Sign In to Follow Application
View All Documents & Correspondence

Novel Promoter And Purine Nucleotide Production Method Using Said Promoter

Abstract: The present application relates to a novel polynucleotide having promoter activity, a composition comprising same for gene expression, and a purine nucleotide production method using same.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
16 October 2019
Publication Number
22/2021
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
cal@patentindia.com
Parent Application
Patent Number
Legal Status
Grant Date
2023-07-24
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330, Dongho-ro, Jung-gu, Seoul 04560

Inventors

1. BAEK, Min Ji
102-902, 15, Gwanggyohosu-ro, Yeongtong-gu, Suwon-si, Gyeonggi-do 16515
2. LEE, Ji Hye
106-1301, 121, Gwanak-daero, Dongan-gu, Anyang-si, Gyeonggi-do 13922
3. PARK, So-jung
205-1406, 92, Jungbu-daero 223beon-gil, Paldal-gu, Suwon-si, Gyeonggi-do 16496
4. BAE, Jee Yeon
101-2013, 373, Gwongwang-ro, Paldal-gu Suwon-si Gyeonggi-do 16493

Specification

novel promoter and method for producing purine nucleotides using the same
Technical field
[One]
The present application relates to a polynucleotide having a novel promoter activity, a composition for gene expression comprising the same, a microorganism, a method for preparing a purine nucleotide using the same, and a use of the polynucleotide.
[2]
Background
[3]
One of the nucleic acid-based substances, 5'-inosine monophosphate (IMP), is an intermediate material in the metabolic system of nucleic acid biosynthesis and is used in various fields such as pharmaceuticals and various medical applications. In addition, in addition to 5'-guanine monophosphate (hereinafter referred to as GMP), it is a material that is widely used as a food seasoning additive or for food. IMP is known to taste beef by itself and, like GMP, is known to enhance the flavor of monosodium glutamic acid (MSG), and is gaining attention as a tasteful nucleic acid seasoning.
[4]
As a method of producing IMP, a method of enzymatically decomposing ribonucleic acid extracted from yeast cells, a method of chemically phosphorylating inosine produced by fermentation (Agri. Biol. Chem., 36, 1511 (1972), etc.) And a method of culturing a microorganism that directly produces IMP and recovering IMP in a culture solution. Among these methods, the most widely used method is a method using a microorganism capable of directly producing IMP.
[5]
In addition, as a method of manufacturing GMP, a method of converting 5'-xanthosine monophosphate (XMP) produced by microbial fermentation to GMP using coryneform microorganisms, and XMP produced by microbial fermentation There is a method of converting to GMP using Lycia coli. In the case of producing XMP among the above methods and then converting it to GMP, the productivity of XMP, a precursor of the conversion reaction during microbial fermentation, must be enhanced, and not only the produced XMP, but also the GMP already generated during the entire process of the conversion reaction. Should not be lost.
[6]
On the other hand, enzymes in their natural state do not always exhibit optimal properties in terms of activity, stability, and substrate specificity for optical isomers required for industrial use. Attempts have been made. Among them, rational design and site-directed mutagenesis methods of enzymes have been applied to improve enzyme function, but in many cases, information on the structure of the target enzyme is insufficient or structure- It has a disadvantage that it cannot be effectively applied because the correlation between functions is not clear. In this case, it has been reported that the activity of the enzyme is improved by attempting to improve the enzyme through a directed evolution method of screening for an enzyme of a desired trait from a mutant enzyme library constructed through random mutation of an enzyme gene.
[7]
Detailed description of the invention
Technical challenge
[8]
In order to produce purine nucleotides in high yield by the method of producing purine nucleotides through the microbial fermentation, the inventors conducted extensive research and completed the present application by discovering a promoter useful for producing higher purine nucleotides.
[9]
Means of solving the task
[10]
One object of the present application is to provide a polynucleotide having promoter activity.
[11]
Another object of the present application is to provide a composition for gene expression comprising the polynucleotide.
[12]
Another object of the present application is to provide a vector including the polynucleotide and the gene encoding the protein of interest.
[13]
Another object of the present application is to provide a microorganism of the genus Corynebacterium containing the vector.
[14]
Another object of the present application is to provide a microorganism of the genus Corynebacterium comprising a gene encoding the polynucleotide and the protein of interest.
[15]
Another object of the present application is to provide a method for producing purine nucleotides, including the step of culturing the microorganism in a medium.
[16]
Another object of the present application is to provide a use of the polynucleotide for increasing the expression of a protein of interest.
[17]
Effects of the Invention
[18]
In the case of culturing a microorganism of the genus Corynebacterium using the polynucleotide having the novel promoter activity of the present application, it is possible to produce purine nucleotides in high yield. In addition, the prepared purine nucleotides can be applied to various products such as human food or food additives, seasonings, pharmaceuticals, as well as animal feed or animal feed additives.
[19]
Best mode for carrying out the invention
[20]
This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present application belong to the scope of the present application. In addition, it cannot be considered that the scope of the present application is limited by the specific description described below.
[21]
[22]
One aspect of the present application for achieving the above object is to provide a polynucleotide having promoter activity, including one or more nucleotide substitutions in the polynucleotide sequence of SEQ ID NO: 1. Specifically, the present application provides a polynucleotide having promoter activity including one or more nucleotide substitutions in the polynucleotide sequence of SEQ ID NO: 1, and the polynucleotide substitution is a group consisting of substitution of the 143 nucleotide and the substitution of the 189 nucleotide. It includes at least any one selected from.
[23]
In another aspect of the present application, in the polynucleotide sequence of SEQ ID NO: 1, a) the 143th nucleotide is substituted with thymine (T), b) the 189th nucleotide is substituted with thymine (T), or c) the 143th nucleotide is It is to provide a polynucleotide having promoter activity in which thymine (T) is substituted and the 189th nucleotide is substituted with thymine (T).
[24]
[25]
In the present application, the term "polynucleotide" is a polymer of nucleotides in which a nucleotide unit (monomer) is connected in a long chain by covalent bonds, and is a DNA strand having a predetermined length or more.
[26]
In the present application, the term "polynucleotide having a promoter activity" refers to a DNA region present near a site to which a target gene is transcribed, including a site to which an RNA polymerase or enhancer, etc. binds for expression of the target gene to be linked later do. For the purposes of the present application, the polynucleotide may be used as a universal weakening promoter. As an example, it can be used as a promoter capable of weakening the expression of adenilosuccinate synthetase. In addition, the polynucleotide refers to a polynucleotide involved in producing or increasing purine nucleotides, but is not limited thereto.
[27]
[28]
In the present application, SEQ ID NO: 1 refers to a polynucleotide sequence having promoter activity. The polynucleotide sequence of SEQ ID NO: 1 can be obtained from GenBank of NCBI, a known database. For example, it may be derived from Corynebacterium sp. , but is not limited thereto.
[29]
In addition, the polynucleotide may be a polynucleotide in which the 143th and/or 189th nucleotides in the sequence of SEQ ID NO: 1 are substituted with other nucleotides. Such a polynucleotide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity ( identity) means that the 143th and/or 189th nucleotides in the nucleotide sequence have been substituted with other nucleotides. A nucleotide sequence having homology or identity may exclude a sequence having 100% identity from the above categories, or may be a sequence having less than 100% identity.
[30]
For example, the polynucleotide of the present application is, in the polynucleotide sequence of SEQ ID NO: 1, a) the 143th nucleotide is substituted with thymine (T), b) the 189th nucleotide is substituted with thymine (T), or c) the 143th nucleotide Is substituted with thymine (T) and the 189th nucleotide is substituted with thymine (T), but may have promoter activity, but is not limited thereto. Specifically, the polynucleotide of the present application may include the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4, but is not limited thereto. More specifically, the polynucleotide in which the 143th nucleotide of the present application is substituted with thymine (T) is SEQ ID NO: 2, and the polynucleotide in which the 189th nucleotide is substituted with thymine (T) is SEQ ID NO: 3 or the 143th nucleotide is thymine ( The polynucleotide in which T) and the 189th nucleotide is substituted with thymine (T) may consist of the nucleotide sequence of SEQ ID NO: 4, but is not limited thereto. The polynucleotide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 2, 3, or 4 ) May have. The polynucleotide sequence having homology or identity may be a sequence having 100% identity excluded or less than 100% identity in the above categories.
[31]
[32]
In addition, even if it is described in the present application as'polynucleotide having a nucleotide sequence described in a specific sequence number', if it has the same or corresponding activity as a polynucleotide consisting of the nucleotide sequence of the sequence number, some sequences are deleted, It is obvious that polynucleotides having modified, substituted or added nucleotide sequences can also be used in the present application. For example, if it has the same or corresponding activity as the polynucleotide, in addition to the specific 143th or 189th mutation that confers a specific activity, an insignificant sequence addition before or after the nucleotide sequence of the corresponding sequence number or a mutation that may occur naturally Or, it does not exclude a silent mutation thereof, and it is apparent that even if such sequence addition or mutation is included, it falls within the scope of the present application.
[33]
[34]
Homology and identity refer to the degree to which two given base sequences are related and can be expressed as a percentage.
[35]
The terms homology and identity can often be used interchangeably.
[36]
The sequence homology or identity of conserved polynucleotides is determined by standard alignment algorithms, and the default gap penalty established by the program used can be used together. Substantially, homologous or identical (identical) sequences are generally in moderate or high stringent conditions along at least about 50%, 60%, 70%, 80% or 90% of the entire sequence or full-length. (stringent conditions) can be hybridized. Polynucleotides containing degenerate codons instead of codons in hybridizing polynucleotides are also contemplated.
[37]
Whether any two polynucleotide sequences have homology, similarity or identity can be determined, for example, in Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: Can be determined using a known computer algorithm such as the "FASTA" program using default parameters as in 2444. Alternatively, as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) can be used to determine. (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) For example, the BLAST, or ClustalW of the National Center for Biotechnology Information can be used to determine homology, similarity, or identity.
[38]
Homology, similarity or identity of polynucleotides is described, for example, in Smith and Waterman, Adv. Appl. As known in Math (1981) 2:482, for example, Needleman et al. (1970), J Mol Biol. 48: It can be determined by comparing sequence information using a GAP computer program such as 443. In summary, the GAP program is defined as the total number of symbols in the shorter of two sequences, divided by the number of similarly aligned symbols (ie, nucleotides or amino acids). The default parameters for the GAP program are (1) a monolithic comparison matrix (contains a value of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. As disclosed by 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); And (3) no penalty for end gaps. Thus, as used herein, the term “homology” or “identity” refers to the relevance between sequences.
[39]
[40]
In addition, the polynucleotide of the present application has various modifications to the coding region within a range that does not change the polynucleotide sequence due to the degeneracy of the codon or in consideration of the preferred codon in the organism to express the polynucleotide. This can be done. Any polynucleotide sequence in which the 143th and/or 189th nucleotides in the nucleotide sequence of SEQ ID NO: 1 are substituted with other nucleotides may be included without limitation. In addition, a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the nucleotide sequence and hydride under stringent conditions, the 143th and/or 189th in the nucleotide sequence of SEQ ID NO: 1 Any polynucleotide sequence in which nucleotides are substituted with other nucleotides may be included without limitation. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. These conditions are specifically described in the literature (eg, J. Sambrook et al., homolog). For example, between genes with high homology or identity, 40% or more, specifically 80% or more, 85% or more, 90% or more, more specifically 95% or more, more specifically Hybridization between genes with more than 97%, in particular, more than 99% homology or identity, and under conditions that do not hybridize with genes with lower homology or identity, or washing with ordinary southern hybridization Conditions of 60°C, 1XSSC, 0.1% SDS, specifically 60°C,
[41]
Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases capable of hybridizing to each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
[42]
Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55° C. and using the above-described conditions. In addition, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art according to the purpose.
[43]
The appropriate stringency to hybridize a polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the parameters are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
[44]
[45]
Another aspect of the present application is to provide a composition for gene expression comprising the polynucleotide.
[46]
The composition for gene expression refers to a composition capable of expressing a gene that can be expressed by the promoter of the present application. For example, the composition for gene expression includes a polynucleotide having a novel promoter activity, and may further include, without limitation, a configuration capable of operating the polynucleotide as a promoter. In the composition for gene expression of the present application, the polynucleotide may be in a form included in a vector to express a gene operably linked in the introduced host cell.
[47]
[48]
Another aspect of the present application includes a vector including a polynucleotide having the promoter activity or a gene encoding the polynucleotide and a protein of interest. Specifically, the target protein may be adenilosuccinate synthetase, but is not limited thereto.
[49]
The term "vector" as used in the present application means a DNA preparation containing a base sequence encoding the target polynucleotide operably linked to a suitable control sequence so that the target polynucleotide can be expressed in a suitable host. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. Vectors can be transformed into suitable host cells and then replicated or function independently of the host genome, and can be integrated into the genome itself.
[50]
The vector used in the present application is not particularly limited as long as it can be replicated in a host cell, and any vector known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as a phage vector or a cosmid vector, and as a plasmid vector, pBR system, pUC system, pBluescriptII system , pGEM system, pTZ system, pCL system, pET system, etc. can be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, and the like can be used.
[51]
For example, it can be replaced with a target polynucleotide in a chromosome through a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto. A selection marker for confirming whether the chromosome is inserted may be additionally included. Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a nucleic acid molecule of interest, and impart a selectable phenotype such as drug resistance, nutritional demand, resistance to cytotoxic agents, or expression of surface polypeptide Markers can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypic traits, and thus transformed cells can be selected.
[52]
[53]
As another aspect, the present application provides a microorganism of the genus Corynebacterium, including a vector including a polynucleotide having a promoter activity of the present application and a gene encoding a protein of interest.
[54]
In addition, as another aspect, the present application provides a microorganism of the genus Corynebacterium, including a polynucleotide having a promoter activity of the present application and a gene encoding a protein of interest.
[55]
Specifically, the microorganism is a microorganism produced by transformation with a vector containing a polynucleotide having the promoter activity and a gene encoding a protein of interest, or containing the polynucleotide having the promoter activity and a gene encoding the protein of interest It may be a microorganism, but is not limited thereto.
[56]
In the present application, the term "transformation" means introducing a vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. Transformed polynucleotides can include all of them, whether inserted into the chromosome of the host cell or located outside the chromosome, as long as it can be expressed in the host cell. In addition, the polynucleotide includes DNA or RNA encoding a target protein. The polynucleotide may be introduced in any form as long as it can be introduced into a host cell and expressed. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a gene construct containing all elements necessary for self-expression. The expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replicating. In addition, the polynucleotide may be introduced into a host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
[57]
In addition, the term "operably linked" in the above means that a promoter sequence for initiating and mediating transcription of a polynucleotide having promoter activity of the present application and the gene sequence are functionally linked.
[58]
[59]
The term "a microorganism including a polynucleotide and a target protein" as used in the present application refers to a microorganism whose expression of a target protein is regulated by the polynucleotide. The microorganism may be a microorganism capable of producing purine nucleotides, a microorganism having a naturally weak purine nucleotide-producing ability, or a microorganism in which the purine nucleotide-producing ability is imparted to a parent strain that does not have a purine nucleotide-producing ability. Specifically, the microorganism may be a microorganism weakening adenilosuccinate synthetase, for example, a polynucleotide in which the 143th and/or 189th nucleotide in the nucleotide sequence of SEQ ID NO: 1 is substituted with another nucleotide. It may be a microorganism containing, but is not limited thereto. More specifically, the microorganism is a microorganism comprising a polynucleotide having a promoter activity including one or more nucleotide substitutions in the polynucleotide sequence of SEQ ID NO: 1, wherein the polynucleotide substitution is performed in which the 143th nucleotide is substituted with thymine (T). , And/or the 189th nucleotide may include a substitution with thymine (T).
[60]
The host cells or microorganisms may belong to the scope of the present application as long as they are capable of producing purine nucleotides including the polynucleotide and the protein of interest for the purpose of the present application.
[61]
In the present application, the microorganism producing purine nucleotides may be used in combination with a microorganism producing purine nucleotides and a microorganism having purine nucleotide-producing ability.
[62]
[63]
For the purposes of the present application, "purine nucleotide" refers to a nucleotide containing a purine-based structure. For example, it may be IMP, XMP or GMP, but is not limited thereto.
[64]
Specifically, the term "IMP (5'-inosine monophosphate) is one of nucleic acid-based substances composed of the following formula (1).
[65]
[Formula 1]
[66]

[67]
[68]
It is also called 5'-inosine monophosphate, 5'-inosine acid by the IUPAC name, and is widely used as a flavor enhancer along with XMP or GMP in food.
[69]
[70]
The term "GMP (5'-guanine monophosphate)" is one of nucleic acid-based substances composed of the following formula (2).
[71]
[Formula 2]
[72]

[73]
[74]
The IUPAC name is [(2R,3S,4R,5R)-5-(2-Amino-6-oxo-1,6-dihydro-9H-purin-9-yl)-3,4-dihydroxytetrahydro-2-furanyl]methyl It is dihydrogen phosphate, and other names are called 5'-guanidylic acid, 5'-Guanylic acid, or guanylic acid.
[75]
GMP is widely used as a food additive such as sodium guanyate, dipotassium guanyate, and calcium guanyate in the form of a salt, and has a synergistic effect to enhance taste when used as an additive with IMP. GMP can be converted from XMP to be manufactured, but is not limited thereto. As confirmed in an embodiment of the present application, the promoter of the present application can increase the production of XMP, and GMP can also be converted from the increased XMP to increase the production, and the GMP can also be used in the present application. It is obvious to be included in the scope.
[76]
[77]
The term "XMP (5'-xanthosine monophosphate)" is an intermediate substance for purine metabolism composed of the following formula (3). IUPAC is also called 5'-inosine monophosphate, 5'-xanthylic acid, and is formed from IMP through the action of IMP dehydrogenase, or XMP can be converted to GMP through the action of GMP synthase. In addition, XMP can be formed from XTP by (d) the enzyme deoxyribonucleoside triphosphate pyrophosphohydrolase containing XTPase activity.
[78]
[Formula 3]
[79]

[80]
[81]
In the present application, the term "microorganism producing purine nucleotides" includes both wild-type microorganisms or microorganisms that have undergone natural or artificial genetic modification, and causes such as insertion of an external gene or enhancement or inactivation of an endogenous gene. As a result, a specific mechanism is weakened or enhanced, and may be a microorganism having a genetic mutation or enhanced activity for the production of a desired purine nucleotide. For the purpose of the present application, the microorganism producing the purine nucleotide is characterized in that the production capacity of the desired purine nucleotide is increased, including the polynucleotide, and may be specifically a microorganism of the genus Corynebacterium. Specifically, in the present application, a microorganism producing purine nucleotides or a microorganism having purine nucleotide-producing ability may be a microorganism in which a part of a gene in the purine nucleotide biosynthesis pathway is strengthened or weakened, or a part of a gene in the purine nucleotide degradation pathway is strengthened or weakened. have. For example, the microorganism may have enhanced expression of purF , a gene encoding phosphoribosylpyrrophosphate amidotransferase, or enhanced expression of purA . Additionally, the expression of guaB , a gene encoding 5'-inosine dehydrogenase, may be regulated according to purine nucleotides . Specifically, if the purine nucleotide is IMP, guaBExpression may be attenuated, and when the purine nucleotide is XMP or GMP, guaB expression may be enhanced, but is not limited thereto.
[82]
[83]
In the present application, the term "the genus Corynebacterium microorganism that produces purine nucleotides" may be a microorganism of the genus Corynebacterium that has the ability to produce purine nucleotides through a natural type or mutation. Specifically, the microorganism of the genus Corynebacterium having purine nucleotide-producing ability in the present application is transformed with a vector containing a polynucleotide having a promoter activity of the present application or a gene encoding the polynucleotide and a protein of interest. As a result, it may be a microorganism of the genus Corynebacterium that has improved purine nucleotide production capability. The'microorganism of the genus Corynebacterium that has improved purine nucleotide production ability' refers to a microorganism having improved purine nucleotide production ability than the parent strain or unmodified microorganism before the transformation of the trait. The'unmodified microorganism' is a natural strain itself, or a microorganism that does not contain a protein variant that produces the purine nucleotide, or a microorganism that has not been transformed with a vector containing a gene encoding the polynucleotide and the target protein. do.
[84]
In the present application, the "microorganisms of the genus Corynebacterium" specifically refers to Corynebacterium glutamicum ( Corynebacterium glutamicum ), Corynebacterium ammoniagenes , and Brevibacterium lactofermentum . , Brevibacterium Plastic pan ( Brevibacterium flavu m), Corynebacterium thermo amino to Ness ( Corynebacterium thermoaminogenes ), Corynebacterium epi syeonseu ( Corynebacterium efficiens ), Corynebacterium stay Yorkshire varnish ( Corynebacterium stationis) or the like , Is not necessarily limited thereto.
[85]
[86]
As another aspect of the present application, it is to provide a method of producing a target material, comprising the step of culturing the microorganisms of the genus Corynebacterium in a medium. For example, the method of the present application may further include the step of recovering the target material from the microorganism or the medium after the culturing step. Specifically, the target substance may be a purine nucleotide, but is not limited thereto.
[87]
In the above method, the step of culturing the microorganism is not particularly limited, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like. At this time, the culture conditions are not particularly limited thereto, but a basic compound (eg, sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (eg, phosphoric acid or sulfuric acid) is used to provide an appropriate pH (eg, pH 5 to 9, specifically Is capable of adjusting pH 6 to 8, most specifically pH 6.8), and maintaining aerobic conditions by introducing oxygen or an oxygen-containing gas mixture into the culture. The culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and may be cultured for about 10 to 160 hours, but is not limited thereto. Purine nucleotides produced by the culture may be secreted into a medium or may remain in cells.
[88]
In addition, the culture medium used is a carbon source such as sugars and carbohydrates (e.g. glucose, sucrose, lactose, fructose, maltose, molase, starch and cellulose), fats and fats (e.g., soybean oil, sunflower seeds). Oil, peanut oil and coconut oil), fatty acids (such as palmitic acid, stearic acid and linoleic acid), alcohols (such as glycerol and ethanol), and organic acids (such as acetic acid) can be used individually or in combination. , Is not limited thereto. Nitrogen sources include nitrogen-containing organic compounds (e.g. peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea), or inorganic compounds (e.g. ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and Ammonium nitrate) or the like may be used individually or in combination, but is not limited thereto. Potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a sodium-containing salt corresponding thereto may be used individually or in combination as a phosphorus source, but are not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins.
[89]
The method of recovering the purine nucleotides produced in the culture step of the present application may collect the desired purine nucleotides from the culture medium using a suitable method known in the art according to the culture method. For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc. may be used, and desired purine nucleotides may be recovered from a medium or microorganism using a suitable method known in the art.
[90]
In addition, the recovery step may include a purification process, and may be performed using a suitable method known in the art. Accordingly, the recovered purine nucleotides may be purified form or microbial fermentation broth containing purine nucleotides (Introduction to Biotechnology and Genetic Engineering, AJ Nair., 2008).
[91]
In addition, for the purpose of the present application, in the case of a microorganism containing a polynucleotide having the promoter activity, the production amount of the target substance is increased. In particular, while the wild-type strain of the genus Corynebacterium cannot produce purine nucleotides or can produce very trace amounts even if it produces purine nucleotides, the amount of purine nucleotide production can be increased through the polynucleotide having the promoter activity of the present application. have.
[92]
As an aspect of the present application, it is to provide a use of the polynucleotide for increasing the expression of a protein of interest.
[93]
Mode for carrying out the invention
[94]
Hereinafter, the present application is described in more detail by examples. However, these examples are for illustrative purposes only, and the scope of the present application is not limited by these examples, and it will be apparent to those of ordinary skill in the art to which the present application belongs.
[95]
[96]
Example 1: Production of wild type-based IMP producers
[97]
[98]
The wild-type strain of the genus Corynebacterium cannot produce IMP, or can produce very trace amounts even if it produces IMP. Therefore, an IMP producer was produced based on the wild-type Corynebacterium stationis ATCC6872. More specifically, an IMP-producing strain that enhances the activity of purF , a gene encoding phosphoribosylpyrrophosphate amidotransferase , and weakens the activity of guaB , a gene encoding 5'-inosine dehydrogenase. Was prepared.
[99]
[100]
Example 1-1: PurF- enhanced strain production
[101]
In order to produce a strain in which the start codon of purF was changed, first, an insertion vector containing purF was constructed. In order to clone the purF gene into the insertion vector, PCR is specifically performed using the primers of SEQ ID NOs: 6 and 7 and SEQ ID NOs: 8 and 9 using the genomic DNA of Corynebacterium stationity ATCC6872 And, 30 seconds of denaturation at 94°C, annealing at 55°C for 30 seconds, and extension of 2 minutes at 72°C were repeated 30 times. Using the two DNA fragments obtained by the PCR reaction as a template, PCR was again performed using SEQ ID NOs: 6 and 9 as primers. PCR conditions were denatured at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extension of 2 minutes at 72°C were repeated 30 times, and the obtained DNA fragment was digested with XbaI. Thereafter, it was cloned into a vector digested with the same restriction enzyme pDZ (Korean Patent No. 10-0924065 and International Patent Publication No. 2008-033001). The vector produced by the above method was named pDZ-purF-g1a.
[102]
[Table 1]
Sequence number Primer name Sequence (5'-3')
6 purF g1a-1 GCTCTAGACCACTCTAAGACGCGGCCACC
7 purF g1a-2 AAGTAGTGTTCACCATGACGCTGATTCTACTAAGTTT
8 purF g1a-3 AGTAGAATCAGCGTCATGGTGAACACTACTTTCCCCAG
9 purF g1a-4 GCTCTAGACTGTGCGCCCACGATATCCAG
[103]
[104]
After transforming the recombinant vector pDZ-purF-g1a into Corynebacterium stationis ATCC6872 by electroporation, the strain into which the vector was inserted on the chromosome by recombination of the homologous sequence was kanamycin. (kanamycin) was selected in a medium containing 25 mg/L. The selected primary strain was again sequenced with the selected strain through the secondary crossover to finally select the strain into which the mutation was introduced, and the selected strain was named 6872-purF (g1a).
[105]
[106]
Example 1-2: guaB weakened strain production
[107]
In order to construct a strain in which the initiation codon of guaB was changed, first, an insertion vector containing guaB was constructed. In order to clone the guaB gene into the insertion vector, specifically, PCR was performed using the genomic DNA of Corynebacterium stationity ATCC6872 as a template, using primers of SEQ ID NOs: 11 and 12 and SEQ ID NOs: 13 and 14, and the PCR Using the product as a template, PCR was performed again using SEQ ID NOs: 11 and 14 as primers, and the obtained DNA fragment was cloned as in Example 1-1. The constructed vector was named pDZ-guaB-a1t. This was introduced into 6872-purF (g1a) in the same way, and finally, the strain into which the mutation was introduced was selected. The selected strain was named CJI2330.
[108]
[Table 2]
Sequence number Primer name Sequence (5'-3')
11 guaB a1t-1 GCTCTAGACTACGACAACACGGTGCCTAA
12 guaB a1t-2 CACGATTTTCGGTCAATACGGGTCTTCTCCTTCGCAC
13 guaB a1t-3 AGGAGAAGACCCGTATTGACCGAAAATCGTGTTTCT
14 guaB a1t-4 GCTCTAGAATCGACAAGCAAGCCTGCACG
[109]
[110]
Example 1-3: Fermentation titer experiment of CJI2330
[111]
After dispensing 2 ml of seed medium into a 18 mm diameter test tube and sterilizing under pressure, ATCC6872 and CJI2330 were respectively inoculated and cultured with shaking at 30° C. for 24 hours to be used as seed culture solution. 29ml of fermentation medium was dispensed into a 250ml Erlenmeyer flask for shaking, sterilized under pressure at 121°C for 15 minutes, and then 2ml of seed culture solution was inoculated and cultured for 3 days. Culture conditions were adjusted to the number of revolutions 170rpm, temperature 30 ℃, pH 7.5.
[112]
After completion of the culture, the production amount of IMP was measured by a method using HPLC (SHIMAZDU LC20A), and the culture results are shown in Table 3 below. The following results suggest that the CJI2330 has the ability to produce IMP.
[113]
[Table 3]
Strain name IMP (g/L)
ATCC6872 0
CJI2330 0.50
[114]
[115]
-Species medium: glucose 1%, peptone 1%, meat juice 1%, yeast extract 1%, sodium chloride 0.25%, adenine 100mg/l, guanine 100mg/l, pH 7.5
[116]
-Fermentation medium: sodium glutamate 0.1%, ammonium chloride 1%, magnesium sulfate 1.2%, calcium chloride 0.01%, iron sulfate 20mg/l, manganese sulfate 20mg/l, zinc sulfate 20mg/l, copper sulfate 5mg/l, L-cysteine ​​23mg /l, alanine 24mg/l, nicotinic acid 8mg/l, biotin 45㎍/l, thiamine hydrochloric acid 5mg/l, adenine 30mg/l, phosphoric acid (85%) 1.9%, glucose 2.55%, fructose 1.45%. .
[117]
[118]
Example 2: discovery of mutations that weaken purA promoter activity
[119]
[120]
In order to attenuate the expression of adenilosuccinate synthetase in order to improve the purine nucleotide production ability, a promoter mutation library of purA , which is a gene encoding it, was constructed and a promoter weakening mutation that increases the purine nucleotide production capacity was attempted to be discovered. .
[121]
[122]
Example 2-1: Construction of a vector containing the purA promoter
[123]
To construct a purA promoter variant library, a GFP (green fluorescent protein) expression vector containing the purA promoter of SEQ ID NO: 1 was first constructed. PCR was carried out using the genomic DNA of Corynebacterium stationary ATCC6872 as a template, using primers of SEQ ID NOs: 15 and 16, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and 72 An extension of 2 minutes at °C was repeated 30 times. The obtained DNA fragment was digested with KpnI and EcoRV, and then cloned into a p117-gfp vector digested with the same restriction enzyme (Korean Patent Laid-Open No. 10-0620092). The vector produced by the above method was named p117-PpurA-gfp.
[124]
[125]
[Table 4]
Sequence number Primer name Sequence (5'-3')
15 purA promoter F GGGGTACCGGCAAAATTGCCGCCGCAGCT
16 purA promoter R GGGATATCGGTTATTCACTTCCTAGATTT
17 purA promoter lib R TTATTTGTAGAGCTCATCCAT
[126]
[127]
Example 2-2: PurA promoter mutation library construction
[128]
A purA promoter mutation library was constructed based on the vector prepared in Example 2-1 . The library was prepared using the error-prone PCR kit (clontech Diversify® PCR Random Mutagenesis Kit). Under conditions in which mutation may occur, a PCR reaction was performed using SEQ ID NO: 15 and SEQ ID NO: 17 as primers. Specifically, pre-heating at 94° C. for 30 seconds under conditions in which 2 to 4 mutations occur per 1000 bp, followed by 30 seconds at 94° C. and 1 minute and 30 seconds at 68° C. were repeated 25 times. The PCR product obtained at this time was used as megaprimer (500~125ng), repeated 25 times of 50 seconds at 95 ℃, 50 seconds at 60 ℃, 12 minutes at 68 ℃, treated with DpnI, and transformed into E. It was spread on LB solid medium containing kanamycin (25mg/L). After selecting 20 transformed colonies, a plasmid was obtained and the polynucleotide sequence was analyzed. As a result, it was confirmed that mutations were introduced at different positions at a frequency of 3.5 mutations/kb. About 10,000 transformed E. coli colonies were taken and a plasmid was extracted, which was named p117-PpurA-gfp-library.
[129]
[130]
Example 3: Evaluation of the produced library and selection of variants
[131]
[132]
Example 3-1: Library evaluation
[133]
The p117-PpurA-gfp-library prepared in Example 2-2 was transformed into the strain CJI2330 prepared in Example 1 by electroporation, and then spread on a nutrient medium containing 25 mg/L of kanamycin, and a mutant vector 5,000 colonies of strains were obtained, and each colony was named from CJI2330_p117-PpurA (mt1) to CJI2330_p117-PpurA (mt5000).
[134]
[135]
-Nutritional medium: peptone 1%, meat juice 1%, sodium chloride 0.25%, yeast extract 1%, agar 2%, pH 7.2
[136]
[137]
The obtained 5,000 colonies were inoculated into 200 µl of each autoclaved seed medium and cultured in a 96 deep well plate with a microplate shaker (TAITEC) for 24 hours at a temperature of 30°C and at 1200 rpm for 24 hours. Was used. After dispensing 290 µl of pressurized fermentation medium into a 96 deep well plate, 20 µl of seed culture was inoculated, and cultured with shaking for 72 hours in the same manner as in the above conditions, followed by centrifugation to obtain cells. Next, the recovered cells were washed in 1X phosphate buffer (10X phosphate-buffered saline: sodium chloride 80g, potassium chloride 2g, sodium phosphate 14.4g, potassium phosphate 2.4g, sterile water 0.8L), resuspended in the same buffer, and then fluorescent. The strength was measured. The fluorescence intensity was measured by irradiating excitation light at 488 nm using a microplate reader and measuring using 511 nm emission light to measure the expression level of the GFP gene. After measurement, two mutant colonies, PpurA (mt3) and PpurA (mt378), whose fluorescence intensity was weakened compared to the wild - type P purA-gfp were selected.
[138]
[139]
Example 3-2: PurA promoter mutation confirmation
[140]
In order to confirm the genetic mutation of the mutant strain, PCR was performed on each of PpurA (mt3) and PpurA (mt378) using primers of SEQ ID NOs: 15 and 17, followed by sequencing, and mutations in the purA promoter were confirmed.
[141]
Specifically, PpurA (mt3) included a polynucleotide sequence in which the 189th nucleotide in the polynucleotide sequence represented by SEQ ID NO: 1 was substituted with thymine (T). In addition, PpurA (mt378) contained a polynucleotide sequence in which the 143th nucleotide in the polynucleotide sequence represented by SEQ ID NO: 1 was substituted with thymine (t). Therefore, in the following examples, it was attempted to confirm whether the mutations affect the amount of purine nucleotides produced by microorganisms of the genus Corynebacterium, respectively.
[142]
[143]
Example 4: Confirmation of IMP-producing ability in IMP-producing strains derived from ATCC6872
[144]
[145]
An IMP-producing strain derived from ATCC6872 was prepared, and the mutation identified in Example 3 was introduced to confirm the IMP-producing ability.
[146]
[147]
Example 4-1: Selection of IMP-producing strains derived from ATCC6872
[148]
ATCC6872 in order to produce a state of producing the IMP ATCC6872-derived in a phosphate buffer (pH7.0) or citrate buffer (pH5.5) 10 7 ~ 10 8 are suspended in cell / ml. Here, UV treatment was performed at room temperature or 32°C for 20 to 40 minutes to induce mutations. After washing twice with 0.85% saline, and diluting the material to be resistant to the minimum medium containing 1.7% agar in a medium containing an appropriate concentration and smearing, colonies were obtained. Each colony was cultured in a nutrient medium and cultured in a seed medium for 24 hours. As a result of culturing in fermentation medium for 3 to 4 days, colonies with the best IMP production accumulated in the culture medium were selected. The above process to give adenine requirement, guanine leak type, lysozyme sensitivity, 3,4-dihydroproline resistance, streptomycin resistance, sulfaguanidine resistance, norvaline resistance, and trimesoprim resistance to produce high concentration IMP producer Was sequentially performed for each material, and CJI2332, which is endowed with resistance to the above materials and has excellent IMP production ability, was finally selected. Table 5 shows the degree of tolerance of CJI2332 compared to ATCC6872.
[149]
[Table 5]
characteristic ATCC6872 CJI2332
Adenine requirement Non-required Demand
Guanine leaking type Non-required Leak type
Lysozyme susceptibility 80 ug/ml 8ug/ml
3,4-dihydroproline resistance 1000 ug/ml 3500ug/ml
Streptomycin resistance 500 ug/ml 2000ug/ml
Sulfaguanidine tolerance 50 ug/ml 200ug/ml
Norvaline resistance 0.2 mg/ml 2mg/ml
Trimesoprim resistance 20 ug/ml 100ug/ml
[150]
[151]
-Minimum medium: glucose 2%, sodium sulfate 0.3%, first potassium phosphate 0.1%, second potassium phosphate 0.3%, magnesium sulfate 0.3%, calcium chloride 10mg/l, iron sulfate 10mg/l, zinc sulfate 1mg/l, manganese chloride 3.6mg/l, L-cysteine ​​20mg/l, calcium pantothenate 10mg/l, thiamine hydrochloride 5mg/l, biotin 30ug/l, adenine 20mg/l, guanine 20mg/l, pH7.3.
[152]
The CJI2332 was deposited on June 22, 2018 with the Korean Microbiological Conservation Center, a trust organization under the Budapest Treaty, and was given the accession number KCCM12277P.
[153]
[154]
Example 4-2: CJI2332 fermentation titer experiment
[155]
After dispensing 2 ml of seed medium into a 18 mm diameter test tube and sterilizing under pressure, ATCC6872 and CJI2332 were respectively inoculated and cultured with shaking at 30° C. for 24 hours to be used as seed culture solution. 29ml of fermentation medium was dispensed into a 250ml Erlenmeyer flask for shaking, sterilized under pressure at 121°C for 15 minutes, and then 2ml of seed culture solution was inoculated and cultured for 3 days. Culture conditions were adjusted to the number of revolutions 170rpm, temperature 30 ℃, pH 7.5.
[156]
After completion of the culture, the production amount of IMP was measured by a method using HPLC (SHIMAZDU LC20A), and the culture results are shown in Table 6 below.
[157]
[Table 6]
Strain name IMP (g/L)
ATCC6872 0
CJI2332 1.74
[158]
[159]
Example 4-3: Construction of an insertion vector containing a purA promoter mutation
[160]
In order to introduce the mutations selected in Example 3 into the strain, an insertion vector was constructed. The process of creating a vector for introducing mutations in PpurA(c143t), PpurA(a189t), and PpurA(c143t, a189t) is as follows.
[161]
Using the genomic DNA of the ATCC6872 strain as a template, PCR was performed using SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20 and SEQ ID NO: 21. PCR was performed 20 times of denaturation at 94°C for 5 minutes, followed by 30 seconds at 94°C, 30 seconds at 55°C, and 1 minute at 72°C, followed by polymerization at 72°C for 5 minutes. Using the resulting DNA fragment as a template, the gene fragment obtained by performing PCR in the same manner as described above was cut with XbaI using SEQ ID NO: 18 and SEQ ID NO: 21. Using T4 ligase, the DNA fragment was cloned into a linear pDZ vector digested with XbaI restriction enzyme to prepare pDZ-purA(c143t)-purA. Using the genomic DNA of the ATCC6872 strain as a template, PCR was performed using SEQ ID NO: 18, SEQ ID NO: 22, and SEQ ID NO: 23 and SEQ ID NO: 21. PCR was performed 20 times of denaturation at 94°C for 5 minutes, followed by 30 seconds at 94°C, 30 seconds at 55°C, and 1 minute at 72°C, followed by polymerization at 72°C for 5 minutes. Using the resulting DNA fragment as a template, a DNA fragment obtained by performing PCR in the same manner as described above using SEQ ID NO: 18 and SEQ ID NO: 21 was cut with XbaI. Using T4 ligase, the DNA fragment was cloned into a linear pDZ vector digested with XbaI restriction enzyme to prepare pDZ-purA(a189t)-purA.
[162]
In addition, in order to see the influence when two mutations are introduced at the same time, a vector into which two mutations are introduced was constructed. Site-directed mutagenesis was performed using the prepared pDZ-purA (c143t) as a backbone. Specifically, PCR was performed using the primers of SEQ ID NO: 24 and SEQ ID NO: 25, at which time denatured at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and extended 12 minutes at 68°C. (extension) process was included, and the above processes were repeated 18 times. The resulting product was treated with DpnI and then transformed into DH5α to obtain a pDZ-PpurA(c143t, a189t)-purA vector.
[163]
[164]
[Table 7]
Sequence number Primer name Sequence (5'-3')
18 PDZ purA F GCTCTAGA ACGGTCACGCGCAAATCAG
19 purA c143t-1R CTACCTTTATCGCCAaTGATAATGTATTTAGCCATG
20 purA c143t-2F CTAAATACATTATCAtTGGCGATAAAGGTAGAGTT
21 PDZ purA R GCTCTAGA TCGTAGGCGACGCAAATAGG
22 purA a189t-1R GGTTATTCACTACCTAGATTTAAG
23 purA a189t-2F TTAAATCTAGGtAGTGAATAACC
24 Site-directed mutagenesis F TAGCCTTAAATCTAGGTAGTGAATAACCATGGCAGCTA
25 Site-directed mutagenesis R TAGCTGCCATGGTTATTCACTACCTAGATTTAAGGCTA
[165]
[166]
Example 4-4: Introduction and evaluation of purA promoter variants in CJI2330 derived from ATCC6872, and CJI2332 strains
[167]
IMP production was evaluated by introducing a purA mutation into the wild-type-derived IMP-producing strain CJI2330 prepared in Example 1 and the strain CJI2332 selected in Example 4-1. In order to confirm whether the mutation in the purA promoter of the CJI2332 strain was included, the genomic DNA of CJI2332 was amplified through PCR. Specifically, first, the conditions of polymerization with Taq DNA polymerase at 94°C for 1 minute, 58°C for 30 seconds, and 72°C for 1 minute using the primers of SEQ ID NOs: 15 and 21 as a template were 28 The purA promoter fragment was amplified and sequenced by repeating PCR . Of CJI2332 strain purA nucleotide sequence of the promoter is the wild-type Corynebacterium stay Yorkshire varnish ATCC6872 purA was the same as the promoter sequence.
[168]
Thereafter, pDZ-PpurA(c143t)-purA, pDZ-PpurA(a189t)-purA, pDZ-PpurA(c143t, a189t)-purA vector was transformed into CJI2330 and CJI2332, and the vector was transferred onto the chromosome by recombination of the homologous sequence. The inserted strain was selected in a medium containing 25 mg/L of kanamycin. The selected primary strain was again subjected to secondary cross-over, and the strain into which the promoter mutation of the target gene was introduced was selected. Whether the mutation was introduced in the final transformed strain was confirmed by performing PCR using the primers of SEQ ID NO: 15 and SEQ ID NO: 21, and analyzing the base sequence. The produced strains are CJI2330_PpurA(c143t)-purA, CJI2330_PpurA(a189t)-purA, CJI2330_PpurA(c143t, a189t)-purA, CJI2332_PpurA(c143t)-purA, CJI2332_PpurA(a189t, PpurA(a189t)-purA(a189t)-purA(a189t)-purA, respectively. Named purA.
[169]
The CJI2332_PpurA(c143t)-purA is referred to as CJI2352, and was deposited with the Korean Microbiological Conservation Center, a trust organization under the Budapest Treaty, on September 10, 2018, and was given the accession number KCCM12315P. In addition, the produced CJI2332_PpurA(a189t)-purA is referred to as CJI2365, and it was deposited with the Korean Microbiological Conservation Center, a trust organization under the Budapest Treaty, on September 10, 2018, and was given the accession number KCCM12314P.
[170]
[171]
IMP production capacity of each strain was evaluated. After completion of the culture, the production amount of IMP was measured by a method using HPLC, and the culture results are shown in Table 8 below.
[172]
[Table 8]
Strain name IMP (g/L)
CJI2330 0.50
CJI2330_PpurA(c143t)-purA 0.58
CJI2330_PpurA(a189t)-purA 0.67
CJI2330_PpurA(c143t, a189t)-purA 0.72
CJI2332 1.74
CJI2332_PpurA(c143t)-purA 2.01
CJI2332_PpurA(a189t)-purA 2.29
CJI2332_PpurA(c143t, a189t)-purA 2.42
[173]
[174]
Example 5: Confirmation of 5'-xanthylic acid production ability upon introduction of purA promoter variant
[175]
[176]
Example 5-1: Selection of strains producing XMP derived from ATCC6872
[177]
In order to produce a state of production of XMP ATCC6872-derived Corynebacterium stay letting the varnish ATCC6872 10 in phosphate buffer (pH7.0) or citrate buffer (pH5.5) 7 ~ 10 8 are suspended in cell / ml. Here, UV treatment was performed at room temperature or 32°C for 20 to 40 minutes to induce mutations. After washing twice with 0.85% saline, and diluting the material to be resistant to the minimum medium containing 1.7% agar in a medium containing an appropriate concentration and smearing, colonies were obtained. Each colony was cultured in a nutrient medium and cultured in a seed medium for 24 hours. As a result of culturing in fermentation medium for 3 to 4 days, colonies with the best XMP production accumulated in the culture medium were selected. Specifically, it was selected from among the mutant strains that can be grown in a medium (added medium) to which fluorotryptophan is added by concentration. The improved strain was selected. The selected strain was named CJX1664.
[178]
[179]
-Minimum medium: glucose 20g/l, potassium phosphate 1g/l, potassium phosphate 2g/l, urea 2g/l, ammonium sulfate 3g/l, magnesium sulfate 1g/l, calcium chloride 100mg/l, iron sulfate 20mg /l, manganese sulfate 10mg/l, zinc sulfate 10mg/l, biotin 30ug/l, thiaminate 0.1mg/l, copper sulfate 0.8mg/l, adenine 20mg/l, guanine 20mg/l, pH 7.2
[180]
-Added medium: Medium containing 10, 20, 50, 70, 100, 200mg/l of fluorotryptophan to the minimal medium
[181]
[182]
The biochemical properties of CJX1664 are shown in Table 9 below. Referring to Table 9, the CJX1664 can be grown in a medium added with fluorotryptophan at a concentration of 100mg/l.
[183]
[Table 9]
characteristic ATCC6872 CJX1664
Fluorotryptophan resistance 10mg/l 100mg/l
[184]
[185]
CJX1664 was deposited on July 6, 2018 with the Korea Microbial Conservation Center, a trust organization under the Budapest Treaty, and was given the accession number KCCM12285P.
[186]
[187]
Example 5-2: CJX1664 fermentation titer experiment
[188]
After dispensing 2 ml of the seed medium into a 18 mm diameter test tube and sterilizing under pressure, ATCC6872 and CJX1664 were respectively inoculated and cultured with shaking at 30°C for 24 hours to be used as a seed culture solution. 29ml of fermentation medium was dispensed into a 250ml Erlenmeyer flask for shaking, sterilized under pressure at 121°C for 15 minutes, and then 2ml of seed culture solution was inoculated and cultured for 3 days. Culture conditions were adjusted to the number of revolutions 170rpm, temperature 30 ℃, pH 7.5.
[189]
After completion of the culture, the production amount of XMP was measured by a method using HPLC (SHIMAZDU LC20A), and the culture results are shown in Table 10 below.
[190]
[Table 10]
Strain name XMP (g/L)
ATCC6872 0
CJX1664 4.72
[191]
[192]
Example 5-3: Introduction and evaluation of variants in CJX1664 strain
[193]
CJX1664 genomic DNA was amplified through PCR to confirm whether the mutation in the purA promoter of the CJX1664 strain selected in Example 5-1 was included. Specifically, first, using the genomic DNA of CJX1664 as a template, using the primers of SEQ ID NO: 15 and SEQ ID NO: 21, denature at 94°C for 1 minute, bind at 58°C for 30 seconds, and polymerize with Taq DNA polymerase at 72°C for 1 minute. The purA promoter fragment was amplified and sequenced through a PCR method in which the above conditions were repeated 28 times . The strain of CJX1664 purA nucleotide sequence of the promoter is the wild-type Corynebacterium stay Yorkshire varnish ATCC6872 purA was the same as the promoter sequence.
[194]
Each of the vectors prepared in Example 4-3 was transformed into CJX1664, and the strain into which the vector was inserted on the chromosome by recombination of the homologous sequence was selected in a medium containing 25 mg/L of kanamycin. The selected primary strain was again subjected to a secondary cross-over, and the strain into which the mutation of the target gene was introduced was selected. Whether or not the gene mutation was introduced in the final transformed strain was confirmed by analyzing the base sequence.
[195]
The CJX1664 and CJX1664_PpurA(c143t)-purA, CJX1664_PpurA(a189t)-purA, and CJX1664_PpurA(c143t, a189t)-purA strains were evaluated for XMP production capacity. After completion of the culture, the production amount of XMP was measured by a method using HPLC, and the culture results are shown in Table 11 below.
[196]
The CJX1664_PpurA(c143t)-purA is referred to as CJX1680, and was deposited with the Korea Microbial Conservation Center, a trust organization under the Budapest Treaty, on September 10, 2018, and was given the accession number KCCM12311P. In addition, the produced CJX1664_PpurA(a189t)-purA is referred to as CJX1668, and it was deposited with the Korea Microbial Conservation Center, a trust organization under the Budapest Treaty, on September 10, 2018, and was given the accession number KCCM12310P.
[197]
[198]
[Table 11]
Strain name XMP (g/L)
CJX1664 4.72
CJX1664_PpurA(c143t)-purA 5.47
CJX1664_PpurA(a189t)-purA 5.91
CJX1664_PpurA(c143t, a189t)-purA 6.01
[199]
[200]
As shown in the table above, it was confirmed that the CJX1664_PpurA(c143t)-purA, CJX1664_PpurA(a189t)-purA, CJX1664_PpurA(c143t, a189t)-purA strains increased XMP production by about 27% compared to CJX1664, an ATCC6872-based XMP-producing strain.
[201]
[202]
From the above description, those skilled in the art to which the present application belongs will understand that the present application may be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including the meaning and scope of the claims to be described later rather than the detailed description, and all changes or modified forms derived from the equivalent concepts within the scope of the present application.

Claims
[Claim 1]
In the polynucleotide sequence of SEQ ID NO: 1, a) the 143th nucleotide is substituted with thymine (T), b) the 189th nucleotide is substituted with thymine (T), or c) the 143th nucleotide is substituted with thymine (T) and the 189th nucleotide A polynucleotide having promoter activity in which the nucleotide is substituted with thymine (T).
[Claim 2]
The polynucleotide of claim 1, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.
[Claim 3]
A composition for gene expression comprising the polynucleotide of claim 1.
[Claim 4]
A vector comprising a gene encoding the polynucleotide of claim 1 and a protein of interest.
[Claim 5]
The vector of claim 4, wherein the protein of interest is adenilosuccinate synthetase.
[Claim 6]
A microorganism of the genus Corynebacterium, comprising the vector of claim 4 or 5.
[Claim 7]
A microorganism of the genus Corynebacterium, comprising a gene encoding the polynucleotide of claim 1 and a protein of interest.
[Claim 8]
The microorganism of claim 7, wherein the target protein is adenilosuccinate synthetase.
[Claim 9]
The microorganism according to claim 7, wherein the microorganism of the genus Corynebacterium is Corynebacterium stationis .
[Claim 10]
Claim 7 comprising the step of culturing the microorganism of the genus Corynebacterium in a medium, purine nucleotide production method.
[Claim 11]
The method of claim 10, further comprising the step of recovering purine nucleotides from the microorganism or medium after the culturing step.
[Claim 12]
Use of the polynucleotide of claim 1 for increasing the expression of a protein of interest.

Documents

Application Documents

# Name Date
1 201937041956-STATEMENT OF UNDERTAKING (FORM 3) [16-10-2019(online)].pdf 2019-10-16
2 201937041956-SEQUENCE LISTING(PDF) [16-10-2019(online)].pdf 2019-10-16
3 201937041956-SEQUENCE LISTING [16-10-2019(online)].txt 2019-10-16
4 201937041956-REQUEST FOR EXAMINATION (FORM-18) [16-10-2019(online)].pdf 2019-10-16
5 201937041956-NOTIFICATION OF INT. APPLN. NO. & FILING DATE (PCT-RO-105) [16-10-2019(online)].pdf 2019-10-16
6 201937041956-FORM 18 [16-10-2019(online)].pdf 2019-10-16
7 201937041956-FORM 1 [16-10-2019(online)].pdf 2019-10-16
8 201937041956-DECLARATION OF INVENTORSHIP (FORM 5) [16-10-2019(online)].pdf 2019-10-16
9 201937041956-COMPLETE SPECIFICATION [16-10-2019(online)].pdf 2019-10-16
10 201937041956-FORM-26 [30-10-2019(online)].pdf 2019-10-30
11 201937041956-Certified Copy of Priority Document (MANDATORY) [28-11-2019(online)].pdf 2019-11-28
12 201937041956-Proof of Right (MANDATORY) [13-12-2019(online)].pdf 2019-12-13
13 201937041956-FORM 3 [17-04-2020(online)].pdf 2020-04-17
14 201937041956.pdf 2021-10-18
15 201937041956-FER.pdf 2022-03-28
16 201937041956-OTHERS [26-09-2022(online)].pdf 2022-09-26
17 201937041956-FER_SER_REPLY [26-09-2022(online)].pdf 2022-09-26
18 201937041956-CLAIMS [26-09-2022(online)].pdf 2022-09-26
19 201937041956-US(14)-HearingNotice-(HearingDate-12-06-2023).pdf 2023-05-03
20 201937041956-FORM 3 [02-06-2023(online)].pdf 2023-06-02
21 201937041956-Correspondence to notify the Controller [09-06-2023(online)].pdf 2023-06-09
22 201937041956-Written submissions and relevant documents [26-06-2023(online)].pdf 2023-06-26
23 201937041956-PatentCertificate24-07-2023.pdf 2023-07-24
24 201937041956-IntimationOfGrant24-07-2023.pdf 2023-07-24

Search Strategy

1 SearchStrategy201937041956E_27-03-2022.pdf

ERegister / Renewals

3rd: 15 Sep 2023

From 08/04/2021 - To 08/04/2022

4th: 15 Sep 2023

From 08/04/2022 - To 08/04/2023

5th: 15 Sep 2023

From 08/04/2023 - To 08/04/2024

6th: 07 Mar 2024

From 08/04/2024 - To 08/04/2025

7th: 27 Feb 2025

From 08/04/2025 - To 08/04/2026