Name of the invention: Novel strain of the genus Troztochytrium, and method for producing polyunsaturated fatty acids using the same
Technical field
[One]
The present application relates to a novel strain of Thraustochytrium genus , containing a high content of polyunsaturated fatty acid, and a biomass produced therefrom, and a method for preparing lipids and polyunsaturated fatty acids including the same.
[2]
Background
[3]
Docosahexaenoic acid (DHA), a polyunsaturated fatty acid, is an essential fatty acid for the brain, eye tissues and nervous system, and is known to play an important function in the development of infants' vision and motor skills. It has been reported to be significantly reduced, and various anti-aging functions such as inhibition of macular degeneration in presbyopia have been newly revealed. In addition, it has been reported that DHA can be used as a fish feed additive (Korean Patent Laid-Open No. 10-2007-0040751). Since most higher animals, including humans, cannot synthesize polyunsaturated fatty acids necessary for normal biological function on their own, polyunsaturated fatty acids must be consumed as an essential nutrient. It is recommended to consume consistently. Traditionally, the sources of DHA polyunsaturated fatty acids are deep-sea fish that top the marine ecosystem, such as tuna and salmon. However, as the marine environment becomes more polluted, the risk of intake of deep sea fish is increasing due to the accumulation of pollutants such as mercury, heavy metals, environmental hormones, and radioactive substances in the body of deep sea fish. Therefore, as a new means to safely and stably supply DHA polyunsaturated fatty acid oil, microalgae in Trouztochytrium have very important industrial value.
[4]
[5]
Various methods have been suggested for gene overexpression in microalgae of the genus Traustochytrium. Since the first genotyping method of microalgae in Trouztochytrium using acetolactate synthase as a selection marker by Martek, has been presented for the first time, a genus of Troztochytrium using various antibiotic resistance genes as selection markers. Microalgae transformation technology has been reported, and specifically, Korean Patent Application Publication No. 2015-0084148 discloses'recombinant vectors and uses thereof to increase biomass and lipid productivity of microalgae'.
[6]
However, the genotransformation technology developed in microalgae in the genus Traustochytrium to date is a method in which commonly introduced genes are inserted into chromosomal DNA. Compared to gene expression methods using centromeric or episomal plasmids with replication capability, it has limitations in gene copy number and expression control.
[7]
Detailed description of the invention
Technical challenge
[8]
The present inventors have developed microalgae with improved docosahexaenoic acid content and productivity by mutating KC01 microalgae in Trauztochytrium, and cultivating the microalgae to produce biomass containing lipids containing docosahexaenoic acid and This application was completed by establishing a method for producing bio oil.
[9]
Means of solving the task
[10]
One object of the present application is to provide a Thraustochytrium genus CJM01 microalgae (Accession No.: KCTC 13538BP) with increased docosahexaenoic acid (DHA) production and reduced amino acid production compared to wild type. will be.
[11]
Another object of the present application is the step of culturing CJM01 microalgae in the Trouztochytrium; And recovering docosahexaenoic acid (DHA)-containing biomass from the microalgae, a culture thereof, a dried product thereof, or a lysate thereof.
[12]
Another object of the present application is the step of cultivating CJM01 microalgae in the trouztochytrium; And recovering docosahexaenoic acid (DHA)-containing lipids from the microalgae, a culture thereof, a dried product thereof, or a lysate thereof.
[13]
Effects of the Invention
[14]
The CJM01 microalgae in the novel Trouztochytrium of the present application significantly decreases the amount of amino acid produced, and the content of unsaturated fatty acids such as docosahexaenoic acid and fat content in the biomass is high. Biomass, concentrates and dried products of the biomass are very useful as feed compositions.
[15]
Brief description of the drawing
[16]
FIG. 1 is a view showing a photograph of a strain of Thraustochytrium Genus KC01 observed with an optical microscope.
[17]
Figure 2 shows the phylogenetic tree between the strains of the genus Thraustochytrium Genus KC01, the strains of the genus Thraustochytrium, the genus Aurantiochytrium and the strains of the genus Schizochytrium ( Schizochytrium genus). It is a drawing.
[18]
Best mode for carrying out the invention
[19]
Hereinafter, the present application will be described in more detail.
[20]
Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of various elements disclosed herein belong to the scope of this application. In addition, it cannot be said that the scope of the present application is limited by the specific description described below. In addition, those of ordinary skill in the art can recognize or ascertain using only routine experimentation a number of equivalents to the specific aspects of the present application described in this application. Also, such equivalents are intended to be included in this application.
[21]
[22]
One aspect of the present application for achieving the above object provides an increase in docosahexaenoic acid (DHA) production and a decrease in amino acid production compared to the wild type, Thraustochytrium genus CJM01 microalgae. .
[23]
[24]
In the present application, the term “ Thraustochytrid genus” strain is an organic species nutrient microalgae, and contains various polyunsaturated fatty acids including docosahexaenoic acid (DHA) in high concentration. It plays an important role as a source of triacylglycerol (triacylglycerol). In addition, the "microalgae" refers to an organism that can freely float in water and lives in the water because it cannot be seen with the naked eye among plants that photosynthesize with chlorophyll, and is also called phytoplankton.
[25]
In the present application, as an example, a wild-type strain of Traustochytrium KC01 was irradiated with gamma rays to generate a mutation, and among the mutant strains, strains with improved production capacity of polyunsaturated fatty acid-containing oil were selected, and this was obtained from the genus Thraustochytrium. genus) was named CJM01, and as of May 30, 2018, it was deposited with the Korean Collection for Type Cultures (KCTC), an international depository under the Budapest Treaty, and was given the accession number KCTC 13538BP.
[26]
In addition, the CJM01 microalgae of the Trouztochytrium of the present application may have the 18s rRNA nucleotide sequence of SEQ ID NO: 1, but are not limited thereto.
[27]
[28]
In the present application, the term “docosahexaenoic acid (DHA)” is one of polyunsaturated fatty acids having a chemical formula of C 22 H 32 O 2 , and is a substance frequently extracted from tuna or sardines, such as blue fish. In addition, docosahexaenoic acid belongs to omega 3 along with eicosapentaenoic acid (EPA) and alpha-linolenic acid (ALA).
[29]
The CJM01 microalgae in the Trouztochytrium of the present application may contain a large amount of docosahexaenoic acid compared to KC01 in the parent strain, Trouztochytrium, and specifically 30 based on the total weight of fatty acids contained in the microalgae. To 65% by weight, 30 to 60% by weight. It may contain 40 to 65% by weight or 40 to 60% by weight of docosahexaenoic acid, but is not limited thereto.
[30]
In addition, the CJM01 microalgae in the Trouztochytrium of the present application may have improved docosahexaenoic acid productivity compared to KC01 in Trouztochytrium, the parent strain, and the productivity is It can be measured in concentration (g/L). Specifically, the microalgae of the present application is 0.4 to 0.8 (g/l/h), 0.4 to 0.7 (g/l/h), 0.5 to 0.8 (g/l/h), or 0.5 to 0.7 (g/l/ h) docosahexaenoic acid productivity, but is not limited thereto.
[31]
[32]
On the other hand, the CJM01 microalgae in the Trouztochytrium of the present application may have reduced amino acid production compared to KC01 in the parent strain, Trouztochytrium. Specifically, the CJM01 microalgae of the present application in the genus Troztochytrium or a culture solution thereof is a group consisting of aspartate, serine, glutamate, glycine, alanine, valine, methionine, isoleucine, leucine, tyrosine, phenylalanine, lysine, and arginine. It may not include at least one or more amino acids selected from. For example, as can be seen in Example 2, aspartate, serine, glutamate, glycine, alanine, methionine, isoleucine, leucine, tyrosine, phenylalanine, lysine in the culture medium of CJM01 microalgae of the present application. , And arginine may not be detected.
[33]
As an example, the total amino acid production of CJM01 microalgae in the Troutocyttrium of the present application may be reduced by 90% or more, 95% or more, 97% or more, or 99% or more compared to KC01 in the parent strain, Trouztochytrium, As a result, it can be seen that the CJM01 strain uses the supplied carbon source more effectively in the docosahexaenoic acid biosynthesis pathway compared to the KC01 parent strain. Specifically, since the CJM01 microalgae of the present application in Troozytrium genus rarely produces amino acids, the culture medium of the strain is 0.1 to 20 mg/L, 0.1 to 15 mg/L or less, 0.1 to 10 mg/L or less Alternatively, it may contain only 0.1 to 7 mg/L or 0.1 to 5 mg/L of amino acids.
[34]
[35]
Another aspect of the present application is the step of culturing CJM01 microalgae in the trauzuto chytrium; And recovering biomass containing docosahexaenoic acid (DHA) from the microalgae, a culture thereof, a dried product thereof, or a lysate thereof. In addition, the biomass may be in the form of dry cells, but is not limited thereto.
[36]
The present application provides biomass produced by the above method. The biomass is 15 to 40% by weight based on the total weight. It may contain 20 to 35% by weight or 25 to 30% by weight of docosahexaenoic acid, but is not limited thereto.
[37]
Another aspect of the present application is the step of culturing CJM01 microalgae in the trauztochytrium, and recovering docosahexaenoic acid (DHA)-containing lipid from the microalgae, its culture, its dry matter, or its lysate. It provides a bio-oil manufacturing method comprising the step of.
[38]
The present application provides a bio-oil prepared by the above method. The bio-oil is 30 to 65% by weight, 30 to 60% by weight based on the total weight of fatty acids. It may contain 40 to 65% by weight or 40 to 60% by weight of docosahexaenoic acid, but is not limited thereto.
[39]
Specifically, the bio-oil manufacturing method of the present application comprises the steps of culturing CJM01 microalgae in the trouztochytrium; Preparing a biomass containing docosahexaenoic acid (DHA) from the microalgae, a culture thereof, a dried product thereof, or a lysate thereof; And recovering the lipid from the lipid containing docosahexaenoic acid (DHA) from the prepared biomass, but is not limited thereto.
[40]
The "genus Troztochytrium" and "docosahexaenoic acid" are as described above.
[41]
"Bioyl" in the present application is obtained from biomass by biological, thermochemical and physicochemical extraction processes, and the biooil prepared in this application may contain polyunsaturated fatty acids, and specifically docosahexaenoic acid. It may contain, but is not limited thereto.
[42]
In addition, the "biomass" refers to an energy source of bioenergy, that is, an organism such as plants, animals, and microorganisms that can be used as chemical energy. It also means. In addition, the biomass may contain cells and/or intracellular contents as well as extracellular substances, including, but not limited to, compounds secreted by cells. In the present application, the biomass may be CJM01 microalgae in Trouztochytrium itself, a culture thereof, a dried product thereof, a crushed product thereof, or a product produced by culturing or fermenting the microalgae, or a concentrate of the biomass. Or it may be a dried product, but is not limited thereto.
[43]
In the present application, the culture of CJM01 microalgae in Troustochytrium refers to a product produced by culturing the microalgae, and specifically, may be a culture solution containing microalgae or a culture solution from which microalgae are removed, but is limited thereto. Is not. In the present application, the dried product of CJM01 microalgae in Trouztochytrium is one from which moisture has been removed from the microalgae, and may be specifically in the form of dry cells, but is not limited thereto. In addition, the crushed product of CJM01 microalgae in the truztochytrium of the present application is a generic term for the result of crushing the microalgae, and may be a supernatant or pellet of the crushed microalgae, but is not limited thereto.
[44]
The CJM01 microalgae of the present application in Troozytrium genus itself, a culture thereof, a dried product thereof, or a lysate thereof contains docosahexaenoic acid, and biomass or biooil can be prepared therefrom.
[45]
[46]
In the present application, "culture" means growing the microalgae under appropriately controlled environmental conditions. The cultivation process of the present application may be performed according to a suitable medium and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art according to the selected microalgae.
[47]
Specifically, the cultivation of CJM01 microalgae in the Trouztochytrium of the present application may be performed under heterotrophic conditions, but is not limited thereto.
[48]
In the present application, "species nutrition" is a nutritional form that relies on organic matter obtained from the outside of the body for an energy (nutrition) source, and is a term corresponding to autotrophic. The CJM01 microalgae in the Trouztochytrium of the present application can increase the content and productivity of docosahexaenoic acid by optimizing the medium composition of a carbon source or nitrogen source under heterotrophic conditions. In addition, in the present application, the term'species nutrition' may be used interchangeably with'cancer culture'.
[49]
[50]
In addition, the step of culturing the microalgae is not particularly limited thereto, but may be performed by a known batch culture method, a continuous culture method, a fed-batch culture method, or the like. The medium and other culture conditions used in the cultivation of microalgae in the present application may be any medium without particular limitation as long as it is a medium used for cultivation of ordinary microalgae. It can be cultured while controlling temperature, pH, etc. under aerobic conditions in a conventional medium containing personnel, inorganic compounds, amino acids and/or vitamins.
[51]
Specifically, a basic compound (such as sodium hydroxide, potassium hydroxide, or ammonia) or an acidic compound (such as phosphoric acid or sulfuric acid) is used to provide an appropriate pH (such as pH 5 to 9, specifically pH 6 to 8, most specifically PH 6.8) can be adjusted, but is not limited thereto.
[52]
In addition, in order to maintain the aerobic state of the culture, oxygen or oxygen-containing gas may be injected into the culture, or nitrogen, hydrogen or carbon dioxide gas may be injected without the injection of gas to maintain the anaerobic and microaerobic state. It is not limited.
[53]
In addition, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and may be cultured for about 10 to 160 hours, but is not limited thereto. In addition, while culturing, an antifoaming agent such as a fatty acid polyglycol ester may be used to suppress the generation of air bubbles, but the present invention is not limited thereto.
[54]
[55]
The cultivation of CJM01 microalgae in the Troustochytrium of the present application may be performed using a medium containing a carbon source and a nitrogen source.
[56]
In the present application, the term "medium" means a culture medium for culturing the microalgae of the present application and/or a product obtained after culturing. The medium is a concept including both a form including microalgae and a form in which microalgae are removed by centrifugation or filtration from the culture medium containing the microalgae.
[57]
In addition, the culture medium used in the present application includes sugars and carbohydrates as carbon sources (eg, glucose, sucrose, lactose, fructose, galactose, mannose, maltose, arabinose, xylose, molase, starch, and cellulose. ), fats and oils (e.g. soybean oil, sunflower seed oil, peanut oil and coconut oil), fatty acids (e.g. palmitic acid, stearic acid and linoleic acid), alcohols (e.g. glycerol and ethanol) and organic acids (e.g. acetic acid) And the like may be used individually or in combination, and specifically, the carbon source is one selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose, and glycerol. It may be the above, but the carbon source used to cultivate microalgae is not limited thereto. In addition, the culture medium used in the present application is glucose at a concentration of 10 to 50 g/L, 10 to 40 g/L, 20 to 50 g/L, 20 to 40 g/L, or 25 to 35 g/L as a carbon source. May be included, but is not limited thereto.
[58]
[59]
The nitrogen source of the culture medium used in the present application may be classified into an organic nitrogen source or an inorganic nitrogen source, but an organic nitrogen source or an inorganic nitrogen source may be used individually or in combination. Specifically, the nitrogen source is an organic nitrogen source selected from the group consisting of yeast extract, beef extract, peptone and tryptone, or ammonium acetate, ammonium nitrate, ammonium chloride, ammonium sulfate, sodium nitrate . It may be an inorganic nitrogen source selected from the group consisting of urea and MSG (Monosodium glutamate).
[60]
In addition, the culture medium used in the present application may include yeast extract, ammonium sulfate, sodium nitrate, and MSG as examples of nitrogen sources, but the nitrogen source used to cultivate microalgae is not limited thereto.
[61]
Specifically, the yeast extract is 0.1 to 10 g/L, 0.5 to 10 g/L, 0.5 to 7 g/L, 0.5 to 5 g/L, 0.5 to 3 g/L, 0.5 to 2 g/L in the medium Alternatively, it may be included in a concentration of 0.5 to 1.5 g/L, and the ammonium sulfate may be included in a concentration of 1 to 5 g/L, 1 to 4 g/L, 2 to 5 g/L, and 2 to 4 g/L in the medium. And, the sodium nitrate is 0.1 to 10 g/L, 0.5 to 9 g/L, 1 to 9 g/L, 2 to 9 g/L, 3 to 9 g/L, 5 to 9 g/L in the medium Alternatively, it may be included in a concentration of 7 to 9 g/L, and the MSG may be included in a concentration of 0.1 to 2 g/L, 0.1 to 1.5 g/L, 0.5 to 2 g/L, or 0.5 to 1.5 g/L in the medium. , But is not limited thereto.
[62]
For the purposes of the present application, since the CJM01 strain has no ammonia inhibition and can grow at a wide salt concentration, the carbon source and nitrogen source can be appropriately adjusted in the medium in consideration of this.
[63]
[64]
The culture medium used in the present application may be used individually or mixed with potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and a sodium-containing salt corresponding thereto as a phosphorus source, but is not limited thereto. In addition, the medium may contain essential growth-promoting substances such as other metal salts (eg, magnesium sulfate or iron sulfate), amino acids and vitamins.
[65]
[66]
In the step of recovering biomass from microalgae cultured in the culturing step of the present application, a culture product produced therefrom, a dried product thereof, or a lysate thereof, the desired biomass can be collected using a suitable method known in the art. have.
[67]
In addition, the step of recovering the docosahexaenoic acid produced in the culturing step of the present application may be performed by using a suitable method known in the art according to the cultivation method. Can be collected (collet). For example, centrifugation, filtration, anion exchange chromatography, crystallization and HPLC, etc. can be used, and the desired microalgae or a culture thereof, a dried product thereof, or a lysate thereof cultured using a suitable method known in the art Biomass or docosahexaenoic acid can be recovered. The step of recovering the biomass or docosahexaenoic acid may further include a separation process and/or a purification step.
[68]
For example, lipids and lipid derivatives such as fatty aldehydes, fatty alcohols and hydrocarbons (eg alkanes) can be extracted with a hydrophobic solvent such as hexane (Frenz et al. 1989, Enzyme Microb. Technol., 11: 717). Lipids and lipid derivatives are also liquefied (Sawayama et al. 1999, Biomass and Bioenergy 17:33-39 and Inoue et al. 1993, Biomass Bioenergy 6(4):269-274); Oil liquefaction (Minowa et al. 1995, Fuel 74(12): 1735-1738); And supercritical CO 2 extraction (Mendes et al. 2003, Inorganica Chimica Acta 356:328-334). In addition, known protocols for microalgal lipid recovery include i) harvesting cells by centrifugation, washing with distilled water, drying by freeze drying, and ii) crushing the obtained cell powder in mortar, followed by n-hexane It discloses a method of extracting lipids [Miao and Wu, Biosource Technology (2006) 97:841-846].
[69]
[70]
Yet another aspect of the present application provides a composition comprising the Thraustochytrium genus CJM01 microalgae, a culture thereof, a dried product thereof, or a lysate thereof. The composition may include biomass or bio oil prepared using the microalgae.
[71]
The CJM01 microalgae of the genus Thraustochytrium genus, a culture thereof, a dried product thereof, or a lysate thereof are as described above. The description of the biomass or biooil prepared using the microalgae is also as described above. Microalgae of the present application may be used for the purpose of preparing a composition containing a high content of docosahexaenoic acid. The composition may be in the form of a solution, powder, or suspension, but is not limited thereto. More specifically, a food composition, a feed composition, or a feed additive including the Thraustochytrium genus CJM01 microalgae, a culture thereof, a dried product thereof, or a crushed product thereof may be provided.
[72]
In the present application, the term "feed" is any natural or artificial diet for eating, ingesting, and digesting animals or suitable therefor, as a component of the single meal, or for preventing metabolic diseases according to the present application The feed containing the therapeutic composition as an active ingredient can be prepared into various types of feed known in the art, and specifically, may include a thick feed, a roughage and/or a special feed.
[73]
In this application, the term "feed additive" is a substance added to feed for various effects such as supplementing nutrients and preventing weight loss, improving digestibility of fiber in feed, improving oil quality, preventing reproductive disorders and improving conception rate, and preventing high temperature stress in summer Includes. The feed additive of the present application corresponds to an auxiliary feed under the feed management law, and minerals such as sodium hydrogen carbonate, bentonite, magnesium oxide, and complex minerals, minerals such as zinc, copper, cobalt, selenium, etc. , Vitamin E, vitamins A, D, E, nicotinic acid, vitamin B complex, etc., protective amino acids such as methionine and lyic acid, protective fatty acids such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture, mold Live bacteria such as fermented products, yeasts, etc. may be additionally included.
[74]
In the present application, “food composition” includes all forms such as functional food, nutritional supplement, healthy food and food additives, and the food composition of this type is sugar It can be prepared in various forms according to a conventional method known in the art.
[75]
The present application provides a method of preparing a composition containing the biomass or bio oil. The biomass, biooil, and composition are as described above.
[76]
The bio-oil manufacturing method as described above is a high content by culturing CJM01 microalgae in Trouztochytrium with excellent docosahexaenoic acid productivity using a medium containing a carbon source and a nitrogen source of a specific composition under heterotrophic conditions. A bio-oil containing docosahexaenoic acid can be prepared.
[77]
Mode for carrying out the invention
[78]
Hereinafter, the configuration and effects of the present application will be described in more detail through examples. These examples are for illustrative purposes only, and the scope of the present application is not limited by the examples.
[79]
[80]
The CJM01 microalgae of the present application are microalgae belonging to the trouztocaitride family, and have the ability to produce polyunsaturated fatty acids including a high content of docosahexaenoic acid. It has the DNA nucleotide sequence of the 18S rRNA gene represented by SEQ ID NO: 1, and shows a high biomass content under heterotrophic conditions, not under normal photoculture conditions.
[81]
[82]
Hereinafter, in Examples, the experimental method will be described in more detail.
[83]
[84]
Example 1: Isolation of the Thraustochytrid family microalgae KC01
[85]
[86]
The following experiment was performed to isolate the strains of the Trouztocaitrid family microalgae.
[87]
Specifically, environmental samples of seawater, soil and leaves were collected from a total of 20 coastal areas in Geoje and Tongyeong, Gyeongsangnam-do, Korea. Immediately after collection, each sample was stored in an ice box at 10°C and transported to the laboratory, and the sample was used for bacterial separation within 2-3 days. After direct smearing on agar medium, trouztokite using a liquid pineal powder attachment method The lead strain was isolated. Through microscopic observation, a sample containing a microalgae-like form of truztocaitride was prepared as an IYP ​​medium (1 g/L yeast extract, 1 g/L peptone, MgSO 4 7H 2 O 2 g) for microbial separation. /L, Sea salt 20g/L, H 3 BO 3 5.0 mg/L, MnCl 2 3.0 mg/L, CuSO 4 0.2 mg/L, NaMo 4 2H 2 O 0.05 mg/L, CoSO 4 0.05 mg /L, ZnSO 4· 7H 2O 0.7mg/L, Agar 15g/L). The obtained colonies were purely isolated through passages several times, and then only the strains forming the zoospore sac, which is a typical characteristic of the troztocaitrid microalgae, were selected and isolated. Environmental samples that cannot be confirmed through microscopic observation were diluted and washed using sterilized seawater of 1.5% salinity, and then, 50 ml of samples were sprinkled with pine pollen powder and cultured. The microbial community obtained by culturing at a temperature and pH condition similar to that of each collection environment was purified by smearing and subculture on IYP ​​medium for microbial separation. At this time, antibiotic cocktail mix solution (Streptomycin sulfate 0-500mg/L, Ampicillin 0-500mg/L, Penicillin G 0-500mg/L, kanamycin Sulfate (Kanamycin sulfate 0-500mg/L) was added while controlling the concentration, through which the growth and contamination of other microorganisms were controlled.
[88]
Separated colonies were IGGYP medium (Glycerol 10g/L, Glucose 10g/L, 1 g/L yeast extract, 1g/L peptone, MgSO 4 7H 2 O 2g/L, sea salt 20g/L , H 3 BO 3 5.0mg/L, MnCl 2 3.0mg/L, CuSO 4 0.2mg/L, NaMo 4· 2H 2 O 0.05mg/L, CoSO 4 0.05mg/L, ZnSO 4· 7H 2O 0.7mg/L, vitamin mixed solution 10ml/L) was incubated in a 500mL flask at 15-28°C and 50-200 rpm for about 7 days. Among them, one kind of microalgae having a high growth rate and not complicated culture conditions was finally selected and the cells were recovered. The shape of the selected strain was observed using an optical microscope (Fig. 1). The recovered cells were washed three times with PBS buffer (Phosphate buffered solution, pH 7.5), and then dried in a dry oven at 55° C. for 16 hours to obtain dry cells.
[89]
The sequence of the 18s rRNA gene was analyzed for molecular biological identification of the final selected microalgal strain. After DNA was isolated from the pure isolated colonies of the selected species, 18s rRNA was amplified by PCR using primers for gene amplification in the 18s rRNA region, and primers for gene amplification are shown in Table 1 below.
[90]
[91]
[Table 1]
primer Sequence (5'-3') Sequence number
18s-001F AACCTGGTTGATCCTGCCAGTA 2
18s-013R CCTTGTTACGACTTCACCTTCCTCT 3
[92]
[93]
At this time, PCR reaction was performed 25 times of denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 52°C for 30 seconds, polymerization at 72°C for 1 minute and 30 seconds, and then polymerization for 7 minutes at 72°C. Proceeded in a way.
[94]
As a result of nucleotide sequence analysis using the amplified reaction solution, nucleotide sequence 1 (SEQ ID NO: 1) of about 1792 bp was obtained. As a result of this NCBI BLAST search, it has about 99% homology with the previously reported strain of the genus Thraustochytrium , and about the strain of the genus Aurantiochytrium and the genus Schizochytrium ( Schizochytrium genus) It was confirmed to have 84% homology.
[95]
Through this, the phylogenetic tree between strains was shown, and the results are shown in FIG. 2. That new strains Sat Tra Woods Kite Lead ( Thraustochytrid been confirmed by microscopic algae that in the atrium of the Rhine Woods Tokai) Family (family), Tra Woods atrium in Tokai ( Thraustochytrium was named Genus) KC01.
[96]
[97]
Example 2: Development of mutant microalgae
[98]
[99]
Example 2-1: Selection of mutant strains through artificial mutation method
[100]
[101]
In the present application, to isolate a strain having improved production of docosahexaenoic acid (DHA) by a mutation of gamma irradiation of the strain KC01 of the genus Thraustochytrium genus isolated in Example 1 above . The same experiment was carried out.
[102]
Specifically, the KC01 strain of the genus Thraustochytrium was cultured in GYEP medium (glucose 2%, peptone 1%, yeast extract 0.5%, sea salt 2%) for 24 hours to obtain the activated strain at 121°C for 15 After inoculation into a seed medium (glucose 5%, peptone 1%, yeast extract 0.5%, sea salt 2%) sterilized for a period of time and incubated for 14 hours, the cells were recovered. The recovered cells were suspended in 50 ml of PBS buffer, irradiated with gamma rays at a dose of 1 to 5 kGy for 1 hour, and then used in a 500 ml flask in 50 ml basic medium (5% glucose, 1% peptone, 0.5% yeast extract, 2% sea salt). After culturing at 28°C for 2 days at 120 rpm, when the mortality rate is 99%, the suspended cells are appropriately diluted and GYEP plate medium (glucose 2%, peptone 1%, yeast extract 0.5%, sea salt 2%, agar 2%, pH 7.0) was passaged twice.
[103]
First, in order to select a strain predicted to have reduced sulfated pigment produced in addition to the polyunsaturated fatty acid-containing oil, colonies whose colony color turns white were selected. The mutant strain obtained by the above method was named Thraustochytrium genus CJM01, and as of May 30, 2018, the Korea Research Institute of Bioscience and Biotechnology Biological Resource Center, an international depository under the Budapest Treaty (Korean Collection for Type Cultures: KCTC) It was deposited with and was assigned the accession number KCTC13538BP.
[104]
[105]
Example 2-2: Analysis of oil production ability containing polyunsaturated fatty acids of newly isolated microalgae and mutant strains
[106]
[107]
In order to compare the ability of the CJM01 and KC01 strains to produce oils containing polyunsaturated fatty acids selected from Example 2-1, they were cultured as follows.
[108]
As a rescue chuck, MJW01 medium (glucose 30g/L, MgSO 4· 7H 2 O 3.0g/L, Na 2 SO 4 10g/L) , NaCl 1.0g/L, yeast extract 9.0g/L, MSG·1H 2 O 1.0g/L, NaNO 3 1.0g/L, KH 2 PO 4 0.1g/L, K 2 HPO 4 0.5g/L, CaCl 2 0.5g/L, vitamin mixed solution 10ml/L) was cultured for about 4 days at 28°C, 300rpm, 1vvm, pH 7.5 under basic culture medium conditions. After collecting the cells by centrifugation, the cells were washed three times with PBS buffer and dried at 55° C. for 12 hours to measure the weight of the cells.
[109]
The content of the oil containing docosahexaenoic acid using the dried cells was measured by the following method. Specifically, after adding 8.3M hydrochloric acid solution to 2 g of dry cells to hydrolyze the cell walls of microalgal cells at 80°C, 30 mL of ethyl ether and 20 mL of petroleum ether were added and mixed for 30 seconds. The centrifugation process was repeated three or more times. Thereafter, the separated solvent layer was recovered, transferred to a round flask weighed in advance, and then removed by nitrogen purge to remove the solvent, and dried by placing it in a container to remove moisture. By measuring the weight of the dried oil, the total oil content was calculated. The DHA content contained in the oil was measured by gas chromatography, pretreated with methanolic 0.5N NaOH and 14% trifluoroborane methanol (BF 3 ).
[110]
The culture results of the KC01 strain of the genus Traustochytrium cultured by the above method and the CJM01 mutant strain selected using gamma irradiation are shown in Tables 2 and 3, and it was confirmed that DHA, a highly functional omega-3 oil, was produced. .
[111]
'Biomass' in Tables 2 and 3 below refers to the concentration of cells in the culture medium, and can be used interchangeably with DCW (dry cell weight), and the content of DHA is expressed as a content of biomass or TFA (total fatty acid). I did.
[112]
[113]
As can be seen from the following results, it was confirmed that the DHA production of the CJM01 mutant strain was improved compared to the parent strain (Trauztochytrium genus KC01) (Table 2, Table 3). Specifically, in the case of the docosahexaenoic acid (DHA) content, the CJM01 strain increased production by about 1.3 times compared to the KC01 strain. In addition, it was confirmed that the incubation time was significantly shortened without the secured cell drop, so that the docosahexaenoic acid productivity was also improved by about 1.7 times compared to the KC01 parent strain in the case of the CJM01 mutant strain.
[114]
[115]
[Table 2] Thraustochytrium sp. Docosahexaenoic acid (DHA) content and production by cultivation of () KC01 parent strain in Trouztochytrium genus
Entry Time Biomass DHA Lipid DHA Productivity
(hr) g/L (%/Biomass) (%/TFA) % (g/l/h)
One 71.5 115.2 22.7 35.6 63.7 0.365
2 73.0 127.5 21.6 33.6 64.3 0.377
3 78.5 141.8 22.3 36.8 60.5 0.402
Avg. 74.3 128.2 22.2 35.3 62.8 0.381
[116]
[117]
[Table 3] Docosahexaenoic acid (DHA) content and production according to culture of Thraustochytrium genus CJM01 mutant strain
Entry Time Biomass DHA Lipid DHA Productivity
(hr) g/L (%/Biomass) (%/TFA) % (g/l/h)
One 57.3 123.0 29.3 47.6 61.5 0.629
2 55.5 133.5 27.5 45.5 60.4 0.661
3 54.8 133.5 28.0 57.1 49.0 0.682
Avg. 55.9 130.0 28.3 50.1 57.0 0.657
[118]
[119]
As shown in the above results, it was confirmed that the mutant strain CJM01 was a strain with improved DHA content and productivity compared to the parent strain, KC01 strain.
[120]
[121]
Example 2-3: Analysis of amino acid production ability of newly isolated microalgae and mutant strains
[122]
[123]
In addition, in order to confirm the culture characteristics of the CJM01 strain, the total amino acid content in the culture medium was examined.
[124]
Specifically, a 10 ml sample was collected from each of the culture solutions, diluted 20 times with distilled water, filtered, and analyzed for total amino acid using liquid chromatography. As a result of checking the total amino acid concentration, aspartate, serine, glutamate, glycine, alanine, valine, methionine, isoleucine, leucine, tyrosine, phenylalanine, lysine, and arginine were all detected above 10 mg/L in the culture medium of the KC01 parent strain. On the other hand, most amino acids were not detected in the culture medium of the CJM01 strain with improved DHA content.
[125]
Specifically, in the case of the CJM01 mutant strain, it was confirmed that the total amino acid concentration produced as a by-product other than DHA produced compared to the KC01 parent strain was reduced by about 99% or more on average (Table 4).
[126]
It was confirmed that the CJM01 mutant strain showed an equivalent level of cell growth compared to the KC01 parent strain, and the total lipid content relative to the cell mass was not significantly reduced. It shows that it was used more effectively.
[127]
[128]
[Table 4] Analysis of total amino acids in the culture medium according to cultivation of the KC01 parent strain and the CJM01 mutant strain of Thraustochytrium genus
Amino acid T. KC01 parent strain T. CJM01 mutant strain
(mg/L) One 2 3 Avg One 2 3 Avg
Asp 20.3 28.9 12.3 20.5 0.0 0.0 0.0 0.0
Ser 49.5 85.2 28.6 54.4 0.0 0.0 0.0 0.0
Glu 91.6 108.4 193.0 131.0 0.0 0.0 0.0 0.0
Gly 32.4 52.8 28.7 38.0 0.0 0.0 0.0 0.0
Ala 72.6 104.4 41.1 72.7 0.0 0.0 0.0 0.0
Val 83.0 130.8 59.5 91.1 10.1 0.0 0.0 3.4
Met 32.1 58.2 16.0 35.4 0.0 0.0 0.0 0.0
Ile 42.1 77.0 18.8 46.0 0.0 0.0 0.0 0.0
Leu 93.0 166.9 41.8 100.6 0.0 0.0 0.0 0.0
Tyr 51.7 86.5 0.0 46.1 0.0 0.0 0.0 0.0
Phe 83.4 129.9 58.4 90.5 0.0 0.0 0.0 0.0
Lys 45.9 83.3 20.2 49.8 0.0 0.0 0.0 0.0
His 15.9 25.0 0.0 13.6 0.0 0.0 0.0 0.0
Arg 57.0 93.7 24.0 58.2 0.0 0.0 0.0 0.0
Sum 770.5 1231.1 542.5 848.0 10.1 0.0 0.0 3.4
[129]
[130]
Example 3: Optimization of media conditions
[131]
[132]
In order to further improve DHA content and productivity, using the CJM01 strain with reduced amino acid and improved DHA content selected in Example 2, optimization of medium conditions was performed.
[133]
Specifically, based on the MJW01 medium used in Example 2-2, in order to increase the nitrogen source content in the medium and to reduce production costs, the concentration of the yeast extract as an organic nitrogen source was reduced, and the inorganic nitrogen source (NH 4 ) 2 SO 4 was added and the concentration of NaNO 3 was increased, and finally MJW02 medium (glucose 30 g/L, MgSO 4 7H 2 O 5.0 g/L, Na 2 SO 4 3 g/L, NaCl 0.5 g/L, yeast extract 1.0 g/L, MSG1H 2 O 1.0g/L, NaNO 3 8.0g/L, (NH 4 ) 2 SO 4 3.0g/L, KH 2 PO 4 0.1g/L, K 2 HPO 40.5g/L, CaCl 2 0.1g/L, vitamin mixed solution 10ml/L).
[134]
In order to compare the MJW01 and MJW02 medium conditions, the culture of the CJM01 strain was performed in the medium. As a result, as shown in Table 5 below, as the concentration of the yeast extract, which is an organic nitrogen source, was reduced, the amount of cells decreased, but the incubation time was significantly shortened by increasing the inorganic nitrogen source. As a result, it was confirmed that the DHA content was equal to or higher, and the DHA productivity was improved by 1.13 times.
[135]
[136]
[Table 5] Docosahexaenoic acid (DHA) content and production according to culture medium conditions
Badge condition Time Biomass DHA Lipid Productivity
(hr) g/L (%/Biomass) (%/TFA) % (g/l/h)
MJW01 59.3 133.4 26.0 42.6 61.0 0.584
MJW02 52.1 124.3 27.7 49.0 56.6 0.661
[137]
[138]
From the above description, those skilled in the art to which the present application belongs will understand that the present application may be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present application should be construed as including the meaning and scope of the claims to be described later rather than the detailed description, and all changes or modified forms derived from the equivalent concepts within the scope of the present application.
[139]

Claims
[Claim 1]
Compared to the wild type, the production of docosahexaenoic acid (DHA) is increased, and the production of amino acids is reduced, Thraustochytrium genus CJM01 microalgae (accession number: KCTC 13538BP).
[Claim 2]
The microalgae according to claim 1, wherein the CJM01 microalgae of the genus Trouztochytrium contains 40 to 60% by weight of docosahexaenoic acid based on the total weight of fatty acids.
[Claim 3]
The microalgae according to claim 1, wherein the CJM01 microalgae in the genus Trouztochytrium has a docosahexaenoic acid productivity of 0.5 to 0.7 (g/l/h).
[Claim 4]
The step of culturing the CJM01 microalgae of claim 1 in Trouztochytrium; And recovering docosahexaenoic acid-containing biomass from the microalgae, a culture thereof, a dried product thereof, or a lysate thereof.
[Claim 5]
The method of claim 4, wherein the culture is performed under heterotrophic conditions.
[Claim 6]
The method of claim 4, wherein the cultivation is performed using a medium containing a carbon source and a nitrogen source.
[Claim 7]
The method of claim 6, wherein the carbon source is at least one selected from the group consisting of glucose, fructose, maltose, galactose, mannose, sucrose, arabinose, xylose, and glycerol.
[Claim 8]
The method of claim 6, wherein the nitrogen source is i) an organic nitrogen source selected from the group consisting of yeast extract, beef extract, peptone and tryptone, or ii) ammonium acetate, ammonium nitrate, ammonium Chloride, ammonium sulfate, sodium nitrate, urea and MSG (Monosodium glutamate) that is an inorganic nitrogen source selected from the group consisting of, biomass production method.
[Claim 9]
The step of culturing the CJM01 microalgae of claim 1 in Trouztochytrium; And recovering docosahexaenoic acid-containing lipids from the microalgae, a culture thereof, a dried product thereof, or a lysate thereof.