Abstract: The present application relates to a novel promoter, and a method for producing L-amino acid by using same and, more specifically, to: a novel polynucleotide having a promoter activity, a vector and a Corynebacterium sp. microorganism comprising same; a method for producing L-amino acid by using the microorganism; a method for producing a fermented composition; and the fermentation composition.
The present application relates to a novel promoter and a method for producing L-amino acid using the same, and more specifically, a novel polynucleotide having a promoter activity, a vector and a microorganism comprising the same, microorganisms of Corynebacterium, and L-amino acids using the microorganism It relates to a production method, a method for producing a fermentation composition, and the fermentation composition.
[2]
Background
[3]
L-amino acid is a basic structural unit of protein, and is used as an important material for pharmaceutical raw materials, food additives, animal feed, nutrients, pesticides, and fungicides. Among them, L-glutamic acid is a representative amino acid produced by fermentation, and has a unique characteristic taste (umami), and is one of the important amino acids widely used in the food field, medicine field, and other animal feed fields. In addition, glycine is mainly used as a seasoning in the food industry due to its sweet taste, and is used with natural seasonings to enhance the taste. Furthermore, it is also used for anti-oxidation and buffering, and in medicine, it is used as an infusion solution, antacid, total amino acid preparation, and nutrition supplement.
[4]
[5]
Common methods for producing the amino acids are mainly Brevibacterium or Corynebacterium (Amino Acid Fermentation, Gakkai Shuppan Center: 195-215, 1986), in addition to Escherichia coli , Bacillus ), Streptomyces ( Streptomyces ), Penny room Solarium ( Penicillum ), a keurep when Ella ( Klebsiella ), control Winiah ( Erwinia ), Ah (in panto Pantoea and the fermentation method using microorganisms such as genus) (U.S. Patent No. 3,220,929 No. , No. 6,682,912), and is also produced by industrial methods through synthetic methods such as monochloroacetic acid method and Strecker method.
[6]
[7]
In addition, various studies have been made to efficiently produce amino acids, for example, efforts have been made to develop microorganisms that produce high-efficiency amino acids or fermentation process technology. Specifically, a target material-specific approach has been developed, such as increasing the expression of genes encoding enzymes involved in amino acid biosynthesis in the genus Corynebacterium or removing genes unnecessary for amino acid biosynthesis (Korean Patent Registration) Publication No. 10-0924065, No. 1208480), a method of removing genes that are not involved in amino acid production other than these methods, and a method of removing genes whose function is not specifically known for amino acid production are also used. However, there is still a need for research into methods that can produce amino acids in an efficient and high yield.
[8]
Detailed description of the invention
Technical challenges
[9]
As a result of efforts to develop a method capable of simultaneously producing several amino acids, the present inventors have developed a new polynucleotide having a promoter activity of the present application, which confirms that it is possible to improve the ability to produce glycine while maintaining the ability to produce glutamic acid of the strain. This application was completed.
[10]
Task resolution
[11]
One object of the present application is promoter activity, wherein the 53th and 55th nucleotides of the nucleotide sequence represented by SEQ ID NO: 1 are replaced by T, or the 53th and 55th nucleotides are replaced by T and the 60th nucleotide is replaced by G. It is to provide a polynucleotide having a.
[12]
Another object of the present application is the polynucleotide; And a gene encoding a target protein operably linked to the polynucleotide.
[13]
Another object of the present application is the polynucleotide; And a gene encoding a target protein operably linked to the polynucleotide, the microorganism of the genus Corynebacterium.
[14]
Another object of the present application is culturing the microorganism of the genus Corynebacterium in a medium; And it provides a method for producing a target material comprising the step of recovering the target material from the medium.
[15]
Another object of the present application is to provide a method for preparing a fermentation composition, comprising culturing the microorganism in the genus Corynebacterium in a medium.
[16]
Another object of the present application is to provide a fermentation composition prepared by the above method.
[17]
Effects of the Invention
[18]
The novel promoter of the present application can be introduced into microorganisms that produce amino acids, thereby increasing the amount of amino acids produced by microorganisms. In particular, when an amino acid is produced using the new promoter, glycine previously produced by a synthetic method can be produced by a fermentation method, and furthermore, since glutamic acid and glycine can be simultaneously produced, it can be usefully used for amino acid production. In addition, by adjusting the amount of glutamic acid and the amount of glycine in the fermentation product, the taste and palatability of the fermentation product can be improved to be applied to the fermentation broth and seasoning material products using the same.
[19]
Best mode for carrying out the invention
[20]
Specifically, it is as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, the scope of the present application is not considered to be limited by the specific descriptions described below.
[21]
[22]
In order to achieve the above object, one aspect of the present application, the 53th and 55th nucleotides of the nucleotide sequence represented by SEQ ID NO: 1 are substituted with T, or the 53th and 55th nucleotides are substituted with T and the 60th It provides a polynucleotide having a promoter activity, the nucleotide is substituted with G.
[23]
[24]
The term "nucleotide sequence represented by SEQ ID NO: 1" in the present application may mean a part of a promoter sequence of a gene encoding Phosphoribosyl-ATP pyrophosphatase (HISE).
[25]
At this time, the term "phosphoribosyl-ATP pyrophosphatase" synthesizes L-histidine from 5-phospho-alpha-D-ribose 1-diphosphate (5-phospho-alpha-D-ribose 1-diphosphate), Refers to an enzyme involved in the histidine synthesis pathway, and may be used interchangeably herein with “HisE”. The histidine synthesis pathway consists of a total of 9 enzymes (HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD), wherein the HisE is the first step ATP phosphoribosyltransferase (HisG) Thereafter, a second step is constructed.
[26]
[27]
The term "promoter" in the present application includes a non-translated nucleotide sequence upstream of the coding region, that is, polymerase, that includes a binding site for a polymerase and has transcription initiation activity of the promoter gene of interest into mRNA. Refers to a DNA region that binds to initiate gene transcription. The promoter may be located at the 5'site of the mRNA transcription start site. In this case, the target gene of the promoter may be a gene encoding phosphoribosyl-ATP pyrophosphatase, but is not limited thereto.
[28]
[29]
In the present application, the polynucleotide having a promoter activity consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 is "the polynucleotide", "nucleotide sequence of this application", "polynucleotide of this application" or "hisEG promoter" It may be used interchangeably and the like, and in this specification, all the terms described above may be used.
[30]
[31]
In the polynucleotide of the present application, the nucleotide sequence represented by SEQ ID NO: 1, that is, the promoter sequence of the hisEG gene has been changed. Specifically, the variation is the 53th and 55th nucleotides of the sequence being substituted with T, or 53 The nucleotides 60th and 55th may be substituted with the nucleotide 60th and G may be substituted. Accordingly, the polynucleotide may be composed of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 (consist of).
[32]
At this time, the term "variation" means a genetic or non-genetically stable phenotypic change, and may be used interchangeably with "mutation" in this specification.
[33]
[34]
Specifically, the polynucleotide may have a mutated (increased or decreased) promoter activity compared to a polynucleotide that does not contain a mutation. Accordingly, the expression of the target gene operably linked to the polynucleotide and the activity of the protein encoded by the target gene can be regulated (increased or decreased), and further, expression of genes other than the target gene can be regulated.
[35]
[36]
For the purposes of the present application, the polynucleotide may be for enhancing expression of hisE gene. In addition, since the hisE and hisG genes are composed of operons, the polynucleotide may further have a purpose for enhancing expression of the hisG gene.
[37]
In addition, the polynucleotide may be for increasing the production amount of glycine.
[38]
[39]
At this time, the "HisG" is also referred to as "ATP phosphoribosyltransferase" in the present application, and refers to an enzyme involved in the histidine synthesis pathway. The histidine synthesis pathway consists of a total of nine enzymes (HisG-HisE-HisI-HisA-HisH-HisB-HisC-HisN-HisD) The HisG constitutes one step among them.
[40]
In addition, since the hisE and hisG genes are composed of an operon, the polynucleotide of the present application can regulate transcription of the hisG gene as well as hisE. Accordingly, the target gene may be a gene encoding phosphoribosyl-ATP pyrophosphatase, a gene encoding ATP phosphoribosyltransferase, or a combination thereof.
[41]
[42]
The HisE and HisG were known to be involved in histidine production, but the association with glycine production is unknown and was first identified by the present inventors. In particular, the increase in the activity of HisE and/or HisG enzymes due to the overexpression of HisE and/or hisG due to the promoter mutation of the hisEG gene, and thus the effect of increasing the production of glycine and maintaining the production of glutamic acid is the first time by the present inventors. Was identified.
[43]
At this time, the term, "glutamic acid" (L-glutamic acid, L-glutamate) is a kind of amino acid and is classified as a non-essential amino acid. It is known as the most common excitatory neurotransmitter in the central nervous system, and its monosodium glutamate (MSG) is widely used as a seasoning because of its rich taste. In general, it is produced through the fermentation of microorganisms that produce glutamic acid.
[44]
In addition, the term, "glycine" (glycine) is an amino acid of a colorless crystal with a sweet taste, also called glycine. It is mainly used as a food seasoning, and in medicine, it is also used as an infusion solution, an antacid, a comprehensive amino acid preparation, and a nutritional supplement. In general, it is manufactured through industrial synthesis methods such as the monochloroacetic acid method and the Strecker method. The synthesis method is a mixture of D-type and L-type amino acids, and thus has the inconvenience of optical division. Therefore, it is necessary to manufacture glycine by a fermentation method having various advantages such as mild reaction conditions, mass production in a short time, environmentally friendly processes, and biodegradability of production materials.
[45]
[46]
Specifically, the polynucleotide may be composed of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
[47]
[48]
In addition, the nucleotide sequence of the present application can be modified by conventionally known mutagenesis methods, for example, direct evolution and site-directed mutagenesis.
[49]
Accordingly, the polynucleotide is at least 60% or more, specifically 70% or more, more specifically 80% or more, more specifically 83% or more, 84% for the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 Or more, 88% or more, 90% or more, 93% or more, 95% or more, or 97% or more. If the sequence having homology to the sequence is a polynucleotide sequence having a biological activity substantially the same as or corresponding to the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3, some sequences may be deleted, modified, substituted, or added to the polynucleotide sequence. It is obvious that the case of having it is also included in the scope of the present application.
[50]
[51]
The term "homology" in the present application means the degree to which a given nucleotide sequence matches and may be expressed as a percentage. In this specification, homology sequences thereof having the same or similar activity to a given nucleotide sequence are denoted as “% homology”. Homology to the nucleotide sequence is described, for example, in the algorithm BLAST by literature (Karlin and Altschul, Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] or FASTA by Pearson (Methods Enzymol., 183, 63, 1990). Based on this algorithm BLAST, a program called BLASTN or BLASTX has been developed (see http://www.ncbi.nlm.nih.gov).
[52]
The term “strict conditions” refers to conditions that enable specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homology). For example, genes having high homology, 60% or more, specifically 90% or more, more specifically 95% or more, more specifically 97% or more, particularly specifically 99% or more homology Hybridization between genes, and conditions for not hybridizing genes with lower homology, or washing conditions for normal Southern hybridization, 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1 % SDS, more specifically 68° C., 0.1×SSC, and conditions for washing once, specifically 2 to 3 times, at a salt concentration and temperature corresponding to 0.1% SDS can be enumerated. Hybridization requires two nucleotides to have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term “complementary” is used to describe the relationship between nucleotide bases that are hybridizable to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application may also include isolated polynucleotide fragments complementary to the entire sequence, as well as substantially similar polynucleotide sequences.
[53]
Specifically, polynucleotides having homology can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value is 60 ℃, 63 ℃? Alternatively, it may be 65°C, but is not limited thereto, and may be appropriately adjusted by a person skilled in the art according to the purpose. The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and variables are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[54]
[55]
In particular, the expression consisting of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 in the above (consist of) occurs during the process of connecting to the target gene, such as the use of restriction enzymes, when the polynucleotide is used as a promoter and linked to the target gene. The addition, and/or deletion, and/or mutation of possible nucleotides are not excluded.
[56]
For example, the polynucleotide having a promoter activity consisting of the nucleotide sequence represented by SEQ ID NO: 2 or SEQ ID NO: 3, hybrids under strict conditions with complementary sequences for all or part of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3 It can also include nucleotide sequences having a promoter activity of the present application.
[57]
[58]
Furthermore, the polynucleotide of the present application can be operably linked to a gene encoding a target protein.
[59]
[60]
The term "gene expression control sequence" in the present application includes a polynucleotide of the present application, and refers to a sequence capable of expressing a target gene operably linked thereto.
[61]
Those skilled in the art may try to enhance expression by using a variation of a gene expression control sequence including a promoter, for example, by attempting to enhance expression by variation of the start codon sequence. As an example, the start codon of the HisE enzyme may be substituted from GTG to ATG.
[62]
The term "operatively linked" in the present application means that the polynucleotide having the promoter activity of the present application is functionally linked to the gene sequence to initiate and mediate transcription of the target gene. Operable linkages can be made using known genetic recombination techniques in the art, and site-specific DNA cleavage and linkages can be made using artisan cleavage and linkage enzymes, but are not limited thereto.
[63]
[64]
Furthermore, the gene expression control sequence of the present application includes any operator sequence for controlling transcription, a sequence encoding a suitable mRNA ribosome binding site, and a DNA for controlling transcription and translation termination, in addition to a promoter for transcription of the gene. It may further include.
[65]
For example, a regulatory sequence suitable for prokaryotes may further include a ribosome binding site in addition to a promoter, but is not limited thereto. The polynucleotide having the promoter activity of the present application can construct a sequence for regulating gene expression as described above by a person skilled in the art as necessary.
[66]
[67]
In the present application, the target gene refers to a gene encoding a target protein to control expression in microorganisms.
[68]
For example, it may be a gene involved in the production of amino acids such as glutamic acid, glycine, and histidine, but is not limited thereto. Specifically, the gene may be a gene encoding an enzyme related to histidine biosynthesis, but is not limited thereto. More specifically, the gene may be a gene encoding HisE and/or HisG, but is not limited thereto. For example, the hisE gene and hisG gene may constitute an operon, and the polynucleotide of the present application may enhance the transcriptional activity of hisE and/or hisG. In addition, the hisE and hisG may be an intrinsic gene or a foreign gene, and may include mutations for regulating activity. For example, the HisG may include a mutation for releasing histidine feedback inhibition. The sequence of the gene encoding the HisE or HisG can be easily obtained by a person skilled in the art through a known database such as GenBank of the National Institutes of Health.
[69]
[70]
For the purposes of the present application, the gene expression control sequence may increase the expression of a gene encoding an enzyme related to histidine biosynthesis, specifically hisE and/or hisG.
[71]
[72]
Another aspect of the present application provides a vector comprising the polynucleotide and a gene encoding a target protein operably linked to the polynucleotide.
[73]
The polynucleotide is as described above.
[74]
[75]
Specifically, the target protein may be phosphoribosyl-ATP pyrophosphatase (HISE), ATP phosphoribosyltransferase (HisG), or a combination thereof. As the target protein, HisE and HisG enzymes may include proteins homologous thereto, and may be proteins in which some amino acids are mutated. As an example, ATP phosphoribosyltransferase (ATP phosphoribosyltransferase: HisG) may be that the amino acids 233 and 235 of the HisG amino acid sequence represented by SEQ ID NO: 16 are substituted with histidine (H) and glutamine (Q), respectively. have.
[76]
[77]
The term "vector" in the present application is an artificial DNA molecule that retains a genetic material so that a target gene can be expressed in a suitable host, the polynucleotide or a suitable gene expression control sequence; And a nucleotide sequence of a gene encoding a target protein operably linked thereto.
[78]
[79]
The vector used in the present application is not particularly limited as long as it can be expressed in the host cell, and any vector known in the art can be used to transform the host cell. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophage.
[80]
[81]
For example, as a phage vector or cosmid vector, pWE15, M13, λLB3, λBL4, λⅨII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc. can be used, and pBR-based, pUC-based, and pBluescriptII-based plasmid vectors , pGEM system, pTZ system, pCL system and pET system.
[82]
In addition, an intrinsic promoter in the chromosome can be replaced with a polynucleotide having the promoter activity of the present application through a vector for chromosomal insertion in the host cell. For example, pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pMW118, pCC1BAC, pCES208, pXMJ19 vectors, etc. may be used, but are not limited thereto.
[83]
In addition, the insertion of the polynucleotide into the chromosome can be made by any method known in the art, for example, homologous recombination.
[84]
Since the vector of the present application may cause homologous recombination and be inserted into the chromosome, it may further include a selection marker to confirm whether the chromosome is inserted. Selection markers are used to select cells transformed with a vector, that is, to confirm the insertion of polynucleotides, and confer selectable phenotypes such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface proteins. Markers can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit different expression traits, so that the transformed cells can be selected.
[85]
[86]
The term "transformation" in the present application means to introduce a vector containing the gene encoding the polynucleotide or gene expression control sequence and a target protein into a host cell, so that the gene can be expressed in the host cell. . Furthermore, as long as the target gene can be expressed in the host cell, the gene encoding the transformed polynucleotide and the target protein includes the case of all of them regardless of whether they are located on or outside the chromosome of the host cell. can do.
[87]
[88]
The transformation method includes all methods for introducing the gene expression control sequence and the gene encoding the target protein into the cell, and can be performed by selecting a suitable standard technique as known in the art according to the host cell. . For example, electroporation, calcium phosphate (CaPO 4 ) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG), DEAE-dextran method, cation liposome method, and Lithium acetate-DMSO method, and the like, but is not limited thereto.
[89]
[90]
Another aspect of the present application is the polynucleotide; And a gene encoding a target protein operably linked with the polynucleotide.
[91]
Genes encoding the polynucleotide and a target protein operably linked to the polynucleotide are as described above.
[92]
[93]
The term "microorganism" in the present application includes both wild-type microorganisms or microorganisms in which natural or artificial genetic modification has occurred, and a specific mechanism is weakened due to reasons such as insertion of an external gene or enhanced or weakened activity of an intrinsic gene. It is a concept that includes both microbial and enhanced microorganisms.
[94]
[95]
In the present application, the microorganism may include the polynucleotide, specifically, a polynucleotide and/or a gene operably linked to the polynucleotide and encoding a target protein. Alternatively, the microorganism may include a vector containing the polynucleotide or gene expression control sequence and a gene encoding a target protein, but is not limited thereto. In addition, the polynucleotide, the gene encoding the target protein and the vector may be introduced into the microorganism by transformation, but is not limited thereto. Furthermore, the microorganism is independent of whether the gene encoding the polynucleotide and the target protein is located on or outside the chromosome if the gene can be expressed.
[96]
[97]
For the purposes of the present application, the microorganism containing the gene encoding the polynucleotide and the target protein may be one in which the production amount of glutamic acid is maintained and the production amount of glycine is increased.
[98]
For example, the microorganism may have enhanced activity of HisE and/or HisG.
[99]
[100]
In the present application, the microorganism may be included without limitation as long as it is a microorganism capable of acting as a promoter by introducing a polynucleotide having a promoter activity of the present application.
[101]
Specifically, the microorganism may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum or Corynebacterium flavum , and most specifically, Corybacterium flavum . Nebacterium glutamicum, but is not limited thereto.
[102]
[103]
Another aspect of the present application is culturing the microorganism in the genus Corynebacterium in a medium; And it provides a method for producing a target material, comprising the step of recovering the target material from the medium.
[104]
The polynucleotide and microorganism are as described above.
[105]
[106]
In the present application, the target substance may be an amino acid. Specifically, the amino acid may be an L-form amino acid, unless otherwise noted, glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine , Arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, and combinations thereof, but is not limited thereto.
[107]
More specifically, the amino acid may be glutamic acid, glycine or a combination thereof, but is not limited thereto.
[108]
[109]
The term "cultivation" in the present application means to grow microorganisms under environmental conditions artificially controlled. In the present application, a method of producing a target substance using a microorganism containing the polynucleotide may be performed using a method well known in the art. Specifically, the culture may be continuously cultured in a batch process, an injection batch or a repeated fed batch process, but is not limited thereto. The medium used for cultivation must meet the requirements of a particular strain in an appropriate manner. Culture media for Corynebacterium strains are known (e.g., Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington DC, USA, 1981).
[110]
Sugars that can be used in the medium include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, palmitic acid, and stearic acid. , Fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture, but are not limited thereto.
[111]
Nitrogen sources that can be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. The nitrogen source can also be used individually or as a mixture, but is not limited thereto.
[112]
Personnel that can be used may include potassium dihydrogen phosphate or dipotassium phosphate or a salt containing the corresponding sodium. In addition, the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth. Finally, in addition to the above materials, essential growth materials such as amino acids and vitamins can be used. In addition, precursors suitable for the culture medium can be used. The above-mentioned raw materials may be added batchwise or continuously in an appropriate manner to the culture during the culture process.
[113]
During the cultivation of the microorganism, the pH of the culture may be adjusted by using a basic compound such as sodium hydroxide, potassium hydroxide, or ammonia or an acid compound such as phosphoric acid or sulfuric acid in an appropriate manner. In addition, anti-foaming agents such as fatty acid polyglycol esters can be used to suppress the formation of bubbles. To maintain aerobic conditions, oxygen or oxygen-containing gas (eg, air) may be injected into the culture.
[114]
The temperature of the culture (medium) may be usually 20°C to 45°C, specifically 25°C to 40°C. The cultivation time may be continued until a desired amount of the desired target product is obtained, but may be specifically 10 to 160 hours.
[115]
[116]
The recovery of the desired substance from the culture (medium) can be separated and recovered by conventional methods known in the art. As the separation method, methods such as centrifugation, filtration, chromatography, and crystallization can be used. For example, the culture may be centrifuged at low speed to remove biomass and the obtained supernatant may be separated through ion exchange chromatography, but is not limited thereto. In another method, a cell separation and filtration process may be performed from the culture (medium), and the target material may be recovered without a separate purification process. Alternatively, the recovery step may further include a purification process.
[117]
[118]
Another aspect of the present application provides a method of preparing a fermentation composition, comprising culturing the microorganism of the genus Corynebacterium in a medium to ferment.
[119]
Another aspect of the present application provides a fermentation composition prepared by the above method.
[120]
The polynucleotide and microorganism are as described above, and the step of culturing the microorganism in the medium is also as described above.
[121]
[122]
The term "the above fermentation composition" in the present application means a composition obtained by culturing the microorganism of the present application. Furthermore, the fermentation composition may include a composition in the form of a liquid or powder obtained after culturing the microorganism, after undergoing an appropriate post-treatment process. At this time, a suitable post-treatment process may include, for example, a culture process of the microorganism, a cell removal process, a concentration process, a filtration process, and a carrier mixing process, and may further include a drying process. In some cases, the post-treatment process may not include a purification process. The fermentation composition can produce an optimal taste by culturing the microorganism of the present application, and while maintaining a certain level of glutamic acid content, the composition contains an increased glycine content.
[123]
In addition, "the fermentation composition" does not exclude seasoning material products (for example, powder products for broth, snack seasoning products, etc.) containing the liquid or powder composition. Furthermore, "the fermentation composition" is a case in which a material obtained by a non-fermentation process and/or another material obtained by a non-natural process is further mixed as long as it contains a composition obtained by culturing the microorganism of the present application. Do not exclude.
[124]
Mode for carrying out the invention
[125]
Hereinafter, the present application will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited to these examples.
[126]
[127]
Example 1. Selection of strains that increase glycine production capacity
[128]
Example 1-1. Random mutagenesis through UV irradiation
[129]
In order to select a mutant strain with improved production ability of glycine, a target product of fermentation, first, wild-type Corynebacterium glutamicum (ATCC13869) was spread on a nutrient medium containing agar and cultured at 30°C for 16 hours. . Hundreds of colonies thus obtained were irradiated with UV at room temperature to cause random mutations on the genome in the strain.
[130]
[131]
Example 1-2. Mutagenesis strain fermentation titer test and strain selection
[132]
Subsequently, fermentation titer experiments were performed on the mutant strains in which random mutations were induced.
[133]
Each colony was passaged in a nutrient medium and then cultured for 5 hours in a fermentation medium. Then, 25% Tween40 was added to each medium at a concentration of 0.4%, and each colony was incubated again for 32 hours.
[134]
[135]
Nutritional medium :
[136]
Glucose 1%, juicy 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2
[137]
[138]
Fermentation medium :
[139]
6% raw sugar, 5% calcium carbonate, 2.25% ammonium sulfate, 0.1% potassium monophosphate, 0.04% magnesium sulfate, 10 mg/L iron sulfate, 0.3 mg/L biotin, 0.2 mg/L thiamine hydrochloride
[140]
[141]
By culturing each colony under the above conditions, mutant strains producing L-glutamic acid equal to or higher than the wild type Corynebacterium glutamicum (ATCC13869) were selected. In addition, for the selected mutant strains, L-glutamic acid concentration was measured using YSI, and glycine concentration was measured using HPLC. The measured concentrations of L-glutamic acid and glycine are shown in Table 1.
[142]
[143]
[Table 1]
Strain name L-glutamic acid (g/L) L-glycine (mg/L)
ATCC13869 14.0 119
ATCC13869-g1 13.2 102
ATCC13869-g2 9.6 35
ATCC13869 -g3 13.9 121
ATCC13869-g4 13.3 110
ATCC13869-g5 12.7 101
ATCC13869 -g6 14.8 132
ATCC13869-g7 2.1 7
ATCC13869-g8 8.4 75
ATCC13869-g9 13.5 115
ATCC13869 -g10 14.2 143
ATCC13869-g11 12.6 108
ATCC13869-g12 13.7 103
ATCC13869-g13 10.1 82
ATCC13869-g14 14.2 105
ATCC13869-g15 13.5 100
ATCC13869-g16 7.2 67
ATCC13869-g17 12.8 101
ATCC13869-g18 13.0 99
ATCC13869-g19 11.9 82
ATCC13869 -g20 14.0 152
ATCC13869-g21 13.8 111
ATCC13869-g22 9.7 120
ATCC13869-g23 13.2 114
ATCC13869-g24 13.3 114
[144]
[145]
Referring to Table 1, as compared to the wild-type strain, the production amount of glutamic acid is equal to or higher, and the strains having increased glycine production are "ATCC13869-g3", "ATCC13869-g6", "ATCC13869-g10" and "ATCC13869-g20" Was selected.
[146]
[147]
Example 2. Confirmation of mutation through gene sequencing
[148]
In order to confirm the genetic variation of the mutant strain, the genes of the ATCC13869-g3, ATCC13869-g6, ATCC13869-g10 and ATCC13869-g20 strains were sequenced and compared with the wild-type strain.
[149]
As a result, the ATCC13869-g3 and ATCC13869-g10 strains contain the same mutation at a specific position in the promoter region of the gene encoding phosphoribosyl-ATP pyrophosphatase (HisE). Confirmed. In addition, it was confirmed that the ATCC13869-g20 strain further contains one mutation in addition to the same mutation at a specific position in the promoter region of the gene encoding the HisE of the ATCC13869-g3 and ATCC13869-g10 strains.
[150]
Specifically, it was confirmed that ATCC13869-g3 and ATCC13869-g10 contain mutations in which the 53th nucleotide A in the sequence of the promoter region represented by SEQ ID NO: 1 is replaced by T and the 55th nucleotide G is replaced by T. It was confirmed that ATCC13869-g20 contains a variation in which the 53th nucleotide A is T, the 55th nucleotide G is T, and the 60th nucleotide T is G in the sequence of the promoter region represented by SEQ ID NO: 1. It was confirmed that the promoter region represented by SEQ ID NO: 1 is a sequence commonly included in microorganisms of the genus Corynebacterium, more specifically, wild-type Corynebacterium glutamicum (ATCC13032, ATCC13869, ATCC14067).
[151]
Therefore, in Examples 3 and 4, it was attempted to confirm whether the mutation affects the amount of glutamic acid and glycine produced by microorganisms of the genus Corynebacterium.
[152]
[153]
Example 3. Production of strains introduced with mutations and confirmation of glycine production
[154]
Example 3-1. Production of strains introduced with mutations
[155]
The variation identified through Example 2 was introduced to prepare a mutant strain. Specifically, the mutation was introduced into the wild-type Corynebacterium glutamicum (ATCC13869) (substituting the 53th and 55th nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1 with T, or the polynucleotide represented by SEQ ID NO: 1 To replace the 53th and 55th nucleotides of the sequence with T and the 60th nucleotide with G), the reverse oligonucleotide containing the target mutation was designed with a length of 75-mer (SEQ ID NO: 4 or SEQ ID NO: 5).
[156]
Specifically, 30 μg of the oligonucleotide of SEQ ID NO: 4 or SEQ ID NO: 5 was electropulsed to the strains of Corynebacterium glutamicum wild type ATCC13869 and ATCC13032 (Appl. Microbiol. Biothcenol., 1999, 52: 541-545) And transformed with 1 ml of the complex liquid medium, and incubated with shaking at 160 rpm for 30 minutes at 30°C. Thereafter, the culture solution was incubated on ice for 10 minutes, centrifuged at 4000 rpm for 10 minutes at 4° C., and the supernatant was removed to obtain a cell. Thereafter, 1 ml of a 10% glycerol solution at 4°C was added and mixed, followed by centrifugation at 4000 rpm for 10 minutes at 4°C and removal of the supernatant to wash the cells. As described above, the cells were washed once more, and 0.1 ml of a 10% glycerol solution at 4°C was added to prepare a strain for the next transformation. Thereafter, the transformation process using the oligonucleotide of SEQ ID NO: 4 or SEQ ID NO: 5 was repeated 10 times by the above-described electric pulse method, and then plated on a composite plate medium to secure colonies (Nat. Protoc., 2014) Oct; 9(10): 2301-16).
[157]
As a result of performing the gene sequence analysis of the secured colonies, it was confirmed that the target mutation was introduced into the strain, and the strains into which the mutation was introduced were "ATCC13869::hisEG-pro-2mt", "ATCC13869::hisEG- pro-3mt" and "ATCC13032::hisEG-pro-2mt" and "ATCC13032::hisEG-pro-3mt".
[158]
[159]
Example 3-2. Check glycine production
[160]
Mutant strains produced through Example 3-1, ATCC13869::hisEG-pro-2mt, ATCC13869::hisEG-pro-3mt and ATCC13032::hisEG-pro-2mt, ATCC13032::hisEG-pro-3mt and their Each wild type Corynebacterium glutamicum (ATCC13869 and ATCC13032) were cultured in the same manner as in Example 1-2.
[161]
After the culture was completed, L-glutamic acid concentration and glycine concentration in each medium were measured. The measured concentrations of L-glutamic acid and glycine are shown in Table 2 below.
[162]
[163]
[Table 2]
Strain name L-glutamic acid (g/L) L-glycine (mg/L)
ATCC13869 14.2 122
ATCC13869::hisEG-pro-2mt 14.0 134
ATCC13869::hisEG-pro-3mt 14.3 141
ATCC13032 9.1 73
ATCC13032::hisEG-pro-2mt 9.4 91
ATCC13032::hisEG-pro-3mt 9.3 99
[164]
[165]
As shown in Table 2, Corynebacterium glutamicum ATCC13869::hisEG-pro-2mt, ATCC13869::hisEG-pro-3mt and ATCC13032::hisEG-pro-2mt, ATCC13032::hisEG- introduced mutations It was confirmed that the concentration of L-glutamic acid produced by the pro-3mt strain was similar to the concentration of L-glutamic acid produced by the wild-type Corynebacterium glutamicum ATCC13869 and ATCC13032 strains.
[166]
On the other hand, the wild-type Corynebacterium glutamicum ATCC13869 and ATCC13032 strains produced glycine at 122 and 73 mg/L, respectively, while the ATCC13869::hisEG-pro-2mt and ATCC13032::hisEG-pro-2mt strains were 134, respectively. And 91 mg/L, confirming that the glycine concentration produced in the mutated strain was higher than in the wild-type strain. In addition, ATCC13869::hisEG-pro-3mt and ATCC13032::hisEG-pro-3mt strains produced glycine at 141 and 99 mg/L, respectively, and ATCC13869::hisEG-pro-2mt and ATCC13032::hisEG-pro-2mt It was confirmed that the glycine concentration produced was higher than that of the strain.
[167]
That is, it was confirmed that the above mutations significantly increased the ability to produce glycine while maintaining little effect on the ability of microorganisms to produce L-glutamic acid.
[168]
Meanwhile, the ATCC13869::hisEG-pro-2mt and ATCC13869::hisEG-pro-3mt strains are strained at the Korea Microbial Conservation Center (KCCM), a depository institution under the Budapest Treaty on February 28, 2018 and March 14, 2019. International deposits under the names "CA02-9206" and "CA02-9215" have been given the deposit numbers of "KCCM12226P" and "KCCM12457P".
[169]
[170]
Example 4. Confirmation of the amount of glutamic acid and glycine production of KFCC11074 with mutations introduced
[171]
Example 4-1. Vector creation with mutations
[172]
In addition to the wild-type strain, in order to confirm whether the above mutations exhibit the same effect even in a strain having increased glutamic acid production capacity, it was attempted to introduce the mutation into the KFCC11074 strain known as the glutamic acid producing strain (Korean Patent Publication No. 10-0292299).
[173]
Specifically, the 53th and 55th nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1 contained in the strain are replaced by T, or the 53th and 55th nucleotides of the polynucleotide sequence represented by SEQ ID NO: 1 are substituted by T And a gene replacement vector was constructed to replace the 60th nucleotide with G. Gene fragments for constructing the vector were obtained through PCR using ATCC13869 genomic DNA as a template. Based on information on the Corynebacterium glutamicum (ATCC13869) gene and surrounding sequences registered in the National Institutes of Health, NIH GenBank, polys of SEQ ID NOs: 6, 7, 8, 9, 10, and 11 Primers containing nucleotides were prepared.
[174]
The conditions of PCR were denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute was repeated 30 times, followed by polymerization reaction at 72°C for 5 minutes. More specifically, 500 bp polynucleotides amplified using primers of SEQ ID NOs: 6 and 7 and 500 bp polynucleotides amplified using primers of SEQ ID NOs: 8 and 9 were obtained. One gene containing the hisE promoter by linking the obtained two gene fragments to the pDZ vector (Republic of Korea Patent No. 10-0924065 and International Patent Publication No. 2008-033001) cut with restriction enzyme SalI. A substitution vector was constructed, which was named "pDZ-hisE-pro-2mt". In addition, 500 bp polynucleotides amplified using primers of SEQ ID NOs: 6 and 11 and 500 nucleotides polynucleotides amplified using primers of SEQ ID NOs: 10 and 9 were obtained. One gene containing the hisE promoter by linking the obtained two gene fragments to the pDZ vector (Republic of Korea Patent No. 10-0924065 and International Patent Publication No. 2008-033001) cut with restriction enzyme SalI. A replacement vector was constructed, which was named "pDZ-hisE-pro-3mt". Primer sequence information used for the construction of the vector is shown in Table 3 below.
[175]
[176]
[Table 3]
Sequence number Primer name 5'sequence 3'
6 Hise pro 2mt AF GATCCTCTAGAGTCGACTTCGACGAATCCCTCG
7 hisE-pro-2mt-AR CGGTACATTATACCACACAACAGTTATCAATG
8 hisE-pro-2mt-BF GTGGTATAATGTACCGAGTGAAGACATTTGAC
9 hisE-pro-2mt-BR ATGCCTGCAGGTCGACTGATACCCAAATCGAG
10 hisE-pro-3mt-AR CGGTCCATTATACCACACAACAGTTATCAATG
11 hisE-pro-3mt-BF GTGG TATAATGG ACCGAGTGAAGACATTTGAC
[177]
[178]
Example 4-2. Production of KFCC11074 with mutations and confirmation of glutamic acid and glycine production
[179]
The gene replacement vectors produced through Example 4-1 were introduced by electroporation into the KFCC11074 strains, pDZ-hisE-pro-2mt and pDZ-hisE-pro-3mt, to produce glutamic acid and glycine-producing strains with mutations introduced therein. "KFCC11074_Pro(2mt)_hisEG" and "KFCC11074_Pro(3mt)_hisEG" were produced.
[180]
Specifically, it was produced through transformation (Appl. Microbiol. It was selected from the agar nutrient medium containing. The selected primary strain was again subjected to a second cross-over, and strains into which two and three target mutations were introduced were selected, respectively. Whether the final transformed strain was changed (substituted) was confirmed through sequencing after PCR was performed using primer pairs of SEQ ID NOs: 6 and 9.
[181]
Thereafter, the selected strains KFCC11074_Pro(2mt)_hisEG and KFCC11074_Pro(3mt)_hisEG were spread on a nutrient medium and cultured at 30°C for 16 hours. Thereafter, 25 ml of autoclaved fermentation medium at 121° C. was dispensed into an Erlenmeyer flask for 250 ml shaking and inoculated with a strain cultured in a nutrient medium and cultured for 48 hours. The culture conditions were adjusted to 200 rpm, temperature 37°C, pH 8.0. The composition of the nutrient medium and fermentation medium is as follows.
[182]
[183]
Nutritional medium :
[184]
Glucose 1%, juicy 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2
[185]
[186]
Fermentation medium :
[187]
6% raw sugar, 5% calcium carbonate, 2.25% ammonium sulfate, 0.1% potassium monophosphate, 0.04% magnesium sulfate, 10 mg/L iron sulfate, 0.3 mg/L biotin, 0.2 mg/L thiamine hydrochloride
[188]
[189]
After the incubation, L-glutamic acid and glycine production were measured through a method using HPLC, and measurement results are shown in Table 4 below.
[190]
[191]
[Table 4]
Strain name L-glutamic acid (g/L) L-glycine (mg/L)
KFCC11074 11.8 170
KFCC11074_Pro(2mt)_hisEG 11.7 203
KFCC11074_Pro(3mt)_hisEG 12.0 212
[192]
[193]
As shown in Table 4, the concentration of L-glutamic acid produced by the strains introduced Corynebacterium glutamicum KFCC11074_Pro(2mt)_hisEG and KFCC11074_Pro(3mt)_hisEG strains, Corynebacterium glue without mutation introduced It was confirmed that the concentration of L-glutamic acid produced by the Tamicum KFCC11074 strain was similar.
[194]
On the other hand, it was confirmed that the concentration of glycine produced by the KFCC11074_Pro(2mt)_hisEG and KFCC11074_Pro(3mt)_hisEG strains was increased by 33 mg/L and 42 mg/L, respectively, compared to the glycine concentration produced by the KFCC11074.
[195]
That is, it was confirmed that while maintaining the mutagenicity of L-glutamic acid of the microorganism without significantly affecting it, the ability to generate glycine was significantly increased.
[196]
[197]
Example 5. Production of strains induced to release the inhibitory inhibitor of HisG and confirmation of the amount of glutamic acid and glycine produced
[198]
[199]
Example 5-1. Vector creation with hisG feedback suppression mutation introduced
[200]
Through the above Examples 1-1 to 4-2, it was confirmed that the glycine generation ability of the strain is increased by mutations in the promoter of the hisEG gene. Was introduced, and its glycine production capacity was confirmed.
[201]
Meanwhile, the hisE and hisG genes are composed of operons, and these genes are involved in the histidine biosynthesis pathway. In particular, since the HisG is subject to feedback suppression by the product histidine, it was intended to confirm whether the glycine production capacity of the strain is increased when the activity of HisG is increased by introducing a mutation in which feedback suppression is released.
[202]
Specifically, it was intended to introduce G233H and T235Q mutations (Schendzielorz et al., 2014) known in the literature to the hisG gene. In order to replace the 233rd and 235th amino acids of the hisG amino acid sequence represented by SEQ ID NO: 16 with H and Q, respectively, a gene replacement vector was constructed. Gene fragments for constructing the vector were obtained through PCR using ATCC13869 genomic DNA as a template. Based on the information on the Corynebacterium glutamicum (ATCC13869) gene and the surrounding nucleotide sequence registered in the US National Institute of Health Gene Bank, primers comprising polynucleotides of SEQ ID NOs: 12, 13, 14 and 15 were prepared. .
[203]
The conditions of PCR were denaturation at 95°C for 5 minutes, then denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute was repeated 30 times, followed by polymerization reaction at 72°C for 5 minutes. Polynucleotides of 722 bp amplified using primers of SEQ ID NOs: 12 and 13 and polynucleotides of 798 bp amplified using primers of SEQ ID NOs: 14 and 15 were obtained. The obtained two gene fragments were linked to the pDZ vector (Republic of Korea Patent No. 10-0924065 and International Patent Publication No. 2008-033001) cut with restriction enzyme SalI using infusion enzyme to change hisG (G233H/T235Q) mutation. One 1.5kbp gene replacement vector containing polynucleotides was constructed, which was designated as "pDZ-hisG(G233H/T235Q)". Primer sequence information used for the construction of the vector is shown in Table 5 below.
[204]
[205]
[Table 5]
Sequence number Primer name 5'sequence 3'
12 hisG (G233H / T235Q) -AF GATCCTCTAGAGTCGACCCCAAACAAGGGCTCGC
13 hisG(G233H/T235Q)-AR CGTGCCAGTGGGGATACCTGTGGGTGGG
14 hisG(G233H/T235Q)-BF AACCCCAGGCCTATCCCACCCACAGGTATC
15 hisG(G233H/T235Q)-BR ATGCCTGCAGGTCGACGCAAGGTTGGCAACAAC
[206]
[207]
Example 5-2. Fabrication and evaluation of hisE promoter mutant strains with HisG feedback suppression-inhibiting mutation
[208]
The gene replacement vector “pDZ-hisG(G233H/T235Q)” prepared in Example 5-1 was introduced into the KFCC11074 strain to produce a “KFCC11074_hisG(G233H/T235Q)” strain whose HisG feedback suppression was released. In addition, by introducing the vector into the KFCC11074_Pro(2mt)_hisEG and KFCC11074_Pro(3mt)_hisEG strains, "KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG" and "KFCC11074_hisG(G233H/T235Q) introduced with variations of the present application (3mt)_hisEG" strain was produced.
[209]
Specifically, the strain was produced through transformation (Appl. It was selected from agar nutrient medium containing mg/L. The selected primary strain was again subjected to a second cross-over, and the strain into which the target G233H/T235Q mutation was introduced was selected. Whether the final transformed strain was changed (substituted) was confirmed by sequencing after PCR was performed using primer pairs of SEQ ID NOs: 12 and 15.
[210]
Then, the selected strains KFCC11074_hisG(G233H/T235Q), KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG and KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG were cultured in the same manner as in Example 4-2, and cultured. After completion, L-glutamic acid concentration and glycine concentration in each medium were measured. The measured concentrations of L-glutamic acid and glycine are shown in Table 6 below.
[211]
[212]
[Table 6]
Strain name L-glutamic acid (g/L) L-glycine (mg/L)
KFCC11074_hisG (G233H / T235Q) 10.3 445.7
KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG 10.1 760.0
KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 10.3 783.2
[213]
[214]
As shown in Table 6, L-glutamic acid produced by the Corynebacterium glutamicum KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG and KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG strains into which hisEG promoter mutation has been introduced. It was confirmed that the concentration of LG-glutamic acid produced by the KFCC11074_hisG (G233H/T235Q) strain introduced with only the mutation in which HisG feedback suppression was released was confirmed.
[215]
On the other hand, the concentration of glycine produced by the KFCC11074_hisG(G233H/T235Q)_Pro(2mt)_hisEG and KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG strains is 4.3 glycine concentration compared to the KFCC11074_hisG (G233H/T235Q) 31 It was confirmed that it was significantly increased as mg/L and 337.5 mg/L.
[216]
That is, it was confirmed that the above mutations significantly increased the ability to produce glycine while maintaining little effect on the ability of microorganisms to produce L-glutamic acid. In addition, it can be seen that these effects are caused by increased activity of hisE and hisG.
[217]
[218]
Example 6. Preparation of fermentation composition for preparing seasoning product
[219]
[220]
As described above, it was confirmed that the strain containing the nucleotide of the present application increases the ability to produce glycine without significantly affecting the ability to produce L-glutamic acid. Therefore, it was intended to prepare a fermentation composition using a microorganism of the genus Corynebacterium containing the nucleotide of the present application.
[221]
[222]
Illustratively, it was prepared by using glutamic acid, a well-known seasoning material as a main ingredient, but the fermentation strain and fermentation process were adjusted to increase byproduct ingredients of other seasonings to increase the composition of rich taste.
[223]
[224]
Example 6-1. Preparation of fermentation composition using 5L fermentation tank
[225]
[226]
Specifically, for the strain used in Example 5, it was intended to prepare a fermentation composition using a 5L fermenter.
[227]
[228]
All ingredients used in the production of the culture medium were used only food grade ingredients.
[229]
[230]
Primary seed medium: contains 1% glucose, 1% yeast extract, 1% peptone, 0.1% ammonium sulfate, 0.25% sodium chloride, 0.15% potassium phosphate, 0.15% potassium phosphate dibasic, and has a pH of 8.0 A seed medium was prepared.
[231]
Secondary medium: 98.5% pure organic sugar 4.6%, magnesium sulfate 0.05%, yeast extract 0.5%, potassium phosphate 0.2%, iron sulfate 0.002%, biotin 1 mg/l, thiamine hydrochloride 2 mg/l and some A secondary seed medium containing an antifoaming agent and having a pH of 7.2 was prepared.
[232]
Fermentation medium: 48.5% organic raw sugar with purity of 98.5%, 0.03% of magnesium sulfate, 1% of yeast extract, 0.22% of phosphoric acid, 0.4% of potassium hydroxide, 0.2mg/l of biotin, 0.6mg/l of thiamine hydrochloride, 0.002% of manganese sulfate, sulfuric acid A fermentation medium having a pH of 7.4 was prepared containing 0.002% iron, 0.002% zinc sulfate, 0.0006% copper sulfate and some antifoaming agent.
[233]
[234]
50 ml of the primary seed medium was dispensed into an Erlenmeyer flask for 500 ml of volume, autoclaved at 121° C. for 20 minutes, cooled, and then inoculated with the strains, respectively, 200 revolutions/minute, 5~5 at a temperature of 30° C. The culture was shaken for 7 hours.
[235]
[236]
The secondary seedling medium was prepared in 0.25L in a 1.5L test fermentation tank, cooled by autoclaving at 121°C for 20 minutes, and then inoculated with 50 ml of the primary seed culture solution, followed by 900 revolutions/min, 31.5°C Incubated for 15 hours.
[237]
[238]
The fermentation medium was prepared in 0.25 L in a 5 L volume test fermentation tank, and autoclaved at 121° C. for 20 minutes, cooled, and then inoculated with 0.26 L of the secondary seed culture solution, and the number of revolutions was 900 times/min, 30 to 34° C. Cultured in
[239]
[240]
While incubating under the above conditions, 28% ammonia water was continuously adjusted so that the pH of the fermentation broth in the range of 7.0 to 7.4 during the culture of Corynebacterium glutamicum. When the concentration of the remnant sugar in the culture is 0.5 to 1.5%, sterilized organic raw sugar is added at any time to continue culturing until the total added sugar is 30 to 34% of the fermentation broth.
[241]
[242]
[Table 7]
Strain name Analysis result (g/l)
main ingredient by-product
Solids Glutamic acid Glycine amino acid Organic acids Residual sugar ion
KFCC11074 140.2 64.2 0.18 11.5 3.5 12.0 11.1
KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG 147.3 59.0 2.43 16.4 2.7 15.1 10.7
[243]
[244]
As a result, as shown in Table 7, the production amount of glutamic acid between the two strains was not significantly different, but the mutation was introduced Corynebacterium glutamicum KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG strain produced fermentation broth It was confirmed that the content of glycine was significantly increased.
[245]
[246]
Even in the case of a fermentation composition using a 3 kL fermenter, the amount of glutamic acid produced between the two strains does not differ significantly, but the variant introduced Corynebacterium glutamicum KFCC11074_hisG(G233H/T235Q)_Pro(3mt)_hisEG strain compared to the KFCC11074 strain Thus, it was confirmed that the content of glycine was significantly increased (0.2 g/L vs 3.2 g/L) without a significant difference in the amount of glutamic acid (64.2 g/L vs 73 g/L).
[247]
[248]
From the above description, those skilled in the art to which the present application pertains will understand that the present application may be implemented in other specific forms without changing its technical spirit or essential characteristics. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present application is to be construed as including the scope and scope of the present application in the form of all changes or modifications derived from the meaning and scope of the claims and their equivalent concepts, rather than the detailed description above.
[249]
[250]
[251]
We Claim
[Claim 1]
Polynucleotide having a promoter activity, wherein the 53th and 55th nucleotides of the nucleotide sequence represented by SEQ ID NO: 1 are substituted with T, or the 53th and 55th nucleotides are substituted with T and the 60th nucleotide is substituted with G.
[Claim 2]
The polynucleotide according to claim 1, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
[Claim 3]
The polynucleotide according to claim 1 or 2, wherein the polynucleotide is operably linked to a gene encoding a target protein.
[Claim 4]
The polynucleotide of claim 1 or 2; And a gene encoding a target protein operably linked to the polynucleotide.
[Claim 5]
The vector of claim 4, wherein the target protein is phosphoribosyl-ATP pyrophosphatase (HISE), ATP phosphoribosyltransferase (HisG), or a combination thereof.
[Claim 6]
The polynucleotide of claim 1; And a gene encoding a target protein operably linked to the polynucleotide, a microorganism of the genus Corynebacterium.
[Claim 7]
The microorganism of the genus Corynebacterium according to claim 6, wherein the polynucleotide consists of the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.
[Claim 8]
The microorganism of the genus Corynebacterium according to claim 7, wherein the target protein is phosphoribosyl-ATP pyrophosphatase (HISE), ATP phosphoribosyltransferase (HisG) or a combination thereof. .
[Claim 9]
According to claim 8, wherein the ATP phosphoribosyltransferase (ATP phosphoribosyltransferase: HisG) is the amino acid sequence 233 and 235 of the HisG amino acid sequence represented by SEQ ID NO: 16, histidine (H) and glutamine (Q), respectively. , Microorganisms of the genus Corynebacterium.
[Claim 10]
The microorganism according to any one of claims 6 to 9, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.
[Claim 11]
Culturing the microorganism of the genus Corynebacterium in any one of claims 6 to 9 in a medium; And recovering the target substance from the medium.
[Claim 12]
The method of claim 11, wherein the target substance is an amino acid.
[Claim 13]
A method for producing a fermentation composition comprising the step of culturing the microorganism of the genus Corynebacterium in any one of claims 6 to 9 in a medium.
[Claim 14]
A fermentation composition prepared by the method of claim 13.
| # | Name | Date |
|---|---|---|
| 1 | 202017006212-FER.pdf | 2024-07-01 |
| 1 | 202017006212-STATEMENT OF UNDERTAKING (FORM 3) [13-02-2020(online)].pdf | 2020-02-13 |
| 2 | 202017006212-Correspondence-140920.pdf | 2021-10-19 |
| 2 | 202017006212-SEQUENCE LISTING(PDF) [13-02-2020(online)].pdf | 2020-02-13 |
| 3 | 202017006212-SEQUENCE LISTING [13-02-2020(online)].txt | 2020-02-13 |
| 3 | 202017006212-Correspondence-160720.pdf | 2021-10-19 |
| 4 | 202017006212-PRIORITY DOCUMENTS [13-02-2020(online)].pdf | 2020-02-13 |
| 4 | 202017006212-Correspondence-170220.pdf | 2021-10-19 |
| 5 | 202017006212-Form 5-160720.pdf | 2021-10-19 |
| 5 | 202017006212-FORM 1 [13-02-2020(online)].pdf | 2020-02-13 |
| 6 | 202017006212-OTHERS-140920.pdf | 2021-10-19 |
| 6 | 202017006212-DECLARATION OF INVENTORSHIP (FORM 5) [13-02-2020(online)].pdf | 2020-02-13 |
| 7 | 202017006212-Power of Attorney-160720.pdf | 2021-10-19 |
| 7 | 202017006212-COMPLETE SPECIFICATION [13-02-2020(online)].pdf | 2020-02-13 |
| 8 | 202017006212.pdf | 2021-10-19 |
| 8 | 202017006212-Proof of Right [30-04-2020(online)].pdf | 2020-04-30 |
| 9 | 202017006212-FORM-26 [30-04-2020(online)].pdf | 2020-04-30 |
| 9 | OPA18518_Sequence Listing-202017006212-170220.pdf | 2021-10-19 |
| 10 | 202017006212-ENDORSEMENT BY INVENTORS [30-04-2020(online)].pdf | 2020-04-30 |
| 10 | Seq. lisitng-202017006212-170220.pdf | 2021-10-19 |
| 11 | 202017006212-Certified Copy of Priority Document [30-04-2020(online)].pdf | 2020-04-30 |
| 11 | 202017006212-FORM 18 [04-12-2020(online)].pdf | 2020-12-04 |
| 12 | 202017006212-FORM 3 [07-08-2020(online)].pdf | 2020-08-07 |
| 12 | 202017006212-FORM-26 [02-06-2020(online)].pdf | 2020-06-02 |
| 13 | 202017006212-certified copy of translation [09-07-2020(online)].pdf | 2020-07-09 |
| 13 | 202017006212-FORM-26 [12-06-2020(online)].pdf | 2020-06-12 |
| 14 | 202017006212-certified copy of translation [09-07-2020(online)].pdf | 2020-07-09 |
| 14 | 202017006212-FORM-26 [12-06-2020(online)].pdf | 2020-06-12 |
| 15 | 202017006212-FORM 3 [07-08-2020(online)].pdf | 2020-08-07 |
| 15 | 202017006212-FORM-26 [02-06-2020(online)].pdf | 2020-06-02 |
| 16 | 202017006212-Certified Copy of Priority Document [30-04-2020(online)].pdf | 2020-04-30 |
| 16 | 202017006212-FORM 18 [04-12-2020(online)].pdf | 2020-12-04 |
| 17 | Seq. lisitng-202017006212-170220.pdf | 2021-10-19 |
| 17 | 202017006212-ENDORSEMENT BY INVENTORS [30-04-2020(online)].pdf | 2020-04-30 |
| 18 | 202017006212-FORM-26 [30-04-2020(online)].pdf | 2020-04-30 |
| 18 | OPA18518_Sequence Listing-202017006212-170220.pdf | 2021-10-19 |
| 19 | 202017006212-Proof of Right [30-04-2020(online)].pdf | 2020-04-30 |
| 19 | 202017006212.pdf | 2021-10-19 |
| 20 | 202017006212-COMPLETE SPECIFICATION [13-02-2020(online)].pdf | 2020-02-13 |
| 20 | 202017006212-Power of Attorney-160720.pdf | 2021-10-19 |
| 21 | 202017006212-DECLARATION OF INVENTORSHIP (FORM 5) [13-02-2020(online)].pdf | 2020-02-13 |
| 21 | 202017006212-OTHERS-140920.pdf | 2021-10-19 |
| 22 | 202017006212-FORM 1 [13-02-2020(online)].pdf | 2020-02-13 |
| 22 | 202017006212-Form 5-160720.pdf | 2021-10-19 |
| 23 | 202017006212-Correspondence-170220.pdf | 2021-10-19 |
| 23 | 202017006212-PRIORITY DOCUMENTS [13-02-2020(online)].pdf | 2020-02-13 |
| 24 | 202017006212-SEQUENCE LISTING [13-02-2020(online)].txt | 2020-02-13 |
| 24 | 202017006212-Correspondence-160720.pdf | 2021-10-19 |
| 25 | 202017006212-SEQUENCE LISTING(PDF) [13-02-2020(online)].pdf | 2020-02-13 |
| 25 | 202017006212-Correspondence-140920.pdf | 2021-10-19 |
| 26 | 202017006212-STATEMENT OF UNDERTAKING (FORM 3) [13-02-2020(online)].pdf | 2020-02-13 |
| 26 | 202017006212-FER.pdf | 2024-07-01 |
| 27 | 202017006212-MARKED COPIES OF AMENDEMENTS [31-12-2024(online)].pdf | 2024-12-31 |
| 28 | 202017006212-FORM 13 [31-12-2024(online)].pdf | 2024-12-31 |
| 29 | 202017006212-FER_SER_REPLY [31-12-2024(online)].pdf | 2024-12-31 |
| 30 | 202017006212-CLAIMS [31-12-2024(online)].pdf | 2024-12-31 |
| 31 | 202017006212-AMMENDED DOCUMENTS [31-12-2024(online)].pdf | 2024-12-31 |
| 32 | 202017006212-PatentCertificate08-01-2025.pdf | 2025-01-08 |
| 33 | 202017006212-IntimationOfGrant08-01-2025.pdf | 2025-01-08 |
| 1 | 202017006212E_28-06-2024.pdf |