Wipo Translate [powered by Marian] koen ... ..[Continue translation]...

100%

WIPO logo
Mobile | Deutsch | Español | Français | 日本語 | 한국어 | Português | Русский | 中文 | العربية |

PATENTSCOPE

Search International and National Patent Collections

World Intellectual Property Organization

Search

Browse

Translate

News



Home 
IP Services 
PATENTSCOPE

Translated by Wipo Translate

Back to original
.



1. (WO2018043856) NOVEL PROMOTER AND USE THEREOF


PCT Biblio. Data
Full Text
Drawings
National Phase
Notices
Documents

​Specification
​The name of the present invention
​Technical field
1
​Background art
2 3 4
​Detailed description of the present invention

​Technical problem
5
​Technical solution
6
​Effect of the present invention
7
​BRIEF DESCRIPTION OF THE DRAWINGS
8 9 10
​Best mode for carrying out the invention
11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46
​Form for carrying out the present invention
47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133
​Claims
1 2 3 4 5 6 7
​Drawing
1 2 3
​Specification

​Novel promoter and use thereof

​Technical field


[1]

​Novel promoter, vector containing same, and microorganism containing said promoter or vector, and a method for producing a target material using the microorganism.

​Background art


[2]

​Feed and medicine using microorganisms, in order to produce a target material such as an amino acid or a dairy material which can be used for various purposes such as food and the like in a high range, or an external gene introduction, etc. (korean patent no. 10-0924065). In one such method, there is a method for inducing overexpression of a target gene in a microorganism, and a highly efficient gene expression system is required. Since the promoter is one of the most important elements in the gene expression system, it can be necessary to develop an useful promoter.


[3]

​An e coli-derived TAC promoter is widely known as a strong promoter, and in the case of a coryneform microorganism, a promoter of a gene gene is transformed to develop A strong promoter (gene, 102, 93-98, 1991; Microbiology, 142, 1297-1309. For example, in the case of a promoter derived from Corynebacterium Ammoniacensis, it is known to have about 10% improvement in comparison with the TAC promoter reported in the conventional e coli (Biotechnol. Lett. 25, 1311-1316. Moreover, as a strong promoter from corynebacterium ammoniagenes, Pcj1-7 promoters of various intensities have been developed, and has a strong promoter activity of 10 times or more than the TAC promoter (korean patent registration no. 10-0620092). ​Corynebacterium Glutamicum) and a second promoter Which Is Synthesized to have activity as a strong promoter in the present invention (korean patent registration no. 10-1632642). However, in comparison with the escherichia coli gene expression system, there is a need for a system which exhibits high expression efficiency even in a microorganism in a Corynebacterium genus microorganism. Therefore, there is still a need for the development of a promoter.


[4]

​Under this background, the present inventors have efforts to develop a promoter capable of strongly inducing gene expression in a microorganism of corynebacterium genus, as a result, a novel synthetic promoter of the present application is developed to obtain a high expression activity compared to a known promoter.

​Detailed description of the present invention

​Technical problem


[5]

​The present inventors have efforts to develop a promoter capable of strongly inducing gene expression in a microorganism of corynebacterium genus, as a result, a novel synthetic promoter of the present application is developed to obtain a high expression activity compared to a known promoter.

​Technical solution


[6]

​Novel nucleic acid molecule having promoter activity, gene expression cassette comprising same nucleic acid molecule and target gene, and a recombinant vector comprising the nucleic acid molecule or the gene expression cassette, a recombinant microorganism containing the promoter or vector, and a method for producing a target material using the recombinant microorganism.

​Effect of the present invention


[7]

​The novel promoter of the present invention can have various activities according to microorganisms inducing expression of a target gene. According to the present invention, when the activity of a target gene needs to be controlled as necessary for producing a target material, the purpose of the present invention is to provide a method for controlling the activity of a target gene, the present invention according to the present invention, a novel promoter of the present invention can be used to efficiently produce a target material.

​BRIEF DESCRIPTION OF THE DRAWINGS


[8]

​FIG. 1 is A graph showing the intensity of new promoters and the results thereof. The present invention relates to A novel assay result of novel promoters based on corynebacterium glutamicum. According to the present invention, the novel promoter of the novel promoters based on the corynebacterium species is obtained by the method of the present invention.


[9]

​FIG. 2 shows an HPLC result confirming glucose production. The present invention relates to A corynebacterium glutamicum ATCC13032/CJ4-ATPE -2,) is obtained by reacting corynebacterium glutamicum ATCC13032/SPL1-ATPE -2 with A fructose substrate using corynebacterium glutamicum ATCC13032/SPL7-ATPE -2.


[10]

​FIG. 3 shows HPLC results confirming tagatose production. The present invention relates to A corynebacterium glutamicum ATCC13032/CJ4-TN (m) is obtained after reacting with the fructose substrate by using corynebacterium glutamicum ATCC13032/SPL13-TN.

​Best mode for carrying out the invention


[11]

​In order to achieve the purpose of the present application, the present application is one aspect of the present invention to 3; and a nucleotide sequence selected from the group consisting of a nucleotide sequence selected from the group consisting of a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 1; and a nucleotide sequence selected from the group consisting of a nucleotide sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO


[12]

​In the present application, the term "promoter" includes a binding site for a polymerase and has a transcriptional initiation activity of a promoter sub-gene to the mengoram, an upper part of an encryption area and an upper part of an upper part of the encryption area) the non-decoded nucleic acid sequence of the present invention, ie, the polymerase, is combined to initiate transcription of the gene. The promoter can be located at a 5 ′ site of the transcriptional initiation site of the MD1 promoter.


[13]

​In the present application, one nucleotide sequence selected from the group consisting of sequence numbers 1 to 3 (ie, SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3; and a nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3.) wherein the nucleic acid molecule having the promoter activity consists of SPL1, SSPL7 and SPL13, respectively. The nucleic acid molecule having the promoter activity can be referred to as a promoter, and all of the above-described terms can be used in the present specification.


[14]

​The promoter of the present application can result in expression of a target gene operably linked with a nucleic acid molecule having the promoter activity in a desired microorganism, the present invention can be used as a general purpose promotor.


[15]

​In addition, the promoter sequence of the present application is a conventional mutation inducing method, for example, a direct evolution method) and site-directed mutagenesis. Therefore, the promoter comprises at least 70% of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, more specifically, at least 80%, more specifically at least 90%, more specifically, at least 95%, and more specifically at least 98%, and most specifically, 99% or more of homology, and a nucleotide sequence showing similar promoter activity can be included without limitation. Also, as a nucleotide sequence having such homology, if a nucleotide sequence having a promoter activity is a nucleotide sequence having a promoter activity, some sequences are deleted, substitution, or added nucleotide sequence should be construed as being included in the nucleic acid molecule scope of the present application.


[16]

​In particular, the expression of the nucleotide sequence of SEQ ID nos: 1, 2, or 3 comprises the steps of: connecting a corresponding promoter to a target gene and using the same, which can occur during a process of connecting to a target gene, such as the use of a restriction enzyme, and/or the like, which are not intended to be exhaustive or to limit the invention to the precise form disclosed.


[17]

​Specifically, any operator sequence for controlling such transcription in addition to a promoter for carrying out transcription of a gene, and a DNA for controlling termination of transcription and translation. For example, a regulatory sequence suitable for a prokaryotic organism may include, but is not limited to, a promoter, an arbitrary operator sequence, and a ribosome binding site. The nucleic acid molecule having the promoter activity of the present application can constitute a sequence for controlling gene expression as described above as necessary by those of ordinary skill in the art.


[18]

​Nucleic acid molecule having promoter activity consisting of one nucleotide sequence selected from the group consisting of 1-3, a probe which can be prepared from a known gene sequence) according to an embodiment of the present invention, to 3, and a nucleotide sequence having the promoter activity of the present application by hydrolase under stringent conditions with a complementary sequence for all or a part of the nucleotide sequence of the present application


[19]

​The term "homologous" as used herein refers to a percentage of identity between two polynucleotides or polypeptide moieties. The similarity between sequences from one moiety to another can be determined by known techniques. For example, score, identity, and similarity) and a standard software for calculating parameters of the same, and more specifically, to a standard software for calculating parameters of the same, and more specifically, to a method for using a standard software which calculates parameters such as, the sequence can be confirmed by comparing the sequence with a hybridization experiment which is performed under the defined stringent conditions, the appropriate hybridization conditions are within the skill of the art and are well known to those skilled in the art (see, for example, J Sambrook et al. ​Molecular Cloning, A Laboratory Manual, 2 Nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, NY, 1989; proc. natl. acad. sci. USA, vol. 45, no. 5, pp, Inc. New York).


[20]

​The term "stringent conditions" means a condition that enables specific hybridization between polynucleotides. This condition is specifically described in (eg, J Sambrook et al, supra). For example, at least 80%, specifically at least 90%, more specifically at least 95%, more specifically, at least 97%, specifically at least 99% homology, is hybridized to each other, a condition which does not hybridize to a gene having a lower degree of homology, or a washing condition of a conventional southern hybridization, 60° c, 1 × {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle around } {circle around} {circle, more specifically, at a salt concentration and temperature corresponding to 68° c. 0.1 ×, one time, specifically, two to three times, can be enumerated. ​Hybridization between bases depending on the stringency of hybridization) even though it is possible, two nucleic acids need to have a complementary sequence. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridization to each other. For example, with respect to a nucleotide base, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present application can also include isolated nucleic acid fragments which are complementary to the entire sequence as well as substantially similar nucleic acid sequences. Specifically, the polynucleotide having homology can be detected using a hybridization condition including a hybridization step at a Tm value of 55°c and using the conditions described above. In addition, the Tm value can be 60° c. 63°c or 65° c, the present invention is not limited thereto, and can be appropriately adjusted by those skilled in the art according to the purpose of the present invention. ​The appropriate stringency for hybridizing the polynucleotide depends on the length and degree of complementarity of the polynucleotide, and the variable is well Known in the art (Sambrook et al.), 9.50-9.51, 11.7-11.8).


[21]

​Nucleic acid molecules having the promoter activity of the present application can be separated or manufactured using standard molecular biology techniques. For example, the present invention can be manufactured using standard synthetic techniques using an automated DNA synthesizer, but is not limited thereto.


[22]

​In another aspect, the present invention provides a gene expression cassette comprising a nucleic acid molecule and a target gene of the present application.


[23]

​The nucleic acid molecule of the present application is as described above.


[24]

​In the present application, the term "gene expression cassette" refers to a promoter and a target gene, the present invention relates to an unit cassette capable of expressing a target gene operably connected downstream from a promoter. Various factors which can help efficient expression of the target gene can be included in the internal or external part of the gene expression cassette. The gene expression cassette includes a promoter which is operably connected to the target gene.) and a transcription termination signal, a ribosome binding site, and a translation termination signal.


[25]

​In the present application, the term "target gene" means a gene encoding a protein to be expressed in a microorganism.


[26]

​For example, saccharides (eg, psicose or tagatose)) L-amino acid (for example, L-lysine, L-valine)) and a product selected from the group consisting of an organic acid and an enzyme, but is not limited thereto. Specifically, the target gene comprises: a saccharide conversion enzyme; a gene encoding an enzyme related to amino acid biosynthesis; and a gene encoding an enzyme related to a reducing force, a gene encoding an enzyme related to the biosynthesis of an organic acid, and a gene encoding a protein related to the emission of the desired product, but is not limited thereto. More specifically, the present invention relates to a gene encoding a glucose epimerization enzyme, a gene encoding the tagatose epimerization enzyme, or a gene encoding the tagatronate epimerization enzyme, a gene encoding the NADP-dependent glyceraldehyde-3-phosphate dehydrogenase, or a gene encoding a branched-chain amino acid aminotransferase.


[27]

​The psicose epimerization enzyme can be denoted as atpe, the present invention relates to a psicose-3-epimerization enzyme having an activity of converting fructose into a liver. Further, the present invention relates to a method for preparing a hexonic acid C4-epimerization enzyme in korean patent no. 10-1550796, which is used in korean patent no. 10-1550796, which is used in korean patent no. 10-1550796) can be expressed as UXAE, and the enzyme has the activity of converting fructose acid to tagatose acid or converting fructose into tagatose. The Botulinum toxin-dependent glyceraldehyde-3-phosphate dehydrogenase can be denoted as GAPN, and glyceraldehyde-3-phosphate (glyceraldehyde -3 phosphate) is represented by the following formula: (MOL) (CDX)) to 3-phosphoglycerate by using a substrate as a substrate. ​Branched-chain amino-acid aminotransferase) can be denoted as ILVE, and the enzyme in the last step in the biosynthetic pathway of branched chain amino acids. The gene encoding the atpe, a gene encoding uxe, and a gene encoding GAPN, the sequence of the gene encoding ILVE is readily available by those skilled in the art through a known data base such as genbank in the united states national health institute. The gene encoding the atpe, a gene encoding uxe, and a gene encoding GAPN, the gene encoding ILVE is only exemplary as one of the target genes that can be operably linked to a nucleic acid molecule having the promoter activity of the present application, the promoter of the present application can be used as a target gene without limitation if it is a gene capable of being expressed from a microorganism as a general-purpose promoter. ​The term "operably linked" in this application) according to the present invention, the nucleic acid sequence having the promoter activity of the present invention starts and mediates transcription of a target gene, the gene sequence and the promoter sequence are functionally linked. The operably linked linkage can be prepared by using genetic recombination techniques known in the art, the present invention can be manufactured using a cutting and linking enzyme in the art, but is not limited thereto.


[28]

​The present application provides a recombinant vector comprising the nucleic acid molecule of the present application or the gene expression cassette of the present application.


[29]

​The nucleic acid molecule and the gene expression cassette are as described above.


[30]

​The term "vector" of the present application is an artificial DNA molecule having a genetic material capable of expressing a target gene in a suitable host, specifically, a DNA preparation containing a nucleotide sequence of a gene operably linked to a suitable regulatory sequence. The regulatory sequences include any operator sequence for controlling such transcription in addition to the promoter of the present application capable of initiating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for controlling termination of transcription and translation.


[31]

​The vector used in the present application is not specifically limited if it is able to be expressed in a host cell, a host cell can be transformed using any vector known in the art. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in natural or recombinant states. For example, the phage vector or cosmid vector is pWE15, m13, λlb3, λlb3, λλii, λashii, λapii, λt10, λt11, charon4a, and charon21a may be used as a plasmid vector, a pbr-based, a PUC-based, a pem-based, a PTZ-based, a PCL-based, and a PET-based, and the like. The vector usable in the present application is not particularly limited, and a known expression vector can be used. In addition, the present invention provides an inherent promoter in a chromosome through a vector for inserting a chromosome in a host cell the present invention the nucleic acid molecule having the promoter activity of the present invention can be replaced with a nucleic acid molecule having the promoter activity of the present application. ​The insertion into the chromosome of the nucleic acid molecule can be accomplished by any method known in the art, for example, homologous recombination. Examples include pECCG117, pDZ, pACYC177, pACYC184, pCL, pUC19, pBR322, pCES208, pXM19 vector, or the like, can be used, but is not limited thereto. The vector of the present application can be inserted into the chromosome by using homologous recombination, and thus the selection marker for identifying the insertion of the chromosome can be obtained) according to the present invention; FIG. 5 is a cross-sectional view taken along line i-i ′ of FIG. 3. The selectable marker is used for selecting a cell transformed with a vector, that is, to identify whether or not a target nucleic acid molecule is inserted, wherein the selection marker is used for identifying whether or not a target nucleic acid molecule is inserted, a marker for giving a selectable phenotype such as resistance to a cytotoxic agent or expression of a surface protein can be used. ​Selective agent) the transformed cells can be screened by expressing only cells expressing the selectable marker or expressing other expression features in the treated environment.


[32]

​As used herein, the term "transformation" means that a vector comprising a polynucleotide encoding a target protein is introduced into a host cell so that a protein encoding the polynucleotide can be expressed in a host cell. The transformed polynucleotide can be expressed in a host cell, which is inserted into the chromosome of the host cell and located or located in addition to the chromosome. In addition, the polynucleotide comprises DNA encoding a target protein and RNA, which can be introduced into a host cell and expressed, and can be introduced into any form. For example, the polynucleotide comprises an expression cassette (expression cassette) which is a gene structure including all of the elements required to be expressed by itself) can be introduced into a host cell in the form of a vector containing the same or a vector containing the same. ​The expression cassette or vector comprising the polynucleotide is, for example, the sequence number 1 of the present application, SEQ ID NO: 2 or a nucleotide sequence of SEQ ID NO: 3; and a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3, and a nucleic acid molecule having a promoter activity, and the target gene may be a vector which is not operably linked. In this case, the nucleic acid molecule having the promoter activity is a host cell (eg, corynebacterium sp. Microorganism) the present invention can be replaced by an intrinsic promoter and a homologous recombination in a human body. Accordingly, the inherent gene of the host cell can be expressed.


[33]

​The transformation method includes any method for introducing a nucleic acid into a cell, a suitable standard technique can be selected and performed as is known in the art according to a host cell. For example, electroporation, Calcium phosphate (CAO 4) precipitation, calcium chloride (CaCl precipitation, microinjection, polyethylene glycol () a cationic liposome method, a cation liposome method, and an acetic acid lithium-DMSO method, but is not limited thereto.


[34]

​In another aspect, the present application relates to a nucleic acid molecule having the promoter activity of the present application, and a recombinant vector containing the gene expression cassette or gene expression cassette.


[35]

​The nucleic acid molecule having the promoter activity, the gene expression cassette, and the recombinant vector are as described above.


[36]

​The gene expression cassette and the recombinant vector can be introduced into the microorganism by transformation.


[37]

​In addition, the transformation is as described above.


[38]

​In the present application, the term "microorganism" includes both a wild-type microorganism or a microorganism having a natural or artificially genetic modification, in which an external gene is inserted or the activity of an intrinsic gene is enhanced or weakened, so that a specific mechanism is attenuated or enhanced. In the present application, the microorganism can be included without limitation if a nucleic acid molecule having the promoter activity of the present application is introduced to operate as a promoter.


[39]

​Specifically, the microorganism can be a microorganism of corynebacterium genus, and more specifically, corynebacterium glutamicum, corynebacterium ammoniagenes, Brevibacterium Lactofermentum, Brevibacterium flavum), Corynebacterium Thermoaminogenes, Corynebacterium species, and the like. More specifically, the present invention is not limited to, but is not limited to, corynebacterium glutamicum.


[40]

​According to another aspect of the present invention, the method comprises the steps of: culturing the recombinant microorganism of the present application in a medium; and) and a step of collecting a target material produced from the microorganism or the medium in which the microorganism is cultured.


[41]

​In the present application, the term "target substance" (eg, glucose or tagatose), L-amino acid (eg, glucose or tagatose), L-amino acid (eg, L-lysine, L-valine), organic acid, enzyme, and combinations thereof. The "saccharide" means a mono-flavor carbohydrate, for example, glucose, fructose, galactose, and alllose, lactose, sucrose, and combinations thereof, and combinations thereof.


[42]

​The "amino acid" or "L-amino acid" refers to a basic structural unit of a protein in which an amino group and a carboxy group are bonded to the same carbon atom. The amino acid can be, for example, glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, and histidine, phenylalanine, tyrosine, tryptophan, proline, and combinations thereof. The organic acid is an acidic organic compound, for example, an organic compound having a carboxy group and a sulfone group. Specific examples of organic acids include lactic acid, acetic acid, succinic acid, butanoic acid, palmitic acid, oxalic acid, tartaric acid, and citric acid, the present invention can include, but is not limited to, tartaric acid, propionic acid, hexenoic acid, caproic acid, caprylic acid, valeric acid, or citric acid. ​Specifically, the "enzyme" is a protein catalyst which mediates chemical reaction inside a living body, the enzyme functions as a catalyst for lowering activation energy of a reaction by forming an enzyme-matrix complex in combination with a substrate. For example, saccharides (eg, glucose or tagatose), and an enzyme involved in the production of the liver, and more specifically, to a method for preparing a glucose epimeration enzyme, the present invention is not limited thereto, but the present invention is not limited thereto.. The target product is a target material which can be produced due to expression of a target gene operably linked with the promoter of the present application, the present invention is not limited by the above example.


[43]

​In the present application, the term "culture" means the growth of microorganisms in a moderately artificially controlled environment. A method for producing a target material using a recombinant microorganism in the present application can be carried out by using methods well known in the art. Specifically, the batch process, the injection arrangement, or the repeated injection batch process (fed batch or repeated fed batch process)) can be continuously cultured in a continuous manner, but is not limited thereto.


[44]

​Medium used in culture must meet the requirements of a specific strain in a proper manner. The culture medium for corynebacterium genus or escherichia sp. Strain is known (for example, Manual of Methods for General Bacteriology. The american Society for Bacteriology. Washington DC, USA. Sugar sources which can be used include glucose, sucrose, lactose, fructose, maltose, starch, sugars and carbohydrates such as cellulose, soybean oil, sunflower oil, castor oil, coconut oil, and the like and fats, palmitic acid, stearic acid, a fatty acid such as linoleic acid, glycerol, an alcohol such as ethanol, gluconic acid, acetic acid, and pyruvic acid, the present invention is not limited thereto, and these materials can be used individually or as a mixture. ​Nitrogen source that can be used is peptone, yeast extract, meat juice, and malt extract, a soybean meal, and an urea or an inorganic compound such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen source can also be used individually or as a mixture. Sources that can be used include, but are not limited to, potassium dihydrogen phosphate or potassium dihydrogen phosphate or the corresponding sodium-containing salt. In addition, the culture medium can contain a metal salt such as magnesium sulfate or iron sulfate required for growth. Essential growth materials such as amino acids and vitamins can be used in addition to the materials. In addition, suitable precursors can be used in the culture medium. Specifically, when the enzyme is produced as a desired product, the substrate can be included in the medium. ​For example, fructose may be included as a substrate for the glucose epimerization enzyme, the tagatose epimerization enzyme, or the tagatronate epimerization enzyme. The above-mentioned raw materials can be added in a batch manner or in a continuous manner by a method suitable for culture in a culture process. The various culture methods are described, for example, by "Biochemical Engineering" by James M Lee, the present invention is disclosed in Prentice-Hall International Editions, pp 138-176.


[45]

​Sodium hydroxide and potassium hydroxide, the pH of the culture can be adjusted by using a base compound such as ammonia or an acid compound such as phosphoric acid or sulfuric acid in a suitable manner. In addition, a foaming agent such as a fatty acid polyglycol ester can be used to suppress generation of bubbles. Oxygen or oxygen-containing gas (eg, air) can be injected into the culture to maintain the aerobic condition. The temperature of the culture is usually from 20 to 45° c. specifically 25 to 40° c, can be changed according to conditions, and the present invention is not limited thereto.


[46]

​A method for producing a target material of the present application comprises the steps of: collecting a target material from a microorganism of the present application or a medium in which the microorganism is cultured, and a method for recovering the target material from the medium in which the microorganism or the microorganism is cultured can be separated or recovered by using a suitable reaction known in the art. For example, treatment with a protein precipitating agent (salting method)), centrifugation, extraction, ultrasonic crushing, ultrafiltration, dialysis, and molecular sieve chromatography (gel filtration)), the ion exchange chromatography, the ion exchange chromatography, the ion exchange chromatography, the ion exchange chromatography, the ion exchange chromatography, the ion exchange chromatography, the ion, the present invention is not limited to these examples, but the present invention is not limited to these examples. The recovery step can include a purification process, and one of ordinary skill in the art can select and utilize various purification processes as necessary.

​Form for carrying out the present invention


[47]

​To facilitate the understanding of the present application, the present invention will be described in detail. The present invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. The embodiments of the present application are provided to more completely explain the present invention to those skilled in the art.


[48]

[49]

​Method for identifying and inducing expression of target gene of novel promoter


[50]

1-1. ​Recombinant vector production containing novel promoter sequence


[51]

​Various promoter sequences derived from corynebacterium sp. Microorganism and escherichia sp. Microorganism are analyzed to synthesize a novel promoter for inducing expression of a target gene, and a sequence number 1, and a promoter having a nucleotide sequence of 2 and 3, which are designated SPL1, SPL7 and SPL13, respectively.


[52]

​Synthetic-manufactured promoter, and method for manufacturing same, a sequence number 4 including a KpnI/ECCOR v cleavage site and a primer of SEQ ID NO: 5; and a method for preparing the same by using the primer of SEQ ID NO: 4 and SEQ ID NO: 5 including a KpnI/ECCOR V cleavage Site, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories). The rice straw condition is modified for 5 minutes at 94° c. and the mixture is modified at 94°c for 30 seconds, 60°c 30 sec annealing, and 72°c 30 sec extension for 30 times, followed by a stretching reaction at 72°c for 7 minutes. As a result, the composition of the present invention has a Size of about 300 bp, a rice straw # 7 and a rice straw straw 13 of about 300 bp.


[53]

​Open Reading Frame of Clostridium botulinum toxin and method for producing same) by using a primer of SEQ ID NO: 6 and SEQ ID NO: 7 containing a PstI/Ecorv cleavage site as a template.. The Pcr is carried out at 94°c for 5 minutes, followed by denaturation of 94°c 30 sec, 55°c 30 sec annealing, the polymerization reaction was carried out at 72°c for 7 minutes. As a result, a gene fragment (SEQ ID NO: comprising a Tang of about 716 bp is obtained.


[54]

​Shuttle vector pccg117 (biotechnology letters vol 13, no 10, which can be expressed in e coli and coryneform bacteria, p 721-726, korean patent registration no. 10-199-0007401) SPL7 and SPL13 and PSTI which are treated with restriction enzymes KPNI and ECCOR v at the PSTI and KPNI positions of the PSTI and KPNI positions of the PSTI and KPNI positions of the PSTI and KPNI, and the orfs of the GFP gene treated with ecorv are operably linked by using a DNA binding enzyme, and finally, the SPL1, SPL7 and SPL13 are connected to GFP, respectively, and are designated pSPl1-GFP, pSPL7-GFP, and pSPL13-GFP, respectively.


[55]

1-2. ​Method for producing transgenic strain


[56]

​Vector ppeccg117 and recombinant vector pspl1-GFP produced above, pspl7-GFP and pspl13-GFP and a conventional promoter PCJ4 (korean patent no. 10-0620092)), and p119-cJ4-GFP containing the same are provided in an electric pulse method (appl. Microbiol. Biothcenol. COPYRIGHT KIPO 2014 [reference numerals] (AA) start; (BB) end; () 52: 541-545); a step of culturing the culture medium; a step of culturing the culture medium; a step of culturing the culture medium; a step of culturing the culture medium; a step of culturing the culture medium; a step of culturing the culture medium; and a step of culturing) LB) agar medium containing 25 mg/l of the transformed strain is obtained in a medium containing 25 mg/l of the transformed strain. ​Corynebacterium glutamicum ATCC13032/peccg117, corynebacterium glutamicum ATCC13032/spl1-GFP, respectively based on atcc13032, corynebacterium glutamicum ATCC13032/SPL7-GFP, corynebacterium glutamicum ATCC13032/SPL13-GFP, and corynebacterium glutamicum ATCC13032/CJ4-GFP. Also, the strains obtained on the basis of ATCC13869 are corynebacterium glutamicum ATCC13869/PECCG117, corynebacterium glutamicum ATCC13869/spl1-GFP, corynebacterium glutamicum ATCC13869/SPL7-GFP, corynebacterium glutamicum ATCC13869/SPL13-GFP, and corynebacterium glutamicum ATCC13869/CJ4-GFP.


[57]

​Atcc13032/spl7-GFP, atcc1332/spl13-GFP and atcc1332/spl1-GFP, atcc13869/spl13-GFP, atcc13869/spl13-GFP, and atcc13869/spl1-GFP 6 strains obtained by transforming the same are ca01-2301, CA01-2303, CA01-2303, CA01-2304, CA01-2305 and CA01-2306, and a korean microorganism preservation center (KCCM)) KCCM11973P, KCCCM11972P, KCCCM11973P, KCCCM11974P, KCCM11975P, and KCCCM11976P by depositing on feb. 17, 2013, the accession number KCCCM11971P, KCCCM11972P, KCCCM11973P, KCCCM11974P, KCCCM11975P, and KCCCM11976P.


[58]

1 ​Method for identifying activity of novel promoter


[59]

​Transformed strains corynebacterium glutamicum ATCC13032/peccg117 obtained from examples 1-2 to confirm the activity of spl1, spl7 and spl13 promoters, corynebacterium glutamicum ATCC13032/CJ4-GFP, corynebacterium glutamicum ATCC13032/spl1-GFP, corynebacterium glutamicum ATCC13032/SPL7-GFP, corynebacterium glutamicum ATCC13869/PECCG117, corynebacterium glutamicum ATCC13869/CJ4-GFP, corynebacterium glutamicum ATCC13869/spl1-GFP, corynebacterium glutamicum ATCC13869/CJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SJ4-GFP, corynebacterium glutamicum ATCC13869/SPL7-GFP and corynebacterium glutamicum ATCC13869/SPL13-GFP are cultured in the following manner, and GFP activity is measured.


[60]

​Medium (glucose 20 g, ammonium sulfate 5 g, yeast extract 5 g), 2 PO 4 4 g, K 2 HPO 4 8 g, 0.5 g of MgSO 4 7 · h, 0.5 g of biotin, 150 μg of biotin, 1.5 mg of thiamin hydrochloride, 3 mg of calcium pantothenate, 3 mg of nicotinamide (1 L of distilled water), 3 mg of calcium pantothenate, 3 mg of nicotinamide, 3 mg of nicotinamide,) at 30°c for 20 hours at a temperature of 30°c for 20 hours. Centrifugation (5,000 rpm, 15 min.) from culture medium); a step of adding 50 MM Tris-hcl (pRE8.0) to a solution of 50 mM tris-Hcl (PPG8.0); a step of adding 50 mM tris-hcl (PPG8.0) the buffer solution was washed twice with a buffer solution, and then suspended in a copper buffer solution. 1. Per 1.5 ml of suspension. 25 ​Bead beater after adding glass bead of g), and crushing the same for 6 minutes; a step of mixing the mixture with water and stirring the mixture; a step of mixing the mixture with water; and a step of mixing the mixture with water, the supernatant is collected through centrifugation (15,000 rpm, 20 min) to quantify the concentration of the protein by the bradford method. For the same amount of a bacterial extract, a method of Laure Gory et Al. (Microbiology Letters 194, 127-133, 2001); a step of irradiating excitation light at 488 nm using an excitation light at 488 nm; and a step of irradiating the excitation light at a wavelength of 511 nm) device is measured by using a device (table 1) COPYRIGHT KIPO 2014 [reference numerals] (AA) start; (BB) end; (CC) yes; (DD) end; (EE) yes; (FF) end


[61]

[표1]
​Strain ​Fluorescent sensitivity
​Atcc13032/pECCG117 0.0
​Atcc13032/CJ4-GFP 850.2
​Atcc13032/SPL1-GFP 3197.4
​Atcc13032/SPL7-GFP 3097.7
​Atcc13032/SPL13-GFP 3051.1
​Atcc13865/pECCG117 0.0
​Atcc13865/CJ4-GFP 921.7
​Atcc13865/SPL1-GFP 3342.3
​Atcc13865/SPL7-GFP 3425.5
​Atcc13865/SPL13-GFP 3287.3

[62]

[63]

​As shown in table 1, All kinds of corynebacterium glutamicum are able to exhibit promoter activity in two kinds of corynebacterium glutamicum as shown in table 1, the present invention has higher fluorescence sensitivity than PCJ4, which is known as a strong promoter in corynebacterium glutamicum. As a result, The present invention has a very strong promoter capable of expressing a target gene in corynebacterium glutamicum.


[64]

[65]

​Method for evaluating productivity of target material


[66]

2 ​Method for evaluating glucose production capacity


[67]

​Vector for expression of ATPE comprising SPL1 and SPL7 promoter sequences and production of transformed strain


[68]

​Psicose epimerization enzyme derived from agrobacterium tumefaciens ATCC 33970 using SPL1 and SPL7), thereby producing a vector for a corynebacterium strain having an increased expression. PET24-ATPE -2 vector (SEQ ID NO:) and a primer of SEQ ID nos: 9 and 10 for 30 seconds at 94°c COPYRIGHT KIPO 2014 [reference numerals] (AA) start; (BB) end; (CC) start; (DD) end, 30 seconds and 72°c for 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 72°c for 30 seconds; 30 seconds at 72°c for 30 seconds;); and a step of amplifying an Open Reading Frame by performing the steps of: amplifying an Open Reading Frame of a Botulinum toxin gene. The method of the present invention comprises the steps of: treating the microorganism with a restriction enzyme ecorv and psti with restriction enzyme ecorv and psti; and a method for producing the same, and a method for manufacturing the same are provided to enable an user to obtain a vector for a corynebacterium strain, and a method for manufacturing the same, and a method for manufacturing the same.


[69]

​The produced pSPL1-atp -2 vector and pSPL7-atp -2 vector are introduced by electroporation to ATCC13032 strain, thereby producing SPL1-atp -2 and SPL7-atp -2 strains.


[70]

(2) 형질전환 균주의 사이코스 생산능 평가


[71]

상기 과정을 거쳐 제작한 균주를 실시예 1과 동일한 조성의 배지를 이용하여 배양한 후 ATPE의 활성을 측정하였다. ATCC13032/pECCG117 균주 및 ATCC13032/CJ4-ATPE-2 균주는 대조군으로 사용하였다.


[72]

30 ℃ 배양기에서 LB 고체 배지 중에 밤새 배양한 각각의 균주를 25 mL 배지에 접종한 다음, 이를 30 ℃ 배양기에서 24 시간 동안 진탕 배양하였으며, 배양 후 원심분리를 통해 상등액을 제거하고 EPPS 용액 (pH 8.0)를 이용하여 수득된 균체를 세척하고, 확보된 펠렛을 EPPS 용액 (pH 8.0)에 용해시킨 후 1 mg/ml의 POESA 첨가하여 실온에서 1 시간 반응 후 원심분리하였다. 그 다음, 원심분리하여 얻은 펠렛을 EPPS 용액 (pH 8.0)에 용해시키고, 기질인 350 g/L 프럭토스 용액을 첨가하여 50 ℃에서 3 시간 반응시킨 후, 열처리를 통해 반응을 정지시켰다. 이후 원심분리를 통해 상등액을 회수하고 HPLC 분석을 통해 사이코스 생성량을 측정하였다 (도 1의 (A), (B) 및 (C)). 반응 후 사이코스 생성량을 하기 표 2에 표시하였다.


[73]

[표2]
균주 프럭토스(g/L) 사이코스(g/L)
ATCC13032/pECCG117 348.7 0
ATCC13032/CJ4-ATPE-2 329.9 18.8
ATCC13032/SPL1-ATPE-2 263.2 79.2
ATCC13032/SPL7-ATPE-2 280.1 67.4

[74]

[75]

​As shown in table 2, corynebacterium glutamicum ATCC13032/SPL1-ATPE -2 and ATCC13032/SPL7-atp -2 have a ratio of 321% to each other than corynebacterium glutamicum ATCC13032/CJ4-atp -2, the present invention has been found to have an improved 258% improvement. According to the present invention, when the promoters SPL1 and SPL7 of the present application are used, the expression amount of the gene encoding the ATPE is increased, thereby remarkably increasing the activity of the ATPE.


[76]

2 ​Method for evaluating production capacity of tagatose


[77]

​Vector for expressing uxe and manufacturing method thereof


[78]

​Cj4-GFP having GFP inserted and spl13-GFP produced in example 1), thereby producing a vector for corynebacterium strains. PET28a-TN (m) vector (SEQ ID NO: as a template, and performing PCR with the primers of SEQ ID NOS: 12 and 13 (94°c for 30 sec, 30 seconds and 72°c for 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 72°c for 30 seconds; 30 seconds at 72°c for 30 seconds;) according to an embodiment of the present invention; FIG. 5 is a flowchart illustrating a method for detecting an open reading frame (ORF) of a tn gene;), and amplifying the amplified signal. The amplified gene tn is selected from the group consisting of n, n, n, n, n, n, n, n, n, n) the vector CJ4-GFP and SPL13-GFP for the corynebacterium strain are treated with the restriction enzyme ecorv and psti, and the vector CJ4-GFP and SPL13-GFP are treated with the restriction enzyme ecorv and psti, thereby producing a vector pj4-tn and pspl13-tn for a corynebacterium strain.


[79]

​Pj4-TN vector and pSPL13-TN (m) vector is introduced by an electroporation method in an ATCC13032 strain, thereby producing ATCC13032/CJ4-TN and SPL13-TN strains.


[80]

​Method for evaluating tagatose productivity of transformation strain


[81]

​The strain produced by the above process is cultured and pre-treated in the same manner as in the medium and culture conditions described in example 1, and then an active strain of uxe is secured. According to the same method as in example 2-1, the activity evaluation is performed in the same manner as in example 2-1, reaction temperature and time (2 hours reaction at 60°c by adding 100 g/L fructose solution). Thereafter, the supernatant was Recovered by centrifugation and the amount of tagatose production was measured through The analysis of the rice straw residue (FIG. 2A).) (B). The amount of tagatose generated after the reaction is shown in table 3. [TABLE-US -00003]


[82]

[표3]
​Strain ​Fructose ​Tagatose
​Atcc13032/pECCG117 100 0
​Atcc13032/CJ4-TN 92.2 6.9
​Atcc13032/SPL13-TN 82.7 16.8

[83]

[84]

​As shown in table 3, corynebacterium glutamicum ATCC13032/SPL13-TN) is improved by 143% of tagatose productivity than corynebacterium glutamicum ATCC13032/CJ4-TN. From this, when the promoter SPL13 of the present application is used, it can be seen that the expression amount of a gene encoding Uxe is increased So That the activity of uxe is remarkably increased.


[85]

2 ​Method for evaluating generation ability of valine


[86]

​Method for producing pBAC/vex117-7-ILVTRO vector and transformation strain comprising the same as the wild-Type 7 promoter Sequence


[87]

​Method for identifying L-valine production ability of L-amino acid, a branched-chain amino-acid aminotransferase, a branched-chain amino-acid aminotransferase, a branched-chain amino-acid aminotransferase, a branched-chain amino-acid aminotransferase, and a branched-chain amino-acid aminotransferase, wherein the branched-chain amino-acid aminotransferase is a branched-chain amino-acid aminotransferase) in order to enhance the enzyme activity of ILVTRO (NCGL2123) coding for the expression of ILVTRO (NCGL2123), the present invention has the following steps: Specifically, the present invention relates to a method for manufacturing) for 30 seconds at 94°c by using the sequence number 14 and sequence number 15 as a primer, 30 seconds and 72°c for 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 72°c for 30 seconds; 30 seconds at 72°c for 30 seconds;) as a result of performing the above-mentioned steps, and has a PstI restriction Enzyme site at the 3 ′ terminal and ecorv at The 5 ′ end of the NCG2123 gene COPYRIGHT KIPO 2014 [reference numerals] (AA) start; (BB) end ​Obtained Therefrom and mixed with Ecorv and PstI restriction enzyme-treated p-{right arrow over------------------------------------------------------------------------------------------------------------------------, a fusion cloning Kit (In-fusion cloning Kit)), and a connection vector is manufactured by using the same.


[88]

​Nucleotide sequence of SEQ ID NO: 14 5 ′ GAGATCAAAACAGATAATATGCATAGAGTTC 3 ′


[89]

​Sequence number 15 5 ′ atcccccgggctgcagttagnccaacctgggta 3 ′


[90]

​Production strain corynebacterium glutamicum KCCCM111P (korean patent no. 10-1117022)) to obtain a transformed strain in a LB agar medium containing kanamycin 25 mg/L after transformation by an electric pulse method in the present invention, the transformed strain is obtained by culturing the transformed strain in a LB agar medium containing 25 mg/L of kanamycin. The obtained strains are named KCCM111P/pECCG117, KCCCM111P/CJ7-IVE and KCCCM111P/SPL7-IVE.


[91]

​Method for evaluating valine productivity of transformation strain


[92]

​The L-valine productivity of the transformed three kinds of strains is analyzed by culturing the same in the following manner.


[93]

​A 250 ml corner-bottle flask containing 25 ml of production medium is inoculated with the strains of 1 platinum and at 30°c for 72 hours, and stirring the mixture at 200 rpm. After the culture is terminated, the concentration of L-valine is analyzed by using the Rice straw Granule.


[94]

​Water-soluble organic solvent


[95]

​50 G of glucose, 20 g of Rice straw and 20 g of Corn Steep Solids) 20 g of rice straw, 1 G of Rice straw, 4 1 G of mGo 4 · 7m2/0.5 g, and 200 μg of biotin (1 liter of distilled water).


[96]

​The culture and analysis are repeated, and the concentration of L-valine analyzed is shown in table 4.


[97]

[표4]
​Strain ​L-valine
​Batch 1 ​Batch 2 ​Batch 3 ​Average
​Control ​Kccc111P/pECCG117 2.7 2.9 2.9 2.8
1 ​Kccc111P/CJ7-ilvE 3.1 3.2 3.4 3.2
2 ​Kccc111P/SPL7-ilvE 3.9 4.0 3.8 3.9

[98]

[99]

​As shown in table 4, which has been introduced by the promoter of the present application than the Corynebacterium glutamicum KCCCM111P/CJ7-IVE, in which the known promoter has been introduced, has a 21.8% improvement in the germination productivity of the KCCCM111P/SPL7-IVE strain in which the promoter of the present application has been introduced. An improved result of 39.2% was confirmed, rather than kCMC111P/pECCG117. From the result, the Present application of the Present application enhances the expression of the ILVP2 gene by enhancing the expression of the ILVP2 gene, it can be seen that the enzyme activity of the gene is remarkably increased.


[100]

2 ​Method for evaluating productivity of-4-lysine


[101]

​Method for producing pBAC-knock-n-{fraction}-GAPDH -1 vector and transformation strain comprising The Same


[102]

​Method for producing L-lysine as a representative example of L-lysine, in order to identify L-lysine productivity)-phosphate dehydrogenase-dependent glyceraldehyde-3-phosphate dehydrogenase (GapN) enzyme activity as follows: (MOL) (CDX)


[103]

​Transgenic bank of korean national institutes of health, so as to be Inserted into transposzone gene NCGG2392 in microorganism of corynebacterium genus) SEQ ID NO: 16 and SEQ ID NO: 17 as a template based on a chromosome of wild-type corynebacterium glutamicum, SEQ ID NO: 18 and SEQ ID NO: 19 are used as primers for 30 seconds at 94° c, 30 seconds and 72°c for 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 72°c for 30 seconds; 30 seconds at 72°c for 30 seconds;) of the NCGG2392 gene and the 3 ′ end of the NCGG2392 gene are amplified. ​Korean patent no. 10-1182033 for korean patent no. 10-1182033) by using the sequence number 20 and 21 as a primer using the vector as a primer for 30 seconds at 94°c for 30 seconds, 30 seconds at 55°c for 30 seconds, as a result of performing the reaction between two minutes at 72° c. the pj7-GAPDH was amplified, a sequence number 22 and a sequence number 23, sequence number 24 and sequence number 21 as primers for 30 seconds at 94°c for 30 seconds, 30 seconds and 72°c for 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 55°c for 30 seconds; 30 seconds at 72°c for 30 seconds; 30 seconds at 72°c for 30 seconds;) and a method for preparing the same are provided to improve the efficiency of the growth of plants, and to improve the growth rate of plants CONSTITUTION: a method for preparing a gene expression vector comprises: a step of amplifying an expression vector; a step of amplifying the expression vector; a step of amplifying the, korean patent no. 0924065 which is incapable of replication in corynebacterium glutamicum along with the NCGG2392 Gene Fragment manufactured by the same) to be cloned in the same manner as described in the present invention, thereby producing pBAC-n-a CJ7-GAPPU1 and pBAC-n-a CJ7-GAPSI1 vector.


[104]

​Nucleotide sequence of SEQ ID NO: 16 5 ′ atCCTCTAAAGGTGCGACCAAACCAACCGTGCCGT 3 ′


[105]

​SEQ ID NO: 17 5 ′ ctcgaggaactcattctcgctcg 3 ′


[106]

​Nucleotide sequence of SEQ ID NO: 18 5 ′ tctagactagtgggcccgacataaccgcgcag 3 ′


[107]

​SEQ ID NO: 19 5 ′ atGCCTGCAGGTGCGACGCACTCCGACTAAC 3 ′


[108]

​Nucleotide sequence of SEQ ID NO: 20 5 ′ GAATGAGTTCCTCGGAGAAACATCCCAGCGCTACT 3 ′


[109]

​Nucleotide sequence of SEQ ID NO: 21 5 ′ gcccactagttctagattattttgatcaaatacga 3 ′


[110]

​SEQ ID NO: 22 5 ′ GAATGAGTTCCTCGTGGGCGCTTCAACCAACAATC 3 ′


[111]

​Sequence number 23 5 ′ attgtttttcatatgtgttttgatctCCTccaata 3 ′


[112]

​SEQ ID NO: 24 5 ′ catatgacaaaacatataaaaaaa 3 ′


[113]

​KCCM11016P (KFCC10881) having improved lysine productivity, the deposit number is applied to the international depository authority, which is the budapest treaty, and is applied with the accession number as KCCCM11016P, korean patent registration no. 10-0159812) and a method for producing the same are provided to improve the efficiency of an electric pulse method by using an electric pulse method (Appl. Microbiol.


[114]

​Biothcenol. COPYRIGHT KIPO 2014 [reference numerals] (AA) start; (BB) end; () 52: 541-545) a method for preparing the same comprises the steps of: culturing a culture medium containing kanamycin (KANAMYCIN) in a culture medium; culturing the culture medium in a culture medium; and culturing the culture medium.) and obtaining a transformed strain in a selective medium containing 25 mg/l.. A secondary recombination process (crossover)) a sequence number 20 and 21 primer pair in order to select a colony into which a GAPDH gene is inserted on the genome; and the primers of SEQ ID nos: 21 and 22 were used to obtain a strain in which Pj7-GAPDH and SPL13-GAPDH were inserted, respectively. Each strain obtained is named KCCM11016P/CJ7-gapN1 and KCCM11016P/SPL13-GAPDH.


[115]

​Method for evaluating productivity of lysine in transgenic strain


[116]

​The L-lysine productivity of the transformed three kinds of strains is analyzed by culturing the same in the following manner.


[117]

​Method for inoculating respective strains into a 250 ml corner-bottle flask containing 25 ml of a species medium, the mixture was stirred at 200 rpm for 20 hours at 30°c for 20 hours. Then, a 250 ml corner-rice straw containing 24 ml of a production medium is provided the present invention comprises: a step of inoculating 1 ml of a species culture medium into a simple flask and culturing the culture medium at 30°c for 72 hours; a step of culturing the culture medium at 30°c for 72 hours; a step of culturing the culture medium at 30°c for, and stirring the mixture at 200 rpm. The concentration of L-lysine is analyzed by using the Hplc.


[118]

​Water-soluble organic solvent


[119]

​20 G of glucose, 10 g of peptone, 5 g of yeast extract, and 1.5 g of urea, KH 2 PO 4 4 g, K 2 HPO 4 8 g, 0.5 g of MgSO 4 7H 2O, 100 μg of biotin, 1000 μg of thiamine HCl, 1 liter of distilled water); 2000 μg of calcium-pantothenic acid; 2000 μg of nicotinamide; (1 liter of distilled water)


[120]

​Water-soluble organic solvent


[121]

​Glucose 100 g, (NH 4) 2 SO 4 40 g, 2.5 g of soy protein, Corn Steep Solids (Corn Steep Solids) 5 g of an element, 3 g of an element, 3 g of an Element, 4 1 g of an element, 3 g of an element, 5 g of an element, 3 g of an element, 3 g of the Element, 4 g, 100 μg of biotin, 100 μg of thiamin hydrochloride, 1000 μg of thiamin hydrochloride, 1000 μg of thiamin hydrochloride, 1000 μg of thiamin hydrochloride, 2000 μg of calcium-pantothenic acid, 3000 Μg of nicotinamide, 30 g of CaCO (1 liter of distilled water).


[122]

​The culture and analysis are repeated, and the concentration of L-lysine analyzed is shown in table 5.


[123]

[표5]
​Strain ​L-lysine
​Batch 1 ​Batch 2 ​Batch 3 ​Average
​Control ​KCCC11016P 42.3 43.1 41.2 42.2
1 ​KCCCM11016P/CJ7-gapN1 47.6 49.1 49.2 48.3
2 ​Kccm11016P/SPL13-gafn1 51.0 51.5 52.9 51.8

[124]

[125]

​As shown in table 5, which has been introduced by the promoter of the present application than the Corynebacterium glutamicum KCCM11016P/CJ7-gapN1 where the known promoter has been introduced, has an improved lysine productivity of the KCCM11016P/SPL13-GAPDH strain in which the promoter of the present application has been introduced. It has been confirmed that 22.7% improvement results are confirmed, rather than the cafeel ® 11016 cc. From the above result, It is possible to enhance the expression of the GAPDH gene by the Wild-type 13 promoter of the present application, it can be seen that the enzyme activity of the gene is remarkably increased.


[126]

​SPL1 of the present application, the SPL7 and SPL13 promoters can significantly increase expression of a target gene in a recombinant microorganism compared to a conventional promoter known in the art, the present invention is capable of providing an effective expression system using the same as well as providing an effective expression system, for example, a saccharide, the present invention can be usefully used in various industrial fields in which functional materials and amino acids are produced in high yield.


[127]

[128]

[129]

[130]

[131]

[132]

[133]

​Claims


​[Claim 1]

​Nucleic acid molecule having promoter activity consisting of one nucleotide sequence selected from the group consisting of sequence numbers 1 to 3


​[Claim 2]

​Gene expression cassette comprising nucleic acid molecule and target gene of claim 1


​[Claim 3]

​Recombinant vector comprising the nucleic acid molecule of claim 1 or the gene expression cassette of claim 2


​[Claim 4]

​Recombinant microorganism of corynebacterium genus comprising the nucleic acid molecule of claim 1 or the vector of claim 3


​[Claim 5]

​The recombinant microorganism of claim 4, wherein the microorganism of corynebacterium glutamicum is corynebacterium glutamicum or corynebacterium ammoniagenes.


​[Claim 6]

​(A) culturing the recombinant microorganism of claim 4 in a medium; and) and a step of collecting the target material from the microorganism or the medium in which the microorganism is cultured.


​[Claim 7]

​The method of claim 6, wherein the target substance is glucose, tagatose or amino acid.