifically, it may be Saccharomyces cerevisiae.
[125]
The microorganism is a microorganism expressing a glutamate-cysteine ​​ligase (Glutamate-cysteine ​​ligase), or a microorganism expressing a polypeptide having glutamate-cysteine ​​ligase activity, or a glutamate-cysteine ​​ligase (Glutamate-cysteine) ligase) may be a microorganism into which a polypeptide having activity is introduced, but is not limited thereto.
[126]
In one embodiment, the microorganism may be a microorganism having a glutathione-producing ability, a microorganism having an enhanced glutathione-producing ability in a parent strain having a naturally weak glutathione-producing ability, or a microorganism conferred with a glutathione-producing ability to a parent strain without glutathione-producing ability. . In one embodiment, the microorganism is a microorganism expressing a glutamate-cysteine ​​ligase variant comprising one or more amino acid mutations in the amino acid sequence of SEQ ID NO: 33, wherein the amino acid mutation is the 86th amino acid from the N-terminus of SEQ ID NO: 33 It may contain a mutation substituted with another amino acid. However, it is not limited thereto. The glutamate-cysteine ​​ligase variant is the same as described above.
[127]
As used herein, the term "to be expressed/becoming" a protein means a state in which a target protein, for example, glutamate-cysteine ​​ligase or a variant thereof, is introduced into a microorganism or modified to be expressed in the microorganism. When the target protein is a protein present in a microorganism, it may mean a state in which its activity is enhanced compared to before intrinsic or modification.
[128]
Specifically, "introduction of protein" may be one that exhibits the activity of a specific protein that the microorganism did not originally have, or exhibits improved activity compared to the intrinsic activity or activity before modification of the corresponding protein. For example, a polynucleotide encoding a specific protein may be introduced into a chromosome in a microorganism, or a vector including a polynucleotide encoding a specific protein may be introduced into the microorganism to exhibit its activity.
[129]
In addition, "enhancement of activity" may be one in which the activity is improved compared to the intrinsic activity or activity before modification of a specific protein of the microorganism. "Intrinsic activity" may refer to the activity of a specific protein originally possessed by the parent strain before the transformation when the trait of a microorganism is changed due to genetic variation caused by natural or artificial factors.
[130]
For the purpose of the present application, the activity enhancement may be made by using the polynucleotide sequence having the promoter activity of the present application as an expression control sequence of the target protein. Since the target protein may be in its native or variant form as described above, the expression control sequence may be an expression control sequence of a gene encoding a variant protein or an expression control sequence of a gene encoding a native protein on a chromosome. .
[131]
In addition, other activity enhancing methods may also be used in combination. For example, in addition to using the polynucleotide sequence having the promoter activity of the present application as the expression control sequence of the target protein, increase the intracellular copy number of the gene encoding the target protein, the gene encoding the native protein on the chromosome Any method selected from the group consisting of a method of replacing the protein variant with a gene encoding the protein variant, a method of additionally introducing a mutation into the gene encoding the protein to enhance the activity of the protein variant, and a method of introducing the protein variant into a microorganism One or more methods may be used, but are not limited thereto.
[132]
By using the polynucleotide having the promoter activity of the present application to control the expression of the target protein in a microorganism, the activity of the target protein can be enhanced.
[133]
For example, the activity or concentration of the corresponding protein is generally at least 1%, 10%, 25%, 50%, 75%, 100%, based on the activity or concentration of the protein in a wild-type or unmodified microbial strain; It may be increased by 150%, 200%, 300%, 400% or 500%, up to 1000% or 2000%, but is not limited thereto.
[134]
In the present application, the term "unmodified microorganism" does not exclude a strain containing a mutation that may occur naturally in a microorganism, is a native strain itself, or a microorganism that does not contain a polynucleotide having the promoter activity of the present application, or Also includes microorganisms not transformed with the vector containing the polynucleotide having the promoter activity of the present application.
[135]
The microorganism of the present application may be a microorganism producing glutathione.
[136]
As used herein, "glutathione" is used interchangeably with "glutathione" and "GSH", and refers to a tripeptide composed of three amino acids: glutamate, cysteine, and glycine. Glutathione may be used as a raw material for pharmaceuticals, health functional foods, flavoring materials, food, feed additives, cosmetics, etc., but is not limited thereto.
[137]
In the present application, "glutathione-producing microorganism" includes all microorganisms in which genetic modification has occurred, either naturally or artificially, and a specific mechanism is weakened due to a cause such as insertion of an external gene or intensification or inactivation of an intrinsic gene. As the modified or enhanced microorganism, it may be a microorganism having a genetic mutation or enhanced activity for the desired glutathione production. For the purpose of the present application, the microorganism producing the glutathione, including the polynucleotide having the promoter activity of the present application, may refer to a microorganism capable of producing the desired glutathione in excess compared to the wild-type or unmodified microorganism.
[138]
The "glutathione-producing microorganism" may be used interchangeably with terms such as "glutathione-producing microorganism", "microorganism having glutathione-producing ability," "glutathione-producing strain", "strain having glutathione-producing ability", and the like.
[139]
The glutathione-producing microorganism may be a recombinant microorganism. The recombinant microorganism is as described above. The microorganism may further include mutations such as strengthening the biosynthetic pathway for increasing glutathione production ability, releasing feedback inhibition, decomposing pathway or gene inactivation to weaken the biosynthetic pathway, and such mutations are artificially, for example, UV It may occur by irradiation, but does not rule out the natural.
[140]
Another aspect of the present application provides a method for producing glutathione comprising the step of culturing the microorganism in a medium. The microorganism, glutathione, is the same as described above. Through strain culture, glutathione can be accumulated in the cells.
[141]
The medium and other culture conditions used for culturing the strain of the present application may be used without any particular limitation as long as it is a medium used for culturing the microorganisms of the genus Saccharomyces. It can be cultured under aerobic or anaerobic conditions in a normal medium containing a nitrogen source, phosphorus, inorganic compounds, amino acids and/or vitamins while controlling temperature, pH, etc.
[142]
As the carbon source in the present application, carbohydrates such as glucose, fructose, sucrose, maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, citric acid and the like; Amino acids such as glutamate, methionine, lysine and the like may be included, but are not limited thereto. In addition, natural organic nutrient sources such as starch hydrolyzate, molasses, blackstrap molasses, rice winter, cassava, sugarcane offal and corn steep liquor can be used, including glucose and sterilized pretreated molasses (i.e. molasses converted to reducing sugar). Carbohydrates such as, etc. may be used, and other appropriate amounts of carbon sources may be variously used without limitation. These carbon sources may be used alone or in combination of two or more thereof.
[143]
Examples of the nitrogen source include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Organic nitrogen sources such as amino acids, peptones, NZ-amines, meat extracts, yeast extracts, malt extracts, corn steep liquor, casein hydrolysates, fish or degradation products thereof, defatted soybean cakes or degradation products thereof and the like can be used. These nitrogen sources may be used alone or in combination of two or more, but is not limited thereto.
[144]
The phosphorus may include potassium first potassium phosphate, second potassium phosphate, or a sodium-containing salt corresponding thereto. As the inorganic compound, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used.
[145]
In addition, the medium may contain amino acids, vitamins and/or appropriate precursors. Specifically, L-amino acid and the like may be added to the culture medium of the strain. Specifically, glycine, glutamate, and/or cysteine ​​may be added, and if necessary, L-amino acids such as lysine may be further added, but not necessarily limited thereto. does not
[146]
The medium or precursor may be added to the culture in a batch or continuous manner, but is not limited thereto.
[147]
In the present application, by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the culture in an appropriate manner during the culture of the strain, the pH of the culture can be adjusted. In addition, during culturing, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress bubble formation. In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected with or without gas to maintain anaerobic and microaerobic conditions.
[148]
The temperature of the culture may be 25 °C to 40 °C, more specifically, 28 °C to 37 °C, but is not limited thereto. The incubation period may be continued until a desired production amount of useful substances is obtained, and specifically, it may be 1 hour to 100 hours, but is not limited thereto.
[149]
The glutathione production method may further include an additional process after the culturing step. The additional process may be appropriately selected depending on the use of glutathione.
[150]
Specifically, the method for producing glutathione may include recovering glutathione from at least one material selected from among the microorganism, the dried product of the microorganism, the extract of the microorganism, the culture of the microorganism, and the lysate of the microorganism after the culturing step. have.
[151]
The method may further include a step of lysing the microorganism (strain) before or simultaneously with the recovery step. The lysis of the strain may be carried out by a method commonly used in the technical field to which the present application belongs, for example, a lysis buffer solution, a sonicator, heat treatment, and a French presser. In addition, the lysis step may include an enzymatic reaction such as a cell wall degrading enzyme, a nucleic acid degrading enzyme, a nucleic acid transfer enzyme, a proteolytic enzyme, but is not limited thereto.
[152]
For the purpose of the present application, dry yeast, yeast extract, yeast extract mix powder, pure purified glutathione containing a high content of glutathione through the glutathione manufacturing method glutathione), but is not limited thereto, and may be appropriately manufactured according to the desired product.
[153]
In the present application, the term "dry yeast" may be used interchangeably with terms such as "dried product of microorganisms" and "dried strain". The dry yeast may be prepared by drying yeast cells accumulating glutathione, and specifically, it may be included in a composition for feed, a composition for food, and the like, but is not limited thereto.
[154]
In the present application, the term "yeast extract" may be used interchangeably with terms such as "extract of microorganisms" and "strain extract". The strain extract may mean a material remaining after separating the cell wall from the cells of the strain. Specifically, it may mean the remaining components excluding the cell wall from the components obtained by lysing the cells. The extract of the strain includes glutathione, and components other than glutathione may include at least one of protein, carbohydrate, nucleic acid, and fiber, but is not limited thereto.
[155]
In the recovery step, glutathione, a target material, may be recovered using a suitable method known in the art.
[156]
The recovery step may include a purification process. The purification process may be pure purification by separating only glutathione from the strain. Through the purification process, pure purified glutathione may be prepared.
[157]
If necessary, the method for preparing glutathione may further include a step of mixing a material selected from among the strains obtained after the culturing step, a dried product, an extract, a culture, a lysate, and glutathione recovered therefrom and an excipient. Through the mixing step, yeast extract mix powder may be prepared.
[158]
The excipient may be appropriately selected and used according to the intended use or form, for example, starch, glucose, cellulose, lactose, glycogen, D-mannitol, sorbitol, lactitol, maltodextrin, calcium carbonate, synthetic aluminum silicate, Calcium monohydrogen phosphate, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, dextrin, sodium alginate, methylcellulose, colloidal silica gel, hydroxypropyl starch, hydroxypropylmethylcellulose, propylene glycol, casein, calcium lactate , Primogel, and gum arabic, and specifically may be one or more components selected from starch, glucose, cellulose, lactose, dextrin, glycogen, D-mannitol, and maltodextrin, but is not limited thereto.
[159]
The excipient may include, for example, a preservative, a wetting agent, a dispersing agent, a suspending agent, a buffer, a stabilizing agent, or an isotonic agent, but is not limited thereto.
[160]
In another aspect of the present application, any one or more nucleotides selected from the group consisting of nucleotides 92, 94, 102, 103, 249, and 251 in the polynucleotide sequence of SEQ ID NO: 1 or 2 are different nucleotides It provides use as a promoter of a polynucleotide substituted with
[161]
The polynucleotide is the same as described above.
Modes for carrying out the invention
[162]
Hereinafter, the present application will be described in more detail through Examples and Experimental Examples. However, these Examples and Experimental Examples are for illustrative purposes of the present application, and the scope of the present application is not limited to these Examples and Experimental Examples.
[163]
Example 1: Obtaining of CJ-5 strain having glutathione-producing ability
[164]
A strain having a glutathione-producing ability was selected by obtaining a strain from yeast containing various strains and improving it.
[165]
Specifically, grain samples such as rice, barley, mung bean, and oats are collected from a total of 20 regions, including Yongin, Icheon, Pyeongtaek, and Hwaseong areas in Gyeonggi-do, Korea, and then kneaded, wrapped in a cloth, pressed firmly to form a shape, and then wrapped with straw and fermented for 10 days. After that, it was dried slowly to prepare yeast.
[166]
Experiments were performed as follows to isolate various strains from the prepared yeast. 45 ml of brine was added to 5 g of koji and pulverized with a mixer. For pure separation of yeast strains, serial dilution was carried out and spread on YPD Agar (Yeast extract 10 g/L, Bacto peptone 20 g/L, Glucose 20 g/L, distilled water based on 1 liter) and cultured at 30° C. for 48 hours. Then, yeast colonies were streaked on YPD agar through colony morphology and microscopic verification. 25ml of YPD broth was dispensed into a 250ml Erlenmeyer flask, inoculated with the pure isolated strain, and cultured with shaking (30°C, 200 rpm) for 48 hours to check the glutathione production, and strain screening was performed.
[167]
For the improvement of the primary isolated strains, a mutation (random mutation) was induced in the isolated strain. Specifically, a strain in which glutathione production was confirmed among the yeast isolated from the yeast was isolated and named CJ-37 strain. After culturing CJ-37 strain on a solid medium, the broth was inoculated to obtain a culture solution, and UV was irradiated to the cells using a UV lamp. Thereafter, only mutant strains that formed colonies were isolated and obtained by smearing the UV-irradiated culture medium on a plate medium, and their glutathione production was confirmed.
[168]
As a result, the strain showing the best glutathione production among the mutated strains was selected as the glutathione-producing strain and named CJ-5 strain. It was deposited on the 31st of the month and was given the deposit number KCCM12568P.
[169]
Example 2: Development of GSH1 mutation sequence through further improvement experiment of CJ-5 strain
[170]
Example 2-1: Mutagenesis and mutation sequence confirmation
[171]
In order to further improve the glutathione-producing ability of the CJ-5 strain, mutations were induced in the following way.
[172]
After culturing the CJ-5 strain on a solid medium, the broth was inoculated to obtain a culture solution, and UV was irradiated to the cells using a UV lamp. After that, only mutant strains that formed colonies were isolated and obtained by smearing the UV-irradiated culture medium on a plate medium, and the strain with the most improved glutathione production ability was isolated and named as the CC02-2490 strain, and the Korea Microorganism Conservation Center, an international depository under the Budapest Treaty. It was deposited with the (Korean Culture Center of Microorganisms, KCCM) on January 17, 2020 and was given an accession number KCCM12659P. As a result of analyzing the nucleotide sequence of the glutathione biosynthesis gene GSH1 in relation to the increase in the glutathione production ability of the strain, it was confirmed that the 86th amino acid cysteine ​​of the GSH1 protein encoded by the GSH1 gene was substituted with arginine.
[173]
Example 2-2: C86 residue substitution experiment of GSH1 protein
[174]
Saccharomyces cerevisiae ( S. cerevisiae) CEN.PK2-1D and S. cerevisiae CJ-5 strains were produced to determine whether glutathione production was increased.
[175]
In order to construct a strain in which cysteine ​​86 of Saccharomyces cerevisiae GSH1 protein (SEQ ID NO: 33) was substituted with arginine, Lee TH, et al. (J. Microbiol. Biotechnol. (2006), 16(6)) , 979-982), pWAL100 and pWBR100 plasmids were used with reference to the contents disclosed in the paper. Specifically, PCR was performed as follows using the genomic DNA of the CJ-5 strain as a template. PCR was performed using the primers of SEQ ID NO: 34 and SEQ ID NO: 35 to secure a partial sequence of GSH1 N-terminal including the N-terminal BamHI flanking sequence, the initiation codon of the GSH1 ORF and the C86R variant coding sequence, and SEQ ID NO: 36 and the sequence A partial sequence of GSH1 C-terminal including a C-terminal XhoI flanking sequence, a GSH1 ORF stop codon and a C86R mutation coding sequence was obtained using the primer of No. 37. Then, using these two sequences as a template, overlap PCR was performed using SEQ ID NO: 34 and SEQ ID NO: 37. As a result, the GSH1 mutant protein coding sequence in which the 86th cysteine ​​was substituted with arginine, N-terminal BamHI, C-terminal XhoI A GSH1 ORF fragment containing a restriction enzyme sequence was obtained. The ORF fragment was cloned into the pWAL100 vector treated with the same enzyme after treatment with BamHI and XhoI to prepare a pWAL100-GSH1(C86R) vector.
[176]
In addition, using the genomic DNA of the CJ-5 strain as a template, PCR using SEQ ID NO: 38 and SEQ ID NO: 39 was performed to secure a 500 bp fragment after the GSH1 ORF stop codon including the N-terminal SpeI and C-terminal NcoI restriction enzyme sequences and SpeI and NcoI restriction enzymes were treated. After cloning into pWBR100 treated with the same restriction enzyme, pWBR100-GSH1 vector was prepared.
[177]
Finally, in order to prepare a DNA fragment to be introduced into yeast, using the pWAL100-GSH1 (C86R) vector prepared above as a template and using the primers of SEQ ID NO: 34 and SEQ ID NO: 40 to include an arginine mutation coding sequence and a part of KlURA3 After obtaining a PCR product containing a part of KlURA3 and 500 bp after the GSH1 stop codon using the primers of SEQ ID NO: 41 and SEQ ID NO: 39 using the pWBR100-GSH1 vector as a template, each PCR product was obtained S. cerevisiae CEN.PK2-1D and S. cerevisiae CJ-5 were transformed at the same molar ratio. PCR was performed under the conditions of 5 minutes for heat denaturation at 95°C, 1 minute for binding at 53°C, and 1 minute for polymerization at 72°C for 1 minute per kb. , 1425), a modified lithium acetate method was used. Specifically, after washing yeast cells with an OD of 0.7 to 1.2 with lithium acetate/TE buffer twice, the PCR products and single stranded DNA (Sigma D-7656) were mixed together in lithium acetate/TE/40% PEG buffer. After stationary incubation at 30°C and 42°C for 30 minutes for 15 minutes, the cells were cultured on an SC (2% glucose) agar plate without Uracil until colonies were seen, and the GSH1 C86R mutation coding sequence and KlURA3 gene were introduced. strains were obtained. Then, to remove KlURA3, each strain was cultured overnight in 2 ml of YPD, diluted 1/100, spread on an SC (2% glucose) agar plate containing 0.1% 5-FOA, and the Uracil marker was removed. cerevisiae CEN.PK2-1D GSH1 C86R mutant strain and S. cerevisiae CJ-5 GSH1 C86R mutant strain were prepared. A strain capable of expressing the GSH1 mutant protein substituted with the remaining 18 amino acids in addition to arginine is also a primer pair in which the arginine coding sequence 86 on the sequence is substituted with a sequence encoding another amino acid with the primers of SEQ ID NO: 35 and SEQ ID NO: 36. It was manufactured in the same way except for the point used.
[178]
[Table 1]
primer 5' -> 3' sequence
F_BamHI_GSH1 (SEQ ID NO: 34) GGTAGGATCCATGGGACTCTTAGCTTTTGGGCAC
R_GSH1_C86R (SEQ ID NO: 35) TTAGCCTC CCT AAGGGACGAATCCT
F_GSH1_C86R (SEQ ID NO: 36) CGTCCCTT AGG GAGGCTAACGATGT
R_XhoI_GSH1 (SEQ ID NO: 37) ATGACTCGAGTTAACATTTGCTTTCTATTGAAGGC
F_SpeI_GSH1_DW (SEQ ID NO: 38) TAGAACTAGTACTCCTTTTATTTCGGTTGTGAA
R_NcoI_GSH1_DW (SEQ ID NO: 39) GCTGCCATGGGAATAGTGTGAACCGATAACTGTGT
R_AL killer (SEQ ID NO: 40) GAGCAATGAACCCAATAACGAAATCTT
F_BR killer (SEQ ID NO: 41) CTTGACGTTCGTTCGACTGATGAG
[179]
The results of measuring the glutathione (GSH) concentration produced by culturing each strain prepared above for 26 hours are shown in Tables 2 and 3.
[180]
[Table 2]
[181]
[Table 3]
[182]
As a result of the experiment, it was confirmed that when cysteine ​​86 of the GSH1 protein was substituted with another amino acid, the glutathione production capacity was increased by up to 27% or more compared to the case containing the wild-type GSH1 protein.
[183]
Example 2-3: Additional mutagenesis and mutation sequence confirmation for increasing glutathione production capacity
[184]
In order to further improve the glutathione-producing ability of the CC02-2490 strain, mutations were induced in the following way.
[185]
After culturing the CC02-2490 strain on a solid medium, the broth was inoculated to obtain a culture solution, and UV was irradiated to the cells using a UV lamp. Thereafter, only mutant strains that formed colonies were isolated and obtained by spreading the UV-irradiated culture medium on a plate medium, and the sequences of the GSH1 coding region and the upstream region of the strain with the most improved glutathione production ability were analyzed.
[186]
As a result, GSH1 ORF upper -250(C→T), -252(G→A), -398(A→T), -399(A→C), -407(T→C), -409(T) →C) It was confirmed that a mutation occurred at the position. The strain was named the CC02-2544 strain and deposited with the Korean Culture Center of Microorganisms (KCCM), an international depository under the Budapest Treaty, on February 20, 2020, and was given an accession number KCCM12674P.
[187]
Example 2-4: Confirmation of glutathione production ability according to GSH1 promoter mutation
[188]
In order to compare the glutathione-producing ability according to the presence or absence of promoter mutation, the glutathione-producing ability of the CC02-2490 strain prepared in Example 2-1 and the CC02-2544 strain prepared in Example 2-3 was measured. As a control, the glutathione-producing ability of the wild-type CEN.PK1-D strain and CJ-5 strain was also measured and shown in Table 4 below.
[189]
[Table 4]
strain # 10hr 26hr 32hr
OD600 OD600 GSH
(mg/L) GSH content (%) OD600 GSH
(mg/L) GSH content (%)
CEN.PK1-D One 37.2 51.4 84.4 0.8 50.6 96.1 0.9
2 36.2 51.6 82.2 0.8 52.0 92.6 0.9
ave 36.7 51.5 83.3 0.8 51.3 94.4 0.9
CJ-5 One 30.2 47.8 266.4 2.7 56.8 267.1 2.3
2 30.0 53.4 256.1 2.3 55.6 266.0 2.3
ave 30.1 50.6 261.2 2.5 56.2 266.5 2.3
CC02-2490 One 36.4 63.4 375.4 2.9 63.2 368.6 2.8
2 37.4 64.8 379.8 2.8 61.6 379.2 3.0
ave 36.9 64.1 377.6 2.9 62.4 373.9 2.9
CC02-2544 One 37.8 66.2 477.7 3.5 64.4 482.0 3.6
2 38.8 64.4 484.2 3.7 60.6 477.0 3.8
ave 38.3 65.3 481.0 3.6 66.6 479.5 3.7
[190]
As a result of the experiment, it was confirmed that the glutathione production of the CC02-2544 strain was significantly increased to 508% compared to the wild-type CEN.PK1-D strain.
[191]
In addition, it was confirmed that CC02-2544 increased glutathione production by 128% or more compared to the parent strain CC02-2490 strain.
[192]
As a result, it was confirmed that glutathione production capacity can be increased through the promoter mutation of the GSH1 gene.
[193]
Example 3: GSH1 promoter mutation introduction experiment by strain
[194]
In order to confirm the effect of the promoter mutation according to the strain, the promoter mutation confirmed in Example 2-3 was introduced into the wild-type strain, CJ-5 strain, and CC02-2490 prepared in Example 2-1 to evaluate the glutathione production ability.
[195]
First, as a result of sequence alignment for mutation introduction, as a result of confirming the GSH1 ORF upstream sequence (SEQ ID NO: 2) of the CJ-5 strain, the same GSH1 promoter sequence as the Saccharomyces cerevisiae CEN KSD-Yc, YJM1450, YJM1401, YJM1307 strains was confirmed to have However, compared with the GSH1 ORF upstream sequence (SEQ ID NO: 1) of the wild-type strain ( Saccharomyces cerevisiae CEN.PK1-D), it was confirmed that the promoter of the CJ-5 strain had an adenine inserted at the -74 position.
[196]
Through this , in the GSH1 ORF upstream sequence of Saccharomyces cerevisiae CEN.PK1-D, the position corresponding to -250, -252, -398, -399, -407, -409 based on the GSH1 ORF upstream sequence of the CJ-5 strain is -249 , -251, -397, -398, -406, and -408 positions were identified through sequence alignment.
[197]
Next, the six mutations described above were introduced into the GSH1 ORF upstream region of each of Saccharomyces cerevisiae CEN.PK1-D, CJ-5 strain, and CC02-2490 strain.
[198]
Specifically, in order to construct a strain introducing the above-mentioned six mutations into the GSH1 ORF upstream region, Lee TH, et al. (J. Microbiol. Biotechnol. (2006), 16(6), 979-982) With reference to the disclosed contents, pWAL100 and pWBR100 plasmids were used.
[199]
After synthesizing the GSH1 ORF upstream ~ GSH1 ORF region fragment containing 6 kinds of mutations in the GSH1 ORF upstream region, PCR was performed using the primers of SEQ ID NO: 34 and SEQ ID NO: 37 to obtain the N-terminal BamHI restriction enzyme sequence and C- A fragment of the GSH1 ORF upstream region containing six types of mutations including the terminal XhoI restriction enzyme sequence was obtained. Thereafter, pWAL100 and the corresponding fragment were treated with BamHI and XhoI and then ligated to prepare a plasmid.
[200]
In addition, using the genomic DNA of the CJ-5 strain as a template, PCR using SEQ ID NO: 38 and SEQ ID NO: 39 was performed to secure 500 bp after the GSH1 ORF stop codon including the N-terminal SpeI and C-terminal NcoI restriction enzyme sequences, and SpeI and NcoI restriction enzymes were treated. Thereafter, one type of plasmid was prepared by ligation to pWBR100 treated with the same restriction enzyme.
[201]
Finally, to prepare a DNA fragment to be introduced into yeast, using the primers of SEQ ID NO: 34 and SEQ ID NO: 40 using the pWAL plasmid prepared above as a template, GSH1 ORF upstream ~ GSH1 ORF region sequence and KlURA3 containing 6 types of mutations Obtain a PCR product containing a part and use the primers of SEQ ID NO: 41 and SEQ ID NO: 39 using the pWBR plasmid as a template to obtain a PCR product containing a part of KlURA3 and 500 bp after the GSH1 ORF stop codon S. cerevisiae CEN.PK2-1D, S. cerevisiae CJ-5 and CC02-2490 strains were transformed at a molar ratio. PCR was carried out under the conditions of 5 minutes of heat denaturation at 95°C, 1 minute of binding at 53°C, and 1 minute of polymerization at 72°C for 1 minute per kb. , 1425) modified lithium acetate method was used. After washing the cells with an OD of 0.7 to 1.2 with lithium acetate/TE buffer twice, mix DNA and single stranded DNA (Sigma D-7656) together in lithium acetate/TE/40% PEG buffer at 30°C for 30 minutes, 42 After stationary incubation at ℃ for 15 minutes, cells were cultured on an SC (2% glucose) agar plate without uracil until colonies were seen. strains were obtained.
[202]
The GSH production of each strain is shown in Table 5 below.
[203]
[Table 5]
Host transition # 10hr 26hr 32hr
OD600 OD600 GSH
(mg/L) GSH content (%) OD600 GSH
(mg/L) GSH content (%)
CEN.PK1-D control One 37.2 51.4 84.4 0.8 50.6 96.1 0.9
2 36.2 51.6 82.2 0.8 52.0 92.6 0.9
ave 36.7 51.5 83.3 0.8 51.3 94.4 0.9
GSH1 promoter 6-point mutation One 36.6 49.2 110.3 1.1 51.8 131.0 1.2
2 36.4 52.0 114.6 1.1 52.8 135.6 1.2
ave 36.5 50.6 112.4 1.1 52.3 133.3 1.2
CJ-5 control One 30.2 47.8 266.4 2.7 56.8 267.1 2.3
2 30.0 53.4 256.1 2.3 55.6 266.0 2.3
ave 30.1 50.6 261.2 2.5 56.2 266.5 2.3
GSH1 promoter 6-point mutation One 30.2 53.0 332.8 3.0 54.2 325.5 2.9
2 29.2 54.2 360.9 3.2 58.8 354.6 2.9
ave 29.7 53.6 346.9 3.1 56.5 340.1 2.9
CC02-2490 control One 36.4 63.4 375.4 2.9 63.2 368.6 2.8
2 37.4 64.8 379.8 2.8 61.6 379.2 3.0
ave 36.9 64.1 377.6 2.9 62.4 373.9 2.9
GSH1 promoter 6-point mutation One 36.5 65.8 468.9 3.4 63.1 472.6 3.6
2 37.6 66.2 475.0 3.4 63.6 471.8 3.5
ave 37.1 66.0 472.0 3.4 63.35 472.2 3.6
[204]
As a result of the experiment, it was confirmed that the glutathione production increased by up to 141% depending on the presence or absence of promoter mutation in the same strain.
[205]
As a result, it was confirmed that it can lead to an increase in glutathione production capacity through the promoter mutation of the GSH1 gene.
[206]
Example 4: GSH1 promoter mutation introduction experiment (1)
[207]
Based on the contents confirmed in the previous example, an experiment was performed to find out whether the glutathione-producing ability was increased even if only some of the substitution positions were introduced with mutations.
[208]
Specifically, 2 points of mutations of -250 and -252 (-250(C→T) -252(G→A)) at the top of the ORF of GSH1, 4 points of mutations of -398, -399, -407 and -409 (- 398(A→T), -399(A→C), -407(T→C), -409(T→C)) were introduced into strains CEN.PK1-D, CJ-5, and CC02-2490, respectively. . (In the case of introducing a mutation in CEN.PK1-D, the mutation was introduced at the corresponding positions -249, -251, -397, -398, -406, -408, and the contents described in the Examples below are the same. ) After gene synthesis of the GSH1 ORF upstream ~ GSH1 ORF region fragment containing the 2 or 4 point mutations in the GSH1 ORF upstream region, PCR was performed using the primers of SEQ ID NO: 34 and SEQ ID NO: 37 to limit N-terminal BamHI A strain was prepared in the same manner as described in Example 3, except that the GSH1 ORF upstream region fragment containing 2 or 4 mutations including the enzyme sequence and the C-terminal XhoI restriction enzyme sequence was secured.
[209]
The experimental results are shown in Tables 6 to 8 below.
[210]
[Table 6]
Host transition # 10hr 26hr 32hr
OD600 OD600 GSH
(mg/L) GSH
content (%) OD600 GSH
(mg/L) GSH
content
(%)
CEN.PK1-D control One 37.2 51.4 84.4 0.8 50.6 96.1 0.9
2 36.2 51.6 82.2 0.8 52.0 92.6 0.9
ave 36.7 51.5 83.3 0.8 51.3 94.4 0.9
GSH1 promoter 2-point mutation One 37.2 50.6 109.8 1.1 53.6 132.0 1.2
2 38.8 48.0 106.9 1.1 54.8 122.0 1.1
ave 38.0 49.3 108.3 1.1 54.2 127.0 1.1
GSH1 promoter 4-point mutation One 37.2 51.4 100.6 0.9 54.2 105.3 0.9
2 37.0 50.8 102.1 1.0 53.2 105.4 1.0
ave 37.1 51.1 101.3 1.0 53.7 105.3 1.0
GSH1 promoter 6-point mutation One 36.6 49.2 110.3 1.1 51.8 131.0 1.2
2 36.4 52.0 114.6 1.1 52.8 135.6 1.2
ave 36.5 50.6 112.4 1.1 52.3 133.3 1.2
[211]
[Table 7]
Host transition # 10hr 26hr 32hr
OD600 OD600 GSH
(mg/L) GSH
content (%) OD600 GSH
(mg/L) GSH
content
(%)
CJ-5 control One 30.2 47.8 266.4 2.7 56.8 267.1 2.3
2 30.0 53.4 256.1 2.3 55.6 266.0 2.3
ave 30.1 50.6 261.2 2.5 56.2 266.5 2.3
GSH1 promoter 2-point mutation One 30.2 53.8 297.6 2.7 54.4 298.8 2.7
2 30.4 57.6 299.0 2.5 53.0 292.4 2.7
ave 30.3 55.7 298.3 2.6 53.7 295.6 2.7
GSH1 promoter 4-point mutation One 31.2 52.4 328.8 3.0 57.2 326.6 2.8
2 40.6 57.8 345.8 2.9 66.0 344.9 2.5
ave 35.9 55.1 337.3 3.0 61.6 335.7 2.7
GSH1 promoter 6-point mutation One 30.2 53.0 332.8 3.0 54.2 325.5 2.9
2 29.2 54.2 360.9 3.2 58.8 354.6 2.9
ave 29.7 53.6 346.9 3.1 56.5 340.1 2.9
[212]
[Table 8]
Host transition # 10hr 26hr 32hr
OD600 OD600 GSH
(mg/L) GSH
content (%) OD600 GSH
(mg/L) GSH
content
(%)
CC02-2490

control One 36.4 63.4 375.4 2.9 63.2 368.6 2.8
2 37.4 64.8 379.8 2.8 61.6 379.2 3.0
ave 36.9 64.1 377.6 2.9 62.4 373.9 2.9
GSH1 promoter 2-point mutation One 37.0 64.8 415.0 3.1 66.6 419.5 3.1
2 37.6 65.4 452.4 3.4 64.6 445.7 3.3
ave 37.3 65.1 433.7 3.2 65.6 432.6 3.2
GSH1 promoter 4-point mutation One 37.8 65.4 455.4 3.4 59.6 452.1 3.7
2 37.6 65.8 459.8 3.4 63.4 455.1 3.5
ave 37.7 65.6 457.6 3.4 66.6 453.6 3.6
GSH1 promoter 6-point mutation One 36.5 65.8 468.9 3.4 63.1 472.6 3.6
2 37.6 66.2 475.0 3.4 63.6 471.8 3.5
ave 37.1 66.0 472.0 3.4 63.35 472.2 3.6
[213]
[214]
As a result of the experiment, 2-point variation (-250(C→T) -252(G→A)) or 4-point variation (-398(A→T), -399(A→C), -407(T→C) , -409(T→C)) respectively, it was confirmed that the glutathione production capacity increased compared to the strain without the mutation in the promoter region in all cases, and it was found that the production increased by up to 135%.
[215]
Through this, it can be seen that the promoter mutation position developed in the present application greatly increases the glutathione production ability even if all of the six mutation positions identified at the beginning are mutated as well as only some of them are mutated.
[216]
Example 5: GSH1 promoter mutation introduction experiment (2)
[217]
Based on the contents confirmed in the previous example, an experiment was performed to see if the glutathione-producing ability was increased even if a mutation was introduced only at some of the substitution positions. Specifically, -250(C→T) mutation (1-point mutation (1)) or -252(G→A) mutation (1-point mutation (2)), and both of the two mutations, were defined as CEN.PK1-D and It was introduced into the CJ-5 strain and the glutathione-producing ability was measured and shown in Tables 9 and 10 below.
[218]
To this end, the GSH1 ORF upstream ~ GSH1 ORF region fragment containing the one-point or two-point mutation was synthesized in the GSH1 ORF upstream region, and PCR was performed using the primers of SEQ ID NO: 34 and SEQ ID NO: 37 to perform N-terminal BamHI A strain was prepared in the same manner as described in Example 3, except that a fragment of the GSH1 ORF upstream region containing 1 or 2 mutations including the restriction enzyme sequence and the C-terminal XhoI restriction enzyme sequence was secured.
[219]
[Table 9]
Host transition # 10hr 26hr 32hr
OD600 OD600 GSH
(mg/L) GSH
content (%) OD600 GSH
(mg/L) GSH
content (%)
CJ-5 control One 30.2 47.8 266.4 2.7 56.8 267.1 2.3
2 30.0 53.4 256.1 2.3 55.6 266.0 2.3
ave 30.1 50.6 261.2 2.5 56.2 266.5 2.3
GSH1 promoter 1-point mutation (1) One 30.8 53.2 253.9 2.3 53.2 268.9 2.5
2 30.8 53.0 257.0 2.4 53.6 269.6 2.4
ave 30.8 53.1 255.4 2.3 53.4 269.3 2.4
GSH1 promoter 1-point mutation (2) One 28.8 52.2 253.9 2.4 53.2 268.9 2.5
2 29.8 51.0 257.0 2.4 53.6 269.6 2.4
ave 29.3 51.6 255.4 2.4 53.4 269.3 2.4
GSH1 promoter 2-point mutation One 30.2 53.8 297.6 2.7 54.4 298.8 2.7
2 30.4 57.6 299.0 2.5 53.0 292.4 2.7
ave 30.3 55.7 298.3 2.6 53.7 295.6 2.7
[220]
[Table 10]
Host transition # 10hr 26hr 32hr
OD600 OD600 GSH
(mg/L) GSH
content (%) OD600 GSH
(mg/L) GSH
content (%)
CEN.PK1-D control One 37.2 51.4 84.4 0.8 50.6 96.1 0.9
2 36.2 51.6 82.2 0.8 52.0 92.6 0.9
ave 36.7 51.5 83.3 0.8 51.3 94.4 0.9
GSH1 promoter 1-point mutation (1) One 37.5 53.8 85.0 0.8 52.2 99.2 0.9
2 36.8 53.7 94.5 0.9 54.1 95.5 0.9
ave 37.2 53.8 89.7 0.8 53.2 97.3 0.9
GSH1 promoter 1-point mutation (2) One 37.8 58.8 95.0 0.8 53.2 91.0 0.8
2 37.2 57.2 90.5 0.8 50.8 105.5 1.0
ave 37.5 58.0 92.7 0.8 52.0 98.2 0.9
GSH1 promoter 2-point mutation One 37.2 50.6 109.8 1.1 53.6 132.0 1.2
2 38.8 48.0 106.9 1.1 54.8 122.0 1.1
ave 38.0 49.3 108.3 1.1 54.2 127.0 1.1
[221]
As a result of the experiment, it was found that the glutathione-producing ability was increased even when only a part of the mutation was introduced.
[222]
Through this, it can be seen that the promoter mutation position discovered in the present application greatly increases the glutathione production ability even if all of the six mutation positions discovered at the beginning are mutated as well as only some of them are mutated.
[223]
Example 6: GSH1 promoter mutation introduction experiment (3)
[224]
Based on the contents confirmed in the previous example, an experiment was performed to see if the glutathione-producing ability was increased even if a mutation was introduced only at some of the substitution positions.
[225]
Specifically, 4 mutations of -398, -399, -407 and -409 (-398 (A→T), -399 (A→C), -407 (T→C), -409 (T→C))) , alone or in combination, to introduce mutations.
[226]
The contents of each mutation are as follows.
[227]
1) 1 point shift (1): GSH1 -398 (A→T)
[228]
2) 1 point mutation (2): GSH1 -399 (A→C)
[229]
3) 1 point mutation (3): GSH1 -407 (T→C)
[230]
4) 1 point shift (4): GSH1 -409 (T→C)
[231]
5) 2-point transition (1): GSH1 -398(A→T) -399(A→C)
[232]
6) 2-point transition (2): GSH1 -398(A→T) -407(T→C)
[233]
7) 2-point transition (3): GSH1 -398(A→T) -409(T→C)
[234]
8) 2-point transition (4): GSH1 -399(A→C) -407(T→C)
[235]
9) 2-point transition (5): GSH1 -399(A→C) -409(T→C)
[236]
10) 2-point transition (6): GSH1 -407(T→C) -409(T→C)
[237]
11) 4-point mutation: GSH1 -398(A→T) -399(A→C) -407(T→C) -409(T→C)
[238]
To this end, the GSH1 ORF upstream ~ GSH1 ORF region fragment containing the 1-point, 2-point, or 4-point mutation in the GSH1 ORF upstream region was gene synthesized, and then PCR using the primers of SEQ ID NO: 34 and SEQ ID NO: 37 was performed. -The same method as described in Example 3, except that the GSH1 ORF upstream region fragment containing 1, 2, or 4 mutations including the terminal BamHI restriction enzyme sequence and the C-terminal XhoI restriction enzyme sequence was obtained strains were prepared.
[239]
The results of confirming the glutathione-producing ability of the strain are shown in Tables 11 and 12 below.
[240]
[Table 11]
[241]
[Table 12]
[242]
As a result of the experiment, it was confirmed that the glutathione-producing ability was increased compared to the strain without the mutation in the promoter region even when all four-point mutations were introduced as well as only some of them. In particular, 5) Two-point transition (1): GSH1 -398(A→T) -399(A→C), 10) Two-point transition (6): GSH1 -407(T→C) -409(T→C) ), the glutathione production capacity was greatly increased compared to the strain without mutation in the promoter region.
[243]
Through this, it can be seen that the promoter mutation position discovered in the present application greatly increases the glutathione production ability even if all of the six mutation positions discovered at the beginning are mutated as well as only some of them are mutated.
[244]
From the above description, those skilled in the art to which the present application pertains will understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application should be construed as including all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description and equivalent concepts thereof.
[245]

[246]

[247]

Claims
[Claim 1]
In the polynucleotide sequence of SEQ ID NO: 1 or 2, any one or more nucleotides selected from the group consisting of nucleotides 92, 94, 102, 103, 249 and 251 in the polynucleotide sequence are substituted with other nucleotides, a poly having promoter activity nucleotides.
[Claim 2]
The polynucleotide according to claim 1, wherein in the polynucleotide having promoter activity, nucleotides 249 and 251 are substituted with other nucleotides.
[Claim 3]
The polynucleotide of claim 1, wherein nucleotides 92, 94, 102 and 103 of the polynucleotide having promoter activity are substituted with other nucleotides.
[Claim 4]
The polynucleotide of claim 1, wherein nucleotides 92, 94, 102, 103, 249 and 251 of the polynucleotide having promoter activity are substituted with other nucleotides.
[Claim 5]
The polynucleotide according to claim 1, wherein the polynucleotide having promoter activity is composed of any one polynucleotide sequence selected from SEQ ID NOs: 3 to 32.
[Claim 6]
A composition for gene expression comprising the polynucleotide of any one of claims 1 to 5.
[Claim 7]
A vector comprising a gene encoding the polynucleotide of any one of claims 1 to 5 and a target protein.
[Claim 8]
The vector according to claim 7, wherein the target protein is a polypeptide having glutamate-cysteine ​​ligase activity.
[Claim 9]
A microorganism of the genus Saccharomyces comprising the polynucleotide of any one of claims 1 to 5, a polynucleotide comprising a gene encoding the polynucleotide and a target protein, or a vector comprising the same.
[Claim 10]
The microorganism of the genus Saccharomyces according to claim 9, wherein the target protein is a polypeptide having glutamate-cysteine ​​ligase activity.
[Claim 11]
A method for producing glutathione, comprising the step of culturing the microorganism of claim 9 in a medium.
[Claim 12]
The method according to claim 11, further comprising recovering glutathione from at least one selected from the cultured microorganism, the dried product of the microorganism, the extract of the microorganism, the culture of the microorganism, and the lysate of the microorganism. Way.
[Claim 13]
In the polynucleotide sequence of SEQ ID NO: 1 or 2, any one or more nucleotides selected from the group consisting of nucleotides 92, 94, 102, 103, 249 and 251 are substituted with other nucleotides in the polynucleotide sequence as a promoter purpose.

Documents

Application Documents

# Name Date
1 202217037483-STATEMENT OF UNDERTAKING (FORM 3) [29-06-2022(online)].pdf 2022-06-29
2 202217037483-SEQUENCE LISTING(PDF) [29-06-2022(online)].pdf 2022-06-29
3 202217037483-SEQUENCE LISTING [29-06-2022(online)].txt 2022-06-29
4 202217037483-REQUEST FOR EXAMINATION (FORM-18) [29-06-2022(online)].pdf 2022-06-29
5 202217037483-FORM 18 [29-06-2022(online)].pdf 2022-06-29
6 202217037483-FORM 1 [29-06-2022(online)].pdf 2022-06-29
7 202217037483-DECLARATION OF INVENTORSHIP (FORM 5) [29-06-2022(online)].pdf 2022-06-29
8 202217037483-COMPLETE SPECIFICATION [29-06-2022(online)].pdf 2022-06-29
9 202217037483.pdf 2022-06-30
10 202217037483-Proof of Right [02-07-2022(online)].pdf 2022-07-02
11 202217037483-FORM-26 [02-07-2022(online)].pdf 2022-07-02
12 202217037483-certified copy of translation [02-07-2022(online)].pdf 2022-07-02
13 202217037483-certified copy of translation [08-07-2022(online)].pdf 2022-07-08
14 202217037483-FORM 3 [08-11-2022(online)].pdf 2022-11-08