Sign In to Follow Application
View All Documents & Correspondence

Novel Protein Having Endoglucanase Activity , Dna Encoding The Protein And Use Of The Protein And Dna

Abstract: A protein, wherein the protein is derived from a basidiomycete, has an endoglucanase activity, and has a molecular weight of 18 kDa which is measured by 5 SDS-PAGE.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
11 February 2011
Publication Number
47/2011
Publication Type
INA
Invention Field
MICRO BIOLOGY
Status
Email
Parent Application

Applicants

THE UNIVERSITY OF TOKYO
3-1, HONGO 7-CHOME, BUNKYO-KU, TOKYO 1138654, JAPAN

Inventors

1. IGARASHI, KIYOHIKO
C/O THE UNIVERSITY OF TOKYO, 3-1, HONGO 7-CHOME, BUNKYO-KU, TOKYO 1138654, JAPAN
2. SAMEJIMA, MASAHIRO
C/O THE UNIVERSITY OF TOKYO, 3-1, HONGO 7-CHOME, BUNKYO-KU, TOKYO 1138654, JAPAN

Specification

NOVEL PROTEIN HAVING ENDOGLUCANASE ACTIVITY, DNA ENCODING
THE PROTEIN, AND USE OF THE PROTEIN AND DNA
5
Technical Field
The present invention relates to a novel protein having an endoglucanase
activity, a novel DNA encoding the protein, a vector containing the DNA, a
transformant containing the vector, a method for producing a protein having an
0 endoglucanase activity using the transformant, a method for producing a sugar
using at least one selected from a protein having an endoglucanase activity and a
basidiomycete, a method for producing ethanol using a sugar produced by this
method, a food, a feed or a detergent containing a protein having an endoglucanase
activity, and a method for treating a cellulose-containing woven fabric using a
5 protein having an endoglucanase activity.
Background Art
Endoglucanases (EGsJ EC 3.2.1.4) are one type of the enzymes that
hydrolyze cellulose. The other cellulose-hydrolyzing enzymes include
o cellobiohydrolases (CBHs; EC 3.4.1.91) and p-glucosidases (BGLs; EC 3.2.1.21). On
the basis of the homology between the amino acid sequences, these enzymes are
classified into the glycoside hydrolase family (hereinafter may be referred to as "GH
family"). The details of the classification can be seen in the Carbohydrate-Active
enZymes (CAZy) web server (http://www.cazy.org/).
5 Cellulose is a linear polymer in which glucose molecules are bound together
via a p"l,4 linkage. Cellulose is a main component of cell walls of plants, and is the
most abundant biopolymer on the earth. Thus, the endoglucanase, which cleaves

the interior of cellulose, has been used in various fields such as the treatment of
biomass materials and the use as a detergent, and much research has been made on
the endoglucanase (see, for example, Patent Literatures 1 and 2).
Hitherto, intensive studies have been conducted on Hypocrea jecorina
5 (anamorph: Trichoderma reesei) which is one of the ascomycetous fungi, and it is
known that Hypocrea jecorina produces two kinds of cellobiohydrolases that belong
respectively to GH families 6 and 7 (i.e., Cel6A (CBHI) and Cel7A (CBHII)) and at
least five endoglucanases (i.e., Cel7B (EGI), Cel5A(EGII), Cell2A (EGIII), Cel61A
(EGIV) and Cel45A (EGV)) and that these enzymes act cooperatively or
10 synergistically to hydrolyze cellulose.
Also, the filtrates of media in which ascomycetes degrade cellulose are
commercially available as a cellulase mixture.
Regarding basidiomycetes including edible mushrooms, it is known that the
wood-rotting fungus Phanerochaete chrysosporium can effectively degrade
15 lignocellulose and produces a series of hydrolases relating to the degradation of
cellulose and hemicellulose. Also, the genome sequence of Phanerochaete
chrysosporium has been revealed.
However, it is merely known that Phanerochaete chrysosporium produces
cellobiohydrolases belonging to GH families 6 and 7 (see, for example, Non-Patent
20 Literature l) and four endoglucanases belonging to GH families 5 and 12 (see, for
example, Non-Patent Literatures 2 and 3). The endoglucanases belonging to GH
family 45 have not yet been found, and also, the mechanism of the degradation of
cellulose has not been revealed in detail.
While ascomycetes include fungi, basidiomycetes include edible mushrooms.
25 Therefore, in consideration of safety, endoglucanases derived from basidiomycetes
are advantageously used as the endoglucanase for treating biomass materials.
Thus, demand has arisen for the production of the basidiomycete-derived

Citation List
Patent Literature
5 PTL l: Japanese Patent (JP-B) No. 3874409
PTL 2: Japanese Patent Application Laid-Open (JP-A) No. 2004-519212
Non-Patent Literature
NPL l: Uzcategui, E., A. Ruiz, R. Montesino, G. Johansson, and G.
Pettersson. 1991. The 1,4-p-D-glucan cellobiohydrolases from Phanerochaete
10 chrysosporium. I. A system of synergistically acting enzymes homologous to
Trichoderma reesei. J. Biotechnol. 19:271-285.
NPL 2'- Henriksson, G., A. Nutt, H. Henriksson, B. Pettersson, J. Stahlberg,
G. Johansson, and G. Pettersson. 1999. Endoglucanase 28 (Cell2A), a new
Phanerochaete chrysosporium cellulase. Eur. J. Biochem. 259:88-95.
15 NPL 3: Uzcategui, E., G. Johansson, B. Ek, and G. Pettersson. 1991. The
1,4-p-D-glucan glucanohydrolases from Phanerochaete chrysosporium.
Re-assessment of their significance in cellulose degradation mechanisms. J.
Biotechnol. 21:143-159.
2 0 Summary of Invention
An object of the present invention is to provide a novel protein having an
endoglucanase activity derived from a basidiomycete into which edible mushrooms
are classified and which are advantageously used in terms of safety, a novel DNA
encoding the protein, a vector containing the DNA, a transformant containing the
2 5 vector, a method for producing a protein having an endoglucanase activity using the
transformant, a method for producing a sugar using at least one selected from a
protein having an endoglucanase activity and a basidiomycete, a method for

producing ethanol using a sugar produced by this method, a food, a feed or a
detergent containing a protein having an endoglucanase activity, and a method for
treating a cellulose-containing woven fabric using a protein having an
endoglucanase activity.
5 The present inventor has conducted extensive studies in order to achieve the
above object, and has found that Phanerochaete chrysosporium, which is one of the
basidiomycetes into which edible mushrooms are classified and which are
advantageously used in terms of safety, produces a novel, useful protein having an
endoglucanase activity although its amino acid sequence has a low identity to those
10 of known endoglucanases, and also the protein has different catalytic residues from
known endoglucanases. On the basis of the findings, the present invention has
been accomplished.
The present invention is based on the findings obtained by the present
inventor. Means for solving the above problems are as follows.
15 <1> A protein,
wherein the protein is derived from a basidiomycete, has an endoglucanase
activity, and has a molecular weight of 18 kDa which is measured by SDS-PAGE.
<2> The protein according to <1>, wherein the basidiomycete is
Phanerochaete chrysosporium.
20 <3> A protein
wherein the protein has an endoglucanase activity and is selected from the
following proteins (a) to (d):
(a) a protein including an amino acid sequence indicated by SEQ ID NO. 1,
(b) a protein including an amino acid sequence which is identical to that
25 indicated by SEQ ID NO. 1, except that one to several amino acids are substituted,
deleted, inserted or added,
(c) a protein including an amino acid sequence ranging from position 27 to

position 206 of the amino acid sequence indicated by SEQ ID NO. 1, and
(d) a protein including an amino acid sequence which is identical to that
ranging from position 27 to position 206 of the amino acid sequence indicated by
SEQ ID NO. 1, except that one to several amino acids are substituted, deleted,
5 inserted or added.
<4> DNA,
wherein the DNA encodes a protein having an endoglucanase activity and is
selected from the following DNAs (a) to (h)::
(a) DNA encoding a protein including an amino acid sequence indicated by
10 SEQ ID NO. 1,
(b) DNA encoding a protein including an amino acid sequence which is
identical to that indicated by SEQ ID NO. 1, except that one to several amino acids
are substituted, deleted, inserted or added,
(c) DNA encoding a protein including an amino acid sequence ranging from
15 position 27 to position 206 of the amino acid sequence indicated by SEQ ID NO. 1,
(d) DNA encoding a protein including an amino acid sequence which is
identical to that ranging from position 27 to position 206 of the amino acid sequence
indicated by SEQ ID NO. 1, except that one to several amino acids are substituted,
deleted, inserted or added,
20 (e) DNA including a nucleotide sequence indicated by SEQ ID NO. 2,
(f) DNA which hybridizes under stringent conditions with DNA including a
nucleotide sequence indicated by SEQ ID NO. 2 or with a complementary strand to
the DNA,
(g) DNA including a nucleotide sequence ranging from position 79 to position
25 621 of the nucleotide sequence indicated by SEQ ID NO. 2, and
(h) DNA which hybridizes under stringent conditions with DNA including a
nucleotide sequence ranging from position 79 to position 621 of the nucleotide

sequence indicated by SEQ ID NO. 2 or with a complementary strand to the DNA.
<5> A recombinant vector including:
the DNA according to <4>.
<6> A transformant,
5 wherein the transformant is transformed with the recombinant vector
according to <5>.
<7> A method for producing a protein having an endoglucanase activity,
including:
culturing the transformant according to <6>, and
10 recovering the protein having the endoglucanase activity from a culture
obtained through the culturing.
<8> A method for producing a sugar, including:
producing the sugar from a biomass material using the protein according to
any one of <1> to <3>, a basidiomycete or both of the protein and the basidiomycete.
15 <9> The method according to <8>, wherein the producing is performed by
further using a cellulase other than the protein according to any one of claims <1> to
<3>.
<10> A method for producing ethanol, including:
fermenting a sugar to produce the ethanol,
20 wherein the sugar is produced by the method according to one of <8> and
<9>.
<11> A food including:
at least one selected from the proteins according to <1> to <3>.
<12> A feed including:
25 at least one selected from the proteins according to <1> to <3>.
<13> A detergent including:
at least one selected from the proteins according to <1> to <3>.

<14> A method for treating a cellulose-containing woven fabric, including:
treating the cellulose-containing woven fabric with at least one selected from
the proteins according to <1> to <3>.
The present invention can provide a novel protein having an endoglucanase
5 activity derived from basidiomycetes into which edible mushrooms are classified and
which are advantageously used in terms of safety, a novel DNA encoding the protein,
a vector containing the DNA, a transformant containing the vector, a method for
producing a protein having an endoglucanase activity using the transformant, a
method for producing a sugar using at least one selected from a protein having an
0 endoglucanase activity and a basidiomycete, a method for producing ethanol using a
sugar produced by this method, a food, a feed or a detergent containing a protein
having an endoglucanase activity, and a method for treating a cellulose-containing
woven fabric using a protein having an endoglucanase activity. These can achieve
the above-described object.
5
Brief Description of Drawings
Fig. 1 is an SDS-PAGE image of a filtrate of a culture of Phanerochaete
chrysosporium (P. chrysosporium).
Fig. 2 shows a nucleotide sequence of cDNA encoding PcCel45A and an
o amino acid sequence encoded by the cDNA.
Fig. 3 shows a position of PcCel45A on the genome of Phanerochaete
chrysosporium (P. chrysosporium).
Fig. 4 shows the results of multiple alignment among the amino acid
sequence of PcCel45A and amino acid sequences of other proteins.
5 Fig. 5 is a phylogenetic tree including PcCel45A.
Fig. 6 shows the result of TLC analysis of hydrolyzates in a reaction mixture
obtained by reacting PcCel45A with each substrate for one hour.

Fig. 7 shows the results of TLC analysis of hydrolyzates in a reaction mixture
obtained by reacting PcCel45A with each substrate for 120 hours.
Fig. 8 is a graph relating to production over time of cellooligosaccharide in a
reaction mixture obtained by reacting PcCel45A with PASC.
5 Fig. 9 is an HPLC chart of cellooligosaccharide produced by reacting cCel45A
and PcCel6A with PASC.
Fig. 10 is a graph relating to synergistic effects obtained by reacting
PcCel45A and PcCel6A with PASC.
10 Best Mode for Carrying Out the Invention
(Protein having endoglucanase activity)
A protein of the present invention having an endoglucanase activity is
derived from a basidiomycete and has a molecular weight of 18 kDa measured by
SDS-PAGE.
15 The protein of the present invention having an endoglucanase activity
encompasses a protein including an amino acid sequence indicated by SEQ ID NO. 1
and a protein including an amino acid sequence ranging from position 27 to position
206 of the amino acid sequence indicated by SEQ ID NO. 1.
Also, the protein of the present invention having an endoglucanase activity
20 encompasses a protein including an amino acid sequence which is identical to that
indicated by SEQ ID NO. 1, except that one to several amino acids are substituted,
deleted, inserted or added, and a protein including an amino acid sequence which is
identical to that ranging from position 27 to position 206 of the amino acid sequence
indicated by SEQ ID NO. 1, except that one to several amino acids are substituted,
25 deleted, inserted or added.
As used herein, the description "several amino acids" is not particularly
limited in number, so long as the obtained proteins have an endoglucanase activity,

and may be appropriately selected depending on the intended purpose. The region
where the one to several amino acids are substituted, deleted, inserted or added is
not particularly limited, so long as the obtained proteins have an endoglucanase
activity, and may be appropriately selected depending on the intended purpose.
5 Notably, the protein of the present invention having an endoglucanase
activity may be those with an amino acid sequence which has a certain sequence
identity to the amino acid sequence indicated by SEQ ID NO. 1 or the amino acid
sequence ranging from position 27 to position 206 of the amino acid sequence
indicated by SEQ ID NO. 1. The sequence identity is not particularly limited, so
10 long as the obtained proteins have an endoglucanase activity, and may be
appropriately selected depending on the intended purpose. The sequence identity
is preferably 70% or higher, more preferably 80% or higher, still more preferably 90%
or higher, particularly preferably 95% or higher.
The identity between amino acid sequences can be determined by the
15 Karlin-Altschul algorithm (Proc. Natl. Acad. Sci. USA 87:2264-2268, 1990, and Proc.
Natl. Acad. Sci. USA 90:5873-5877, 1993). BLAST programs based on such an
algorithm have been developed by Altschul, et al. (J. Mol. Biol. 215:403-410, 1990).
These are available in, for example, the NCBI Protein Database
(http://www.ncbi.nlm.nih.gov/blast/Blast.cgi).
20 The BLAST program used for analyzing the identity between amino acid
sequences is not particularly limited and may be appropriately selected depending
on the purpose. Examples thereof include blastp programs. The parameters used
for analyzing the sequence identity with the above program are not particularly
limited and may be appropriately selected depending on the intended purpose. For
25 example, default values can be used.
Note that the sequence identity between nucleotide sequences can be
determined similarly.

■ Measurement of molecular weight -
The molecular weight of the protein of the present invention having an
endoglucanase activity can be measured by SDS-PAGE (polyacrylamide gel
electrophoresis).
5 The method of the SDS-PAGE is not particularly limited and may be
appropriately selected depending on the intended purpose. Known methods can be
employed.
Polyacrylamide gel used for the SDS-PAGE is not particularly limited and
may be appropriately selected depending on the intended purpose. Examples
10 thereof include 12% polyacrylamide gel.
The device for the electrophoresis is not particularly limited and may be
appropriately selected depending on the intended purpose. Examples thereof
include Mini-Protein II (product of Bio-Rad).
- Measurement of endoglucanase activity -
15 Whether the protein of the present invention has an endoglucanase activity
can be confirmed by measuring the endoglucanase activity of the protein.
The method for measuring the endoglucanase activity is not particularly
limited and may be appropriately selected depending on the intended purpose. In
one exemplary method, a sample is allowed to react with a substrate, and the
20 resultant product is detected.
The substrate is not particularly limited, so long as it can be degraded by
endoglucanase, and may be appropriately selected depending on the intended
purpose. Examples thereof include non-crystalline cellulose, carboxymethyl
cellulose, lichenan, barley p-glucan and glucomannan.
25 The reaction temperature is not particularly limited, so long as it is a
temperature at which endoglucanase exhibits its activity, and may be appropriately
selected depending on the intended purpose. The reaction temperature is, for

example, 30°C.
The resultant product is a degraded product of the substrate and is, for
example, a reducing sugar.
The detection method is not particularly limited, so long as the resultant
5 product can be detected, and may be appropriately selected depending on the
intended purpose. Examples thereof include the p-hydroxybenzoic acid hydrazide
(PHBAH) method, thin layer chromatography (TLC) and high-performance liquid
chromatography (HPLC).
- Determination of amino acid sequence -
10 The amino acid sequence of the protein of the present invention having an
endoglucanase activity can be determined by a known method using, for example, a
protein sequencer (Model 491 cLcJ product of Applied Biosystems).
■ Substrate -
Examples of the substrate of the protein of the present invention having an
15 endoglucanase activity include non-crystaline cellulose, carboxymethyl cellulose,
lichenan, barley p-glucan and glucomannan, with lichenan and barley p-glucan
being preferred.
The degraded product of the substrate may be, for example, reducing mono-
to heptasaccharides. Of these, reducing tri- to pentasaccharides can be suitably
20 obtained.
■ Optimum temperature -
The temperature at which the protein of the present invention having an
endoglucanase activity is used is not particularly limited and may be appropriately
selected depending on the intended purpose. It is preferably 10°C to 70°C, more
25 preferably 20°C to 60°C, particularly preferably 30°C to 50°C. When the
temperature is lower than 10°C, the protein having an endoglucanase activity may
not function. When the temperature is higher than 70°C, the protein having an

endoglucanase activity may be deactivated. When the temperature is in the
particularly preferable range, the substrate can be efficiently degraded, which is
advantageous.
■ Optimum pH -
5 The pH at which the protein of the present invention having an
endoglucanase activity is used is not particularly limited and may be appropriately
selected depending on the intended purpose. It is preferably 2.0 to 8.0, more
preferably 3.0 to 7.0, particularly preferably 4.0 to 6.0. When the pH is lower than
2.0 or higher than 8.0, the enzyme may be inactivated. When the pH is in the
10 particularly preferable range, the substrate can be efficiently degraded, which is
advantageous.
■ Combinational use -
When the protein of the present invention having an endoglucanase activity
is used in combination with other cellulases, the substrate can be efficiently
15 degraded by virtue of their synergistic effects. The cellulase is not particularly
limited and may be appropriately selected depending on the intended purpose.
Examples thereof include Cel6A from Phanerochaete chrysosporium (P.
chrysosporium).
In combinational use, the molar ratio of the protein of the present invention
20 having an endoglucanase activity : the other cellulases is not particularly limited
and may be appropriately selected depending on the intended purpose. The molar
ratio is preferably 75 : 25 to 25 : 75, more preferably 75 : 25.
The protein of the present invention having an endoglucanase activity can be
produced by the below-described production method, and can be suitably used for the
25 below-described applications.' i.e., a method for producing a sugar, a method for
producing ethanol using the sugar, a food, a feed, a detergent and a method for
treating a cellulose-containing woven fabric.

(Method for producing protein having endoglucanase activity)
The protein of the present invention having an endoglucanase activity can be
obtained from a culture of a basidiomycete, and also, can be suitably produced by a
method using a transformant of the present invention.
5
The method for producing the protein having an endoglucanase activity
using the basidiomycete includes at least a step of culturing the basidiomycete
(culturing step) and a step of recovering the protein having an endoglucanase
activity from a culture obtained through the culturing (recovering step); and, if
10 necessary, further includes other steps. This production method is a first
embodiment of the method for producing the protein of the present invention having
an endoglucanase activity.
- Culturing step -
The culturing step is a step of culturing a basidiomycete.
15 The basidiomycete is not particularly limited and may be appropriately
selected depending on the intended purpose. Basidiomycetes belonging to
Agaricomycotina, Basidiomycota are preferred; basidiomycetes belonging to
Homobasidiomycetes, Agaricomycotina, Basidiomycota are more preferred;
basidiomycetes belonging to Corticiaceae, Homobasidiomycetes, Agaricomycotina,
20 Basidiomycota are still more preferred; and Phanerochaete chrysosporium is
particularly preferred.
The culturing method is not particularly limited and may be appropriately
selected depending on the intended purpose. Examples thereof include solid
culture methods using an agar medium, and liquid culture methods using a liquid
25 medium. Of these, liquid culture methods are preferred, since a large amount of
the protein can be produced.
The liquid medium is not particularly limited and may be appropriately

selected depending on the intended purpose. Examples thereof include the Kremer
and Wood medium containing cellulose (Kremer, S. M., and P. M. Wood. 1992.
Evidence that cellobiose oxidase from Phanerochaete chrysosporium is primarily an
Fe(IIl) reductase. Kinetic comparison with neutrophil NADPH oxidase and yeast
5 flavocytochrome b2. Eur. J. Biochem. 205:133-138.).
The culturing temperature is not particularly limited and may be
appropriately selected depending on the intended purpose. It is preferably 20°C to
45°C, more preferably 30°C to 40°C, particularly preferably 37°C. When the
culturing temperature is lower than 20°C, the growth rate of the basidiomycetes
10 may be lowered. When the culturing temperature is higher than 45°C, the
basidiomycetes do not grow in some cases. When the culturing temperature is in
the particularly preferable range, the protein having an endoglucanase activity can
be efficiently produced, which is advantageous.
The culturing period is not particularly limited and may be appropriately
15 selected depending on the intended purpose. It is preferably 1 day to 30 days, more
preferably 2 days to 14 days, particularly preferably 3 days to 7 days. When the
culturing period is shorter than 1 day, the number of basidiomycetes becomes small,
resulting in that the protein having an endoglucanase activity may be
disadvantageously produced in a small amount. When the culturing period is
20 longer than 30 days, the number of dead basidiomycetes may increases, and the
produced protein having an endoglucanase activity may be degraded. When the
culturing period is in the above particularly preferable range, the protein having an
endoglucanase activity can be efficiently produced, which is advantageous.
- Recovering step -
25 The recovering step is a step of recovering the protein having an
endoglucanase activity from a culture obtained through the culturing step.
The recovering method is not particularly limited and may be appropriately

selected depending on the intended purpose. For example, when the protein of the
present invention having an endoglucanase activity is produced in bacterial cells or
the surfaces thereof, the bacterial cells are separated from the culture and then
treated by a known method such as ultrasonic disruption, to thereby recover the
5 protein of the present invention having an endoglucanase activity. Alternatively,
for example, when the protein of the present invention having an endoglucanase
activity is produced in the culture, bacterial cells are removed through, for example,
centrifuging or filtration, to thereby recover the protein of the present invention
having an endoglucanase activity.
10 The recovered protein having an endoglucanase activity is preferably
purified. The purification method is not particularly limited and may be
appropriately selected depending on the intended purpose. Examples thereof
include ammonium sulfate fractionation, various chromatographies, alcohol
precipitation and ultrafiltration.
15 • Other steps -
The other steps are not particularly limited and may be appropriately
selected depending on the intended purpose. Examples thereof include a step of
freeze-drying the protein having an endoglucanase activity for storage, and a step of
concentrating the protein having an endoglucanase activity to increase the protein
2 0 concentration.

The method for producing the protein having an endoglucanase activity
includes at least a step of culturing the below-described transformant of the present
invention (culturing step) and a step of recovering the protein having an
25 endoglucanase activity from a culture obtained through the culturing (recovering
step); and, if necessary, further includes other steps. This production method is a
second embodiment of the method for producing the protein of the present invention

having an endoglucanase activity.
■ Culturing step -
The culturing step is a step of culturing the below-described transformant of
the present invention.
5 The culturing method is not particularly limited and may be appropriately
selected depending on the intended purpose. Examples thereof include solid
culture methods using an agar medium, and liquid culture methods using a liquid
medium. Of these, liquid culture methods are preferred, since a large amount of
the protein can be produced.
10 The transformant is not particularly limited and may be appropriately
selected depending on the intended purpose. Examples thereof include yeasts such
as Pichia pastoris and Saccharomyces cerevisiae, and Escherichia coli. Of these,
Pichia pastoris is preferably used, since it can produce an enzyme having an activity
in a larger amount.
15 The medium used is not particularly limited and may be appropriately
selected depending on the intended purpose. The medium is preferably selected in
consideration of the type of the transformant. For example, when the transformant
is Pichia pastoris which contains an alcohol oxidase promoter as an
expression-regulating sequence of a recombinant vector, one exemplary medium
20 used is preferably a medium containing a yeast extract, peptone and methanol, for
example. Alternatively, when the transformant is Saccharomyces cerevisiae which
contains a GAL1 promoter as an expression-regulating sequence of a recombinant
vector, one preferable manner is that a liquid minimum medium containing raffinose
as a carbon source is used as a pre-culturing medium, and then a liquid minimum
25 medium containing galactose and raffinose as carbon sources is used. Also, when
the transformant is Escherichia coli containing a lac promoter as an
expression-regulating sequence of a recombinant vector, an IPTG-containing liquid

medium is preferably used, for example.
• Recovering step -
The recovering step is a step of recovering the protein having an
endoglucanase activity from a culture obtained through the culturing step.
5 The recovering method is not particularly limited and may be appropriately
selected depending on the intended purpose. For example, when the protein of the
present invention having an endoglucanase activity is produced in bacterial cells or
the surfaces thereof, the bacterial cells are separated from the culture and then
treated by a known method such as ultrasonic disruption, to thereby recover the
10 protein of the present invention having an endoglucanase activity. Alternatively,
for example, when the protein of the present invention having an endoglucanase
activity is produced in the culture, bacterial cells are removed through, for example,
centrifuging or filtration, to thereby recover the protein of the present invention
having an endoglucanase activity.
15 The recovered protein having an endoglucanase activity is preferably
purified. The purification method is not particularly limited and may be
appropriately selected depending on the intended purpose. Examples thereof
include ammonium sulfate fractionation, various chromatogarphies, alcohol
precipitation and ultrafiltration. Also, when a tag sequence for purification is
20 added to the protein having an endoglucanase activity, a purification method
corresponding to the added tag can be employed. The purification method
corresponding to the added tag is not particularly limited and may be appropriately
selected depending on the intended purpose. For example, when the added tag is a
sequence of six histidine residues, a purification method using a nickel column can
25 be employed.
• Other steps -
The other steps are not particularly limited, so long as the effects of the

present invention cannot be impeded, and may be appropriately selected depending
on the intended purpose. Examples thereof include the steps described in the above
.
(DNA encoding protein having endoglucanase activity)
5 DNA encoding the protein of the present invention having an endoglucanase
activity is DNA encoding a protein including an amino acid sequence indicated by
SEQ ID NO. l; DNA encoding a protein including an amino acid sequence ranging
from position 27 to position 206 of the amino acid sequence indicated by SEQ ID NO.
l; DNA including a nucleotide sequence indicated by SEQ ID NO. 21 and DNA
10 including a nucleotide sequence ranging from position 79 to position 621 of the
nucleotide sequence indicated by SEQ ID NO. 2.
Also, the DNA encoding the protein of the present invention having an
endoglucanase activity encompasses DNA encoding a protein including an amino
acid sequence which is identical to that indicated by SEQ ID NO. 1, except that one
15 to several amino acids are substituted, deleted, inserted or added; and DNA
encoding a protein including an amino acid sequence which is identical to that
ranging from position 27 to position 206 of the amino acid sequence indicated by
SEQ ID NO. 1, except that one to several amino acids are substituted, deleted,
inserted or added. Here, similarly, the description "several amino acids" is not
20 particularly limited, so long as the obtained proteins have an endoglucanase activity,
and may be appropriately selected depending on the intended purpose. Also, the
region where the one to several amino acids are substituted, deleted, inserted or
added is not particularly limited, so long as the obtained proteins have an
endoglucanase activity, and may be appropriately selected depending on the
25 intended purpose.
Furthermore, the DNA encoding the protein of the present invention having
an endoglucanase activity encompasses DNA which hybridizes under stringent

conditions with DNA including a nucleotide sequence indicated by SEQ ID NO. 2 or
with a complementary strand to the DNA>* and DNA which hybridizes under
stringent conditions with DNA including a nucleotide sequence ranging from
position 79 to position 621 of the nucleotide sequence indicated by SEQ ID NO. 2 or
5 with a complementary strand to the DNA.
Notably, DNA encoding the protein of the present invention having an
endoglucanase activity may be those with a nucleotide sequence which has a certain
sequence identity to the nucleotide sequence indicated by SEQ ID NO. 2 or to the
nucleotide sequence ranging from position 79 to position 621 of the nucleotide
10 sequence indicated by SEQ ID NO. 2. The sequence identity is not particularly
limited, so long as the obtained proteins have an endoglucanase activity, and may be
appropriately selected depending on the intended purpose. The sequence identity
is preferably 70% or higher, more preferably 80% or higher, still more preferably 90%
or higher, particularly preferably 95% or higher.
15 The identity between the nucleotide sequences can be analyzed similar to the
analysis of the identity between amino acid sequences. The program used for
analyzing the identity between the nucleotide sequences is not particularly limited
and may be appropriately selected depending on the intended purpose. Examples
thereof include blastn programs. The parameters used for analyzing the sequence
20 identity with the above program are not particularly limited and may be
appropriately selected depending on the intended purpose. For example, default
values can be used.
The preparation method of the DNA is not particularly limited and may be
appropriately selected depending on the intended purpose. Examples thereof
25 include hybridization (Southern, EM., J. Mol. Biol., 1975, 98, 503.), polymerase
chain reaction (PCR) (Saiki, RK. et al., Science, 1985, 230, 1350., Saiki, RK. et al.,
Science, 1988, 239, 487.) and introduction of mutation into the DNA by the

site-directed mutagenesis (Kramer, W. & Fritz, HJ., Methods Enzymol, 1987, 154,
350.).
Notably, nucleotide sequences may be naturally mutated, potentially causing
mutation of the amino acid sequence of the encoded proteins. On the other hand,
5 even if nucleotide sequences are mutated, the amino acid sequence of the encoded
protein is not mutated in some cases. The DNA of the present invention
encompasses artificially-prepared DNAs and naturally-mutated DNAs.
The form of the DNA is not particularly limited and may be appropriately
selected depending on the intended purpose. For example, the DNA is in the form
10 of genome DNA, cDNA or chemically-synthesized DNA.
The preparation method of the genome DNA is not particularly limited and
may be appropriately selected depending on the intended purpose. In one
preparation method, the genome DNA is extracted from an organism containing a
gene encoding the protein of the present invention having an endoglucanase activity;
15 a genomic library of the genome DNA is formed (using, as a vector, a plasmid, a
pharge, a cosmid, a BAC or PAC) and expanded; and colony or plaque hybridization
is performed using probes which are prepared based on the nucleotide sequence
indicated by SEQ ID NO. 2 or nucleotide sequences on the genome in the vicinity of
the nucleotide sequence indicated by SEQ ID NO. 2. In another preparation
20 method, PCR is performed using primers specific to the nucleotide sequence
indicated by SEQ ID NO. 2 or nucleotide sequences on the genome in the vicinity of
the nucleotide sequence indicated by SEQ ID NO. 2.
The preparation method of the cDNA is not particularly limited and may be
appropriately selected depending on the intended purpose. In one preparation
25 method, cDNA is synthesized based on mRNA which has been extracted from an
organism containing a gene encoding the protein of the present invention having an
endoglucanase activity; the thus-synthesized cDNA is inserted into a vector to

prepare a cDNA library, which is then expanded; and colony or plaque hybridization
or PCR is performed using probes or primers which are prepared based on the
nucleotide sequence indicated by SEQ ID NO. 2.
The DNA of the present invention encompasses DNA that can be isolated
5 through hybridization or PCR and contains the nucleotide sequence of SEQ ID NO. 2,
and DNA that hybridizes with the DNA or with a complementary strand to the DNA,
so long as they encode a protein having an endoglucanase activity.
The reaction conditions for the hybridization are not particularly limited, so
long as the above DNA can be isolated, and may be appropriately selected depending
10 on the intended purpose. Stringent conditions are preferred.
The stringent conditions are not particularly limited and may be
appropriately selected depending on the intended purpose. For example, the
sodium concentration is preferably 25 mM to 500 mM, more preferably 25 mM to 300
mM; and the temperature is preferably 42°C to 68°C, more preferably 42°C to 65°C.
15 For example, the buffer used is 5 x SSC (83 mM NaCl, 83 mM sodium citrate), and
the temperature is 42°C.
The DNA isolated through hybridization under the above reaction conditions
is thought to have a high sequence identity to the nucleotide sequence indicated by
SEQ ID NO. 2 or the nucleotide sequence ranging from position 79 to position 621 of
20 that indicated by SEQ ID NO. 2. The high sequence identity is preferably 70% or
higher, more preferably 80% or higher, still preferably 90% or higher, particularly
preferably 95% or higher, on the basis of the whole nucleotide sequence. Such
nucleotide sequences are thought to encode a protein having an activity
substantially comparable to the endoglucanase of the present invention.
25 Notably, in addition to using as an index the results of hybridization as
described above, DNA having the above-described nucleotide sequence identity or
DNA encoding a protein having a certain amino acid sequence identity can be easily

discovered by search, using the aforementioned BLAST program, public databases
or a group of DNAs whose functions are unknown and which are obtained through,
for example, analysis of the genome nucleotide sequence. Such search is a method
commonly used by researchers in the art.
5 Whether the thus-obtained DNA encodes a protein having an endoglucanase
activity can be confirmed as follows: the DNA is introduced into an appropriate
vector, which is used to transform an appropriate host.' and the resultant
transformant is cultured and the produced protein is measured for endoglucanase
activity as described above. Next, detail description will be given to this method.
10 (Recombinant vector)
A recombinant vector of the present invention includes at least the DNA of
the present invention; and, if necessary, further includes other DNAs.
The vector is not particularly limited, so long as it is replicable in a host
used, and may be appropriately selected depending on the intended purpose.
15 Examples thereof include plasmids, cosmids, pharges and viruses. Specific
examples include plasmids derived from yeasts, plasmids derived from Escherichia
coli, plasmids derived from Bacillus subtilis, X pharge, animal viruses (e.g.,
retroviruses and vaccinia viruses) and insect viruses (e.g., baculoviruses).
Also, the vector is preferably an expression vector capable of expressing the
2 0 DNA of the present invention.
The other DNAs are not particularly limited, so long as the effects of the
present invention cannot be impeded, and may be appropriately selected depending
on the intended purpose. Examples thereof include marker genes, regulatory
sequences and purifying sequences.
25 Examples of the marker gene include genes complementing auxotrophy of a
host such as URA3 and niaD, and drug-resistant genes against, for example,
ampicillin and kanamycin.

Examples of the regulatory sequence include promoter sequences, enhancer
sequences, terminator sequences and polyadenylation sequences. The promoter
sequences are not particularly limited and may be appropriately selected depending
on the intended purpose. Also, there can be used other promoters than specific
5 promoters that intrinsically regulate the expression of the DNA of the present
invention.
The purifying sequence is, for example, nucleotide sequences encoding
histidine(s).
The recombinant vector of the present invention can be obtained by ligating
10 (inserting) with (into) an appropriately vector the DNA of the present invention and
optionally used other DNAs.
The method of inserting the DNA into the vector is not particularly limited
and may be appropriately selected depending on the intended purpose. In one
exemplary method, a purified DNA is cut with an appropriately restriction enzyme,
15 and then the cut fragment is inserted into a restriction enzyme recognition site or a
multicloning site of an appropriate vector DNA for ligation with the vector.
(Transformant)
The transformant of the present invention can be obtained by introducing
into a host a vector (expression vector) of the present invention.
20 The host is not particularly limited, so long as it can express the protein of
the present invention having an endoglucanase activity, and may be appropriately
selected depending on the intended purpose. Examples thereof include yeasts such
as Pichia pastoris, Saccharomyces cerevisiae and Schizosaccharomyces pombe,
bacteria belonging to the Genus Escherichia such as Escherichia coli, bacteria
25 belonging to the Genus Bacillus such as Bacillus subtilis, bacteria belonging to the
Genus Pseudomonas such as Pseudomonas putida, animal cells such as COS cells
and CHO cells, and insect cells such as Sf9 cells. Of these, Pichia pastoris is
preferred since it produces a large amount of active-form enzymes.
23

The method for introducing the vector into the host is not particularly
limited and may be appropriately selected depending on the intended purpose.
The method for introducing the recombinant vector into yeasts is, for
example, the electroporation method, the spheroplast method and the lithium
5 acetate method.
The method for introducing the recombinant vector into bacteria is, for
example, the calcium ion method and the electroporation method.
The method for introducing the recombinant vector into animal cells is, for
example, the electroporation method, the calcium phosphate method and the
10 lipofection method.
The method for introducing the recombinant vector into insect cells is, for
example, the calcium phosphate method, the lipofection method and the
electroporation method.
The method for confirming whether or not the recombinant vector of the
15 present invention has been introduced into the host is not particularly limited and
may be appropriately selected depending on the intended purpose. Examples
thereof include PCR, southern hybridization and northern hybridization.
In one exemplary method of PCR for confirming whether or not the
recombinant vector of the present invention has been introduced into the host, DNA
20 is prepared from the transformant; primers specific to the DNA are synthesized to
perform PCR; the amplified product is subjected to, for example, agarose gel
electrophoresis, polyacrylamide gel electrophoresis or capillary electrophoresis; the
resultant product is stained with, for example, ethidium bromide or SYBR Green
liquid to thereby detect the amplified product as a single band. Also, primers
25 labeled with, for example, a fluorescent dye can be used to perform PCR, whereby
the amplified product can be detected. In addition, the amplified product, which

has been bonded to a solid phase such as a microplate, can be confirmed through
fluorescent or enzymatic reaction.
As described above, the transformant can be used in the method for
producing the protein of the present invention having an endoglucanase activity.
5 The obtained protein having an endoglucanase activity can be suitably used in the
below-described applications; i.e., a method for producing a sugar, a method for
producing ethanol, a food, a feed, a detergent and a method for treating a
cellulose-containing woven fabric.
(Method for producing sugar)
10 A method of the present invention for producing a sugar includes a step of
producing the sugar from a biomass material using the protein of the present
invention having an endoglucanase activity, a basidiomycete or both of the protein
and the basidiomycete (sugar-producing step); and, if necessary, further includes
other steps.
15 - Sugar-producing step-
The sugar-producing step is a step of producing a sugar from a biomass
material using the protein of the present invention having an endoglucanase activity,
a basidiomycete or both of the protein and the basidiomycete. If necessary, there
can be further used an additional cellulase other than the protein of the present
2 0 invention having an endoglucanase activity.
The biomass material is not particularly limited and may be appropriately
selected depending on the intended purpose. Examples thereof include "waste
biomass" which is a residue generated in production activities such as agriculture
and forestry, and "resource crop biomass" which is obtained through intentional
25 cultivation for obtaining energy, etc. Examples of the "waste biomass" include
waste building materials, thinned materials, rice straws, wheat straws, chaff and
bagasse (sugarcane pomace). Examples of the "resource crop biomass" include

carbohydrate crops such as sugarcanes and corns. In addition, the biomass
material is further classified into "woody biomass" derived from woods and
"herbaceous biomass" derived from herbs.
The above biomass materials may be used individually or in combination.
5 The basidiomycete is not particularly limited and may be appropriately
selected depending on the intended purpose. Basidiomycetes belonging to
Agaricomycotina, Basidiomycota are preferred; basidiomycetes belonging to
Homobasidiomycetes, Agaricomycotina, Basidiomycota are more preferred;
basidiomycetes belonging to Corticiaceae, Homobasidiomycetes, Agaricomycotina,
10 Basidiomycota are still more preferred; and Phanerochaete chrysosporium is
particularly preferred.
The cellulase is not particularly limited and may be appropriately selected
depending on the intended purpose. Examples thereof include Cel6A of
Phanerochaete chrysosporium (P. chrysosporium).
15 The amount of the protein of the present invention having an endoglucanase
activity used in the sugar-producing step is not particularly limited and may be
appropriately selected depending on the intended purpose. For example, it is
preferably 0.001 mg to 100 mg, more preferably 0.01 mg to 10 mg, particularly
preferably 0.1 mg to 1 mg, relative to 1 g of the biomass material. When the protein
20 used is less than 0.001 mg relative to 1 g of the biomass material, saccharification
may become insufficient. When the protein used is more than 100 mg,
saccharification may be prevented. When the amount of the protein used is in the
particularly preferable range, a larger amount of the sugar can be produced using a
smaller amount of the enzyme, which is advantageous.
25 Also, the amount of the basidiomycete used is not particularly limited and
may be appropriately selected in consideration of the amount of endoglucanase
produced by the basidiomycete.

Notably, when the additional cellulase is used, the amount of the additional
cellulase is not particularly limited and may be appropriately selected depending on
the intended purpose. The molar ratio of the protein of the present invention
having an endoglucanase activity : the additional cellulase is preferably 75 : 25 to
5 25 : 75, more preferably 75 : 25.
The temperature at the sugar-producing step is not particularly limited and
may be appropriately selected depending on the intended purpose. For example,
the temperature is preferably 10°C to 70°C, more preferably 20°C to 60°C,
particularly preferably 30°C to 50°C. When the temperature is lower than 10°C,
10 saccharification does not occur in some cases. When the temperature is higher than
70°C, the protein having an endoglucanase activity may be deactivated. When the
temperature is in the particularly preferable range, a larger amount of the sugar can
be produced using a smaller amount of the protein having an endoglucanase activity,
which is advantageous.
15 The pH at the sugar-producing step is not particularly limited and may be
appropriately selected depending on the intended purpose. For example, the pH is
preferably 2.0 to 8.0, more preferably 3.0 to 7.0, particularly preferably 4.0 to 6.0.
When the pH is lower than 2.0 or higher than 8.0, the protein having an
endoglucanase activity may be deactivated. When the pH is in the particularly
20 preferable range, a larger amount of the sugar can be produced using a smaller
amount of the protein having an endoglucanase activity, which is advantageous.
Through the sugar-producing step, a sugar solution containing glucose
derived from cellulose can be obtained, for example. Preferably, the sugar solution
obtained at the sugar-producing step also contains a sugar derived from
25 hemicellulose. Examples of the sugar derived from hemicellulose include pentoses
such as xylose and arabinose and hexoses such as glucose, galactose and mannose.
For example, the sugar solution may be directly used in the below-described

method of the present invention for producing ethanol. Alternatively, the sugar
solution may be subjected to the following other steps and then used in the
below-described method of the present invention for producing ethanol.

5 The other steps are not particularly limited and may be appropriately
selected depending on the intended purpose. Examples thereof include a step of
adjusting the pH of the sugar solution to a value at which the below-described
fermenting step is performed properly.
(Method for producing ethanol)
10 A method of the present invention for producing ethanol includes fermenting
the sugar produced by the above-described method (fermenting step); and, if
necessary, further includes other steps.
- Fermenting step -
The method for fermenting the sugar is not particularly limited and may be
15 appropriately selected depending on the intended purpose. In one particularly
preferable method, alcohol fermenting microorganisms (e.g., yeasts) are added to the
sugar solution for performing alcohol fermentation.
The yeast is not particularly limited and may be appropriately selected
depending on the intended purpose. Examples thereof include those belonging to
20 the Genus Saccharomyces. Notably, the yeast may be natural yeasts or genetically
modified yeasts.
The conditions for the fermentation (e.g., the amount of the yeast used,
fermenting temperature, pH and fermenting period) are not particularly limited and
may be appropriately selected depending on, for example, the amount of the sugar
25 used for alcohol fermentation and the type of the yeast used.
- Other steps -
The other steps are not particularly limited and may be appropriately

selected depending on the intended purpose. Examples thereof include a step of
separating/purifying ethanol obtained from the fermenting step. The
separating/purifying method is not particularly limited and may be appropriately
selected depending on the intended purpose. Examples thereof include distillation.
5 The ethanol produced by the method for producing ethanol can be suitably
used as, for example, fuel-use ethanol and industrial ethanol. The ethanol can be
obtained from a biomass material. Thus, the ethanol can be reproduced so long as
the biomass material exists. Also, the biomass material is derived from plants
which absorb carbon dioxide in the atmosphere during cultivation. Thus, when
10 carbon dioxide is generated when the ethanol is burnt, the concentration of carbon
dioxide in the atmosphere is not increased. Therefore, the ethanol is a desired
energy source for preventing global warming. Furthermore, in recent years, such
ethanol has been particularly expected to be used as an environmentally-friendly
automotive fuel when mixed with gasoline.
15 (Food and feed)
A food or feed of the present invention contains at least the protein of the
present invention having an endoglucanase activity! and, if necessary, further
contains other ingredients.
The amount of the protein of the present invention having an endoglucanase
20 activity contained in the food or feed is not particularly limited and may be
appropriately selected depending on the intended purpose.
The method for producing the food or feed is not particularly limited and may
be appropriately selected depending on the intended purpose.
Since the food or feed of the present invention contains the protein having an
25 endoglucanase activity, cellulose or other ingredients contained in the food or feed
can be degraded, resulting in that the food or feed is made to be efficiently digested.
(Detergent)

A detergent of the present invention contains at least the protein of the
present invention having an endoglucanase activity,' and, if necessary, further
contains other ingredients.
The amount of the protein of the present invention having an endoglucanase
5 activity is not particularly limited and may be appropriately selected depending on
the intended purpose.
The method for producing the detergent is not particularly limited and may
be appropriately selected depending on the intended purpose.
The detergent, containing the protein of the present invention having an
10 endoglucanase activity, can efficiently remove stains present inside cellulose fibers of
objects to be washed.
(Method for treating cellulose-containing woven fabric)
A method of the present invention for treating a cellulose-containing woven
fabric includes a step of treating the cellulose-containing woven fabric with the
15 protein of the present invention having an endoglucanase activity (treating step);
and, if necessary, further includes other steps.
The cellulose-containing woven fabric is not particularly limited and may be
appropriately selected depending on the intended purpose. Examples thereof
include jeans.
20 The conditions for the treating step (e.g., the amount of the protein of the
present invention having an endoglucanase activity, temperature and time) are not
particularly limited and may be appropriately selected depending on the intended
purpose.
For example, the jeans can be stonewashed with the method of the present
25 invention for treating a cellulose-containing woven fabric.
Examples

The present invention will next be described by way of examples, which
should not be construed as limiting the present invention thereto.
(Search for gene encoding novel protein having endoglucanase activity)
For obtaining a gene encoding a novel protein having an endoglucanase
5 activity, first, proteins produced by Phanerochaete chrysosporium K-3 strain (one
basidiomycete) (Johnsrud, S. C, and K. E. Eriksson. 1985. Cross breeding of selected
and mutated homokaryotic strains of Phanerochaete chrysosporium K-3 - New
cellulase deficient strains with increased ability to degrade lignin. Appl. Microbiol.
Biotechnol. 21:320-327.) were examined as follows.
10 Specifically, cells of Phanerochaete chrysosporium K-3 strain were cultured
for 3 days in the Kremer and Wood medium containing 2% cellulose (CF11I product
of Whatman) (Kremer, S. M., and P. M. Wood. 1992. Evidence that cellobiose oxidase
from Phanerochaete chrysosporium is primarily an Fe(III) reductase. Kinetic
comparison with neutrophil NADPH oxidase and yeast flavocytochrome b2. Eur. J.
15 Biochem. 205:134) according to the description of Habu, N., K. Igarashi, M.
Samejima, B. Pettersson, and K. E. Eriksson. 1997. Enhanced production of
cellobiose dehydrogenase in cultures of Phanerochaete chrysosporium supplemented
with bovine calf serum. Biotechnol. Appl. Biochem. 26:98.
The culture obtained after the culturing was filtrated, and mycelia were
20 separated using a glass fiber membrane (ADVANTEC (registered trademark)
GA-100; product of Toyo Roshi Kaisha , Ltd.). The thus-separated mycelia were
frozen with liquid nitrogen, and then was used for extraction of the whole RNA.
The filtrate (500 uL) of the culture was concentrated with a centrifugal filter
device (Ultrafree (registered trademark)-0.5 Centrifugal Filter Device, product of
25 Millipore). The resultant concentrated liquid (unpurified protein: about 100 ug)
was subjected to SDS-PAGE (using 12% polyacrylamide gel) with a device of Bio-Rad
(Mini-Protean II). As a result, the cells of Phanerochaete chrysosporium K-3 strain

were found to produce proteins shown in Fig. 1. Notably, in Fig. 1, the "arrow"
indicates a protein whose N-terminal amino acid sequence was determined as
described below.
After the SDS-PAGE, the protein of 18 kDa (indicated by the arrow in Fig. 1,
5 hereinafter may be referred to as "PcCel45A") was transferred onto a PVDF
membrane (product of Millipore) using a device of Bio-Rad (Trans-Blot SD Cell).
Thereafter, the N-terminal amino acid sequence of the thus-transferred
PcCel45A was determined with a protein sequencer (Model 491 cLcl product of
Applied Biosystems). As a result, the N-terminal amino acid sequence of PcCel45A
10 was found to be ATGGYVQQAT.
Sequence identity search based on the N-terminal amino acid sequence of
PcCel45A was performed to identify a sequence having an identity with PcCel45A.
The sequence identity search was performed using tblastn as BLAST
program and using as a database the genome database v2.0 of Phanerochaete
15 chrysosporium (httpV/genome.jgi-psf.org/Phchrl/Phchrl.home.html). The
parameters of the tblastn were default values, except that "expect value" was set to
"le-1" and "scoring matrix" was set to "PAM30."
As a result, the N-terminal amino acid sequence of PcCel45A was found to be
identical with Phanerochaete chrysosporium's "Scaffold 6, 1798263-1798234" whose
20 functions are unknown.
(Cloning of cDNA of PcCel45A)
Next, cloning of cDNA of PcCel45A was performed as follows.
First, the whole RNA (about 200 mg) was extracted from the above-frozen
mycelia using ISOGEN (product of NIPPON GENE CO., LTD.) per the
25 manufacturer's manual.
Subsequently, mRNA was purified from the thus-extracted whole RNA (l ug)
using Oligotex (TM)-dT30 (product of TAKARABIO INC.).

Thereafter, the thus-obtained mRNA was treated using a reverse
transcriptase (ReverTraAce; product of TOYOBO CO., LTD.) and a 3'RACE adaptor
primer (product of Invitrogen) per the manufacturer's manual, whereby a
First-strand cDNA was synthesized.
5 Then, the First-strand cDNA was used to amplify the PcCel45A-encoding
region and the 3' untranslated region through PCR (94°C/2 min: 1 cycle, 98°C/10
sec-68°C/30 sec: 25 cycles, 4°C (termination)). The PCR was performed by using, as
a polymerase, KOD-Plus (version 2; product of TOYOBO CO., LTD.), primers
Pccel45A-Fl and Pccel45A-F2 designed based on the genome sequence of
10 Phanerochaete chrysosporium and a reverse primer (product of Invitrogen) per the
manufacturer's manual.
Primer:
Pccel45A-Fi: ATGGCGAAGCTGTCGATGTTCTTGGG (SEQ ID NO. 3)
Pccel45A-F2: CTGACCGTCTCCGAGAAGCGTG (SEQ ID NO. 4)
15 Reverse primer: Abridged Universal Amplification Primer (product of
Invitrogen)
Also, the nucleotide sequence of the 5' untranslated region was amplified
using GneneRacer (trademark) Kit (product of Invitrogen), Superscript (trademark)
III RT (product of Invitrogen) and the following gene-specific primers (94°C/2 min: 1
20 cycle, 98°C/10 sec-70°C/30 sec: 5 cycles, 98°C/10 sec-68°C/30 sec: 5 cycles, 98°C/10
sec-66°C/30 sec-68°C/30 sec: 20 cycles, 4°C (termination)).
Primers:
Pccel45A-5'-Ri: CAGCCTTGCCGCAAGCAGGAGAGCCGC (SEQ ID NO. 5)
Pccel45A-5'R2: CGCAAGCAGGAGAGCCGCAGCCCGAAT (SEQ ID NO. 6)
25 The above-obtained PCR product was cloned using Zero Blunt (trademark)
TOPO (trademark) PCR cloning kit (product of Invitrogen) and E. coli JM109
(product of TAKARA BIO INC.).

Then, the nucleotide sequence of the PCR product was analyzed using
Thermo Sequence Primer Cycle Sequencing Kit (product of GE Healthcare) and a
DNA sequencer SQ5500E (product of Hitachi High-Technologies Corporation.).
As a result, the cDNA was found to consist of 718 bp, containing a translated
5 region encoding 206 amino acids, which is divided into three exons by two introns on
the genome of Phanerochaete chrysosporium (P. chrysosporium). The results are
shown in Figs. 2 and 3.
Notably, in Fig. 2, a sequence of gray highlighted characters (KR) is the
processing site by Kex2 protease, and a sequence of bold letters is that found in the
10 previous secretome studies.
(Analysis for amino acid sequence of PcCel45A)
■ Analysis of signal peptide -
The signal peptide was analyzed using SignalP 3.0 server
(http://www.cbs.dtu.dk/services/SignalP/) of the Center for Biological Sequence
15 Analysis.
The analysis indicates that a signal peptide was a sequence of the first 19
amino acids (marked by the single underline in Fig. 2) which is different from the
N-terminal amino acid sequence of PcCel45A (marked by the double underline in Fig.
2).
2 0 ■ Analysis of glycosylation site -
The N-glycosylation sites were analyzed using NetNGlyc 1.0 Server
(http://www.cbs.dtu.dk/services/NetNGlyc/) of the Center for Biological Sequence
Analysis.
As a result, one N-glycosylation site was predicted (indicated by highlighted
25 characters (NYT) in Fig. 2).
The Oglycosylation sites were analyzed using NetOGlyc 3.1 Server
(http://www.cbs.dtu.dk/services/NetOGlyc/) of the Center for Biological Sequence

Analysis.
As a result, four Oglycosylation sites were predicted (indicated by boxed
characters in Fig. 2).
■ Sequence identity analysis ■
5 The amino acid sequence of PcCel45A was searched for sequence identity
using blastp as BLAST program and using as a database the NCBI protein database
(httpV/www.ncbi.nlm.nih.gov/blast/Blast.cgi). Notably, the parameters of blastp
were set to default values.
As a result, the amino acid sequence of PcCel45A was found to have a low
10 sequence identity with that of an endoglucanase belonging to GH family 45 of a
fungus (EGV), and thus, PcCel45A was found to be a novel protein.
The protein having the highest sequence identity (i.e., 22%) with PcCel45A
was EGV of Hypocrea jecorina (H. jecorina (T. reesei)) except for hypothetical
proteins. Also, PcCel45A was found to contain no putative domains conserved in
15 the endoglucanase belonging to the fungal GH family 45 (EGV).
Next, using MAFFT (version 6;
httpV/align.bmr.kyushu-u.ac.jp/mafft/online/server/) program of E-INS-i algorithm,
multiple alignment was performed between the amino acid sequence of PcCel45A
and the amino acid sequences of the following five proteins which had been
20 considered as having relevant sequences as a result of BLAST search. The results
are shown in Fig. 4. Notably, Fig. 4 was made with BOXSHADE
(http://www.ch.embnet.org/software/BOX_form.html).
Five proteins:
Hypothetical protein of Coprinopsis cinerea (hereinafter may be abbreviated
25 as "CcHP")
Hypothetical protein of Ustilago maydis (hereinafter may be abbreviated as
"UmHP")

Hypothetical protein of Aspergillus nidulans (hereinafter may be abbreviated
as "AnHP")
Hypothetical protein of Aspergillus fumigatus (hereinafter may be
abbreviated as "AfHF')
5 Cel45A of Hypocrea jecorina (hereinafter may be abbreviated as "HjCel45A")
Notably, except for hypothetical proteins, HjCel45A was found to have the
highest sequence identity with the amino acid sequence of the above 18 kDa protein.
Through comparison between the amino acid sequences of PcCel45A and
HjCel45Aas shown in Fig. 4, Asp 140 in the amino acid sequence of PcCel45A
10 (indicated by the arrow in Fig. 4) is thought to be one of the catalytic residues.
However, another possible catalytic residue (Asp27 of HjCel45A) was not found in
the amino acid sequence of PcCel45A. Therefore, PcCel45A is considered different
in reaction mechanism from known enzymes.
■ Phylogenetic analysis -
15 Next, phylogenetic analysis was performed on the amino acid sequences of
PcCel45A and the following proteins considered as having relevant sequences
through blastp search: enzymes belonging to subfamily B of the fungal GH family 45
(hereinafter may be referred to as "Cel45-subB"), plant expansin, enzymes belonging
on the CAZy server to subfamily A of the fungal GH family 45 (hereinafter may be
20 referred to as "Cel45-subA") and fungal swollenin. The results are shown in Fig. 5.
The phylogenetic tree of Fig. 5 was made from the results of multiple
alignment on the MAFFT server with the minimum linkage method, and was drawn
with FigTree (version 1.1.2! http://tree.bio.ed.ac.uk/software/figtree/).
From the results of the BLAST search, the amino acid sequence of PcCel45A
25 was slightly similar to those of subfamily B of GH family 45, but quite different from
those of subfamily A of GH family 45.
Also, as shown in Fig. 5, the clade containing PcCel45A was found to include

only hypothetical proteins derived from the following basidiomycetes: Coprinopsis
cinerea (EAU91056) and Ustilago maydis (XP_761686).
The above-described discussion indicates that PcCel45Ais a novel protein
classified into a new subfamily of GH family 45. Next, description will be given to
5 one exemplary production method of PcCel45A.
(Production of PcCel45A using yeast)
■ Production of recombinant vector (expression vector) -
The following oligonucleotide primers were formed on the basis of the
nucleotide sequence of the mature PcCel45A.
0 Oligonucleotide primer:
Pccel45A-XhoIF:TTTCTCGAGAAAAGACTGACCGTCTCCGAGAAGCGTG
(SEQ ID NO. 7)
Pccel45A-NotIR:TTTTGCGGCCGCTCACGAAGGGGCAGTCCCCTTGTT
(SEQ ID NO. 8)
5 Using a PcCel45A gene-containing vector (serving as a template), the above
oligonucleotide primers, and polymerase KOD-Plus (version 2," product of TOYOBO
CO., LTD.), PCR was performed (94°C/2 min: 1 cycle, 98°C/10 sec-68°C/30 sec: 20
cycles, 4°C (termination)) to amplify a DNA fragment to be inserted into an
expression vector.
o The thus-amplified DNA fragment was inserted into the Xhol and NotI sites
of vector pPICZa (product of Invitrogen) of a yeast (Pichia), to thereby obtain a
recombinant vector (expression vector).
- Production of transformant -
The above-obtained expression vector (about 5 ug) was linearized with
5 Bpull02I (product of TAKARA BIO INC.). Then, the thus-linearized recombinant
vector was introduced through electroporation into cells of yeast (Pichia pastoris)
KM71H strain (product of Invitrogen), followed by selection of transformants.

The electroporation and selection of transformants were performed per the
manual of EasySelect (trademark) Pichia expression kit (version Gl product of
Invitrogen). Through the above procedure, transformants transformed by the
above expression vector were obtained.
5 ■ Culturing of transformed yeast, and production and purification of PcCel45A -
Using a reciprocating shaking incubator, the above-obtained transformants
were cultured for 24 hours in 10 mL of a YPG medium (1% yeast extract, 2%
polypeptone, 1% glycerol) containing Zeocin (25 ug/mL) at 30°C and 300 rpm. The
thus-cultured transformants were inoculated into a conical flask containing the YPG
10 medium (200 mL), followed by culturing for 24 hours with a rotary shaking
incubator (30°C, 150 rpm). After recovered through centrifuging (3,000 g, 10 min),
the cells were transferred to 50 mL of a YPM medium (1% yeast extract, 2%
polypeptone, 1% methanol). Then, while methanol was being added thereto every
24 hours so that the final concentration thereof was 1%, the medium was further
15 cultured for 96 hours with a rotary shaking incubator (30°C, 150 rpm).
The culture liquid was centrifuged (30 min, 5,000 x g) to obtain the culture
supernatant (crude enzyme liquid). Then, ammonium sulfate was added to the
thus-obtained crude enzyme liquid so that the final concentration thereof was 1 M.
In addition, a sodium acetate buffer (pH 5.0) was added thereto so that the final
2 0 concentration thereof was 20 mM.
The resultant solution was fractionated using Phenyl-Toyopearl 650S column
(26 mm x 120 mm, product of TOSOH CORPORATION) equilibrated with a 20 mM
sodium acetate buffer (pH 5.0) containing 1 M ammonium sulfate. PcCel45Awas
eluted to the 20 mM sodium acetate buffer (pH 5.0) with reverse gradient (300 mL).
25 Thereafter, fractions containing PcCel45A were collected and equilibrated to
a 20 mM potassium phosphate buffer (pH 7.0). Subsequently, the equilibrated
PcCel45A-containing solution was added to SuperQ-Toyopearl 650S column (9 mm x

120 mm, product of TOSOH CORPORATION) equilibrated with a 20 mM potassium
phosphate buffer (pH 7.0). PcCel45A was eluted from the column with a linear
gradient from 0 M to 0.5 M of sodium chloride (100 mL).
The purity of the obtained PcCel45A was analyzed through SDS-PAGE (12%
5 polyacrylamide gel). Also, the N-terminal amino acid sequence of PcCel45A was
analyzed with a protein sequencer (Model 491 cLc>' product of Applied Biosystems).
As a result, the N-terminal amino acid sequence of PcCel45A obtained in the
transformed yeasts was found to be ATGGYVQQAT, which was the same as that of a
naturally-occurring one derived from Phanerochaete chrysosporium (P.
10 chrysosporium) of basidiomycetes.
Next, whether the above-obtained PcCel45Ahas an endoglucanase activity
was determined by the following enzymatic test.
(Enzymatic test)
- Hydrolyzing activity to various substrates -
15 The above-obtained PcCel45A (1.0 uM) and each (0.5%) of the below-listed
substrates were reacted with each other in 250 [ih of a 50 mM sodium acetate
solution (pH 5.0) at 30°C for up to 120 hours.
Substrate •
Crystalline cellulose (Funacel II, product of Funakoshi Corporation
20 (hereinafter may be referred to as "MCC"))
Non-crystalline cellulose (phosphoric acid swollen cellulose, which had been
prepared from crystalline cellulose by the method described in Wood, T.M. 1988.
Preparation of crystalline, amorphous, and dyed cellulase substrates. Methods
Enzymol. 160: 19-25 (hereinafter may be referred to as "PASC"))
25 Carboxymethyl cellulose (7LFD, product of Hercules (hereinafter may be
referred to as "CMC"))
Lichenan (product of Sigma-Aldrich)

Barley p-glucan (product of Sigma-Aldrich)
Glucomannan (product of Wako Pure Chemical Industries, Ltd.)
Xylan (product of Sigma-Aldrich)
- Measurement of the amount of reducing sugar ■•
5 The above reaction was performed for 1 hour and then terminated by the
addition of an equal volume of a 1.0 M sodium hydroxide solution. Then, by the
p-hydroxybenzoic acid hydrazide (PHBAH) method (Lever, M. 1972. A new reaction
for colorimetric determination of carbohydrates. Anal. Biochem. 47:273-279.), the
amount of the reducing sugar was measured using, as a standard, glucose (product
10 of Wako Pure Chemical Industries, Ltd.). The results are shown in Table 1.

In Table 1, "n.d." means that no reducing sugar was detected after the
reaction had been performed for 120 hours.
15 From the data shown in Table 1, PcCel45A was found to hydrolyze PASC,
CMC, lichenan, barley p-glucan and glucomannan, and thus to have an
endoglucanase activity.
In contrast, PcCel45A was found to have no hydrolyzing activity to MCC and
xylan.
20 Also, PcCel45A was found to exhibit higher initial rate (activity) to
p-l,3/l,4-glucans (lichenan and barley p-glucan) than to p-l,4-glucans (PASC and
carboxymethyl cellulose).

■ Analysis of hydrolyzate -
-■ Analysis through thin-layer chromatography (TLC) -
PcCel45A and each substrate were reacted with each other as follows, and
the resultant oligosaccharide (hydrolyzate) was analyzed through TLC.
Specifically, PcCel45A(l.O uM) and each substrate (0.5%) (MCC, PASC, CMC,
lichenan, barley p-glucan, glucomannan or xylan) were reacted with each other in
250 uL of a 50 mM sodium acetate solution (pH 5.0) at 30°C for 1 hour or 120 hours.
The reaction mixture was boiled for 5 min to terminate the reaction, followed
by centrifuging (x 15,000 g). The resultant supernatant was applied to a pre-coated
silica gel 60 TLC plate (product of Merck) and developed using as a developing
solvent EtOAc/CH3COOH/H20 (3/2/1 by volume). The reducing sugars were
detected with an orcinol reagent by the method described in Kawai, R., K. Igarashi,
M. Kitaoka, T. Ishii, and M. Samejima. 2004. Kinetics of substrate
transglycosylation by glycoside hydrolase family 3 glucan (l->3)-p-glucosidase from
the white-rot fungus Phanerochaete chrysosporium. Carbohydr. Res. 339^2852-2853.
The results are shown in Figs. 6 and 7.
Fig. 6 shows the result of TLC analysis of soluble products in hydrolyzates
obtained when the reaction was performed for one hour. Fig. 7 shows the result of
TLC analysis of soluble products in hydrolyzates obtained when the reaction was
performed for 120 hours.
In Figs. 6 and 7, lane "1" indicates the case where the substrate was "MCC,"
lane "2" indicates the case where the substrate was "PASC," lane "3" indicates the
case where the substrate was "CMC," lane "4" indicates the case where the substrate
was "lichenan," lane "5" indicates the case where the substrate was "barley
p- glucan," lane "6" indicates the case where the substrate was "glucomannan" and
lane "7" indicates the case where the substrate was "xylan." Also, in each lane, "+"
indicates the case where "PcCel45A was present," and "-" indicates the case where

"PcCel45Awas absent."
As is clear from Figs. 6 and 7, PcCel45A was found to produce
oligosaccharides when the substrate was p-l,4-glucan (PASC or CMC).
-■ Analysis through high-performance chromatography (HPLC) -
PcCel45A and PASC (substrate) were reacted with each other as follows, and
the amounts of the resultant mono- to heptasaccharides were analyzed through
HPLC.
Specifically, PcCel45A (1.0 uM) and PASC (0.5%) were reacted with each
other in 250 uL of a 50 mM sodium acetate solution (pH 5.0) at 30°C for 30 min, 60
min, 120 min, 180 min or 240 min. Each of the reaction mixture was boiled for 5
min to terminate the reaction, followed by centrifuging (x 15,000 g). The resultant
supernatant was separated with linear gradient of acetnitrile/H20 (60/40 to 50/50,
volume/volume) using Shodex (trademark) Asahipak NH2P-5O (product of SHOWA
DENKO K.K.). The separated substances were quantified using, as standards,
cellooligosaccharides having a degree of polymerization (DP) of 2 to 7 (product of
SEIKAGAKU CORPORATION).
Notably, the HPLC apparatus used was LC-2000 (product of JASCO
Corporation) using Corona (trademark) Charged Aerosol Detector (trademark)
(product of ESA Biosciences). The results are shown in Fig. 8.
In Fig. 8, "solid squares" correspond to the monosaccharides, "solid circles"
correspond to the disaccharides, "solid triangles" correspond to the trisaccharides,
"solid rhombi" correspond to the tetrasaccharides, "open squares" correspond to the
pentasaccharides, "open circles" correspond to the hexasaccharides, and "open
triangles" correspond to the heptasaccharides.
From the graph of Fig. 8, it was found that, when the substrate was PASC,
PcCel45A produced the cellooligosaccharides having a degree of polymerization (DP)
of 3 to 5 (tri- to pentasaccharides) in a large amount. In contrast, the disaccharides

(DP = 2) and the monosaccharides (DP = l) were produced in a small amount.
Notably, the cellooligosaccharides having a DP of 6 or 7 (hexa- or heptasaccharides)
were also produced in a small amount, but this is likely because these saccharides
have low solubility.
■ Synergistic effect of PcCel45A -
Using PcCel45A (enzyme), a recombinant Phanerochaete chrysosporium (P.
chrysosporium) Cel6A (hereinafter may be referred to as "Cel6A") expressed in a
methylotrophic yeast (Pichia pastoris) and PASC (substrate), the synergistic effect of
PcCel45A was tested as follows based on the hydrolyzate of the substrate.
-■ Production of recombinant Cel6A -
■-■ Cloning of Cel6A gene —
The following primers were designed on the basis of Cel6A gene (AAB32942)
derived from Phanerochaete chrysosporium on the NCBI database.
Primer:
PcCel6A-EcoRI-F: TTTGAATTCCAGGCGTCGGAGTGGGGACAG (where
the sequence "GAATTCC" is the cleavage sequence of restriction enzyme EcoRI)
(SEQ ID NO. 9)
PcCel6ANotIR: TTTGCGGCCGCCTACAGCGGCGGGTTGGCAGC (where
the sequence "GCGGCCGC" is the cleavage sequence of restriction enzyme NotI)
(SEQ ID NO. 10)
The above primers were used to perform PCR (94°C/2 min: 1 cycle, 98°C/10
sec-68°C/1.5 min: 25 cycles, 4°C (termination)) using, as a template, cDNA which had
been prepared in the same manner as in PcCel45A, to thereby obtain a nucleotide
sequence encoding a mature PcCel6A (an amino acid sequence subsequent to the
21th amino acid).
The above-obtained PCR product was cloned using Zero Blunt (trademark)
TOPO (trademark) PCR cloning kit (product of Invitrogen) and E.coli JM109 strain

(product of TAKARA BIO INC.).
— Production of recombinant vector (expression vector) —
A vector containing PcCel6A gene prepared by miniprep and a yeast
expression vector pPICZaA (product of Invitrogen) were cut with restriction enzymes
EcoRI and NotI (product of TAKARA BIO INC.). The resultant fragments were
separated through agarose electrophoresis and then recovered through gel
extraction.
The above-treated pPICZaA and PcCel6A gene (each: 20 ng) were ligated
together with DNA Ligation Kit (product of TAKARA BIO INC.), and
then cloned with E. coli JM109 strain (product of TAKARA BIO INC.). In order to
remove the Stel3 signal cleavage site from the yeast expression vector pPICZaA
containing PcCel6A gene prepared by miniprep (hereinafter may be referred to as
"pPICZaA/PcCel6A"), the following primers were designed and used to perform PCR
(94°C/2 min: 1 cycle, 98°C/10 sec-68°C/1.5 min: 15 cycles, 4°C (termination)) using
pPICZaA/PcCel6A as a template.
Primer^
PcCel6A-Kex2-F:
GAAGGGGTATCTCTCGAGAAAAGACAGGCGTCGGAGTGGGGACAG (SEQ ID
NO. 11)
PcCel6A-Kex2-R:
CTGTCCCCACTCCGACGCCTGTCTTTTCTCGAGAGATACCCCTTC (SEQ ID NO.
12)
The amplified gene fragments were treated with restriction enzyme Dpnl,
and then cloned with E. coli JM109 strain (product of TAKARA BIO INC.).
■■■ Production of transformant —
The pPICZaA/PcCel6A-Ste (-) (which had been obtained by miniprep), from
which the Stel3 signal cleavage site had been removed, was linealized with

restriction enzyme BstXI (product of TAKARA BIO INC.), and introduced through
electroporation into cells of yeast (Pichia pastoris) KM-71H strain. The
transformants were selected based on antibiotic (Zeocin) resistance as an index.
-■- Culturing of transformed yeast, and production and purification of Cel6A —
Using a reciprocating shaking incubator, the above-obtained transformants
were cultured for 24 hours in 10 mL of a YPG medium (l% yeast extract, 2%
polypeptone, 1% glycerol) containing Zeocin (25 ng/mL) at 30°C and 300 rpm. The
thus-cultured transformants were inoculated on a conical flask containing the YPG
medium (200 mL), followed by culturing for 24 hours with a rotary shaking
incubator (30°C, 150 rpm). After recovered through centrifuging (3,000 g, 10 min),
the cells were transferred to 50 mL of a YPM medium (1% yeast extract, 2%
polypeptone, 1% methanol). Then, while methanol was being added thereto every
24 hours so that the final concentration thereof was 1%, the medium was further
cultured for 96 hours with a rotary shaking incubator (30°C, 150 rpm). The culture
liquid was centrifuged (3,000 g, 10 min) to obtain the culture supernatant (crude
enzyme liquid).
Then, ammonium sulfate was added to the thus-obtained crude enzyme
liquid so that the concentration thereof was 70% of the saturated concentration,
followed by centrifuging (15,000 g, 30 min), to thereby recover a precipitate. The
precipitate was dissolved in a 20 mM sodium acetate buffer (pH 5.0) containing 1 M
sodium sulfate.
The resultant solution was fractionated using Phenyl-Toyopearl 650S column
(26 mm x 120 mm, product of TOSOH CORPORATION) equilibrated with a 20 mM
sodium acetate buffer (pH 5.0) containing 1 M ammonium sulfate. PcCel6Awas
eluted with a 300 mL reverse gradient to 20 mM sodium acetate buffer (pH 5.0).
Thereafter, fractions containing PcCel6A were collected and equilibrated to a
20 mM Tris-HCL buffer (pH 8.0). Subsequently, the equilibrated

PcCel6A-containing solution was added to SuperQ-Toyopearl 650S column (9 mm x
120 mm, product of TOSOH CORPORATION) equilibrated against a 20 mM
Tris-HCl buffer (pH 8.0). PcCel6A was eluted from the column with linear gradient
from 0 M to 0.5 M of sodium chloride (100 mL).
The obtained PcCel6A was analyzed through SDS-PAGE (12%
polyacrylamide gel), and as a result a single band was observed. Also, the
N-terminal amino acid sequence of PcCel6A was analyzed with a protein sequencer
(Model 491 cLc; product of Applied Biosystems). As a result, the N-terminal amino
acid sequence of PcCel6A obtained in the transformed yeasts was found to be
QASEWGQCGGIG, which was the same as that of a naturally-occurring Cel6A
derived from Phanerochaete chrysosporium (P. chrysosporium) of basidiomycetes.
-- Test for synergistic effect -
PcCel45A and Cel6Aat a molar ratio of 100 : 0, 75 : 25, 50 : 50, 25 : 75 or 0 :
100 (total enzyme concentration: 1.0 \iM) were reacted with PASC (0.5%) in 250 (j,L of
a 50 mM sodium acetated solution (pH 5.0) at 30°C for 60 min, 120 min, 180 min or
240 min. Then, each reaction mixture was boiled for 5 min, followed by
centrifuging (x 15,000 g).
The cellooligosaccharides contained in the resultant supernatant were
analyzed in the same manner as in the above-described HPLC analysis. The
results are shown in Figs. 9 and 10.
In Fig. 9, the solid line corresponds to the case where the molar ratio
PcCel45A: Cel6A was 100 : 0, the dotted line corresponds to the case where the
molar ratio PcCel45A: Cel6A was 50 : 50, and the broken line corresponds to the
case where the molar ratio PcCel45A: Cel6A was 0 : 100.
From the graph of Fig. 9, it was found that cellobiose (DP = 2) was the main
product produced by PcCel6A from PASC. Also, even when PcCel45A and PcCel6A
were used in combination, the main product produced from PASC was found to be

cellobiose (DP = 2) similarly.
In Fig. 10, "solid squares" correspond to the case where the reaction time was
60 min, "solid circles" correspond to the case where the reaction time was 120 min,
"solid triangles" correspond to the case where the reaction time was 180 min, and
"solid rhombi" correspond to the case where the reaction time was 240 min. Also,
each dotted line indicates the total amount of hydrolyzates produced when the
enzymes were separately reacted with the substrate.
From the graph of Fig. 10, when PcCel45A and PcCel6A were used in
combination, the resultant hydrolyzates (cellooligosaccharides) were obtained in an
amount larger than the total amount of those produced when they were used
separately. The amount of the hydrolyzates produced when PcCel45A and PcCel6A
at a molar ratio of 75 : 25 had been reacted for 120 min was found to be 3.6 times
larger than the calculated value (indicated by the dotted line in Fig. 10). The
amount of the hydrolyzates produced when PcCel45A and PcCel6A at a molar ratio
of 50 : 50 had been reacted for 120 min was found to be 2.7 times larger than the
calculated value (indicated by the dotted line in Fig. 10).
This indicates that PcCel45A exhibits a synergistic effect when used in
combination with another cellulase. This is likely because PcCel45A enhances the
activity of PcCel6A.
The protein of the present invention having an endoglucanase activity can be
suitably used in, for example, a method for producing a sugar from a biomass
material, a method for producing ethanol using the sugar, a food, a feed, a detergent
and a method for treating a cellulose-containing woven fabric.

CLAIMS
1. A protein,
wherein the protein is derived from a basidiomycete, has an endoglucanase
activity, and has a molecular weight of 18 kDa which is measured by SDS-PAGE.
2. The protein according to claim 1, wherein the basidiomycete is
Phanerochaete chrysosporium.
3. A protein,
wherein the protein has an endoglucanase activity and is selected from the
following proteins (a) to (d):
(a) a protein comprising an amino acid sequence indicated by SEQ ID NO. 1,
(b) a protein comprising an amino acid sequence which is identical to that
indicated by SEQ ID NO. 1, except that one to several amino acids are substituted,
deleted, inserted or added,
(c) a protein comprising an amino acid sequence ranging from position 27 to
position 206 of the amino acid sequence indicated by SEQ ID NO. 1, and
(d) a protein comprising an amino acid sequence which is identical to that
ranging from position 27 to position 206 of the amino acid sequence indicated by
SEQ ID NO. 1, except that one to several amino acids are substituted, deleted,
inserted or added.
4. DNA,
wherein the DNA encodes a protein having an endoglucanase activity and is
selected from the following DNAs (a) to (h):
(a) DNA encoding a protein comprising an amino acid sequence indicated by
SEQ ID NO. 1,
(b) DNA encoding a protein comprising an amino acid sequence which is
identical to that indicated by SEQ ID NO. 1, except that one to several amino acids

are substituted, deleted, inserted or added,
(c) DNA encoding a protein comprising an amino acid sequence ranging from
position 27 to position 206 of the amino acid sequence indicated by SEQ ID NO. 1,
(d) DNA encoding a protein comprising an amino acid sequence which is
identical to that ranging from position 27 to position 206 of the amino acid sequence
indicated by SEQ ID NO. 1, except that one to several amino acids are substituted,
deleted, inserted or added,
(e) DNA comprising a nucleotide sequence indicated by SEQ ID NO. 2,
(f) DNA which hybridizes under stringent conditions with DNA comprising a
nucleotide sequence indicated by SEQ ID NO. 2 or with a complementary strand to
the DNA,
(g) DNA comprising a nucleotide sequence ranging from position 79 to
position 621 of the nucleotide sequence indicated by SEQ ID NO. 2, and
(h) DNA which hybridizes under stringent conditions with DNA comprising a
nucleotide sequence ranging from position 79 to position 621 of the nucleotide
sequence indicated by SEQ ID NO. 2 or with a complementary strand to the DNA.
5. A recombinant vector comprising:
the DNA according to claim 4.
6. A transformant,
wherein the transformant is transformed with the recombinant vector
according to claim 5.
7. A method for producing a protein having an endoglucanase activity,
comprising'-
culturing the transformant according to claim 6, and
recovering the protein having the endoglucanase activity from a culture
obtained through the culturing.
8. A method for producing a sugar, comprising^

producing the sugar from a biomass material using the protein according to
any one of claims 1 to 3, a basidiomycete or both of the protein and the
basidiomycete.
9. The method according to claim 8, wherein the producing is performed by
further using a cellulase other than the protein according to any one of claims 1 to 3.
10. A method for producing ethanol, comprising:
fermenting a sugar to produce the ethanol,
wherein the sugar is produced by the method according to one of claims 8 and
9.
11. A food comprising:
at least one selected from the proteins according to claims 1 to 3.
12. A feed comprising:
at least one selected from the proteins according to claims 1 to 3.
13. A detergent comprising:
at least one selected from the proteins according to claims 1 to 3.
14. A method for treating a cellulose-containing woven fabric, comprising:
treating the cellulose-containing woven fabric with at least one selected from
the proteins according to claims 1 to 3.

A protein, wherein the protein is derived from a basidiomycete, has an
endoglucanase activity, and has a molecular weight of 18 kDa which is measured by
5 SDS-PAGE.

Documents

Application Documents

# Name Date
1 abstract-667-kolnp-2011.jpg 2011-10-07
2 667-kolnp-2011-translated copy of priority document.pdf 2011-10-07
3 667-kolnp-2011-specification.pdf 2011-10-07
4 667-kolnp-2011-sequence listing.pdf 2011-10-07
5 667-kolnp-2011-pct priority document notification.pdf 2011-10-07
6 667-kolnp-2011-pa.pdf 2011-10-07
7 667-kolnp-2011-others.pdf 2011-10-07
8 667-kolnp-2011-others pct form.pdf 2011-10-07
9 667-kolnp-2011-international publication.pdf 2011-10-07
10 667-kolnp-2011-form-5.pdf 2011-10-07
11 667-kolnp-2011-form-3.pdf 2011-10-07
12 667-kolnp-2011-form-2.pdf 2011-10-07
13 667-kolnp-2011-form-13.pdf 2011-10-07
14 667-kolnp-2011-form-1.pdf 2011-10-07
15 667-KOLNP-2011-FORM 3-1.1.pdf 2011-10-07
16 667-kolnp-2011-drawings.pdf 2011-10-07
17 667-kolnp-2011-description (complete).pdf 2011-10-07
18 667-kolnp-2011-correspondence.pdf 2011-10-07
19 667-KOLNP-2011-CORRESPONDENCE-1.1.pdf 2011-10-07
20 667-kolnp-2011-claims.pdf 2011-10-07
21 667-kolnp-2011-assignment.pdf 2011-10-07
22 667-kolnp-2011-abstract.pdf 2011-10-07
23 667-KOLNP-2011-FORM-18.pdf 2012-07-07
24 667-KOLNP-2011-(17-04-2014)-CORRESPONDENCE.pdf 2014-04-17
25 667-KOLNP-2011-(17-04-2014)-ANNEXURE TO FORM 3.pdf 2014-04-17
26 667-KOLNP-2011-(20-11-2015)-ANNEXURE TO FORM 3.pdf 2015-11-20
27 667-KOLNP-2011-FER.pdf 2017-02-20
28 667-KOLNP-2011-AbandonedLetter.pdf 2017-10-08

Search Strategy

1 667searchstrategy_16-02-2017.pdf