Sign In to Follow Application
View All Documents & Correspondence

Novel Promoter And L Amino Acid Production Method Using Same

Abstract: The present application relates to a novel promoter and an L-amino acid production method using same and, more specifically, to a novel polynucleotide having promoter activity, a vector and a Corynebacterium sp. microorganism comprising same, an L-amino acid production method using the microorganism, a method for preparing a fermented compound, and the fermented compound.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
20 February 2020
Publication Number
37/2020
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
sunita@skslaw.org
Parent Application
Patent Number
Legal Status
Grant Date
2024-04-18
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu, Seoul 04560

Inventors

1. CHOI, Sun Hyoung
330, Dongho-ro, Jung-gu, Seoul 04560
2. CHANG, Jin Sook
330, Dongho-ro, Jung-gu, Seoul 04560
3. KIM, Hyung Joon
330, Dongho-ro, Jung-gu, Seoul 04560
4. YOON, Byoung Hoon
330, Dongho-ro, Jung-gu, Seoul 04560
5. LEE, Ji Yeon
330, Dongho-ro, Jung-gu, Seoul 04560
6. CHOI, Yunjung
330, Dongho-ro, Jung-gu, Seoul 04560

Specification

Specification
Title of the invention: Novel promoter and L-amino acid production method using the same
Technical field
[One]
The present application relates to a novel promoter and a method for producing L-amino acids using the same, and more particularly, a novel polynucleotide having promoter activity, a vector containing the same, and a microorganism of the genus Corynebacterium, and the L-amino acid using the microorganism. It relates to a production method, a method of preparing a fermentation composition, and the fermentation composition.
[2]
Background
[3]
Glutamic acid is a representative amino acid produced by fermentation and has a unique taste, so it is one of the important amino acids widely used in the field of food, pharmaceuticals, and other animal feed.
[4]
[5]
The usual method for producing glutamic acid is mainly produced through fermentation using Brevibacterium or Coryneform bacteria including the genus Corynebacterium and its mutants (Amino Acid Fermentation, Gakkai Shuppan Center). : 195-215, 1986) in addition, E. coli ( Escherichia coli ), Bacillus subtilis ( Bacillus ), actinomycetes ( Streptomyces ), Penny Solarium room ( Penicillum ), a keurep when Ella ( Klebsiella ), air Winiah ( Erwinia in) Oh panto ( Pantoea ) and the like are known methods of using microorganisms such as the genus (US Patent Nos. 3,220,929, 6,682,912). When producing glutamic acid through microbial fermentation, various substances including organic acids in addition to L-glutamic acid are mixed in the fermented product.
[6]
[7]
The above organic acids are acidic organic compounds, and include lactic acid, acetic acid, formic acid, citric acid, oxalic acid, uric acid, and the like. Organic acids in food exhibit acidity and umami, and have the effect of preventing spoilage by lowering the pH of food. Typically, lactic acid is known to occupy the largest proportion of organic acids produced through microbial fermentation.
[8]
[9]
However, as the specific gravity of lactic acid produced by fermentation increases, the sour taste in the fermentation product increases, so there is a concern that palatability may decrease. Therefore, it is necessary to control the amount of lactic acid produced in the fermentation product produced through microbial fermentation.
[10]
Detailed description of the invention
Technical challenge
[11]
As a result of trying to reduce the ability of the microorganisms producing glutamic acid to produce organic acids, the present inventors developed a new polynucleotide having the promoter activity of the present application, which increased the ability of the strain to produce glutamic acid and confirmed that the ability to produce lactic acid can be reduced. This application was completed.
[12]
Means of solving the task
[13]
One object of the present application is to provide a polynucleotide having promoter activity in which the 37th nucleotide of the nucleotide sequence represented by SEQ ID NO: 2 is substituted with G.
[14]
Another object of the present application is the polynucleotide; And it is to provide a vector comprising a gene encoding the target protein operably linked to the polynucleotide.
[15]
Another object of the present application is the polynucleotide; And it is to provide a microorganism of the genus Corynebacterium comprising a gene encoding a protein of interest operably linked to the polynucleotide.
[16]
Another object of the present application is the step of culturing the microorganisms of the genus Corynebacterium in a medium; And it is to provide a method for producing a target material comprising the step of recovering the target material from the medium.
[17]
Another object of the present application is to provide a method for producing a fermentation composition comprising the step of fermenting the microorganisms of the genus Corynebacterium in a medium.
[18]
Another object of the present application is to provide a fermentation composition prepared by the above method.
[19]
Effects of the Invention
[20]
The novel promoter of the present application is introduced into a microorganism that produces amino acids, so that the amount of amino acid produced by the microorganism is increased and the amount of organic acid is decreased. Specifically, when producing glutamic acid using the novel promoter of the present application, the taste and palatability of the fermented product may be improved by adjusting the amount of glutamic acid and the amount of organic acid in the fermented product.
[21]
Best mode for carrying out the invention
[22]
This is described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be seen that the scope of the present application is limited by the specific description described below.
[23]
[24]
In order to achieve the above object, one aspect of the present application provides a polynucleotide having promoter activity in which the 37th nucleotide of the nucleotide sequence represented by SEQ ID NO: 2 is substituted with G.
[25]
[26]
In the present application, the term "nucleotide sequence represented by SEQ ID NO: 2" may mean a part of the promoter sequence of a gene encoding lactate dehydrogenase (LDH).
[27]
In this case, the term "lactate dehydrogenase" is an enzyme that generates lactate, that is, lactic acid using pyruvate as a substrate, and may be referred to as "LDH" in the present specification. Specifically, the lactate dehydrogenase gene may include the nucleotide sequence of SEQ ID NO: 3, and the protein thereof may include the amino acid sequence of SEQ ID NO: 4, but is not limited thereto.
[28]
[29]
In the present application, the term "promoter" includes a binding site for a polymerase and has an activity of initiating transcription of a promoter gene into mRNA, a non-translated nucleotide sequence upstream of the coding region, that is, a polymerase It refers to a region of DNA that binds to initiate transcription of a gene. The promoter may be located at the 5'site of the mRNA transcription initiation site. In this case, the target gene of the promoter may be lactate dehydrogenase, but is not limited thereto.
[30]
[31]
The polynucleotide of the present application is the nucleotide sequence represented by SEQ ID NO: 2, that is, the promoter sequence of the lactate dehydrogenase gene is mutated, and specifically, the mutation is the 37th nucleotide of the sequence, T is substituted with G. Can be. Accordingly, the polynucleotide may consist of the nucleotide sequence of SEQ ID NO: 1 (consist of).
[32]
In this case, the term "mutation" refers to a genetically or non-genetically stable phenotypic change, and may be referred to as "mutation" in the present specification.
[33]
[34]
Specifically, the polynucleotide may have a mutated (increased or decreased) promoter activity compared to a polynucleotide that does not contain the mutation. Accordingly, it is possible to control (increase or decrease) the expression of the target gene operably linked to the polynucleotide and the activity of the protein encoded by the target gene, and further control the expression of genes other than the target gene.
[35]
[36]
For the purposes of the present application, the polynucleotide may be for weakening the activity of lactate dehydrogenase.
[37]
In addition, the polynucleotide may be for increasing the amount of glutamic acid and/or reducing the amount of lactic acid.
[38]
It was known that the lactate dehydrogenase was involved in the production of lactic acid, but the association with the production of glutamic acid was not known, and was first identified by the present inventors. In particular, the effect of reducing the activity of lactate dehydrogenase by the mutation of the promoter of lactate dehydrogenase as described above, and thus increasing the amount of glutamic acid and reducing the amount of lactic acid produced was first identified by the present inventors.
[39]
In this case, the term "glutamic acid" (L-glutamic acid, L-glutamate) is a kind of amino acid and is classified as a non-essential amino acid. It is known as the most common excitatory neurotransmitter in the central nervous system, and its monosodium glutamate (MSG) has been developed and widely used as a seasoning because it has a rich taste. It is generally produced through fermentation of glutamic acid-producing microorganisms.
[40]
In addition, the term "lactic acid" is a kind of organic acid having a sour taste, and is called lactic acid, lactic acid, and the like. For food, it is used as an acidifying agent for fruit extract, syrup, and soft drinks, and is also used to prevent the propagation of spoilage bacteria in the early stages of fermentation of liquor. In general, it is produced through fermentation of lactic acid-producing microorganisms, and if excessively produced, the quality of the fermented product may be deteriorated due to excessive acidity, so the concentration of lactic acid needs to be appropriately adjusted during cultivation.
[41]
[42]
Specifically, the polynucleotide may be composed of the nucleotide sequence of SEQ ID NO: 1.
[43]
In addition, the nucleotide sequence of the present application may be modified by a conventionally known mutagenesis method, for example, a direct evolution method and a site-directed mutagenesis method.
[44]
Therefore, the polynucleotide is at least 60% or more, specifically 70% or more, more specifically 80% or more, even more specifically 83% or more, 84% or more, 88% of the nucleotide sequence of SEQ ID NO: 1 It may include a polynucleotide comprising a nucleotide sequence having homology of at least 90%, at least 93%, at least 95%, or at least 97%. If a polynucleotide sequence having biological activity substantially identical to or corresponding to the nucleotide sequence of SEQ ID NO: 1 as a sequence homologous to the sequence, some sequences have a deleted, modified, substituted or added polynucleotide sequence. It is obvious that it is included in the scope of this application.
[45]
[46]
In the present application, the term "homology" means the degree to which it matches a given nucleotide sequence and may be expressed as a percentage. In the present specification, its homologous sequence having the same or similar activity as a given nucleotide sequence is indicated as "% homology". Homology to this nucleotide sequence is determined, for example, by the algorithm BLAST by literature [see Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on this algorithm BLAST, a program called BLASTN or BLASTX has been developed (see: http://www.ncbi.nlm.nih.gov).
[47]
The “stringent conditions” refer to conditions that allow specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, among genes with high homology, genes with homology of 60% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly 99% or more Under conditions that hybridize to each other and do not hybridize to genes with lower homology, or to wash conditions for general Southern hybridization, 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1 At a salt concentration and temperature corresponding to% SDS, more specifically 68° C., 0.1×SSC, and 0.1% SDS, the conditions for washing once, specifically two to three times, can be enumerated. Hybridization requires that two nucleotides have a complementary sequence, although a mismatch between bases is possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include substantially similar polynucleotide sequences as well as isolated polynucleotide fragments that are complementary to the entire sequence.
[48]
Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the above-described conditions. In addition, the Tm value is 60 ℃, 63 ℃? Alternatively, it may be 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose. The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[49]
[50]
In particular, the expression of the nucleotide sequence of SEQ ID NO. It does not exclude cases of addition, and/or deletion, and/or variation.
[51]
For example, the polynucleotide having a promoter activity consisting of the nucleotide sequence represented by SEQ ID NO: 1 is hybridized with a complementary sequence to all or part of the nucleotide sequence of SEQ ID NO: 1 under stringent conditions to achieve the promoter activity of the present application. Any nucleotide sequence may be included without limitation.
[52]
[53]
Furthermore, the polynucleotide of the present application may be operably linked with a gene encoding a protein of interest.
[54]
[55]
In the present application, the term "gene expression control sequence" refers to a sequence capable of expressing a target gene that includes the polynucleotide of the present application and is operably linked thereto.
[56]
In the present application, the term "operatively linked" means that the polynucleotide having the promoter activity of the present application is functionally linked to the gene sequence to initiate and mediate transcription of the gene of interest. The operable linkage may be prepared using a gene recombination technique known in the art, and site-specific DNA cleavage and linkage may be prepared using a cleavage and linkage enzyme in the art, but is not limited thereto.
[57]
[58]
Furthermore, the gene expression control sequence of the present application includes an arbitrary operator sequence for controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, and a DNA controlling the termination of transcription and translation in addition to a promoter for transcribing a gene. It may contain more.
[59]
For example, the regulatory sequence suitable for prokaryotes may further include a ribosome binding site in addition to the promoter, but is not limited thereto. The polynucleotide having the promoter activity of the present application may constitute a sequence for regulating gene expression as described above as needed by a person skilled in the art.
[60]
[61]
In the present application, the target gene refers to a gene encoding a target protein to be regulated in a microorganism.
[62]
For example, it may be a gene involved in the production of a product selected from the group consisting of amino acids (glutamic acid, etc.), organic acids (lactic acid, etc.), and combinations thereof, but is not limited thereto. Specifically, the gene may be a gene encoding an enzyme related to amino acid (glutamic acid) biosynthesis and/or a gene encoding an enzyme related to organic acid (lactic acid, etc.) biosynthesis, but is not limited thereto. More specifically, the gene may be a gene encoding lactate dehydrogenase (LDH), but is not limited thereto. The sequence of the gene encoding LDH can be easily obtained by those skilled in the art through a known database such as GenBank of the National Institutes of Health.
[63]
[64]
For example, the gene expression control sequence of the present application may be operably linked to a gene sequence encoding LDH, thereby increasing the amount of glutamic acid produced in the microorganism and reducing the amount of lactic acid produced.
[65]
[66]
Another aspect of the present application provides a vector including the polynucleotide and a gene encoding a protein of interest operably linked to the polynucleotide.
[67]
The polynucleotide is as described above.
[68]
[69]
Specifically, the target protein may be lactate dehydrogenase (LDH).
[70]
[71]
In the present application, the term "vector" refers to an artificial DNA molecule containing a genetic material so as to express a gene of interest in a suitable host, the polynucleotide or a suitable gene expression control sequence; And it means a DNA preparation comprising the nucleotide sequence of the gene encoding the protein of interest operably linked thereto.
[72]
[73]
The vector used in the present application is not particularly limited as long as it can be expressed in the host cell, and the host cell may be transformed using any vector known in the art. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
[74]
For example, pWE15, M13, λLB3, λBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and pBR-based, pUC-based, pBluescriptII-based plasmid vector , pGEM system, pTZ system, pCL system, pET system, etc. can be used.
[75]
In addition, it is possible to replace the endogenous promoter in the chromosome with a polynucleotide having the promoter activity of the present application through the vector for chromosome insertion into the host cell. For example, pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 vectors, etc. may be used, but are not limited thereto.
[76]
In addition, the insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, by homologous recombination.
[77]
Since the vector of the present application can be inserted into a chromosome by causing homologous recombination, it may additionally include a selection marker to confirm whether the chromosome is inserted. The selection marker is used to select cells transformed with a vector, that is, to confirm whether a polynucleotide has been inserted, and confer a selectable phenotype such as drug resistance, auxotrophic resistance, resistance to cytotoxic agents, or expression of surface proteins. Markers can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
[78]
[79]
In the present application, the term "transformation" means introducing a vector including the polynucleotide or gene expression control sequence and the gene encoding the target protein into a host cell, so that the gene can be expressed in the host cell. . Furthermore, as long as the target gene can be expressed in the host cell, the transformed polynucleotide and the gene encoding the target protein include all cases regardless of whether it is located on the chromosome of the host cell or outside the chromosome. can do.
[80]
[81]
The transformation method includes all methods of introducing the gene expression control sequence and the gene encoding the target protein into the cell, and may be performed by selecting an appropriate standard technique as known in the art according to the host cell. . For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and Lithium acetate-DMSO method, etc., but is not limited thereto.
[82]
[83]
Another aspect of the present application is the polynucleotide; And it provides a microorganism of the genus Corynebacterium, comprising a gene encoding a protein of interest operably linked to the polynucleotide.
[84]
The polynucleotide and the gene encoding the target protein operably linked to the polynucleotide are as described above.
[85]
[86]
In the present application, the term "microorganism" includes wild-type microorganisms or microorganisms that have undergone natural or artificial genetic modification, and a specific mechanism is weakened due to reasons such as insertion of an external gene or the enhancement or attenuation of the activity of an endogenous gene. It is a concept that includes all microorganisms that have become or fortified.
[87]
[88]
In the present application, the microorganism may include the polynucleotide, and specifically, may include a gene that is operably linked to the polynucleotide and/or the polynucleotide and encodes a target protein. Alternatively, the microorganism may include a vector including the polynucleotide or gene expression control sequence and a gene encoding the target protein, but is not limited thereto. In addition, the polynucleotide, the gene encoding the target protein, and the vector may be introduced into the microorganism by transformation, but are not limited thereto. Furthermore, in the microorganism, as long as the gene can be expressed, the gene encoding the polynucleotide and the protein of interest is located on a chromosome or outside the chromosome.
[89]
[90]
For the purposes of the present application, a microorganism including a gene encoding the polynucleotide and the protein of interest may have an increased amount of glutamic acid and a decreased amount of lactic acid.
[91]
For example, in the microorganism, the polynucleotide may have a weakened activity of lactate dehydrogenase.
[92]
[93]
In the present application, the microorganism may be included without limitation as long as it is a microorganism capable of operating as a promoter by introducing the polynucleotide having the promoter activity of the present application.
[94]
Specifically, the microorganism may be a microorganism of the genus Corynebacterium, more specifically Corynebacterium glutamicum or Corynebacterium flavum , and most specifically Corynebacterium flavum It may be Nebacterium glutamicum, but is not limited thereto.
[95]
[96]
Another aspect of the present application is the step of culturing the microorganisms of the genus Corynebacterium in a medium; And it provides a method for producing a target material comprising the step of recovering the target material from the medium.
[97]
The polynucleotide and microorganism are as described above.
[98]
[99]
In the present application, the target substance may be an amino acid. Specifically, the amino acid may be an L-form amino acid unless otherwise stated, and glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine , Arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, and may be selected from the group consisting of a combination thereof, but is not limited thereto.
[100]
More specifically, the amino acid may be glutamic acid, but is not limited thereto.
[101]
[102]
In the present application, the term "culture" refers to growing microorganisms in an appropriately artificially controlled environmental condition. In the present application, a method of producing a target substance using a microorganism containing the polynucleotide may be performed using a method widely known in the art. Specifically, the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto. The medium used for cultivation must meet the requirements of the specific strain in an appropriate manner. Culture media for Corynebacterium strains are known (eg, Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington DC, USA, 1981).
[103]
Sugar sources that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid. , Fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
[104]
Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen source may also be used individually or as a mixture, but is not limited thereto.
[105]
Personnel that may be used may include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or salts containing the corresponding sodium. In addition, the culture medium may contain a metal salt such as magnesium sulfate or iron sulfate required for growth. Finally, essential growth substances such as amino acids and vitamins can be used in addition to the above substances. In addition, precursors suitable for the culture medium may be used. The above-described raw materials may be added batchwise or continuously to the culture during the culture process by an appropriate method.
[106]
During the culture of the microorganism, a basic compound such as sodium hydroxide, potassium hydroxide, ammonia, or an acid compound such as phosphoric acid or sulfuric acid may be used in an appropriate manner to adjust the pH of the culture. In addition, foaming can be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. Oxygen or an oxygen-containing gas (eg, air) may be injected into the culture to maintain an aerobic condition.
[107]
The temperature of the culture (medium) may be usually 20°C to 45°C, specifically 25°C to 40°C. The cultivation time may be continued until the desired amount of the target substance is obtained, but may be specifically 10 to 160 hours.
[108]
[109]
Recovery of the target material from the culture (medium) can be separated and recovered by a conventional method known in the art. In this separation method, methods such as centrifugation, filtration, chromatography, and crystallization may be used. For example, the culture medium may be centrifuged at a low speed to remove biomass, and the obtained supernatant may be separated through ion exchange chromatography, but is not limited thereto. As another method, the process of separating and filtering the cells from the culture (medium) may be performed, and the target material may be recovered without a separate purification process. As another method, the recovery step may further include a purification process.
[110]
[111]
Another aspect of the present application provides a method for producing a fermentation composition comprising the step of fermenting the microorganisms of the genus Corynebacterium in a medium.
[112]
Another aspect of the present application provides a fermentation composition prepared by the above method.
[113]
The polynucleotide and the microorganism are as described above, and the step of culturing the microorganism in a medium is also as described above.
[114]
[115]
In the present application, the term "the fermentation composition" refers to a composition obtained by culturing the microorganism of the present application. Further, the fermentation composition may include a composition in the form of a liquid or powder obtained after culturing the microorganism and then undergoing an appropriate post-treatment process. In this case, an appropriate post-treatment process may include, for example, a process of culturing the microorganism, a process of removing cells, a process of concentration, a process of filtration, and a process of mixing a carrier, and may further include a process of drying. In some cases, the post-treatment process may not include a purification process. The fermentation composition may produce an optimum taste by including a composition in which the amount of glutamic acid is increased and the amount of lactic acid is decreased by culturing the microorganism of the present application.
[116]
In addition, "the fermentation composition" does not exclude seasoning products (eg, broth powder products, snack seasoning products, etc.) containing the above liquid or powdered composition. Furthermore, "the fermentation composition" refers to the case of additionally mixing a material obtained by a non-fermentation process and/or another material obtained by a non-natural process, as long as it includes a composition obtained by culturing the microorganism of the present application. Do not exclude
[117]
Mode for carrying out the invention
[118]
Hereinafter, the present application will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited to these examples.
[119]
[120]
Example 1. Selection of mutant strains with decreased lactate production
[121]
Example 1-1. Random mutagenesis through UV irradiation
[122]
In order to select the mutant strains whose ability to produce glutamic acid, which is the target product of fermentation, is improved, and the ability to produce lactic acid that decreases the palatability of the fermentation product , Spread on a nutrient medium containing and incubated at 30° C. for 16 hours. Hundreds of colonies thus obtained were subjected to UV irradiation at room temperature to induce random mutations in the genome of the strain.
[123]
[124]
Example 1-2. Mutagenic strain fermentation titer experiment and strain selection
[125]
Thereafter, fermentation titer experiments were performed on the mutant strains in which random mutations were induced.
[126]
Each colony was subcultured in a nutrient medium and then incubated for 5 hours in a fermentation medium. Then, 25% tween 40 was added to each medium at a concentration of 0.4%, and each colony was cultured again for 32 hours.
[127]
[128]
Nutritional medium:
[129]
Glucose 1%, meat juice 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2
[130]
[131]
Fermentation medium:
[132]
Raw sugar 6%, calcium carbonate 5%, ammonium sulfate 2.25%, potassium monophosphate 0.1%, magnesium sulfate 0.04%, iron sulfate 10 mg/L, biotin 0.3 mg/L, thiamine hydrochloride 0.2 mg/L
[133]
[134]
Each colony was cultured under the above conditions, and mutant strains producing L-glutamic acid equal to or higher than that of wild-type Corynebacterium glutamicum (ATCC13869) were selected. Then, for the selected mutant strains, L-glutamic acid concentration was measured using YSI, and lactic acid concentration was measured using HPLC. The measured concentrations of L-glutamic acid and lactic acid are shown in Table 1 below.
[135]
[136]
[Table 1]
Strain name L-glutamic acid (g/L) Lactic acid (g/L)
ATCC13869 14.5 1.5
ATCC13869-m1 15.1 1.2
ATCC13869-m2 14.0 0.7
ATCC13869-m3 17.7 1.5
ATCC13869-m4 13.9 2.0
ATCC13869-m5 14.4 1.8
ATCC13869-m6 16.7 0.9
ATCC13869-m7 18.8 0.4
ATCC13869-m8 16.2 0.7
ATCC13869-m9 18.9 0.1
ATCC13869-m10 12.4 2.1
ATCC13869-m11 13.8 2.1
ATCC13869-m12 15.7 1.4
ATCC13869-m13 15.3 0.8
ATCC13869-m14 16.4 1.0
ATCC13869-m15 17.2 1.1
ATCC13869-m16 18.2 0.7
[137]
[138]
Referring to Table 1, "ATCC13869-m7" and "ATCC13869-m9" were selected as mutant strains in which the production amount of glutamic acid increased and the amount of lactic acid was decreased compared to the wild-type strain.
[139]
[140]
Example 2. Confirmation of mutation through gene sequencing
[141]
In order to confirm the genetic variation of the mutant strain, the genes of the ATCC13869-m7 and ATCC13869-m9 strains were compared with the wild-type strain.
[142]
As a result, it was confirmed that the ATCC13869-m7 and ATCC13869-m9 strains contained the same mutation at a specific position in the promoter region of the gene encoding lactate dehydrogenase.
[143]
Specifically, it was confirmed that ATCC13869-m7 and ATCC13869-m9 contained a mutation in which the 37th nucleotide T in the sequence of the promoter region represented by SEQ ID NO: 2 was substituted with G. The promoter region represented by SEQ ID NO: 2 was confirmed to be a sequence commonly included in microorganisms of the genus Corynebacterium, more specifically, wild-type Corynebacterium glutamicum (ATCC13032, ATCC13869, ATCC14067).
[144]
Therefore, in Examples 3 and 4 below, it was attempted to confirm whether the mutation affects the amount of glutamic acid and lactic acid produced by microorganisms in Corynebacterium.
[145]
[146]
Example 3. Preparation of the strain introduced mutation and confirmation of the amount of lactic acid produced
[147]
Example 3-1. Production of strains with mutations introduced
[148]
It was intended to produce a mutant strain into which the mutation identified through Example 2 was introduced. Specifically, in order to introduce the mutation into the wild-type Corynebacterium glutamicum (ATCC13869 and ATCC13032) (substitution of the 37th nucleotide of the polynucleotide sequence represented by SEQ ID NO: 2 with G), a reverse oligo containing a target mutation The nucleotides were designed to be 75-mers in length.
[149]
Specifically, 30 μg of the oligonucleotide of SEQ ID NO: 5 was transformed into Corynebacterium glutamicum wild-type ATCC13869 strain and ATCC13032 strain by an electric pulse method (Appl. Microbiol. Biothcenol., 1999, 52:541-545), and 1 ml of the complex liquid medium was added and incubated with shaking at 160 rpm for 30 minutes at 30°C. Thereafter, the culture solution was incubated on ice for 10 minutes, centrifuged at 4000 rpm for 10 minutes at 4°C, and then the supernatant was removed to obtain cells. Thereafter, 1 ml of a 10% glycerol solution at 4° C. was added and mixed, and then centrifuged at 4000 rpm for 10 minutes at 4° C. and the supernatant was removed to wash the cells. Thus, the cells were washed once more, and 0.1 ml of a 10% glycerol solution at 4° C. was added to prepare a strain for the next transformation. Thereafter, the process of transformation using the oligonucleotide of SEQ ID NO: 5 was repeated 10 times by the electric pulse method as described above, and then the colonies were secured by spreading on a complex plate medium (Nat. Protoc., 2014 Oct; 9( 10):2301-16).
[150]
As a result of performing the gene sequence analysis of the obtained colonies, it was confirmed that the target mutation was introduced into the strain, and the strains into which the mutation was introduced were "ATCC13869::ldh-pro-1mt" and "ATCC13032::ldh- pro-1mt".
[151]
[152]
Example 3-2. Confirmation of lactic acid production
[153]
The mutant strains ATCC13869::ldh-pro-1mt and ATCC13032::ldh-pro-1mt produced through Example 3-1 and their respective wild-type Corynebacterium glutamicum (ATCC13869 and ATCC13032) were each Example It was cultured in the same manner as 1-2.
[154]
After the culture was completed, the L-glutamic acid concentration and lactic acid concentration in each medium were measured. The measured concentrations of L-glutamic acid and lactic acid are shown in Table 2 below.
[155]
[156]
[Table 2]
Strain name L-glutamic acid (g/L) Lactic acid (g/L)
ATCC13869 14.5 1.5
ATCC13869::ldh-pro-1mt 19.2 0.0
ATCC13032 8.2 2.7
ATCC13032::ldh-pro-1mt 10.8 0.3
[157]
[158]
As shown in Table 2, the concentration of L-glutamic acid produced by the strain introduced Corynebacterium glutamicum ATCC13869::ldh-pro-1mt strain was L produced by wild-type Corynebacterium glutamicum ATCC13869 -It was confirmed that about 4.7 g/L (about 32%) was higher than the glutamic acid concentration. On the other hand, wild-type Corynebacterium glutamicum ATCC13869 produced 1.5 g/L of lactic acid, but lactic acid was not measured in the culture medium of ATCC13869::ldh-pro-1mt strain.
[159]
In addition, the concentration of L-glutamic acid produced by the mutated Corynebacterium glutamicum ATCC13032::ldh-pro-1mt strain is about the concentration of L-glutamic acid produced by the wild-type Corynebacterium glutamicum ATCC13032 It was found to be higher than 2.6 g/L (about 32%). On the other hand, wild-type Corynebacterium glutamicum ATCC13032 produced 2.7 g/L of lactic acid, but a very small amount (0.3 g/L) of lactic acid was measured in the culture medium of ATCC13032::ldh-pro-1mt strain.
[160]
That is, it was confirmed that the mutation increases the ability of microorganisms to produce L-glutamic acid and decreases the ability to produce lactic acid.
[161]
In addition, the strain ATCC13869::ldh-pro-1mt was named CA02-9209, and on February 28, 2018, it was internationally deposited with the Korean Microbial Conservation Center (KCCM), a depository institution under the Budapest Treaty, and the deposit number of KCCM12227P was given.
[162]
[163]
Example 4. Confirmation of the amount of lactic acid production and enzyme activity of the strain KFCC11074 into which the mutation was introduced
[164]
Example 4-1. Vector creation with mutations
[165]
In addition to the wild-type strain, in order to confirm whether the mutation exhibits the same effect in the strain having increased glutamic acid production capacity, the mutation was introduced into the KFCC11074 strain known as a glutamic acid-producing strain (Korean Patent Publication No. 10-0292299).
[166]
Specifically, a gene replacement vector was constructed to replace the 37th nucleotide of the polynucleotide sequence represented by SEQ ID NO: 2 included in the strain with G. The gene fragment for constructing the vector was obtained through PCR using ATCC13869 genomic DNA as a template. Based on information on the Corynebacterium glutamicum (ATCC13869) gene and surrounding nucleotide sequences registered in the National Institutes of Health GenBank (NIH GenBank), the polynucleotides of SEQ ID NOs: 6, 7, 8 and 9 A primer was prepared.
[167]
PCR was performed by denaturing at 95° C. for 5 minutes, then denaturing at 95° C. for 20 seconds, annealing at 55° C. for 20 seconds, and repeated polymerization for 30 seconds at 72° C. for 5 minutes. More specifically, a 500 bp polynucleotide amplified using the primers of SEQ ID NOs: 6 and 7 and a 500 bp polynucleotide amplified using the primers of SEQ ID NOs: 8 and 9 were obtained. A gene replacement vector was prepared by linking the obtained two gene fragments to a pDZ vector (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001) cut with restriction enzymes BamHI and SalI using an infusion enzyme, This was named "pDZ-ldh-pro-1mt". The primer sequence information used for the construction of the vector is shown in Table 3 below.
[168]
[169]
[Table 3]
Sequence number Primer name 5'SEQ ID NO:3'
6 ldh-pro-1mt-AF CGGTACCCGGGGATCCTGTGGGTGGCGTTGTA
7 ldh-pro-1mt-AR CTTTGTTACACCTTTACTTATGCCCGATTATGT
8 ldh-pro-1mt-BF GTAAAGGTGTAACAAAGGAATCCGGGCACAAGC
9 ldh-pro-1mt-BR ATGCCTGCAGGTCGACCCACACTGCGTAGGTC
[170]
[171]
Example 4-2. Production of KFCC11074 with introduced mutation and confirmation of lactic acid production
[172]
The gene replacement vector prepared in Example 4-1 was introduced into the KFCC11074 strain to prepare a mutated glutamic acid producing strain "KFCC11074::ldh-pro-1mt". Corynebacterium glutamicum KFCC11074 and the KFCC11074::ldh-pro-1mt strain to which the mutation was not introduced were cultured in the same manner as in Example 1-2, respectively.
[173]
After the culture was completed, the L-glutamic acid concentration and lactic acid concentration in each medium were measured. The measured concentrations of L-glutamic acid and lactic acid are shown in Table 4 below.
[174]
[175]
[Table 4]
Strain name L-glutamic acid (g/L) L-lactic acid (g/L)
KFCC11074 9.1 22.5
KFCC11074::ldh-pro-1mt 17.1 6.5
[176]
[177]
As shown in Table 4, the concentration of L-glutamic acid produced by the mutation-introduced Corynebacterium glutamicum KFCC11074::ldh-pro-1mt strain is Corynebacterium glutamicum KFCC11074 to which the mutation is not introduced. It was confirmed that about 8 g/L (about 88%) was higher than the produced L-glutamic acid concentration.
[178]
On the other hand, it was confirmed that the concentration of lactic acid produced by the KFCC11074::ldh-pro-1mt strain was 17 g/L lower than the concentration of lactic acid produced by the Corynebacterium glutamicum KFCC11074 to which the mutation was not introduced.
[179]
That is, it was confirmed once again that the mutation increases the ability of microorganisms to produce L-glutamic acid and decreases the ability to produce lactic acid.
[180]
[181]
Example 4-3. Confirmation of LDH enzyme activity of KFCC11074 introduced mutation
[182]
While confirming the mechanism for the decrease in lactate production ability of the KFCC11074::ldh-pro-1mt strain produced through Example 4-2, the mutation was in the promoter of lactate dehydrogenase (LDH). When it was confirmed that it was included, it was attempted to confirm the activity of lactate dehydrogenase, an enzyme producing lactic acid according to the mutation.
[183]
Specifically, the activity evaluation of the enzyme was performed in the following manner. First, cells were cultured in 25 ml (250 ml flask) of #3 medium of the following composition for 6 hours (30°C, 200 rpm), and then the cells were precipitated (4000 rpm, 10 minutes) to remove the supernatant and then 20 mM Tris Cell washing was repeatedly performed 3 times with 25 ml of -HCl (pH7.5). After washing, the supernatant was removed, and resuspended in 2 ml of 15% glycol buffer in a composition of 20 mM Tris (pH 7.5) for cell extraction, and 1 ml was added to a bead tube. Homogenization was performed 6 times under the condition of 46/30 seconds using a homogenizer. Then, it was centrifuged at 4° C. and 13000 rpm for 20 minutes.
[184]
[185]
Badge #3:
[186]
(Glucose 2%, Polypeptone 1%, (NH 4 ) 2 SO 4 1%, KH 2 PO 4 0.52%, K 2 HPO 4 1.07%, yeast extract 1%, urea 0.15%, MgSO 4 -7H 2 O 0.05%, d-Biotin 1.8 mg/L, Thiamine-HCl (Thiamin-HCl) 9 mg/L, Calcium-pantothenic acid 9 mg/L, Niacinamide 60 mg/L
[187]
[188]
Thereafter, a Bradford assay was performed to confirm and standardize the concentration of the protein contained in the supernatant (sample) obtained from the bead tube. In the Bradford assay, a standard curve was obtained by referring to Tables 5 and 6 below, and the concentration of the sample was confirmed. At this time, 980 µl of 1x Biorad protein assay reagent was added to the sample of a total volume of 20 µl and vortexed to measure absorbance at 595 nm within 3 minutes.
[189]
[190]
[Table 5]

mg/mL 0 0.025 0.05 0.1 0.2
BSA (1mg/mL) (µl) 0 0.5 One 2 4
Extraction buffer (µl) 20 19.5 19 18 16
Total volume (µl) 20 20 20 20 20
[191]
[192]
[Table 6]
Cell extract 1/10 diluted 1/5 diluted 1/20 dilution 1/50 dilution
Cell extract (µl) 2 4 (1/10)10 (1/10)4
Extraction buffer (µl) 18 16 10 16
Total volume (µl) 20 20 20 20
[193]
[194]
Thereafter, the activity experiment for lactate dehydrogenase of the KFCC11074 and KFCC11074::ldh-pro-1mt strains was performed using the reaction solution composition ratio shown in Table 7 below, and 30 mM sodium pyruvate as a starter. ) Was used. In addition, the lactate dehydrogenase activity of the two strains measured under the conditions of Table 8 below is shown in Table 9 below.
[195]
[196]
[Table 7]
Reaction solution Criteria for reaction 1
0.2 M Tris-HCl pH 7.5 (µl) 500
30 mM sodium pyruvate (µl) 100
6.6 mM NADH (µl) 50
Cell extract (mg/ml) 178 μg
DDW Up to 1 ml
[197]
[198]
[Table 8]
[199]
[200]
[Table 9]
Strain name LDH activity (U)
KFCC11074 0.398
KFCC11074::ldh-pro-1mt 0.150
[201]
[202]
As shown in Table 9, it was confirmed that the activity of lactate dehydrogenase decreased in the strain into which the mutation was introduced.
[203]
That is, it was confirmed that the mutation decreases the activity of lactate dehydrogenase in microorganisms, thereby reducing the ability to produce lactic acid.
[204]
[205]
In summary, the polynucleotide of the present application is a promoter of lactate dehydrogenase containing a mutation in which one base is substituted.Through the mutated promoter activity, a wild-type or glutamic acid-producing strain is converted to lactate dehydrogenase. It is possible to increase the production capacity of glutamic acid, which is the target product of fermentation, by weakening the activity of genase, and further reduce the production capacity of lactic acid, which lowers the palatability of fermentation products. It can be useful.
[206]
[207]
From the above description, those skilled in the art to which the present application pertains will appreciate that the present application may be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including the meaning and scope of the claims to be described later rather than the above detailed description, and all changes or modified forms derived from the equivalent concepts thereof.
[208]

Claims
[Claim 1]
A polynucleotide having promoter activity in which the 37th nucleotide of the nucleotide sequence represented by SEQ ID NO: 2 is substituted with G.
[Claim 2]
The polynucleotide according to claim 1, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 1.
[Claim 3]
The polynucleotide according to claim 1 or 2, wherein the polynucleotide is operably linked with a gene encoding a protein of interest.
[Claim 4]
The polynucleotide of claim 1 or 2; And a gene encoding a protein of interest operably linked to the polynucleotide.
[Claim 5]
The vector of claim 4, wherein the protein of interest is lactate dehydrogenase.
[Claim 6]
The polynucleotide of claim 1; And a gene encoding a protein of interest operably linked to the polynucleotide.
[Claim 7]
The microorganism of claim 6, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 1.
[Claim 8]
According to claim 6, The target protein is lactate dehydrogenase (lactate dehydrogenase), Corynebacterium genus microorganism.
[Claim 9]
The microorganism according to any one of claims 6 to 8, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum .
[Claim 10]
Culturing the microorganism of the genus Corynebacterium according to any one of claims 6 to 8 in a medium; And comprising the step of recovering the target material from the medium, the method of producing a target material.
[Claim 11]
The method of claim 10, wherein the target substance is an amino acid.
[Claim 12]
A method for producing a fermentation composition comprising the step of fermenting the microorganism of the genus Corynebacterium according to any one of claims 6 to 8 in a medium.
[Claim 13]
A fermentation composition prepared by the method of claim 12.

Documents

Application Documents

# Name Date
1 202017007236-STATEMENT OF UNDERTAKING (FORM 3) [20-02-2020(online)].pdf 2020-02-20
2 202017007236-SEQUENCE LISTING(PDF) [20-02-2020(online)].pdf 2020-02-20
3 202017007236-SEQUENCE LISTING [20-02-2020(online)].txt 2020-02-20
4 202017007236-PRIORITY DOCUMENTS [20-02-2020(online)].pdf 2020-02-20
5 202017007236-FORM 1 [20-02-2020(online)].pdf 2020-02-20
6 202017007236-DECLARATION OF INVENTORSHIP (FORM 5) [20-02-2020(online)].pdf 2020-02-20
7 202017007236-COMPLETE SPECIFICATION [20-02-2020(online)].pdf 2020-02-20
8 202017007236-FORM-26 [08-05-2020(online)].pdf 2020-05-08
9 202017007236-FORM-26 [02-06-2020(online)].pdf 2020-06-02
10 202017007236-FORM-26 [12-06-2020(online)].pdf 2020-06-12
11 202017007236-ENDORSEMENT BY INVENTORS [14-07-2020(online)].pdf 2020-07-14
12 202017007236-FORM 3 [07-08-2020(online)].pdf 2020-08-07
13 202017007236-Proof of Right [19-08-2020(online)].pdf 2020-08-19
14 202017007236-FORM 18 [02-09-2020(online)].pdf 2020-09-02
15 OPA18460_Sequence Listing-202017007236-cd-260220.pdf 2021-10-19
16 202017007236.pdf 2021-10-19
17 202017007236-Power of Attorney-230720.pdf 2021-10-19
18 202017007236-OTHERS-270820.pdf 2021-10-19
19 202017007236-Form 5-230720.pdf 2021-10-19
20 202017007236-Correspondence-270820.pdf 2021-10-19
21 202017007236-Correspondence-260220.pdf 2021-10-19
22 202017007236-Correspondence-230720.pdf 2021-10-19
23 202017007236-FER.pdf 2023-02-14
24 202017007236-MARKED COPIES OF AMENDEMENTS [14-08-2023(online)].pdf 2023-08-14
25 202017007236-FORM 3 [14-08-2023(online)].pdf 2023-08-14
26 202017007236-FORM 13 [14-08-2023(online)].pdf 2023-08-14
27 202017007236-FER_SER_REPLY [14-08-2023(online)].pdf 2023-08-14
28 202017007236-CLAIMS [14-08-2023(online)].pdf 2023-08-14
29 202017007236-certified copy of translation [14-08-2023(online)].pdf 2023-08-14
30 202017007236-Certified Copy of Priority Document [14-08-2023(online)].pdf 2023-08-14
31 202017007236-AMMENDED DOCUMENTS [14-08-2023(online)].pdf 2023-08-14
32 202017007236-US(14)-HearingNotice-(HearingDate-16-04-2024).pdf 2024-03-15
33 202017007236-PETITION UNDER RULE 137 [12-04-2024(online)].pdf 2024-04-12
34 202017007236-Correspondence to notify the Controller [12-04-2024(online)].pdf 2024-04-12
35 202017007236-Written submissions and relevant documents [16-04-2024(online)].pdf 2024-04-16
36 202017007236-PatentCertificate18-04-2024.pdf 2024-04-18
37 202017007236-IntimationOfGrant18-04-2024.pdf 2024-04-18
38 202017007236-FORM 4 [09-08-2024(online)].pdf 2024-08-09

Search Strategy

1 SEQID2SEARCHE_14-02-2023.pdf
2 SEQID1SEARCHE_14-02-2023.pdf

ERegister / Renewals

3rd: 09 Aug 2024

From 08/03/2021 - To 08/03/2022

4th: 09 Aug 2024

From 08/03/2022 - To 08/03/2023

5th: 09 Aug 2024

From 08/03/2023 - To 08/03/2024

6th: 09 Aug 2024

From 08/03/2024 - To 08/03/2025

7th: 12 Dec 2024

From 08/03/2025 - To 08/03/2026