Sign In to Follow Application
View All Documents & Correspondence

Novel Targets For Anti Ageing

Abstract: A method of screening anti aging actives comprising: (a) treating human primary fibroblasts with active(s) to be screened in vitro; (b) enhancing the synthesis of collagen in fibroblast cells by appropriate actives on providing specific growth condition; (c) harvesting cells with enhanced collagen synthesis to isolate mRNA; (d) using said mRNA to isolate genes causing said enhanced collagen synthesis; (e) hybridization of differential regulated genes of Sequence ID 1, 2, 3, 4 and 5 with said isolated genes to quantify up-regulation of said isolated genes; and (f) short-listing actives based on up-regulation of at least one sequence selected from Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4 and Sequence ID 5 to provide actives that increase procollagen. Also described are the kit for screening anti aging actives in accordance with the above method and compositions comprising anti aging actives

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
30 March 2011
Publication Number
30/2015
Publication Type
INA
Invention Field
PHARMACEUTICALS
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2019-03-28
Renewal Date

Applicants

ITC LIMITED
37  J.L.Nehru Road  Kolkata – 700 071  State of West Bengal  India

Inventors

1. MURUGESAN Minnie;
ITC R&D Centre  Peenya Industrial Area  1st Phase  Bangalore – 560058  India
2. R Arthe;
ITC R&D Centre  Peenya Industrial Area  1st Phase  Bangalore – 560058  India
3. BHASKAR  James  P
ITC R&D Centre  Peenya Industrial Area  1st Phase  Bangalore – 560058  India
4. RAMAMURTHI Suresh
ITC R&D Centre  Peenya Industrial Area  1st Phase  Bangalore – 560058  India
5. KRISHNAN  Venkat;
ITC R&D Centre  Peenya Industrial Area  1st Phase  Bangalore – 560058  India

Specification

Field of the invention
The present invention relates to a method for controlling dermal ageing. The invention also
relates to compositions for controlling dermal ageing.
Background and Prior art
The skin is the largest organ in the body, accounting for around 12 - 15% of body weight. It
is made up of three principle layers (epidermis, dermis and hypodermis), each of which has
sub layers. The epidermis is the outer layer of constantly regenerating cells that gradually
keratinize and flake off as they move from the innermost layer to the outermost. Under this
layer, is the dermis - a complex layer of elastic (elastin) and inelastic (collagen) connective
tissue, oil, sweat glands, hair follicles, blood vessels and nerve fibers.
Dermal aging results in skin losing its ability to regenerate, while simultaneously suffering
from damage caused by free radicals and ultraviolet rays. Aged skin becomes wrinkled,
saggy, dry, rough and chapped.
Stress is one of the major causes of degradation of human cells. This degradation manifests
itself in speedy aging and premature cell death. Premature cell aging and cell death cause
various medical conditions that essentially require treatment. Stress may be of various kinds
such as oxidative stress, chemical stress, photochemical stress, so on and so forth. In all its
varieties stress leads to the production of unquenched, activated free radicals that in turn
activate enzymes present in the human body. These activated enzymes act as mediators in the
degradation process. For example oxidative stress results in generation of ROS species that
activate enzyme matrix metalloproteinase resulting in degradation of collagen. Oxidative
stress is one of the key biochemical responses of sagging of skin.
The genetic basis of aging is not well understood. A few key mediators have been
recognized as targets for anti-aging. Searching for aging-related proteins in human dermal

microvascular endothelial cells treated with anti-aging agents, Proteomics. 2006
Feb;6(4):1351-61, Lee JH, Chung KY, Bang D, Lee KH, discloses that endothelial cells
constitute an interface between blood and tissue and act as a medium for active interaction
between plasma and the intracellular environment for homeostasis. Aging of endothelial cells
plays a significant role in the pathophysiology of age-related vascular diseases; however,
precise mechanisms for senescence have not been elucidated. Proteomics allows
identification of protein structures, functions, and characteristics, and can be applied to the
study of aging processes. Using cultured human dermal microvascular endothelial cells and
two-dimensional proteomic mapping, Lee et al. had studied the effects of kinetin,
epigallocatechin-3-gallate, all-trans-retinoic acid, and selenium on their senescence and
searched for the aging-related proteins. The treatments resulted in 68 qualitative changes and
172 quantitative changes, and we were able to identify 46 spots among them. All of the
agents induced changes in the expression of moesin, rho guanosine-5'-diphosphate-
dissociation inhibitor, and actin. Lee et al. mentions that although practical significance
remains to be confirmed by in vivo research, their study may provide a basis for
understanding the mechanism of aging and age-related diseases.
The inventors of WO2006075350 have found that POF1B gene has a highly specific pattern
of expression in stratified epithelia and the encoded protein is specifically expressed in
junctions of stratified epithelia. Accordingly WO'350 discloses use of an encoded product of
the POF1B gene or biologically active fragments thereof for the production of a cosmetic
product for skin topic use, for skin regeneration and anti-aging and/or for hair and/or hair-
epidermis related disorders.
However as mentioned in forgoing paragraphs the process of dermal ageing is not well
understood and given the complexity of the process, it is thus important to identify,
understand and modulate key genes, pathways, intervention points and actives that controls
dermal aging.

Object of the Invention
It is the object of the present invention to provide polynucleotide sequences which when
differentially regulated control dermal ageing.
It is another object of the present invention to provide a method for screening novel actives
that controls dermal aging through differential regulation of disclosed genes sequences.
It is yet another object of the invention to provide a kit for identification of potential actives
that control dermal aging through differential regulation of disclosed gene sequences.
It is a further object of the present invention to provide compositions comprising one or more
actives that up-regulates the expression of one or more sequences of the present invention.
It is still further the object of the present invention to provide compositions comprising one
or more novel actives wherein the actives have been screened by the kits of the present
invention.
It is still another object of the present invention to provide anti aging compositions
comprising one or more novel actives wherein said compositions controls dermal aging
through differential regulation of disclosed gene sequences.
Brief Description of Accompanying Figures
Figure 1 a illustrates enhanced expression of Sequence ID 3, Sequence ID 2 and Sequence
ID 1 which translates to increased procollagen synthesis (shown by treatment with
Gibberellic acid)
Figure 1 b illustrates reduction of intracellular ROS species on treatment with Gibberellic
acid.

Figure 2 a illustrates enhanced expression of Sequence ID 2, Sequence ID 3 and Sequence
ID 1 which translates to increased procollagen synthesis (shown by treatment with Mandelic
acid)
Figure 2 b illustrates reduction of intracellular ROS species on treatment with Mandelic acid.
Figure 3 a illustrates enhanced expression of Sequence ID 3, Sequence ID 1, Sequence ID 2
and Sequence ID 5 which translates to increased procollagen synthesis (shown by treatment
with Magniferin)
Figure 3 b illustrates reduction of intracellular ROS species on treatment with Magniferin.
Figure 4 a illustrates enhanced expression of Sequence ID 3, Sequence ID 1 and Sequence
ID 2 which translates to increased procollagen synthesis (shown by treatment with Adonitol)
Figure 4 b illustrates reduction of intracellular ROS species on treatment with Adonitol.
Figure 5 a illustrates enhanced expression of Sequence ID 2, Sequence ID 3, Sequence ID 1
and Sequence ID 5 which translates to increased procollagen synthesis (shown by treatment
with Thr-Lys-Pro-Arg)
Figure 6 a illustrates enhanced expression of Sequence ID 1, Sequence ID 2 and Sequence
ID 4 which translates to increased procollagen synthesis (shown by treatment with
Methionine)
Figure 6 b illustrates reduction of intracellular ROS species on treatment with Methionine.
Figure 7 a illustrates enhanced expression of Sequence ID 3, Sequence ID 2 and Sequence
ID 1 which translates to increased procollagen synthesis (shown by treatment with Chrysin)
Figure 7 b illustrates reduction of intracellular ROS species on treatment with Chrysin.
Summary of the invention
According to one aspect of the present invention there is provided a method of screening anti
aging actives comprising:
a. treating human primary fibroblasts with active(s) to be screened in vitro;
b. enhancing the synthesis of collagen in fibroblast cells by appropriate actives on
providing specific growth condition;
c. harvesting cells with enhanced collagen synthesis to isolate mRNA;
d. using said mRNA to isolate genes causing said enhanced collagen synthesis;

e. hybridization of differential regulated genes of Sequence ID 1, 2, 3, 4 and 5 with said
isolated genes to quantify up-regulation of said isolated genes; and
f. short-listing actives based on up-regulation of at least one sequence selected from
Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4 and Sequence ID 5 to
provide actives that increase procollagen.
According to another aspect of the present invention there is provided a screening kit
comprising:
a. Primary Human fibroblast cells;
b. RNA extraction and qPCR reagents; and
c. Specific primers for Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4,
Sequence ID 5 selected from the group comprising
TCTGGACAATGCCAGCATTTGGAT,
ACAGGAACAGCACAGAAGACAGAC,
ATGGCCTCAAGGGTCATGTGTTTG,
TGCCATGGAAATTAATCAGGCAT,
TGTTCCACACCAACAGAGGACCTA,
TATGATGGCACACTGGGCTTGGAT,
TGCTCGGAAACGCTTGGTGATACA,
CGTGACAAATGATACCTGTGTTGG, and
AGAGTTTCTCCATGTTGAGGCTGC,
AAACGAGCTAGTCCGTACCAAGCA.
According to a further aspect of the invention there is provided an anti aging composition
comprising one or more active agents wherein such active agent up-regulates the expression

of at least one sequence selected from sequences of Sequence ID 1, Sequence ID 2, Sequence
ID 3, Sequence ID 4, and Sequence ID 5.
According to yet another aspect of the present invention there is provided a cosmetic method
for inducing collagen expression in primary human fibroblast by manipulating expression of
nucleotide sequences having sequence id selected from Sequence ID 1, Sequence ID 2,
Sequence ID 3, Sequence ID 4, and Sequence ID 5.
Detailed Description of the invention
The present invention relates to novel target genes sequences whose differential regulation
controls dermal ageing. The invention also discloses, kits, screening methods employing the
said sequences and compositions comprising actives that up-regulate the expression of the
said sequences.
The term 'anti-ageing' refers to reduction in wrinkles, reduced sagging of skin, increased skin
elasticity, reduction in dark spot formation, reduction of uneven skin tone, reduced fine line
formation, skin firming and toning, moisturization and hydration, prevention of solar
elastosis, reduction of skin tanning and darkening, reduced skin atrophy, increased skin
repair, replenishment and rejuvenation achieved by extracellular matrix protein (such as
collagen) induction, MMP inhibition, inhibition of intracellular ROS, reduction on advanced
glycation end products, elastase inhibition, vascularization, tyrosinase inhibition, melanin
inhibition and the like.
The term anti-ageing composition refers to any personal care composition that provides anti-
ageing effects. It can be in the form of leave - on products such as creams, lotions, serums,
masks, balms, emulsions, microemulsions and wash - off products such as soaps, shampoos,
shower gels, face wash, mousse, conditioners and the like.
The term dermal anti-ageing refers to reduction in wrinkles, reduced sagging of skin,
increased skin elasticity, reduction in dark spot formation, reduction of uneven skin tone,

reduced fine line formation, skin firming and toning, moisturization and hydration, solar
elastosis, skin tanning, skin darkening owing to extracellular matrix protein induction such as
collagen, MMP inhibition, inhibition of intracellular ROS, reduction on advanced glycation
end products, elastase inhibition, vascularization, tyrosinase inhibition, melanin inhibition
and the like, as evident on skin.
According to one of its embodiments the present invention discloses genes sequences whose
differential regulation controls dermal ageing. The following sequences, as detailed
hereunder, can be differentially regulated to control dermal aging:
Sequence ID 1 : Gene I.D. & regulation: A_24_P524562 (+3.7 fold)
ACGTAGATCCATCCATCACATACTTCTAACTGAGTGTCCTACAGCAAGTACGTTT
TTGTG
Sequence ID 2 : Gene I.D. & regulation: A_24_P33385 (+3.5 fold)
GAAAATTCAAGCTGATACTGAAGTGTTCAGGGCAAAAATGCCTGATTAATTTCCA
TGGCA
Sequence ID 3 : Gene I.D. & regulation: A_24_P384200 (+4.0 fold)
AATGTTTGATGTAACATCAAGAGTTACTTACATGTGCCTATGGCATAGAGATCAG
GTGAG
Sequence ID 4 : Gene I.D. & regulation: A_24_P298099 (+3.33 fold)
AAGTTGTTAAGAGTAAGGCCTACTTTAAGAGATATGTGAAATTTAGAAGACGAC
GAGAGG
Sequence ID 5 : Gene I.D. & regulation: A_24_P272735 (+3.4 fold)
CTGGTAAAACAAGGATCGTCCATGTTGTCTACAATACATCTAATAACGAGCTAGT
CCGTA
The Locus, annotation and origin of the sequences with sequence ID 1, sequence ID 2,
sequence ID 3, sequence ID 4, and sequence ID 5 are stated herewith in the format Notation:
Chromosome No.: Contig from: Contig to: Strand


The present inventors have found out that the above genes provide anti-aging effects when
up-regulated by >2 fold. These sequences have thus been employed to develop a method that
can be useful for screening antiaging actives. Accordingly, the present inventors have found a
method of screening antiaging actives. The said method comprises:
a. treating human primary fibroblasts with active(s) to be screened in vitro;
b. enhancing the synthesis of collagen in fibroblast cells by appropriate actives on
providing specific growth condition;
c. harvesting cells with enhanced collagen synthesis to isolate mRNA;
d. using said mRNA to isolate genes causing said enhanced collagen synthesis;
e. hybridization of differential regulated genes of Sequence ID 1, 2, 3, 4 and 5 with said
isolated genes to quantify up-regulation of said isolated genes; and
f. short-listing actives based on up-regulation of at least one sequence selected from
Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4 and Sequence ID 5 to
provide actives that increase procollagen.
The actives to be screened may be selected from a group comprising translated amino acid
sequence, siRNAs, natural extracts, herbal extracts, chemical compounds, and combinations
thereof. The present inventors have indentified potential anti aging actives employing the
screening method of the present invention. Actives such as Adonitol, Pyrocatechol, Mandelic
acid, Inosine, Inositol, gibberelllic acid, chrysin, N-acetyl-D-mannosamine, p-aminohippuric
acid, cycloserine harpagoside, esculin hydrate, vitamin K2, Vitexin-2-O-rhamnoside,
Doxazosin mesylate, azacytidine, yohimbine hydrochloride, quipazine maleate, betulinic
acid, magniferin, lycopodium, peptides such as Arg-Tyr-Tyr-Arg-Ile-Lys, casein, Leu 28, 31
Y(24-36), Thr-Lys-Pro-Arg, QKRPSQRSKYL, uremic pentapeptide, antioxidant peptide B
were screened out. These actives up-regulated at least one sequence selected from sequences

of Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4, and Sequence ID 5 and
showed an increase in collagen synthesis in human cells resulting in dermal anti-ageing
effect.
Accordingly in one of the embodiments of the present invention, there is provided antiaging
compositions comprising one or more anti aging actives that up-regulates the expression of at
least one sequence selected from sequences of Sequence ID 1, Sequence ID 2, Sequence ID
3, Sequence ID 4, and Sequence ID 5. Non limiting examples of the actives that upregulate
the expression of sequences of Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID
4, and Sequence ID 5 include but are not limited to Adonitol, Pyrocatechol, Mandelic acid,
Inosine, Inositol, gibberelllic acid, chrysin, N-acetyl-D-mannosamine, p-aminohippuric acid,
cycloserine harpagoside, esculin hydrate, vitamin K2, Vitexin-2-O-rhamnoside, Doxazosin
mesylate, azacytidine, yohimbine hydrochloride, quipazine maleate, betulinic acid,
magniferin, lycopodium and peptides selected from Arg-Tyr-Tyr-Arg-Ile-Lys, casein, Leu
28, 31 Y(24-36), Thr-Lys-Pro-Arg, QKRPSQRSKYL, Uremic pentapeptide, antioxidant
peptide B.
According to another embodiment of the present invention there is provided an anti aging
composition comprising translated amino acid sequence actives (peptides) adapted to
differentially regulate at least one of the genes selected from Sequence ID 1, Sequence ID 2,
Sequence ID 3, Sequence ID 4, Sequence ID 5 said peptides selected from Arg-Tyr-Tyr-Arg-
Ile-Lys, casein, Leu 28, 31 Y(24-36), Thr-Lys-Pro-Arg, QKRPSQRSKYL, uremic
pentapeptide, antioxidant peptide B.
The present inventors have found that the said actives, amino acid, peptides and combinations
thereof increased procollagen expression. It was also found that the said actives, amino acid,
peptides and combinations thereof inhibited intracellular reactive oxygen species generation.
This increased collagen expression and inhibition of intracellular ROS (reactive oxygen
species), in effect led to dermal anti-aging.

According to a further embodiment of the present invention there is provided a screening kit
for identifying potential actives that enhance the production of collagen, said kit comprising:
a. Primary human dermal fibroblast;
b. RNA extraction and qPCR reagents;
c. Primers for genes Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID
4, Sequence ID 5
According to a preferred embodiment of the present invention there is provided a screening
kit for identifying potential actives that enhance the production of collagen, the said kit
comprising:
a. Primary human dermal fibroblast cells, DMEM medium with 0.5-10% fetal bovine
serum treated with active molecules;
b. Customized array chip comprising sequences of Sequence ID 1, Sequence ID 2,
Sequence ID 3, Sequence ID 4, and Sequence ID 5;
c. Primers for Sequence ID1, Sequence ID 2, Sequence ID 3, Sequence ID 4, and
Sequence ID 5; and
d. RNA isolation and extraction reagents, Reverse transcriptase and IX buffer, dT oligo
primers, DNA Polymerase, dNTPs, Mg solution, fluorescence detection dye reagent
The primers employed in the present invention are as follows:
Primer for Sequence I.D. 1 :A_24_P524562
(TCTGGACAATGCCAGCATTTGGAT,ACAGGAACAGCACAGAAGACAGAC),
Primer for Sequence I.D. 2:A_24_P33385
(ATGGCCTCAAGGGTCATGTGTTTG,TGCCATGGAAATTAATCAGGCAT),
Primer for Sequence I.D. 3:A_24_P384200
(TGTTCCACACCAACAGAGGACCTA,TATGATGGCACACTGGGCTTGGAT)
Primer for Sequence I.D. 4:A_24_P298099
(TGCTCGGAAACGCTTGGTGATACA, CGTGACAAATGATACCTGTGTTGG) and
Primer for Sequence I.D. 5:A_24_P272735
(AGAGTTTCTCCATGTTGAGGCTGC,AAACGAGCTAGTCCGTACCAAGCA)

According to yet another embodiment of the invention there is provided a composition to
control dermal ageing comprising one or more actives that differentially regulate genes of
Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4, and Sequence ID 5 and as
have been screened using the screening kit of the present invention. The formulation of the
present invention enhances collagen synthesis in human skin and according act as anti ageing
composition. Such actives may be selected from the group comprising translated amino acid
sequence, siRNAs, natural extracts, herbal extracts, chemical compounds, and combinations
thereof. According to the present invention the composition may comprise one or more of the
active components selected from the group consisting but not limited to Adonitol,
Pyrocatechol, Mandelic acid, Inosine, Inositol, gibberelllic acid, chrysin, N-acetyl-D-
mannosamine, p-aminohippuric acid, cycloserine harpagoside, esculin hydrate, vitamin K2,
Vitexin-2-O-rhamnoside, Doxazosin mesylate, azacytidine, yohimbine hydrochloride,
quipazine maleate, betulinic acid, magniferin, lycopodium and peptides such as Arg-Tyr-Tyr-
Arg-Ile-Lys, casein, Leu 28, 31 Y(24-36), Thr-Lys-Pro-Arg, QKRPSQRSKYL, Uremic
pentapeptide, antioxidant peptide B.
The composition may further contain one or more of other commonly added cosmetic
additives such as emulsifying agents, humectants, emollients, thickeners, structurants,
polymers, surfactants, chelating agents, preservatives, carrier liquids, neutralizers, silicones
and siloxanes, other active ingredients such as sunscreens, skin-lightening agents, anti-
wrinkle agents, anti-acne, antimicrobial and antifungal actives, essential oils, anti-glycation
agent, artificial tanning actives, sebum stimulators / regulators, protease inhibitors, skin
tightening, vitamins, anti-itch ingredients and the like.
Emulsifying agents which may be optionally added to the compositions of the present
invention include but are not restricted to oxyalkylenated fatty acid esters of polyols, for
example polyethylene glycol stearates, for instance PEG-100 stearate, PEG-50 stearate and
PEG-40 stearate; and mixtures thereof, CI2-15 Alkyl Benzoate, mixture of glyceryl
monostearate and of polyethylene glycol stearate (100 EO) (Simulsol 165), oxyalkylenated
fatty acid esters of sorbitan comprising, for example, from 20 to 100 EO such as Tween 20 or

Tween 60, oxyalkylenated (oxyethylenated and/or oxypropylenated) fatty alcohol ethers;
alkoxylated or non-alkoxylated sugar esters, such as sucrose stearate and PEG-20
methylglucose sesquistearate; sorbitan esters such as the sorbitan palmitate ( Span 40), esters
of diacid and of fatty alcohol, such as dimyristyl tartrate; mixtures of these emulsifiers, for
instance the mixture of glyceryl stearate and of PEG-100 stearate(Arlacel 165), and mixtures
comprising these emulsifiers, such as the mixture of dimyristyl tartrate, cetearyl alcohol,
Pareth-7 and PEG-25 laureth-25, (Cosmacol PSE) , Potassium Cetyl Phosphate (and)
Hydrogenated Palm Glycerides, steareth - 2, steareth 21, PPG-15 stearyl ether.
Thickeners which may be used in the instant invention include but are not restricted to
alkyloamides, carbomer 934,940,941,960,961, Acrylates/C 10-30 Alkyl Acrylate Cross
polymer, cetearyl alcohol, cetyl alcohol, gelatin, gums, magnesium aluminium silicates,
Ammonium Acryloyl - dimethyltaurate / VP Copolymer, ozocarite, paraffin, tragacanth,
sodium alginate, Tinovis ADM, Xanthan gum and the like.
Structurants which may be used in compositions of the present invention include those
materials which are well known in the art and include fatty acids, fatty alcohols, fatty acid
esters, and fatty acid amides, having fatty chains of from 8 to 30 carbons atoms. Preferably
the structurant used is stearic acid.
Non limiting specific examples of surfactants applicable to the instant invention include alkyl
benzene sulfonates, alkane sulfonates, olefin sulfonates, alkyl ether sulfonates, glycerol ether
sulfonates, Sodium dodecyl sulfate (SDS), ammonium lauryl sulfate, and other alkyl sulfate
salts Sodium laureth sulfate, also known as sodium lauryl ether sulfate (SLES) Soaps, or fatty
acid salts, alpha.-methyl ester sulfonates, sulfofatty acids, alkyl sulfates, monoglyceride
(ether) sulfates, fatty acid amide (ether) sulfates, mono- and dialkyl sulfosuccinates, mono-
and dialkyl sulfosuccinamates, sulfotriglycerides, amide soaps, ether carboxylic acids and
salts thereof, fatty acid isethionates, fatty acid sarcosinates, fatty acid taurides, acyl lactylates,
acyl tartrates, acyl glutamates, acyl aspartates, alkyl oligoglucoside sulfates, protein fatty acid
condensates (more particularly wheat-based vegetable products) and alkyl (ether) phosphates,
Dodecyl betaine, Dodecyl dimethylamine oxide, Cocamidopropyl betaine,Coco ampho

glycinate, alkyl betaines, alkyl amidobetaines, aminopropionates, aminoglycinates,
imidazolinium betaines and sulfobetaines, fatty alcohol polyglycol ethers, alkylphenol
polyglycol ethers, fatty acid polyglycol esters, fatty acid amide polyglycol ethers, fatty amine
polyglycol ethers, alkoxylated triglycerides, alk(en)yl oligoglucosides, fatty acid-N-alkyl
glucamides, protein hydrolyzates (more particularly soya-based vegetable products), polyol
fatty acid esters, sugar esters, sorbitan esters and polysorbates, Alkyl poly(ethylene oxide),
Copolymers of poly(ethylene oxide) and poly(propylene oxide) (commercially called
Poloxamers or Poloxamines), Alkyl polyglucosides, including Octyl glucoside, Decyl
maltoside, Fatty alcohols, Cetyl alcohol, Oleyl alcohol, Cocamide MEA, cocamide DEA,
cocamide TEA and mixtures thereof.
Various emollients as are known to a person skilled in the art and as are available in the
market can be employed as an optional constituent in the instant invention. These include but
are not restricted to the group consisting of lanolin, octyl dodecanol, hexyl decanol, oleyl
alcohol, decyl oleate, isopropyl stearate, isopropyl palmitate, isopropyl myristate, hexyl
laureate, dioctyl cyclohexane, PPG-15 stearyl ether, isohexadecane, stearic acid, cetyl
alcohol, mineral oil etc
Non-limiting examples of neutralizers, which may be used in the instant invention, include
organic and inorganic neutralizers. Non-limiting examples of organic neutralizers are 2-
amino-2-methyl-l, 3-propanediol (AMPD); 2-amino-2-ethyl-l, 3-propanediol (AEPD); 2-
amino-2-methyl-l-propanol (AMP); 2-amino-l-butanol (AB); monoethanolamine (MEA);
diethanolamine (DEA); triethanolamine (TEA); monoisopropanolamine (MIPA);
diisopropanol-amine (DIPA); triisopropanolamine (TIPA); and dimethyl stearamine (DMS).
A long chain amine neutralising agent such as stearamidopropyl dimethylamine or
lauramidopropyl dimethylamine may be employed. Also suitable are inorganic neutralises,
non limiting examples of which include sodium hydroxide, potassium hydroxide and borax.
Non-limiting examples of rheology modifier, which may be used in the instant invention,
include Hydroxyethyl Acrylate / Sodium Acryloyldimethyl Taurate Copolymer (and)
Isohexadecane (and) Polysorbate 60.

Various chelating agents may be used as optional constituents of the instant invention. These
may be selected from a group consisting of but not limited to Dimercaptosuccinic acid
(DMSA), Dimercapto-propane sulfonate (DMPS), Alpha lipoic acid (ALA), Calcium
disodium versante (CaNa2-EDTA), Disodium EDTA, Dimercaprol (BAL).
Anti-acne actives can be effective in treating acne vulgaris, a chronic disorder of the
pilosebaceous follicles. Non-limiting examples of useful anti-acne actives include the
keratolytics such as salicylic acid (o-hydroxybenzoic acid), derivatives of salicylic acid such
as 5-octanoyl salicylic acid and 4 methoxysalicylic acid, and resorcinol; retinoids such as
retinoic acid and its derivatives (e.g., cis and trans); sulfur-containing D and L amino acids
and their derivatives and salts, particularly their N-acetyl derivatives, mixtures thereof and
the like.
Antimicrobial and antifungal actives can be effective to prevent the proliferation and growth
of bacteria and fungi. Non-limiting examples of antimicrobial and antifungal actives include
b-lactam drugs, quinolone drugs, ciprofloxacin, norfloxacin, tetracycline, erythromycin,
amikacin, 2,4,4'-trichloro-2'-hydroxy diphenyl ether, 3,4,4'-Trichlorocarbanilide
(triclocarban), phenoxyethanol, 2,4,4'-Trichloro-2'-Hydroxy Diphenyl Ether (triclosan); and
mixtures thereof and the like.
Anti-wrinkle, anti-skin atrophy and skin repair actives can be effective in replenishing or
rejuvenating the epidermal layer. These actives generally provide these desirable skin care
benefits by promoting or maintaining the natural process of desquamation. Non-limiting
examples of anti-wrinkle and anti-skin atrophy actives include vitamins, minerals, and skin
nutrients such as milk, vitamins A, E, and K; vitamin alkyl esters, including vitamin C alkyl
esters; magnesium, calcium, copper, zinc and other metallic components; retinoic acid and its
derivatives (e.g., cis and trans); retinal; retinol; retinyl esters such as retinyl acetate, retinyl
palmitate, and retinyl propionate; vitamin B 3 compounds (such as niacinamide and nicotinic
acid), alpha hydroxy acids, beta hydroxy acids, e.g. salicylic acid and derivatives thereof

(such as 5-octanoyl salicylic acid, heptyloxy 4 salicylic acid, and 4-methoxy salicylic acid);
mixtures thereof and the like.
Skin barrier repair actives are those skin care actives which can help repair and replenish the
natural moisture barrier function of the epidermis. Non-limiting examples of skin barrier
repair actives include lipids such as cholesterol, ceramides, sucrose esters and pseudo-
ceramides; ascorbic acid; biotin; biotin esters; phospholipids, mixtures thereof, and the like.
Non-steroidal Cosmetic Soothing Actives can be effective in preventing or treating
inflammation of the skin. The soothing active enhances the skin appearance benefits of the
present invention, e.g., such agents contribute to a more uniform and acceptable skin tone or
color. Non-limiting examples of cosmetic soothing agents include the following categories:
propionic acid derivatives; acetic acid derivatives; fenamic acid derivatives; mixtures thereof
and the like.
Artificial tanning actives can help in simulating a natural suntan by increasing melanin in the
skin or by producing the appearance of increased melanin in the skin. Non-limiting examples
of artificial tanning agents and accelerators include dihydroxyacetaone; tyrosine; tyrosine
esters such as ethyl tyrosinate and glucose tyrosinate; mixtures thereof, and the like.
Skin lightening actives can actually decrease the amount of melanin in the skin or provide
such an effect by other mechanisms. Non-limiting examples of skin lightening actives useful
herein include aloe extract, alpha-glyceryl-L-ascorbic acid, aminotyrosine, ammonium
lactate, glycolic acid, hydroquinone, 4 hydroxyanisole, mixtures thereof, and the like.
Also useful herein are sunscreen actives. Non-limiting examples of sunscreens which are
useful in the compositions of the present invention are those selected from the group
consisting of octyl methoxyl cinnamate (Parsol MCX) and butyl methoxy benzoylmethane
(Parsol 1789), 2-ethylhexyl p-methoxycinnamate, 2-ethylhexyl N,N-dimethyl-p-
aminobenzoate, p-aminobenzoic acid, 2-phenylbenzimidazole-5-sulfonic acid, oxybenzone,
mixtures thereof, and the like.

Sebum stimulators can increase the production of sebum by the sebaceous glands. Non-
limiting examples of sebum stimulating actives include bryonolic acid,
dehydroetiandrosterone (DHEA), orizanol, mixtures thereof, and the like.
Sebum inhibitors can decrease the production of sebum by the sebaceous glands. Non-
limiting examples of useful sebum inhibiting actives include aluminum hydroxy chloride,
corticosteroids, dehydroacetic acid and its salts, dichlorophenyl imidazoldioxolan (available
from Elubiol), mixtures thereof, and the like.
Also useful as actives in the present invention are protease inhibitors. Protease inhibitors can
be divided into two general classes: the proteinases and the peptidases. Proteinases act on
specific interior peptide bonds of proteins and peptidases act on peptide bonds adjacent to a
free amino or carboxyl group on the end of a protein and thus cleave the protein from the
outside. The protease inhibitors suitable for use in the present invention include, but are not
limited to, proteinases such as serine proteases, metalloproteases, cysteine proteases, and
aspartyl protease, and peptidases, such as carboxypepidases, dipeptidases and
aminopepidases, mixtures thereof and the like.
Also useful as actives in the present invention are silicones, or polysiloxanes", Silicones are
inorganic-organic polymers with the chemical formula [R.2SiO]n, where R= organic groups
such as methyl, ethyl, and phenyl. These materials consist of an inorganic silicon-oxygen
backbone (...-Si-O-Si-O-Si-O-...) with organic side groups attached to the silicon atoms,
which are four-coordinate. In some cases organic side groups can be used to link two or more
of these -Si-O- backbones together. Examples of silicone compounds suitable for use in the
instant invention include, but are not limited to, silicone oil, volatile and non volatile
silicones, linear and branched chain silicones, alone or in combination and may be selected
from the group comprising dimethicone copolyol, dimethylpolysiloxane, diethylpolysiloxane,
high molecular weight dimethicone, mixed C1-C30 alkyl polysiloxane, phenyl dimethicone,
dimethiconol, cyclopentasiloxane, dimethicone, dimethiconol, mixed C1-C30 alkyl
polysiloxane, and mixtures thereof.

Other useful active ingredients in the present invention are skin tightening agents. Non-
limiting examples of skin tightening agents which are useful in the compositions of the
present invention include monomers which can bind a polymer to the skin such as
terpolymers of vinylpyrrolidone, (meth) acrylic acid and a hydrophobic monomer comprised
of long chain alkyl (meth)acrylates, mixtures thereof, and the like.
Active ingredients in the present invention may also include vitamins. The vitamin used in
the composition of the present invention is selected from a group comprising vitamin A,
vitamin B (1-12), vitamin C, vitamin D (2-4), vitamin E, vitamin K, their derivatives, such as
acetates, propionates, palmitates, phosphates, alone on in combinations thereof.
Active ingredients in the present invention may also include anti-itch ingredients. Suitable
examples of anti-itch ingredients which are useful in the compositions of the present
invention include hydrocortisone, methdilizine and trimeprazine, mixtures thereof, and the
like.
A non-limiting example of an anti-glycation agent which is useful in the compositions of the
present invention would be Amadorine (available from Barnet Products Distributor), and the
like.
Essential oils for the present invention can be extracted from plants including, but not limited
to Citrus aurantium L. ssp. Bergamia, Citrus aruantium L. ssp. Amara, Betula lenta,
Melaleuca cajuputi, Daucus carota L., Cedrus atlantica, Matricaria chamomilla L.,
Anthemis nobilis L., Cinnamomum zeylanicum, Cymbopogon nardus L., Eugenia
caryophyllus, Citrus limonum L., Cymbopogon flexuosus, Origanum majorana L., Melissa
officinalis L., Citrus aurantium L., Melaleuca viridiflora quinquenervia, Myristica fragrans,
Citrus sinensis L., Origanum heracleoticum L., Coriandrum sativum L., Cymbopogon
martini, Cuminum cyminum L., Cupressus sempervirens L., Mentha piperita L., Santalum
austrocaledonicum, Zingiber officinale, Pogostemon cablin, Picea mariana, Boswellia
carteri, Melaleuca alternifolia, Pinus sylvestris L., Lavandula hybrid, Lavandula

angustifolia, Citrus paradisii, Eucalyptus citriodora, Gaultheria fragrantissima, Juniperus
communis L., Aniba rosaeodora, Eucalyptus radiate, Eucalyptus globules, Rosmarinus
officianlis L, Pimento officinalis , Nepeta cataria, Salvia sclarea, Anethum graveolens,
Juniperus communis and any combination thereof.
Various cosmetically and dermatologically suitable preservatives may be added to the instant
composition. These may be selected from the group consisting of but not restricted to 2-
phenoxyethanol, para-hydroxybenzoic acid esters, also known as parabens, for instance
methyl para-hydroxybenzoate (methyl paraben), ethyl para-hydroxybenzoate (ethyl paraben)
and propyl para-hydroxybenzoate (propyl paraben) and mixtures thereof; formaldehyde-
releasing agents, for instance imidazolidinylurea or diazolidinylurea; haloalkynyl carbamates,
for instance 3-iodo-2-propynyl butyl carbamate (IPBC); caprylyl glycol, also known as 1,2-
octanediol; ethylhexyl glycerin; sodium benzoate; N-(3-chloroallyl)-hexaminium chloride (or
Quaternium-15); polyhexamethylene biguanide hydrochloride (CTFA name:
polyaminopropyl biguanide); alkyltrimethylammonium bromides, for instance
dodecyltrimethylammonium bromide, myristyltrimethylammonium bromide and
hexadecyltrimethylammonium bromide, and mixtures thereof.
Free-radical scavengers and antioxidants which may be optionally added to the compositions
of the instant invention include but are not restricted to phosphonic acid derivatives such as
ethylenediaminetetra (methylenephosphonic acid), methylene phosphonic acid,
methylenephosphonic acid and salts thereof, in particular the sodium salts thereof;
ethylenediaminetetraacetic acid and its salts, such as the sodium salt; guanosine; superoxide
dismutase; tocopherol (vitamin E) and its derivatives (acetate); ethoxyquine; lactoferrin;
lactoperoxidase, and nitroxide derivatives; superoxide dismutases; glutathione peroxidase;
plant extracts with free-radical-scavenging activity, such as the aqueous extract of wheatgerm
(Detoxiline), green tea, and mixtures thereof.
The above invention is now being illustrated by way of non-limiting examples.

Example 1
Primary human dermal fibroblast cells were cultured in DMEM and FBS medium to 80%
confluency and then treated with gibberellic acid. The cells were harvested and RNA was
isolated and gene expression profile was noted using qPCR.
It was found that on treatment with gibberellic acid expression of sequence ID 3 increased by
262% translating to an increase in procollagen expression by 389% (Figure la).
It was found that on treatment with gibberellic acid expression of sequence ID 2 increased by
260% translating to an increase in procollagen expression by 389% ((Figure la).
It was found that on treatment with gibberellic acid expression of sequence ID 1 increased by
244% translating to an increase in procollagen expression by 389% ((Figure la).
Further, primary human dermal fibroblast were also subjected to oxidative stress and
subsequently treated with gibberellic acid. Figure lb represents reduction of intracellular
ROS species from 100% to 48.4%.
Example 2
Primary human dermal fibroblast cells were cultured in DMEM and FBS medium to 80%
confluency and then treated with mandelic acid. The cells were harvested and RNA was
isolated and gene expression profile was noted using qPCR.
It was found that on treatment with mandelic acid expression of sequence ID 2 increased by
303% translating to an increase in procollagen expression by 289% (Figure 2a).
It was found that on treatment with mandelic acid expression of sequence ID 3 increased by
233% translating to an increase in procollagen expression by 289% (Figure 2a).

It was found that on treatment with mandelic acid expression of sequence ID 1 increased by
230% translating to an increase in procollagen expression by 289% ((Figure 2a).
Further, primary human dermal fibroblast were also subjected to oxidative stress and
subsequently treated with mandelic acid. Figure 2b represents reduction of intracellular ROS
species from 100% to 48.4%.
Example 3
Primary human dermal fibroblast cells were cultured in DMEM and FBS medium to 80%
confluency and then treated with magniferin. The cells were harvested and RNA was isolated
and gene expression profile was noted using qPCR.
It was found that on treatment with magniferin expression of sequence ID 3 increased by
242% translating to an increase in procollagen expression by 230% (Figure 3a).
It was found that on treatment with magniferin expression of sequence ID 1 increased by
165% translating to an increase in procollagen expression by 230% (Figure 3a).
It was found that on treatment with magniferin expression of sequence ID 2 increased by
150% translating to an increase in procollagen expression by 230% ((Figure 3 a).
It was found that on treatment with magniferin expression of sequence ID 5 increased by
130% translating to an increase in procollagen expression by 230% ((Figure 3a).
Further, primary human dermal fibroblast were also subjected to oxidative stress and
subsequently treated with magniferin. Figure 3b represents reduction of intracellular ROS
species from 100% to 37.6%.

Example 4
Primary human dermal fibroblast cells were cultured in DMEM and FBS medium to 80%
confluency and then treated with adonitol. The cells were harvested and RNA was isolated
and gene expression profile was noted using qPCR.
It was found that on treatment with adonitol expression of sequence ID 3 increased by 242%
translating to an increase in procollagen expression by 212% (Figure 4a).
It was found that on treatment with adonitol expression of sequence ID 1 increased by 165%
translating to an increase in procollagen expression by 212% (Figure 4a).
It was found that on treatment with adonitol expression of sequence ID 2 increased by 150%
translating to an increase in procollagen expression by 212% ((Figure 4a).
Further, primary human dermal fibroblast were also subjected to oxidative stress and
subsequently treated with adonitol. Figure 4b represents reduction of intracellular ROS
species from 100% to 37.4%.
Example 5
Primary human dermal fibroblast cells were cultured in DMEM and FBS medium to 80%
confluency and then treated with Thr-Lys-Pro-Arg. The cells were harvested and RNA was
isolated and gene expression profile was noted using qPCR.
It was found that on treatment with Thr-Lys-Pro-Arg expression of sequence ID 2 increased
by 231% translating to an increase in procollagen expression by 243% (Figure 5).
It was found that on treatment with Thr-Lys-Pro-Arg expression of sequence ID 3 increased
by 223% translating to an increase in procollagen expression by 243% (Figure 5).
It was found that on treatment with Thr-Lys-Pro-Arg expression of sequence ID 1 increased
by 209% translating to an increase in procollagen expression by 243% ((Figure 5).

It was found that on treatment with Thr-Lys-Pro-Arg expression of sequence ID 5 increased
by 208% translating to an increase in procollagen expression by 243% ((Figure 5).
Example 6
Primary human dermal fibroblast cells were cultured in DMEM and FBS medium to 80%
confluency and then treated with methionine. The cells were harvested and RNA was isolated
and gene expression profile was noted using qPCR.
It was found that on treatment with methionine expression of sequence ID 1 increased by
204% translating to an increase in procollagen expression by 288% (Figure 6a).
It was found that on treatment with methionine expression of sequence ID 2 increased by
271% translating to an increase in procollagen expression by 288% (Figure 6a).
It was found that on treatment with methionine expression of sequence ID 4 increased by
296% translating to an increase in procollagen expression by 288% ((Figure 6a).
Further, primary human dermal fibroblast were also subjected to oxidative stress and
subsequently treated with methionine. Figure 6b represents reduction of intracellular ROS
species from 100% to 37.4%.
Example 7
Primary human dermal fibroblast cells were cultured in DMEM and FBS medium to 80%
confluency and then treated with chrysin. The cells were harvested and RNA was isolated
and gene expression profile was noted using qPCR.
It was found that on treatment with chrysin expression of sequence ID 3 increased by 309%
translating to an increase in procollagen expression by 211% (Figure 7a).

It was found that on treatment with chrysin expression of sequence ID 2 increased by 243%
translating to an increase in procollagen expression by 211% (Figure 7a).
It was found that on treatment with chrysin expression of sequence ID 1 increased by 188%
translating to an increase in procollagen expression by 211% ((Figure 7a).
Further, primary human dermal fibroblast were also subjected to oxidative stress and
subsequently treated with chrysin. Figure 7b represents reduction of intracellular ROS
species from 100% to 45.2%.
Example 8
Method for isolation of polynucleotide sequences which relate to dermal anti-ageing
Human primary fibroblasts were treated under predetermined conditions with anti-aging
agents such as curcumin, ascorbic acid, genistein, resveratrol and were assayed for collagen
content, which revealed a significant increase in collagen synthesis (up to 61%), when
compared to control. Subsequently, the mRNA was isolated and subjected to a DNA micro-
array analysis using a 44K human gene chip. Surprisingly, a set of genes sequences
(Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4, and Sequence ID 5) was
found to be differentially regulated as a result of the treatment given under predetermined
conditions. The expression of these genes was found to be increased. Based on gene
expression, a cut off was drawn to narrow down the hits to a few targets for dermal anti-
aging.
The results have been validated for increased gene expression and collagen increase related to
controlling dermal ageing with other novel active and/or composition such as Adonitol,
Pyrocatechol, Mandelic acid, Inosine, Inositol, gibberelllic acid, chrysin, N-acetyl-D-
mannosamine, p-aminohippuric acid, cycloserine harpagoside, esculin hydrate, vitamin K2,
Vitexin-2-O-rhamnoside, Doxazosin mesylate, azacytidine, yohimbine hydrochloride,
quipazine maleate, betulinic acid, magniferin, lycopodium and peptides. It was shown that

these actives both upregulated the genes of sequence IDs 1,2,3,4 and 5 and enhanced collagen
synthesis thereby controlling dermal ageing.
Example 9
The personal care composition comprises an active ingredient along with conventional
ingredients. The invention is now described by way of non limiting illustrative example. The
following personal care composition was prepared with active agent - gibberellic acid.

The cream composition contains 0.1% to 5% by weight of gibberellic acid. In vitro study
with 0.1% of gibberellic acid revealed about 2.6 fold increase in the expression of gene

bearing Sequence ID 3, about 2.6 fold increase in the expression of gene bearing Sequence
ID 2, 2.4 fold increase in the expression of gene bearing Sequence ID 1, which correlates
389% increase in procollagen as mentioned in Example 1.
Example 10
Screening Kit and Method for screening in accordance with the present invention
Novel actives that are relevant to dermal anti-ageing may be screened using the kit of the
present invention. The screening kit comprises primary human dermal fibroblast cells,
DMEM medium with 0.5-10% fetal bovine serum treated with active molecules; customized
array chip comprising sequences of Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence
ID 4, and Sequence ID 5; primers for Sequence ID1, Sequence ID 2, Sequence ID 3,
Sequence ID 4, and Sequence ID 5; RNA isolation and extraction reagents, Reverse
transcriptase and IX buffer, dT oligo primers, DNA Polymerase, dNTPs, Mg2+ solution,
fluorescence detection dye reagent. Primers for sequences are stated herewith.
Primer for Sequence I.D. 1 :A_24_P524562
(TCTGGACAATGCCAGCATTTGGAT,ACAGGAACAGCACAGAAGACAGAC),
Primer for Sequence I.D.2 :A_24_P33385
(ATGGCCTCAAGGGTCATGTGTTTG,TGCCATGGAAATTAATCAGGCAT),
Primer for Sequence I.D. 3 :A_24_P3 84200
(TGTTCCACACCAACAGAGGACCTA,TATGATGGCACACTGGGCTTGGAT)
Primer for Sequence I.D. 4:A_24_P298099
(TGCTCGGAAACGCTTGGTGATACA, CGTGACAAATGATACCTGTGTTGG) and
Primer for Sequence I.D. 5 :A_24_P272735
(AGAGTTTCTCCATGTTGAGGCTGCAAACGAGCTAGTCCGTACCAAGCA)

Human primary fibroblasts were treated with active(s) to be screened, at non cytotoxic
dosage, in vitro. Cells with enhanced collagen synthesis were harvested and mRNA was
isolated there from. This mRNA was converted to cDNA and hybridized with sequences of
Sequence ID 1, 2, 3, 4 and 5. Quantification of up-regulation of sequences of Sequence ID 1,
2, 3, 4 and 5 was done using fluorescent dye. The intensity of fluorescence signal revealed
potential anti-aging actives.

Documents

Orders

Section Controller Decision Date

Application Documents

# Name Date
1 Power of Authority.pdf 2011-10-06
2 Form-3.doc 2011-10-06
4 424-KOL-2011-FORM 1-1.1.pdf 2011-10-06
5 424-KOL-2011-CORRESPONDENCE.pdf 2011-10-06
6 424-KOL-2011--(28-03-2012)-FORM-5-1.pdf 2012-03-28
7 424-KOL-2011--(28-03-2012)-FORM-2.pdf 2012-03-28
8 424-KOL-2011--(28-03-2012)-DRAWINGS.pdf 2012-03-28
9 424-KOL-2011--(28-03-2012)-DESCRIPTION (COMPLETE).pdf 2012-03-28
10 424-KOL-2011--(28-03-2012)-CORRESPONDENCE.pdf 2012-03-28
11 424-KOL-2011--(28-03-2012)-ABSTRACT.pdf 2012-03-28
12 424-KOL-2011-(28-03-2012)-FORM-5.pdf 2012-03-28
13 424-KOL-2011-(28-03-2012)-FORM-13.pdf 2012-03-28
14 424-KOL-2011-(28-03-2012)-FORM-1.pdf 2012-03-28
15 424-KOL-2011-(28-03-2012)-CORRESPONDENCE.pdf 2012-03-28
16 424-KOL-2011-FORM-18.pdf 2012-04-24
17 424-KOL-2011-(17-02-2015)CORRESPONDENCE.pdf 2015-02-17
18 whole document.pdf 2015-07-21
19 424-KOL-2011-(15-04-2016)-CORRESPONDENCE.pdf 2016-04-15
20 424-KOL-2011-FER.pdf 2017-05-24
21 424-KOL-2011-OTHERS [23-11-2017(online)].pdf 2017-11-23
22 424-KOL-2011-FER_SER_REPLY [23-11-2017(online)].pdf 2017-11-23
23 424-KOL-2011-CLAIMS [23-11-2017(online)].pdf 2017-11-23
24 424-KOL-2011-HearingNoticeLetter.pdf 2019-02-12
25 424-KOL-2011-Written submissions and relevant documents (MANDATORY) [27-03-2019(online)].pdf 2019-03-27
26 424-KOL-2011-PatentCertificate28-03-2019.pdf 2019-03-28
27 424-KOL-2011-IntimationOfGrant28-03-2019.pdf 2019-03-28

Search Strategy

1 Search_22-05-2017.pdf

ERegister / Renewals