Novel selection marker-comprising cell line and uses thereof for protein production

Field of the invention

The present invention concerns cell lines and selection markers for protein production.

Backaround of the invention

Producing recombinant proteins on an industrial scale requires isolation of clones producing high amounts of recombinant proteins. Introducing heterologous genes into animal host cells and screening for expression of the added genes is a lengthy and complicated process. The process involves the transfection and the selection of clones with stable long-term expression, and the screening for clones having high expression rates for the corresponding recombinant protein.

When generating clones expressing a recombinant protein from expression vectors, host cells are usually transfected with a DNA vector encoding both the protein of interest and the selection marker on the same vector. Such an expression vector thus comprises a selectable marker allowing the selection of clones in which the expression vector is present. Such a selectable marker may also lead to a co-amplification of transfected DNA, thereby allowing the isolation of high-producer clones.

Most selectable markers are either a protein conferring resistance to an antibiotic or other toxic substance or a protein essential to cell survival. Several such selectable markers are known in the art, including e.g. G418, hygromycin, puromycin, zeomycin, dihydrofolate reductase (DHFR), glutamine synthetase (GS) and hypoxanthine-guanine phosphoribosyltransferase (HPRT). In particular, GS is widely used as a selectable marker in the field of industrial recombinant protein production in eukaryotic cells. The GS gene permits the synthesis of glutamine, essential for cell growth, and is inhibited by MSX (L-methionine sulfoximine). In the presence of MSX, only cells expressing higher amount of GS do survive. After appropriate screening it is possible to select cells producing the exogenous proteins.

In previous application WO2016/062837, the inventors developed an expression system based on the use of dehydroorotate dehydrogenase (DHODH) as a selectable marker. DHODH is an enzyme required for pyrimidine synthesis. Compounds which inhibit DHODH therefore inhibit DNA synthesis and hence cell proliferation. This selection

marker thus comprises an expression vector encoding DHODH used in combination with a DHODH inhibitor such as leflunomide and teriflunomide.

However, most of the inhibitors used with the above selection markers are toxic. In the case of the DHODH selection marker, teriflunomide is for example a potent immune-suppressor and its handling especially at large scale can be challenging for safety reasons. In the case of the GS selection marker, MSX is a convulsant at high doses and may thus also raise handling issues. In the case of DHFR selection marker, methotrexate is known for displaying hematopoietic and digestive toxicities, thereby also raising handling issues.

Accordingly, there is a need for expression systems where the selection of the protein of interest-producing clone can be performed without addition of difficult to handle compound.

The present invention meets this need.

Summary of the invention

The present invention arises from the design by the inventors of a cell line wherein protein of interest-producing cells can be selected in a medium devoid of uridine, thanks to the partial or full inactivation of the DHODH gene in said cell line. This cell line, wherein the DHODH gene is partially or fully inactivated, is typically grown in a medium supplemented with uridine, but, when transfected with an expression vector comprising a nucleotide sequence encoding a mammalian DHODH, in particular encoding a mutated mammalian DHODH, and an expression cassette for expressing a protein of interest, the culture medium is typically changed by a culture medium devoid of uridine, thereby selecting the protein of interest-producing cells.

Such an expression system is particularly advantageous because, by avoiding the use of inhibitors as selection pressure, it increases the viability of the producing cells. The inventors further demonstrated that this decrease in toxicity was associated with a high productivity.

The present invention thus concerns a cell line comprising an endogenous dehydroorotate dehydrogenase (DHODH) gene which is partially or fully inactivated.

In a particular embodiment, said cell line is a Chinese Hamster Ovary (CHO) cell line.

In a more particular embodiment, the cell line is produced by

a) inactivating the endogenous DHODH gene in a cell, in particular by a gene editing method, such as by a CRISPR-Cas9 method, and

b) culturing the cell in a culture medium comprising uridine under conditions suitable for generating a cell line in which the endogenous DHODH gene is partially or fully inactivated.

In a particular embodiment, all the alleles of the endogenous DHODH gene of said cell line are partially or fully inactivated.

In a further embodiment, said cell line further comprises an expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing recombinant protein, wherein said exogenous DHODH comprises a sequence at least 60% identical to the sequence SEQ ID NO: 2 or to the sequence SEQ ID NO: 4.

In a particular embodiment thereof, said nucleotide sequence comprises the sequence of SEQ ID NO: 1 or the sequence of SEQ ID NO: 3.

In another particular embodiment thereof, said recombinant protein is a monoclonal antibody.

In still another particular embodiment thereof, said vector comprises a first expression cassette suitable for cloning of an antibody light chain, and a second expression cassette suitable for cloning of an antibody heavy chain.

Another object of the invention is an expression system comprising:

(i) the cell line comprising an endogenous dehydroorotate dehydrogenase (DHODH) gene which is partially or fully inactivated as defined above, and

(ii) an expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing a recombinant protein, wherein said exogenous DHODH comprises a sequence at least 60% identical to the sequence SEQ ID NO: 2 or to the sequence SEQ ID NO: 4.

In a particular embodiment, said nucleotide sequence comprises the sequence of SEQ ID NO: 1 or the sequence of SEQ ID NO: 3.

In another particular embodiment, said recombinant protein is a monoclonal antibody.

In still a particular embodiment, said vector comprises a first expression cassette suitable for cloning of an antibody light chain, and a second expression cassette suitable for cloning of an antibody heavy chain.

The present invention further concerns (i) the cell line as defined above, or the expression system as defined above, and (ii) a culture medium devoid of uridine.

Another object of the invention relates to an in vitro method of producing a recombinant protein comprising the steps of:

A) a1 ) providing a cell line as defined above further comprising an expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing recombinant protein, wherein said exogenous DHODH comprises a sequence at least 60% identical to the sequence SEQ ID NO: 2 or to the sequence SEQ ID NO: 4;

or

a2) providing a cell line as defined above, and

a2’) introducing an expression vector as defined above into the cell line provided in step a2);

or

a3) providing a cell line comprising an endogenous DHODH gene, a3’) partially or fully inactivating the endogenous DHODH gene in the cell line provided in step a3), and

a3”) introducing an expression vector as defined above into the cell line comprising a partially or fully inactivated endogenous DHODH gene obtained in step a3’);

B) culturing said cell line under conditions suitable for production of the recombinant protein; and

C) isolating and/or purifying said recombinant protein.

In a particular embodiment, step B) of said method is conducted in a culture medium devoid of uridine.

In another particular embodiment, said method further comprises a step D) of formulating said recombinant protein into a pharmaceutical composition.

The present invention further concerns the use of a cell line as defined above, an expression system as defined above or a kit as defined above for producing a recombinant protein.

In a particular embodiment, the cell line, the expression system or the kit is used in combination with a culture medium devoid of uridine.

Brief description of the fiqures

Figure 1 shows the genomic structure of the human DHODH gene referenced under the Gene ID: 100756632 available on 21 December 2018 on Genbank NCBI.

Figure 2 shows the alignment of the sequence n°1 DHODH exon2. PAM : Protospacer Adjacent Motif sequence (TGG).

Figure 3 shows the screening of different KO (knock-out) DHODH clones for producing antibodies in the presence of different concentrations of teriflunomide as a selective agent.

Figure 4 shows the quantity of protein produced in mg/ml_ using different DHODH variants as selection markers.

Figure 5 shows lipase production at day 14 using human DHODH G202A or human GS selection marker and DHODH KO or wild-type CHO cells.

Figure 6 shows monoclonal antibody, mAb-B, production at day 14 using human DHODH G202A or human GS selection marker and DHODH KO or wild-type CHO cells.

Figure 7 shows bispecific antibody production at day 14 using human DHODH G202A and/or human GS selection marker and DHODH KO or wild-type CHO cells.

Figure 8 shows trispecific antibody production at day 14 using human DHODH G202A and human GS selection markers and DHODH KO or wild-type CHO cells.

Detailed description of the invention

Dihydroorotate dehydrogenase

As used herein, the term "dihydroorotate dehydrogenase" or "DHODH" refers to a polypeptide capable of catalyzing the conversion of dihydroorotate (4,5-dihydroorotic acid or 2,6-dioxo-1 ,3-diazinane-4-carboxylic acid) to orotate (orotic acid or 1 ,2,3,6-tetrahydro-2,6-dioxo-4-pyrimidinecarboxylic acid), as represented by the following reaction:

(S)-dihydroorotate + O2 < orotate + H2O2

Such a polypeptide is classified under Enzyme Commission (EC) number 1 .3.3.1. Polypeptides capable of catalyzing the above reaction exhibit“DHODH activity”.

The above reaction is the fourth step in the de novo synthesis of uridine monophosphate (rUMP) required for the synthesis of DNA and RNA. Inhibition or inactivation of DHODH thus has the effect of inhibiting DNA and RNA synthesis and hence inhibits cell proliferation.

Cell line

The present invention concerns a cell line comprising an endogenous dehydroorotate dehydrogenase (DHODH) gene which is partially or fully inactivated.

The cell line is a eukaryotic cell line, e.g. a mammalian cell line such as a Chinese Hamster Ovary (CHO) cell line, a monkey cell line or a human cell line.

In a particular embodiment, the cell line is a CHO cell line.

CHO cell lines are commonly used for industrial protein production, and many CHO cell lines are known to those skilled in the art. For instance, such CHO cell lines include strains which are publicly available from the American Type Culture Collection such as the CHO-K1 cell line (ATCC Number: CCL-61 ), the CHO-S cell line (marketed for instance by Invitrogen and Gibco), the CHO DP-12 cell line (ATCC Nos. CRL-12444 and 12445) and the CHO 1 -15 cell line (ATCC Number CRL-9606). Another cell line suitable for industrial protein production is the CHO 9E4 cell line. The 9E4 cell line was established from a clone of the CHO-K1 cell line through a single cell cloning process. The establishment of the 9E4 cell line is presented more deeply in Example 1. The CHO-K1 cell line was obtained by Puck in 1957 and has been deposited at the ATCC under number CCL-61 .

Human cells such as HEK293 (ATCC Number CRL-1573), HKB1 1 (ATCC Number CRL-12568), PER-C6 (Crucell), HT1080 (ATCC Number CRL-121 ), Jurkat, Daudi, Raji and CAP (ATCC Number CRL-1098) cells may also be used for protein production, in order to obtain a native glycosylation pattern for recombinant human proteins.

In one embodiment, the cell line is capable of growing in serum-free medium ( e.g . a chemically-defined medium) and/or in suspension. Such a cell line can easily be obtained by those skilled in the art by adapting the parent cell line to grow in serum-free medium and/or in suspension (e.g. through single cell cloning, through progressive adaptation and/or through a "starve and save" process).

The cell line of the present invention is a cell line comprising an endogenous dehydroorotate dehydrogenase (DHODH) gene which is partially or fully inactivated.

By "endogenous DHODH gene" is meant herein a DHODH gene normally present in said particular cell at a particular developmental stage under particular environmental conditions.

The "endogenous DHODH gene" distinguishes from the "exogenous DHODH" defined below, in that said exogenous DHODH is provided by the expression vector defined below, which may be present in the cell line of the invention if said expression vector has been introduced in said cell line.

As will be understood from the skilled person, the endogenous DHODH gene will depend on the cell line. For example, in a CHO cell line, the endogenous DHODH gene is a Chinese hamster DHODH gene; in a human cell line, the endogenous DHODH gene is a human DHODH gene.

Typically, a wild-type Chinese hamster DHODH refers to a sequence comprising or consisting of SEQ ID NO: 2, as well as variants thereof exhibiting DHODH activity. Such variants may for example correspond to variants that occur naturally in hamster species (such as allelic variants or splice variants).

Typically, a wild-type human DHODH refers to a sequence comprising or consisting of SEQ ID NO: 4, as well as variants thereof exhibiting DHODH activity. Such variants may for example correspond to variants that occur naturally in human species (such as allelic variants or splice variants).

As used herein, a "gene" includes a DNA region encoding a gene product, as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and/or transcribed sequences. Accordingly, a gene includes promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

Gene "inactivation" refers to any reduction in gene expression as compared to the corresponding wild-type cell. Gene inactivation may be complete (full inactivation or knock-out) or partial (e.g. a hypomorph in which a gene exhibits less than normal

expression levels or a product of a mutant gene that shows partial reduction in the activity it influences).

In a particular embodiment, all the alleles of the endogenous DHODH gene are partially or fully inactivated.

In a particular embodiment, said endogenous DHODH gene is fully inactivated.

In a more particular embodiment, all the alleles of the endogenous DHODH gene are fully inactivated.

In a particular embodiment, the endogenous DHODH gene is inactivated using the CRISPR-Cas9 method, as described in Aga et al. (2015) BMC Proceedings 9(suppl 9):P2.

As well-known from the skilled person, CRISPR-Cas9 system is a prokaryotic adaptive immune response system that uses noncoding RNAs to guide the Cas9 nuclease to induce site-specific DNA cleavage. This DNA damage is repaired by cellular DNA repair mechanisms, either via the non-homologous end joining DNA repair pathway (NHEJ) or the homology-directed repair (HDR) pathway. To create gene disruptions, a single guide RNA (gRNA), consisting of a crRNA sequence that is specific to the DNA target, and a tracrRNA sequence that interacts with the Cas9 protein, binds to a recombinant form of Cas9 protein that has DNA endonuclease activity. The resulting complex will cause target-specific double-stranded DNA cleavage. The cleavage site will be repaired by the nonhomologous end joining (NHEJ) DNA repair pathway, an error-prone process that may result in insertions/deletions (INDELs) that may disrupt gene function.

In a particular embodiment, at least one exon of the DHODH gene is targeted for inactivation, in particular by a gene editing method, such as a CRIPR-Cas9 method. In a more particular embodiment, the part of the DHODH gene encoding the N-terminal part of the DHODH protein is targeted for inactivation, in particular by a gene editing method, such as a CRISPR-Cas9 method. In still another embodiment, the second exon of the DHODH gene is targeted for inactivation, in particular by a gene editing method, such as a CRISPR-Cas9 method.

In one embodiment, a 20-nucleotide sequence of sequence

CAAGG AT GAT GGCT GCAT CC (SEQ ID NO: 23) or of sequence

GGATGCAGCCATCATCCTTG (SEQ ID NO: 5) or any sequence compatible with the knocking out of DHODH gene without impairing the CHO survival, is used as the corresponding piece of DNA for generating gRNA, which targets the second exon of the DHODH gene. This gRNA is typically obtained using the oligonucleotides of sequence CACCGCACCGGG AT GCAGCCAT CAT CCTT G (SEQ ID NO: 6) and

AAAACCAAGG AT GAT GGCT GCAT CC (SEQ ID NO: 7) or using the oligonucleotides of

sequence GG AT GCAGCCAT CAT CCTT GGTTTT (SEQ ID NO: 24) and CAAGG AT GAT GGCT GCAT CCCGGT G (SEQ ID NO: 25), typically cloned at a unique restriction site of a plasmid, such as the Bael site of the pCM3561 plasmid (commercialized by Invitrogen), so that the cloned DNA sequence is under the control of the U6 promoter and, once said plasmid is introduced into the cell, is transcribed into a single transcription unit containing a crRNA fused to tracrRNA, the crRNA part being specific of the second exon of the DHODH gene and the tracrRNA part being recognized by the Cas9 enzyme.

In order to identify a cell line inactivated, for the DHODH gene, single cells are typically isolated by limiting dilution in well plates, and, after reaching appropriate confluence, for example 90% confluence, the cells are split into at least 2 conditions, such as one in a culture medium supplemented with uridine and another in a culture medium devoid of uridine. Clones of interest are typically the clones sensitive to the lack of uridine.

Once isolated, these cells of interest can be cultured in a culture medium comprising a pyrimidine base, in particular a culture medium comprising uridine.

By“pyrimidine base” is meant herein pyrimidine per se and various pyrimidine derivatives having a pyrimidine nucleus as a skeleton. Examples of such pyrimidine bases include uracil nucleic acid-related substances, such as uracil, uridine, uridine phosphates, in particular uridine monophosphate (UMP), uridine diphosphate (UDP) and uridine triphosphate (UTP), deoxyuridine, deoxyuridine phosphates, in particular deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP) and deoxyuridine triphosphate (dUTP); cytosine nucleic acid-related substances, such as cytosine, cytidine, cytidine phosphates, in particular cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), deoxycytidine, 2’-deoxycytidine, deoxycytidine phosphates, in particular deoxycytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP) and deoxycytidine triphosphate (dCTP); thymine, thymidine, thymidine phosphates in particular thymidine monophosphate (TMP) thymidine diphosphate (TDP) and thymidine triphosphate (TTP), deoxythymidine, deoxythymidine phosphates in particular deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTDP) and deoxythymidine triphosphate (dTTP) and orotate.

In a particular embodiment, said pyrimidine base is uridine.

By "uridine" is meant herein the nucleoside of the following formula

By "culture medium devoid of uridine" is meant any basal culture medium suitable for the growth of a particular cell line, wherein said medium comprises less than 1 mM of uridine, in particular said medium does not comprise any uridine.

By "culture medium comprising uridine" is meant any basal culture medium suitable for the growth of a particular cell line, wherein said medium further comprises from 1 mM and 25 mM of uridine, in particular from 5 mM to 10 mM of uridine.

By "basal culture medium" is meant herein an unsupplemented medium which is suitable for exposure to cells, for example to CHO cells. As will be understood by the skilled person, the basal culture medium to be used will depend of the type of cells used. Examples of basal culture medium include CDCHO medium, OPTiCHO™ medium, Fecto CHO™ medium, FortiCHO™ medium, ExpiCHO™ medium, Ex-Cell™ medium, ActiPRO™ medium, MAM PF77™ medium and PowerCHO™ medium.

In a particular embodiment, the basal culture medium is further supplemented with glutamine, typically with 4 to 6 mM of glutamine.

Accordingly, in a particular embodiment, the cell line of the invention is produced by

a) inactivating the endogenous DHODH gene in a cell, in particular by a gene editing method, such as a CRISPR-Cas9 method, and

b) culturing the cell in a culture medium comprising uridine under conditions suitable for generating a cell line in which the endogenous DHODH gene is partially or fully inactivated.

The production of a CHO cell line comprising an endogenous DHODH gene which is fully or partially inactivated by a CRISPR-Cas9 approach, is more deeply exemplified in

Examples 2 and 3.

The production of a cell line, such as a CHO cell line, comprising an endogenous DHODH gene which is fully or partially inactivated can be generated by a variety of other molecular biology techniques known in the art. For example, other gene editing techniques useful for generating a cell line having an endogenous DHODH gene which is fully or partially inactivated include use of zinc finger nucleases (ZFNs) or Transcription Factor-like Effector Nucleases (TALENs). A Cre/Lox method can also be used to knock out one or more or all alleles of the DHODH gene.

In a particular embodiment, the cell line of the invention further comprises an expression vector as defined below in the section "Expression vector”.

Said expression vector may be introduced into the cell line by any suitable technique well-known from the skilled person, such as by transfection, in particular by electroporation or chemical transfection, or transduction.

In a particular embodiment, said cell line of the invention may further comprise an additional expression vector comprising a selection marker different from the expression vector of the invention, typically an additional expression vector comprising a sequence encoding glutamine synthetase.

Exogenous DHODH

The DHODH encoded by the expression vector used in the present invention (further referred to as "exogenous DHODH") may comprise or consist of a sequence at least 60%, 62%, 65%, 70%, 75%, 80%, 85%, 90%, 91%; 92%; 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% or 100% identical to SEQ ID NO: 2 or SEQ ID NO: 4. It may also comprise or consist of a fragment of at least 100, 150, 200, 250, 300 or 350 consecutive amino acids of SEQ ID NO: 2 or SEQ ID NO: 4, provided the protein retains DHODH activity.

In some embodiments, the exogenous DHODH according to the invention comprises or consists of a sequence at least 60%, 62%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %; 92%; 93%, 94%, 95%, 95.5%, 96%, 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5% or 100% identical both to the sequence of SEQ ID NO: 2 and to the sequence of SEQ ID NO: 4.

In some embodiments, the exogenous DHODH according to the invention is a human DHODH, i.e. a DHODH of human origin.

As used herein, the term "human DHODH" refers to a protein of sequence comprising or consisting of SEQ ID NO: 4, as well as variants thereof exhibiting DHODH activity. Such variants may for example correspond to variants that occur naturally in human species (such as allelic variants or splice variants). Alternatively, such variants may correspond to variants obtained by genetic engineering. In one embodiment, such variants only differ from the sequence of SEQ ID NO: 4 by the presence of at most 150, 140, 130, 120, 1 10, 100, 90, 80, 70, 60, 50, 40, 30, 25, 24, 23, 22, 21 , 20, 19, 18,17,16,15,14,13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variations as compared to SEQ ID NO: 4 (said variations including substitutions, insertions and deletions).

In a particular embodiment, said human DHODH is a variant comprising a G202A mutation compared to the wild-type sequence, typically a protein comprising or consisting of the amino acid sequence SEQ ID NO: 26.

In some embodiments, the exogenous DHODH is a hamster DHODH, i.e. a DHODH of hamster origin. The hamster DHODH may be, for example, Chinese hamster (Cetulus griseus) DHODH.

As used herein, the term "Chinese hamster DHODH" refers to a sequence comprising or consisting of SEQ ID NO: 2, as well as variants thereof exhibiting DHODH activity. Such variants may for example correspond to variants that occur naturally in hamster species (such as allelic variants or splice variants). Alternatively, such variants may correspond to variants obtained by genetic engineering. In one embodiment, such variants only differ from the sequence of SEQ ID NO: 2 by the presence of at most 150, 140, 130, 120, 1 10, 100, 90, 80, 70, 60, 50, 40, 30, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid variations as compared to SEQ ID NO: 2 (said variations including substitutions, insertions and deletions).

In another embodiment, the variant DHODH will have DHODH activity, optionally the same level of activity as the wild-type protein, or 50%, 60%, 70%, 80%, 90%, 100%, 1 10%, 120%, 130%, 140% or more of the level of activity as the wild-type protein.

By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% (5 of 100) of the amino acid residues in the subject sequence may be inserted, deleted, or substituted with another amino acid.

Sequence identity may be determined over the full length of the variant sequence, the full length of the reference sequence, or both. For example, the percentage of identity may be calculated using a global alignment (i.e. the two sequences are compared over their entire length). Methods for comparing the identity and homology of two or more sequences are well known in the art. The "needle" program, which uses the Needleman-Wunsch global alignment algorithm (Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453) to find the optimum alignment (including gaps) of two sequences when considering their entire length, may for example be used when performing a global alignment. This needle program is for example available on the ebi.ac.uk world wide web site. The

percentage of identity in accordance with the invention is preferably calculated using the EMBOSS::need|e (global) program with a“Gap Open” parameter equal to 10.0, a“Gap Extend” parameter equal to 0.5, and a Blosum62 matrix.

Variants of a reference sequence may comprise mutations such as deletions, insertions and/or substitutions compared to the reference sequence. In case of substitutions, the substitution preferably corresponds to a conservative substitution as indicated in the table below.

Expression vector

The expression vector used in the context of the invention is suitable for the production of a recombinant protein, and comprises a sequence encoding dihydroorotate dehydrogenase (DHODH).

The expression vector is preferably a DNA vector.

The expression vector used in the context of the invention comprises a sequence encoding an exogenous DHODH as defined in section "Exogenous DHODH1' above.

In a specific embodiment, the cell line into which the expression vector is to be introduced is a CHO cell line, and the exogenous DHODH is of heterologous origin (i.e. exogenous DHODH is not a hamster DHODH).

The sequence encoding such an exogenous DHODH may be the naturally occurring nucleotide sequence. Alternatively, the triplet codons of the sequence encoding such a DHODH may be biased for expression in CHO cells. Software and algorithms for biasing sequence in order to obtain an optimal expression are known in the art and include, e.g. the algorithm described in Raab et al. (2010) Syst Synth Biol. 4:215-225. This algorithm not only provides the best available codons for expression, but also takes into account the GC content and the absence of non-desired DNA motifs.

For instance, the sequence encoding the exogenous DHODH may comprise or consist of a sequence at least 60%, 62%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 3 (i.e. a sequence encoding the human

DHODH of SEQ ID NO: 4, which has been designed for optimal expression in CHO cells) and/or to the sequence of SEQ ID NO: 1 (i.e. a sequence encoding a hamster DHODH of SEQ ID NO: 2, which has been designed for optimal expression in CHO cells).

In one embodiment, the sequence encoding the exogenous DHODH comprises or consists of a sequence of SEQ ID NO: 1 or SEQ ID NO: 3.

In the expression vector used in the context of the invention, the sequence encoding the exogenous DHODH defined above may be placed under the control of any promoter known to those skilled in the art.

For instance, the sequence encoding the exogenous DHODH defined above may for example be placed under the control of a promoter suitable for driving expression of DHODH, for instance a Simian vacuolating virus 40 (SV40) promoter ( e.g . the late or the early promoter of SV40), CMV promoter, Elongation Factor 1 promoter, GAPDH promoter, RPL37 promoter, Actin Promoter. An early SV40 promoter is for example described in Benoist and Chambon (1981 ) Nature 290:304-310 and in Moreau et at. (1981 ) Nucleic Acids Res. 9:6047-6068. In particular, said SV40 promoter is a full-length promoter. Said SV40 promoter may also have a replication origin containing a 72bp repeat.

In some embodiments, said SV40 promoter is not an SV40 promoter in which positions 128 to 270 have been removed, i.e. said SV40 promoter is not the SV40 promoter described in Korean patent No. 10-0267720 and transforming the E. coli transformant deposited to the Gene Bank, Institute of Bioengineering, KIST on 17 December 1997 under the Deposition Number: KCTC 8860 P.

In other embodiments, the sequence encoding the exogenous DHODH defined above is not placed under the control of a SV40 promoter.

Expression vectors that are suitable for the production of recombinant proteins are known to those skilled in the art. Such vectors typically correspond to expression vectors that comprise an origin of replication and at least one expression cassette allowing the cloning and the expression of the recombinant protein for which production is desired. An expression cassette typically comprises a 5’ untranslated region (comprising or consisting of a promoter, and optionally an enhancer sequence), one or more restriction sites allowing the cloning of a sequence encoding the recombinant protein, a 3' untranslated region (e.g. a polyA signal), and optionally one or more introns. The promoter sequence may correspond to any strong promoter well-known to the art, such as e.g. the human CMV promoter. Optionally, the expression vectors used in the context of the invention comprise a prokaryotic origin of replication (e.g. a prokaryotic replicon such as ColE1 in E. coli) and at least a prokaryote-selective marker gene, also known as prokaryotic selectable marker, so that the vectors allows for replication in prokaryotic cells. The cells which replicate the vectors also express the prokaryote-selective marker gene, and therefore can be identified and selected. Prokaryote-selective marker genes are well known to the person skilled in the art. Examples of prokaryote-selective marker genes are for instance nucleic acid sequences encoding a protein conferring antibiotic resistance {e.g. a sequence encoding a protein conferring resistance to ampicillin, chloramphenicol, blasticidin or kanamycin).

The recombinant protein may correspond to any protein that is of interest to those skilled in the art.

As used herein, the term "protein" is meant to encompass peptides (i.e. amino acid chains of less than 50 amino acids), polypeptides (i.e. amino acid chains of at least 50 amino acids), monomeric proteins (i.e. proteins consisting of one amino acid chain) and multimeric proteins (i.e. proteins consisting of two or more amino acid chains, such as e.g. monoclonal antibodies).

The expression vector used in the context of the invention typically comprises a number of expression cassettes that is identical to the number of different amino acid chains that constitute the protein (e.g. one expression cassette in case of a monomeric protein or homodimeric protein, two in the case of a heterodimeric protein or of a monoclonal antibody, etc.)

Alternatively, the expression vector used in the context of the invention may comprise only one expression cassette even when production of a heterodimeric protein or of a monoclonal antibody is desired. In such a case, the sequence(s) encoding the other amino acid chain(s) of the protein is (are) present on a separate expression vector, which is co-transfected with the expression vector according to the invention into the host cell line, in particular into the CHO cell line.

In that case, the supplemental separate expression vectors may comprise selection markers different from the DHODH selection marker described herein, such as DHFR, GS or HPRT.

In one embodiment, the expression vector used in the context of the invention may be devoid of expression cassette. In such a case, the expression cassette(s) suitable for expression of the recombinant protein is (are) present on a separate vector, which is co transfected with the expression vector according to the invention into the host cell line, in particular into the DHODH-inactivated cell line of the invention, more particularly into the DHODH-inactivated CHO cell line of the invention.

Thus, in some embodiments, the expression vector used in the context of invention comprises:

- a sequence encoding exogenous DHODH, as defined above, placed under the control of the early SV40 promoter;

- a first expression cassette, in which the sequence encoding the light chain of the antibody is placed under the control of the CMV promoter;

- a second expression cassette, in which the sequence encoding the heavy chain of the antibody is placed under the control of the CMV promoter;

- a prokaryotic origin of replication; and

- a selectable marker for use in prokaryotic cells, namely a sequence encoding a protein conferring resistance to ampicillin, placed under the control of its natural promoter.

Throughout the present specification, the term“recombinant protein” refers to any recombinant protein for which production is desired. It can for example correspond to a therapeutic and/or a prophylactic protein, i.e. a protein intended for use as a medicament (including vaccines). In a specific embodiment, the recombinant protein for which production is desired is not a DHODH. In another specific embodiment, the recombinant protein for which production is desired is an antibody, for instance a monoclonal antibody. In still another specific embodiment, the recombinant protein for which production is desired is an antigenic protein.

The term“antibody” is used herein in the broadest sense and specifically covers monoclonal antibodies (including full length monoclonal antibodies) of any isotype such as IgG, IgM, IgA, IgD, and IgE, polyclonal antibodies, multispecific antibodies (including bispecific and trispecific antibodies), antibody fragments (such as e.g. Fv, scFv, ds, Fab, Fab’, or F(ab fragments), single domain antibodies and fragment thereof, and fusion proteins comprising an antibody fragment. An antibody reactive with a specific antigen can be generated by recombinant methods such as selection of libraries of recombinant antibodies in phage or similar vectors, or by immunizing an animal with the antigen or an antigen-encoding nucleic acid.

A “monoclonal antibody”, as used herein, is an antibody obtained from a population of substantially homogeneous antibodies, i.e. the antibodies forming this population are essentially identical except for possible naturally occurring mutations which might be present in minor amounts. These antibodies are directed against a single epitope (or a single group of epitopes in the case of multispecific monoclonal antibodies) and are therefore highly specific.

A typical monoclonal antibody is comprised of two identical heavy chains and two identical light chains that are joined by disulfide bonds. Each heavy and light chain contains a constant region and a variable region. Each variable region contains three

segments called “complementarity-determining regions” (“CDRs”) or “hypervariable regions”, which are primarily responsible for binding an epitope of an antigen. They are usually referred to as CDR1 , CDR2, and CDR3, numbered sequentially from the N-terminus (see Kabat et al., Sequences of Proteins of Immunological Interest, 5th edition, National Institute of Health, Bethesda, MD, 1991 ). The more highly conserved portions of the variable regions are called the“framework regions”.

The monoclonal antibody may for example be a murine antibody, a chimeric antibody, a humanized antibody, or a fully human antibody.

The monoclonal antibody may be a monospecific, a bispecific or a trispecific antibody.

When the recombinant protein for which production is desired is a monoclonal antibody, the expression vector according to the invention may comprise a first expression cassette suitable for cloning of the antibody light chain, and a second expression cassette suitable for cloning of the antibody heavy chain.

In a specific embodiment, said first and second expression cassettes each comprise the cytomegalovirus (CMV) promoter, for instance a CMV promoter from a human or a murine CMV. More specifically, said first and second expression cassettes may comprise:

- a CMV immediate early enhancer promoter ( e.g . the one having the sequence described in Teschendorf et al. (2002) Anticancer Res. 22:3325-3330); or

- a IE2 promoter/enhancer region from mouse CMV (e.g. the one having the sequence described in Chatellard et al. (2007) Biotechnol Bioeng. 96:106-1 17); or

- a hCMV-MIE regulatory element (e.g. the one having the sequence described in WO 89/01036).

The term“antigenic protein” is used herein in the broadest sense and covers any protein capable of generating an immune response, either alone or in combination with an adjuvant. It may be intended for use either in a prophylactic vaccine or in a therapeutic vaccine. In a specific embodiment the antigenic protein is a vaccinal protein, i.e. a protein intended for use in a prophylactic vaccine.

CLAIMS

1. A cell line comprising an endogenous dehydroorotate dehydrogenase (DHODH) gene which is partially or fully inactivated.

2. The cell line according to claim 1 , which is a Chinese Hamster Ovary (CHO) cell line.

3. The cell line according to claim 1 or 2, wherein the cell line is produced by

a) inactivating the endogenous DHODH gene in a cell, and

b) culturing the cell in a culture medium comprising uridine under conditions suitable for generating a cell line in which the endogenous DHODH gene is partially or fully inactivated.

4. The cell line according to claim 3, wherein the endogenous DHODH gene is inactivated by a gene-editing method.

5. The cell line according to claim 4, wherein the endogenous DHODH gene is inactivated by the CRISPR-Cas9 method.

6. The cell line according to any one of claims 1 to 5, wherein one or more or all the alleles of the endogenous DHODH gene are partially or fully inactivated.

7. The cell line according to any one of claims 1 to 6, wherein the cell line further comprises an expression vector comprising a nucleotide sequence encoding an exogenous mammalian DHODH and at least one expression cassette for expressing recombinant protein, wherein said exogenous DHODH comprises a sequence at least 60% identical to the sequence SEQ ID NO: 2 or to the sequence SEQ ID NO: 4.

8. An expression system comprising:

(i) the cell line according to any one of claims 1 to 6, and

(ii) an expression vector comprising a nucleotide sequence encoding a mammalian DHODH and at least one expression cassette for expressing a recombinant protein, wherein said DHODH comprises a sequence at least 60% identical to the sequence SEQ ID NO: 2 or to the sequence SEQ ID NO: 4.

9. The cell line according to claim 7 or the expression system according to claim 8, wherein said nucleotide sequence comprises the sequence of SEQ ID NO: 1 or the sequence of SEQ ID NO: 3.

10. The cell line according to claim 7 or 9 or the expression system according to claim 8 or 9, wherein said recombinant protein is a monoclonal antibody.

11. The cell line according to any one of claims 7, 9 and 10 or the expression system according to any one of claims 8 to 10, wherein said vector comprises a first expression cassette suitable for cloning of an antibody light chain, and a second expression cassette suitable for cloning of an antibody heavy chain.

12. A kit comprising (i) the cell line according to any one of claims 7 and 9-1 1 , or the expression system according to any one of claims 8 to 1 1 , and (ii) a culture medium devoid of uridine, in particular further devoid of DHODH inhibitor.

13. An in vitro method of producing a recombinant protein comprising the steps of:

A) a1 ) providing a cell line according to any one of claims 7 and 9-1 1 ;

or

a2) providing a cell line according to any one of claim 1 to 6, and a2’) introducing an expression vector as defined in any one of claims 9 to

1 1 into the cell line provided in step a2);

or

a3) providing a cell line comprising an endogenous DHODH gene, a3’) partially or fully inactivating the endogenous DHODH gene in the cell line provided in step a3), and

a3”) introducing an expression vector as defined in any one of claims 9 to 1 1 into the cell line comprising a partially or fully inactivated endogenous DHODH gene obtained in step a3’);

B) culturing said cell line under conditions suitable for production of the recombinant protein; and

C) isolating and/or purifying said recombinant protein.

14. The method according to claim 13, wherein step B) is conducted in a culture medium devoid of uridine, in particular further devoid of DHODH inhibitor.

15. The method according to claim 13 or 14, further comprising a step D) of formulating said recombinant protein into a pharmaceutical composition.

16. Use of a cell line according to any one of claims 7 and 9-1 1 , an expression system according to any one of claims 9-1 1 or a kit according to claim 12 for producing a recombinant protein.

17. The use according to claim 16, wherein the cell line, the expression system or the kit is used in combination with a culture medium devoid of uridine, in particular in the absence of DHODH inhibitor.