Sign In to Follow Application
View All Documents & Correspondence

"Nucleic Acid Based Detection Methods"

Abstract: "NUCLEIC ACID BASED DETECI ION METHODS" A process, sets of oligonucleotides and kits lor detecting disease and non-disease related conditions inclusive of but not limited to infections. drug resistance, mutations, genetic diseases, cancer and/or SNP variations in a sample are provided herein.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
04 January 2008
Publication Number
32/2009
Publication Type
INA
Invention Field
BIO-CHEMISTRY
Status
Email
Parent Application

Applicants

PREMAS BIOTECH PVT. LTD.
PLOT NO.77,SECTOR 4,IMT MANESAR, HARYANA,INDIA

Inventors

1. MEHROTRA, NUPUR
PLOT NO.77,SECTOR 4,IMT MANESAR, HARYANA,INDIA
2. KUNDU, PRABUDDHA KUMAR
PLOT NO.77,SECTOR 4,IMT MANESAR, HARYANA,INDIA
3. ARORA, KAJAL
PLOT NO.77,SECTOR 4,IMT MANESAR, HARYANA,INDIA
4. SONI, RAJEEV
PLOT NO.77,SECTOR 4,IMT MANESAR, HARYANA,INDIA

Claims

1. A process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reactions, said process comprising: (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of said set is complementary to a third oligonucleotide and a second oligonucleotide of said set is complementary to a fourth oligonucleotide; and a thermostable ligase; (b) subjecting said reaction mixture under isothermal conditions to obtain a first resultant reaction mixture thereby amplifying said target nucleic acid, wherein said isothemial conditions comprise of one cycle of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 10 minutes; and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes; and 8 to 25 cycles of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes: (c) subjecting said first resultant reaction mixture to the following isothermal conditions using said set of oligonucleotides, and said thermostable ligase to obtain a second resultant reaction mixture, wherein said isothermal conditions comprise 8-32 cycles of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes: and (d) detecting the amplified nucleic acid.

2. A process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reactions, said process comprising: (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of said set is complementary to a third oligonucleotide and a second oligonucleotide of said set is complementary to a fourth oligonucleotide; and thermostable ligase; (b) subjecting said reaction mixture under isothermal conditions to obtain a first resultant reaction mixture, wherein said isothemial conditions are one cycle of denaturation at 95°C for 10 minutes; and annealing and amplification at 65°C for 3 minutes; and 14 cycles of denaturation at 95°C for 1 minute and atmealing and amplification at GS^C for 1 minute; and (c) subjecting a part or whole of the said first resultant reaction mixture to following isothermal conditions using said set of oligonucleotides, and thermostable ligase to obtain a second resultant reaction mixture, wherein said isothermal conditions are 23 cycles at 95°C for 1 minute and 65°C for 1 minute; and (d) detecting the amplified nucleic acid

3. The process as claimed in claim 1 or 2, wherein step (c) optionally comprises passing said first resultant reaction mixture tlirough a purification column to obtain flowthrough and subjecting said flowthrough under said isothennal conditions to obtain a second resultant reaction mixture.

4. The process as claimed in claim 1 or 2, wherein a phosphate group is attached to the 5' end of said second and third oligonucleotides.

5. The process as claimed in claim 1 or 2, wherein the 3" end of said second and third oligonucleotides are optionally modified.

6. The process as claimed in claim 5. wherein said modification is carried out by adding a phosphate, deoxy. alkyl or aryl group at the 3' end.

7. The process as claimed in claim 5. wherein said modification is carried out by adding phosphate group at the 3" end.

8. The process as claimed in claim 1 or 2, wherein at least one oligonucleotide of said set of oligonucleotides is optionally attached to a probe selected from the group consisting of radioactive, colorimetric, enzymatic, fluorescent, chemiluminiscent, and photo-active probes.

9. The process as claimed in claim 1 or 2. wherein said process detects a target nucleic acid of disease or non-disease related conditions selected from the group consisting of infectious diseases, genetically transmitted diseases, cancer, SNP variations, mutations and drug resistance, and combinations thereof.

10. The process as claimed in claim 1 or 2. wherein said sample is of human, veterinary, plant or microorganism origin.

11. The process as claimed in claim 1 or 2, wherein said sample is selected from the group consisting of blood, sputum, tissue, saliva, cerebro-spinal fluid, pleural fluid, lymph, synovial fluid, semen, other body fluids, milk and other body secretions, urine, other body excretions, broncho-alveolar lavage and other washings from a subject.

12. The process as claimed in claim 1 or 2. wherein said sample is of plant origin.

13. The process as claimed in claim 9. wherein said cancer is prostate cancer.

14. The process as claimed in claim 10, wherein said micro-organism is selected from the group consisting of bacteria, viruses, fungi, archaea protozoans, and combinations thereof

15. The process as claimed in claim 10. wherein said micro-organism is selected from the group consisting of M. tuberculosis. M. hovis , M avium. Hepatitis A virus, Hepatitis B virus. Hepatitis C virus, Hepatitis D virus and Hepatitis E virus.

16. A set of oligonucleotides for detection of sequence specific regions that are implicated in susceptibility to prostate cancer in a sample, wherein the nucleotide sequence of said set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100. 17. A kit for detection of sequence specific regions that are implicated in susceptibility to prostate cancer, wherein said kit comprises the set of oligonucleotides as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97- 100.

Specification

TECHNICAL FIELD
The present invention relates to nucleic acid based detection method for detecting disease and non-disease related conditions inclusive of but not limited to infections, drug resistance, mutations, genetic diseases, cancer and/or SNP variations in a sample.
BACKGROUND OF THE INVENTION
In the last decade, molecular diagnostics have become mainstay in the field of clinical diagnostics. Nucleic acid amplification technology has opened new avenues of detection and characterization of diseases as they provide a rapid and accurate way of assessing deviations in the physiology and pathophysiology in a given population or during developmental stages. The molecular methods are becoming more popular due to their ease of performance, reproducibility, sensitivity and specificity of results obtained, low turn around time as compared to traditional methods.
Various methods of amplifying nucleic acid sequences for disease detection are known in the art. Techniques such as the polymerase chain reaction (PCR). the ligase chain reaction (LCR). reverse transcription polymerase chain reaction (RT-PCR), Self-Sustained Synthetic Reaction (3SR/NASBA). and Q.beta.-Replicase (Q.beta.) are finding increasing use in the clinical laboratories; PCR being the most commonly used technology cuirently.
Presently, the most practical and useful application of nucleic acid amplification tests (NAATs) is in detecting and identifying infectious agents where they supersede the routine growth-based culture and microscopy methods in terms of their ease of use and a low turn-around time. Apart from providing comparable and/or better confirmatory results in certain cases, the NAATs provide substantial time and cost saving over traditional culture methods by determining the presence/absence of a given pathogen in a clinical specimen. Certain NAATs also provide quantification of the pathogen thereby

producing more efficient results. These technologies vary among themselves in their sensitivity and specificity to provide an accurate diagnosis. There is an increased demand for tests which maintain very high positive predictive value (PPV) and negative predictive value (NPV) for detection of all microorganisms and give reproducible results.
Besides the advantages offered by NAATs as mentioned above, there is an increasing evidence in literature and from our own experience that the nucleic acid amplification may be inhibited in certain cases due to the quality of genomic DNA template (obtained by methods well known in the art) and various other reasons associated with the genomic DNA and/or reaction conditions, but not fully understood. A number of laboratories are reportedly engaged in research to eliminate this drawback and identify means to improve currently existing nucleic acid amplitlcation technologies [S. Chakravorty and J.S. Tyagi FEMS Microbiology letters 205 (2001). 113-117].
SUMMARY OF THE INVENTION
The present invention relates to a nucleic acid based detection method for the diagnosis of disease and non disease related conditions inclusive of but not limited to microorganisms, pathogens, mutations, cancer and/or single nucleotide polymorphism (SNP) variations in a sample.
One aspect of the present invention relates to a process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reactions, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and a thermostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture thereby amplifying the target nucleic acid, wherein the isothermal conditions

comprises one cycle of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 10 minutes; and annealing and amplification at a temperature ranging from about 55"C to 74°C for 30 seconds to 3 minutes; and 8 to 25 cycles of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes; (c) subjecting a part or whole of the first resultant reaction mixture to the following isothermal conditions using the set of oligonucleotides, and the thermostable ligase to obtain a second resultant reaction mixture, wherein the isothermal conditions comprise 8-32 cycles of denaturation at a temperature ranging from about 90''C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to lA^C for 30 seconds to 3 minutes; and (d) detecting the amplified nucleic acid.
Another aspect of the present invenfion relates to a process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reaction, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and thermostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture, wherein the isothermal conditions are one cycle of denaturation at 95°C for 10 minutes; and amiealing and amplification at 65°C for 3 minutes; and 14 cycles of denaturation at 95°C for 1 minute and annealing and amplification at 65°C for 1 minute; and (c) subjecting a part or whole of the first resultant reaction mixture to following isothermal conditions using the set of oligonucleotides, and thermostable ligase to obtain a second resultant reaction mixture, wherein the isothermal conditions are 23 cycles at 95°C for 1 minute and 65°C for 1 minute; and (d) detecting the amplified nucleic acid.

Yet another aspect of the present invention relates to a set of oligonucleotides for detection of sequence specific regions that are implicated in susceptibility to prostate cancer in a sample, wherein the nucleotide sequence of the set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
Yet another aspect of the present invention relates to a kit for detection of sequence specific regions that are implicated in susceptibility to prostate cancer, wherein said kit comprises the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
The present invention may be applicable, but not limited to the detection of diseases, mutations and/or SNP variations and can detect genomic DNA from a variety of samples obtained from any source.
The present invention provides a process that leads to an improved amplification signal and yields consistent and reproducible resuhs. Furthermore, the present invention helps in improving sensitivity, specificity, reproducibility of data and is capable of detecting very low titres of the target, as compared to currently used nucleic acid amplification processes.
BRIEF DESCRIPTION OF THE ACCOMPANYING DRAWING
Figure 1 shows gel photograph for dual isothermal nucleic acid amplification reaction (DINAR) using the oligonucleotide set 1 for detection of M. tuberculosis.
Figure 2 shows gel photograph for dual isothermal nucleic acid amplification reaction (DINAR) using the oligonucleotide set 17 for detection of M tuberxulosis.
Figure 3 shows gel photograph for dual isothermal nucleic acid amplification reaction (DINAR) for detection of prostate cancer.

DESCRIPTION OF THE INVENTION
The present invention relates to a nucleic acid based detection method for the identification of disease and non disease related conditions inclusive of but not limited to microorganisms, pathogens, mutations, cancer and/or single nucleotide polymorphism (SNP) variations in a sample.
The nucleic acid based detection method for the identification of infectious diseases, genetically transmitted diseases, cancer and/or SNP variations in samples is herein after also referred as Dual Isothermal Nucleic Acid Amplification Reaction (DINAR) in which two similar but separate reactions are performed wherein the product obtained from the first reaction is used as a template for the second reaction. The product from the first reaction may or may not have undergone suitable processing by passing through a purification column. DINAR has an advantage over standard ligase chain reaction as the latter has been known to give non-reproducible results coupled with poor amplification signals.
Another embodiment of the present invention provides method of detection of target nucleic acid, said method comprising providing sample for detection: providing oligonucleotide sequences specific for the target nucleic acid: performing the first isothermal nucleic acid amplification reaction under suitable conditions for appropriate number of cycles; performing the second isothermal nucleic acid amplification reaction using the product of the first reaction as such or after suitable processing and using said oligonucleotides under suitable conditions for appropriate number of cycles and detecting the presence of amplified nucleic acid. The reaction product may be analyzed using various modes, but not limited to one of the following namely, agarose gel electrophoresis, solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase

chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection, solid phase using radioactive detection.
The method described in the present invention for nucleic acid detection by amplification of the target nucleic acid in the sample (if present), leads to the enhancement of amplification signal by overcoming inhibition due to genomic DNA, other reaction constituents or reaction conditions. The method is also highly sensitive in eliminating the problem of non specific amplification that leads to false-positives.
Another embodiment of the present invention provides a nucleic acid based detection method (DINAR) that is highly sensitive, specific, easy to use, capable of detecting very low titers, as exemplified by detection of upto 1.6 genomic equivalents of M tuberculosis genomic DNA that corresponds to 8fg and significantly lower than attomole quantities of the nucleic acid present and yields consistent and reproducible results. The genomic DNA used can be extracted from the sample by using methods well known in the art.
Yet another embodiment of the present invention provides DINAR for the detection of target nucleic acid of disease or non-disease related conditions inclusive but not limited to infectious diseases, genetically transmitted diseases, cancer and/or SNP variations in samples of human, veterinary and/or plant origin, wherein the sample may be selected from a group consisting of blood, sputum, tissues, saliva, cerebro-spinal fluid, pleural fluid, lymph, synovial fluid, semen and other body tluids, milk and other body secretions, urine and other body excretions, bronchoalveolar lavage and other washings from a subject and plant extracts.
Yet another embodiment of the present invention provides a method for detection of a target nucleic acid oi an organism, wherein the said organism is selected from a group consisting of bacteria, mammals, plants, viruses, fungi, parasites and protozoans.

Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria includes M. tuberculosis, M. bovis and M. avium.
Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria includes Mycobacterium species that include M. tuberculosis and/or M bovis.
Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is Mycobacterium tuberculosis.
Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is Mycobacterium bovis.
Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is Mycobacterium avium.
Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is M. avium subsp. paratuberculosis KIO.
Another embodiment of the present invention provides a method for detection of a target nucleic acid of bacteria, wherein said bacteria is M. avium 104.
Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said vims includes Hepatitis A vims. Hepatitis B virus. Hepatitis C virus. Hepatitis D vims and/or Hepatitis E virus.
Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said virus includes Hepatitis B and Hepatitis C vims.

Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said virus is Hepatitis B virus.
Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of viruses, wherein said virus is Hepatitis C virus.
Yet another embodiment of the present invention provides a method for detection of sequence specific regions that are implicated in susceptibility to prostate cancer.
Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of mammals, wherein said mammals can be humans and/or animals.
Yet another embodiment of the present invention provides a method for detection of a target nucleic acid of plant species.
Another embodiment of the present invention provides a method of detection of nucleic acid in a sample, wherein the method is useful for detecting mutations in a sample, wherein the mutation may be mutation resulting in drug resistance.
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 1 as set forth in SEQ ID NO: 2-5 is designed from nucleotide position 62716-62765 (SEQ ID NO: 1) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region: 1
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 2 as set forth in SEQ ID NO: 7-10 is designed from nucleotide position 85252-85301 (SEQ ID NO: 6) of the DNA sequence of Mycohacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis. This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region: 2
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 3 as set forth in SEQ ID NO: 12-15 is designed from nucleotide position 82712-82761 (SEQ ID NO: 11) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region: 3
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 4 as set forth in SEQ ID NO: 17-20 is designed from nucleotide position 2041-2088 (SEQ ID NO: 16) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region 4:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 5 as set forth in SEQ ID NO: 22-25 is designed from nucleotide position 79850 to 79897 (SEQ ID NO: 21) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region 5:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 6 as set forth in SEQ ID NO: 27-30 is designed from nucleotide position 4206202-4206249 (SEQ ID NO: 26) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region 6:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 7 as set forth in SEQ ID NO: 32-35 is designed from nucleotide position 4203720-4203769 (SEQ ID NO: 31) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region 7:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 8 as set forth in SEQ ID NO: 37-40 is designed from nucleotide position 3002631-3002680 (SEQ

ID NO: 36) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region 8:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 9 as set forth in SEQ ID NO: 42-45 is designed from nucleotide position 50070 to 50119 (SEQ ID NO: 41) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis. Mycobacterium bovis and Mycobacterium avium paratuberculosis K10 and Mycobacterium avium 104.
Region: 9
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 10 as set forth in SEQ ID NO: 47-50 is designed from nucleotide position 20679 to 20720 (SEQ ID NO: 46) of the DNA sequence of Mycobacterium avium104 (Accession

number CP000479). This region is specific to detect Mycobacterium avium 104 and Mycobacterium avium paratuberculosis KIO.
Region 10: SEQ ID NO: 46
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 11 as set forth in SEQ ID NO: 52-55 is designed from nucleotide position 2152482 to 2152432 nucleotide (SEQ ID NO: 51) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect drug resistance against Isoniazid due to mutation in Kat G gene of Mycobacterium tuberculosis, Mycobacterium bovis. In case of absence of drug resistance the wild type KAT G gene has Serine (S) at position 315.
Region 11W:
(Sequence Removed)
In this case of drug resistance, there is a mutation in KAT G gene at position 315 where Serine is changed to Threonine (S-> T). Thus this mutation can be detected using the oligonucleotide set (SEQ ID NO: 57-60).
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 12 as set forth in SEQ ID NO: 62-65 is designed from nucleotide position designed from 242 to 284 nucleotide (SEQ ID NO: 61) of the DNA sequence of hepatitis B virus (Accession number NC_003977). This region is specific to detect Hepatitis B Virus.
Region 12:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 13 as set forth in SEQ ID NO: 67-70 is designed from nucleotide position from 672 to 717 nucleotide (SEQ ID NO: 66) of the DNA sequence of hepatitis B virus (Accession number NC_003977), This region is specific to detect Hepatitis B Virus
Region 13:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 14 as set forth in SEQ ID NO: 72-75 is designed from nucleotide position 48-106 nucleotide (SEQ ID NO: 71) of the DNA sequence of hepatitis C virus (Accession number NC_004102). This region is specific to detect Hepatitis C Virus.
Region 14:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 15 as set forth in SEQ ID NO: 77-82 is designed from nucleotide position 127-176 nucleotide (SEQ ID NO: 76) of the DNA sequence of hepatitis C vims (Accession number NC_004I02). This region is specific to detect Hepatitis C Virus.
Region 15:
(Sequence Removed)
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 16 as set forth in

SEQ ID NO: 82-85 is designed from nucleotide position 204-261 nucleotide (SEQ ID NO: 81) of the DNA sequence of hepatitis C virus (Accession number NC_004102). This region is specific to detect Hepatitis C Virus.
Region 16:
(Sequence Removed)
Another embodiment of the present invention provides a diagnostic kit for
detecting presence of nucleic acid in samples associated with infectious
diseases caused by microorganisms, genetically transmitted diseases, cancer
and/or SNP variations.
In an embodiment, the present invention provides oligonucleotides useful for detection of nucleic acid, wherein the oligonucleotide set 17 as set forth in SEQ ID NO: 87-90 is designed from nucleotide position 484256 to 484207 (SEQ ID NO: 86) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516).
Region 17:
(Sequence Removed)
A phosphate group was attached to the 5" end of the oligonucleotides as set forth in SEQ ID NO: 88 and SEQ ID NO: 89.

The oligonucleotide set as set forth in SEQ ID NO: 87-90 was tested with sputum, blood, ascitic fluid, bronchial washing samples, pleural fluid, urine, semen, tissue samples, milk, serum and pure culture of Mycobacterium species.
In an embodiment, the present invention provides oligonucleotides useful for detection of sequence specific regions that are implicated in susceptibility to prostate cancer (oligonucleotide set 18 and set 19) having nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
The oligonucleotide set 18 as set forth in SEQ ID NO: 92-95 is designed to include the INDEll region in the MSRl gene that corresponds to nucleotide position -14458bp (SEQ ID NO: 91) of the DNA sequence of Homo sapiens chromosome 8 (Accession number NT_030737). This region is specific to detect presence of marker INDELl which is an MSRl sequence variant and maybe implicated in association with prostate cancer risk.
Region 18:
(Sequence Removed)
In this case, a 15 base pair sequence INDELl is present in the gene MSRl. The insertion of INDELl can be detected using the oligonucleotide set (SEQ ID NO: 92-95).
The oligonucleotide set 19 as set forth in SEQ ID NO: 97-100 is designed by deleting the INDELl region in the MSRl gene that corresponds to nucleotide position -14458bp (SEQ ID NO: 96) of the DNA sequence of Homo sapiens chromosome 8 (Accession number NT 030737). This region is specific to

detect the absence of marker INDHLl which is an MSRl sequence variant and maybe implicated in association with prostate cancer risk.
Region 19:
(Sequence Removed)
In this case, the 15 base pair sequence INDELl is deleted in the gene MSRl. This mutation by deletion can be detected using the oligonucleotide set (SEQ ID NO: 97-100).
A phosphate group was attached to the 5" end of the oligonucleotides as set forth in SEQ ID NO: 98 and SEQ ID NO: 99.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for detection of an organism, wherein the organism is selected from a group comprising of bacteria, mammals, plants, viruses, fungi, protozoa and parasites.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide set or primers used interchangeably herein, wherein the oligonucleotide set comprises at least four oligonucleotides, wherein the oligonucleotides having size ranging from 15-50 bp. The four oligonucleotides are designated as A. B. G. D. wherein first oligonucleotide
(A) is complementary to third oligonucleotide (G) and second oligonucleotide
(B) is complementary to fourth oligonucleotide (D). The second and third oligonucleotide (B and G) has a phosphate group attached to the 5' end. The 3' end of the second and third oligonucleotide {B and G) is optionally modified. The second and third oligonucleotide (B and G) of each oligonucleotide set disclosed in the present invention are modified by adding phosphate group at

the 3' end. The modification may be carried out by adding phosphate, deoxy. alkyl or aryl group at the 3' end.
One embodiment relates to a probe that can be optionally attached to any of the four (A, B, C and D) oligonucleotides in each set wherein the probe is selected from a group consisting of radioactive, colorimetric, enzymatic, fluorescent, chemiluminiscent, and photo-active probe.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium species that include M. tuberculosis, M. avium and/or M bovis.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium species that include M. tuberculosis and/or M bovis.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium tuberculosis.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium bovis.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Mycobacterium avium.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of M. avium subsp. paratuberculosis K10.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of M. avium 104.

Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis virus that include Hepathis A virus. Hepatitis B virus. Hepatitis C virus. Hepatitis D virus and Hepatitis E virus.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis B virus and/or Hepatitis C virus.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis B virus.
Another embodiment of the present invention provides a diagnostic kit comprising oligonucleotide sequences useful for nucleic acid detection of Hepatitis C vims.
Another embodiment of the present invention relates to a kit for detection of sequence specific regions that are implicated in susceptibility to prostate cancer.
In accordance with the present invention, one embodiment provides a process for detecting a target nucleic acid in a sample using dual isothemial nucleic acid amplification reactions, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleodde of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and a thermostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture thereby amplifying said target nucleic acid, wherein the isothermal conditions comprises one cycle of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 10 minutes; and annealing and amplification at a temperature ranging from about 55°C to 74"C for 30

seconds to 3 minutes; and 8 to 25 cycles of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to 74''C for 30 seconds to 3 minutes; (c) subjecting a part or whole of the first resultant reaction mixture to the following isothennal conditions using the set of oligonucleotides, and said thennostable ligase to obtain a second resultant reaction mixture, wherein the isothermal conditions comprise 8-32 cycles of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes; and (d) detecting the amplified nucleic acid.
Another embodiment of the present invention provides a process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reaction, the process comprises (a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of the set is complementary to a third oligonucleotide and a second oligonucleotide of the set is complementary to a fourth oligonucleotide; and thennostable ligase; (b) subjecting the reaction mixture under isothermal conditions to obtain a first resultant reaction mixture, wherein the isothermal conditions are one cycle of denaturation at 95°C for 10 minutes; and annealing and amplification at 65°C for 3 minutes; and 14 cycles of denaturation at 95^' for 1 minute and annealing and amplification at 65°C for 1 minute; and (c) subjecting a part or whole of the first resultant reaction mixture to following isothennal conditions using the set of oligonucleotides, and thermostable ligase to obtain a second resultant reaction mixture, wherein the isothermal conditions are 23 cycles at 95°C for 1 minute and 65°C for 1 minute; and (d) detecting the amplified nucleic acid.

The process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reaction as disclosed in the present invention, wherein step (c) optionally comprises passing the first resultant reaction mixture through a purification column to obtain flowthrough and subjecting a part or whole of the flowthrough under the isothermal conditions to obtain a second resultant reaction mixture.
One embodiment of the present invention provides set of oligonucleotides, wherein a phosphate group is attached to the 5' end of the second and third oligonucleotides.
Another embodiment of the present invention provides a set of oligonucleotides, wherein the 3' end of the second and third oligonucleotides are optionally modified.
Another embodiment of the present invention provides a set of oligonucleotides, wherein the 3" end of the second and third oligonucleotides are optionally modified, wherein the modification is carried out by adding a phosphate, deoxy, alkyl or aryl group at the 3* end.
Another embodiment of the present invention provides a set of oligonucleotides, wherein the 3" end of the second and third oligonucleotides are optionally modified, wherein the modification is carried out by adding phosphate group at the 3' end.
Another embodiment of the present invention provides a set of oligonucleotides, wherein at least one oligonucleotide of the set of oligonucleotides is optionally attached to a probe selected from the group consisting of radioactive, colorimetric, enzymatic, fluorescent, chemiluminiscent. and photo-active probes.
The process for detecting a target nucleic acid in a sample using dual isothermal nucleic acid amplification reaction as disclosed in the present invention, wherein the process detects a target nucleic acid of disease or non-

disease related conditions selected from the group consisting of infectious diseases, genetically transmitted diseases, cancer, SNP variations, mutations and drug resistance, and combinations thereof.
One embodiment of the present invention provides the sample of human, veterinary, plant or microorganism origin.
Another embodiment of the present invention provides the sample selected from the group consisting of blood, sputum, tissue, saliva, cerebro-spinal fluid, pleural fluid, lymph, synovial fluid, semen, other body fluids, milk and other body secretions, urine, other body excretions, broncho-alveolar lavage and other washings from a subject.
Another embodiment of the present invention provides the sample of plant origin.
One embodiment of the present invention relates to micro-organism selected from the group consisting of bacteria, viruses, fungi, arachea, protozoans, and combinations thereof.
Yet another embodiment of the present invention relates to micro-organisms, wherein the said micro-organism is selected from the group consisting of M tuberculosis. M. bovis. M. avium. Hepatitis A vims. Hepatitis B virus. Hepatitis C virus. Hepatitis D virus and Hepatitis E virus.
In one embodiment of the present invention there is provided a set of oligonucleotides for detection of Mycobacterium nucleic acid in a sample, wherein the nucleotide sequence of said set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in
(Sequence Removed)
wherein Mycobacterium is selected from the group consisting of Mycobacterium tuberculosis. M. avium and M. bovis.

In another embodiment of the present invention there is provided a set of oligonucleotides for detection of nucleic acid of Mycobacterium in a sample, wherein said set of oligonucleotides is selected from the group consisting of nucleotide sequence as set forth in SEQ ID NO: 42-45 and SEQ ID NO: 47-50. wherein Mycobacterium is selected from the group consisting of Mycobacterium aviumparatuberculosis KIO and Mycobacterium avium 104.
In another embodiment of the present invention there is provided a set of oligonucleotides for detection oi^ nucleic acid of Mycobacterium tuberculosis nucleic acid in a sample, wherein said set of oligonucleotides is selected from the group consisting of nucleotide sequence as set forth in
(Sequence Removed)
In yet another embodiment of the present invention there is provided a set of oligonucleotides for detection of nucleic acid of Mycobacterium bovis in a sample, wherein said set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in
(Sequence Removed)
In yet another embodiment of the present invention there is provided a set of oligonucleotides for nucleic acid detection oi Mycobacterium tuberculosis and Mycobacterium bovis in a sample, wherein the nucleotide sequence of said set of oligonucleotides is as set forth in
(Sequence Removed)
In yet another embodiment of the present invention there is provided a set of oligonucleotides for nucleic acid detection of Hepatitis virus in a sample.

wherein the nucleotide sequence of said set of oligonucleotides is as set forth in SEQ ID NO: 62-65, SEQ ID NO: 67-70, SEQ ID NO: 72-75, SEQ ID NO: 77-80 or SEQ ID NO: 82-85. said Hepatitis virus being selected from the group consisting of Hepathis B and C virus.
In yet another embodiment of the present invention there is provided a set of oligonucleotides for nucleic acid detection of Hepatitis B virus in a sample, wherein the nucleotide sequence of said set of oligonucleotides is as set forth in SEQ ID NO: 62-65 or SEQ ID NO: 67-70.
In yet another embodiment of the present invention there is provided a set of oligonucleotides for nucleic acid detection of Hepatitis C virus in a sample, wherein the nucleotide sequence of said set of oligonucleotides is as set forth in SEQ ID NO: 72-75, SEQ ID NO: 77-80 or SEQ ID NO: 82-85.
In still yet another embodiment of the present invention there is provided a set of oligonucleotides for detection of sequence specific regions implicated in the susceptibility to prostate cancer in a sample, wherein the nucleotide sequence of said set of oligonucleotides is selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of a Mycobacterium species in a sample, wherein said kit comprises the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in
(Sequence Removed)
wherein the Mycobacterium is selected from the group consisting of A/vcoZ)ac/'mMW tuberculosis. M avium and M. bovis.
Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of a Mycobacterium species in a sample, wherein said kit comprises the set of oligonucleotides selected from the group consisting of

nucleotide sequence as set forth in SEQ ID NO: 42-45 and SEQ ID NO: 47-50, wherein the Mycobacterium is selected from the group consisting of Mycobacterium avium paratubercitlosis K10 and Mycobacterium avium 104.
Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of Mycobacterium tuberculosis in a sample, wherein said kit comprises the set of oligonucleotides selected from the group consisting of nucleotide sequence as set forth in
(Sequence Removed)
Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of Mycobacterium bovis, in a sample, wherein the kit comprises the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in
(Sequence Removed)
Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of Mycobacterium tuberculosis and Mycobacterium bovis in a sample, wherein said kit comprises the set of oligonucleotides is as set forth in (Sequence Removed)

Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of a Hepatitis virus, wherein said kit comprises the set of oligonucleotides is as set forth in
(Sequence Removed)
wherein the Hepatitis virus being selected from the group consisting of Hepatitis B and C virus.

Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of Hepatitis B virus, wherein said kit comprises the set of oligonucleotides is as set forth in SEQ ID NO: 62-65 or SEQ ID NO: 67-70.
Yet another embodiment of the present invention relates to a kit for detection of a nucleic acid of Hepatitis C virus, wherein said kit comprises the set of oligonucleotides is as set forth in SEQ ID NO: 72-75, SEQ ID NO: 77-80 or SEQ ID NO: 82-85.
Yet another embodiment of the present invention relates to a kit for detection of sequence specific regions that are implicated in susceptibility to prostate cancer, wherein said kit comprises the set of oligonucleotides selected from the group consisting of the nucleotide sequence as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-100.
An embodiment of the present invention is to provide a kit containing all the necessary reagents to perform the methods of detection disclosed herein. Ihe kit may contain specific oligonucleotide sequence sets optionally attached to a label, a suitable buffer and a thermostable ligase. The kit may further contain a set of printed instructions indicating that the kit is useful for detection of the specific disease and/or non disease related conditions as disclosed in the present invention.
EXAMPLES
It should be understood that the following examples described herein are for illustrative purposes only and that various modifications or changes in light will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and the scope of the appended claims.
Example 1
Dual isothermal nucleic acid amplification reaction (DINAR) for detecting Mycobacterium DNA using oligonucleotide set (Set 1)

The oligonucleotide set (Set 1) having nucleotide sequence as set forth in SEQ ID NO: 2- 5 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 62716-62765 (SEQ ID NO: 1) of the DNA sequence oi Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region 1:
(Sequence Removed)
A phosphate group was attached to the 5" end of the oligonucleotides as set forth in SEQ ID NO: 3 and SEQ ID NO: 4.
The oligonucleotide set as set forth in SEQ ID NO: 2-5 was tested with blood, milk, sputum, pleural effusion, urine, stool, lung tissue, cotyledons, semen, ascitic fluid, bronchial washing samples and pure culture of Mycobacterium species.
The DINAR for detecting Mycobacterium DNA was performed in two steps as given below.
STEPl
The isothermal nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 2-5 for detection of Mycobacterium DNA in samples. The total volume of the reaction mixture was 20 |.il. The tinal concentration of the components of the reaction mixture was 2 \x\ buffer (lOX). 1 |.il Themiostable ligase (5U/|il). I Hl each of oUgonucleotides lA. IB, IC and ID (SEQ ID NO: 2-5) at

concentration 2.5ng each, lOOng of template DNA and ultrapure water to bring the reaction volume to 20 \x\. The cycling reaction employed is as follows: first cycle at 95°C for 10 niin and 60''C for 3 min followed by 14 cycles at 95''C for 1 min and 60"C for 1 min. Various samples and controls were used for detection of Mycobacterium DNA. The description of the different reactions (reactions 1-7) used as template DNA is given below.
Reaction 1: NC-Negative control- no template DNA in the reaction mixture
Reaction 2: HGD-Negative control- template DNA from healthy subject (not
infected TB patient)
Reaction 3: PCI-Positive control- 3.2 Kb plasmid (pPBPCl) with 250 bp from
the region of 62716-62765 of Mycobacterium genome having accession
number AE000516
Reaction 4: SS-template DNA from sputum sample of confirmed
Mycobacterium infected patient
Reaction 5: S9- template DNA from sputum sample of suspected
Mycobacterium infected patient
Reaction 6: SIO- template DNA from sputum sample of suspected
Mycobacterium infected patient
Reaction 7: Sll- template DNA from sputum sample of suspected
Mycobacterium infected patient
After completion of 15 cycles of reaction in the thermocycler. the resultant reaction mixture was processed through a purification column and the flow through obtained was used as a template for the second isothermal nucleic acid amplification reaction.
STEP 2
In the second step, isothermal nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO: 2-5). The reaction mixture used for performing the second isothermal nucleic acid amplification reaction was 8 |.il of the flow through obtained by

processing the final reaction mixture of reactions 1 -7 of step 1. 2 µl buffer (10X), 1 µ1 Thermostable ligase (5U/ µl). 1µl each of oligonucleotides lA, 1B, IC and ID (SEQ ID NO: 2-5) at concentration 2.5ng each and ultrapure water to bring the reaction volume to 20 µl. The cycling reaction was carried out as follows: 23 cycles 95°C for 1 min and 60°C for 1 min.
After completion of the 23 cycles of reaction in the thermocycler, the entire reaction mixture of reactions 1-7 was electrophoresed on a 2.5% agarose gel at 100V for 45 min and the DNA products were identified using methods known in the art. The gel picture was captured on a gel documentation system as shown in Figure 1.
The amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.
The results (Figure 1) indicate that there was no non-specific amplification of 50 bp fragment observed in the reaction 1 marked as lane NC (negative control sample) and reaction 2 marked as lane HGD (template DNA from healthy subject). A fragment of 25bp was obtained in reaction 1 and 2 and these correspond to primer annealing as expected. There was amplification of 50 bp fragment observed in reaction 3 marked as lane PCI (positive control) and the reacfion 4 marked as lane S8 (sample containing Mycobacterium DNA). Amplification of 50 bp fragment was observed in reactions 5-7 marked as lane S9-S11 confirming presence of Mycobacterium DNA in the suspected patients. This clearly indicates that the primer set having nucleotide sequence as set forth in SEQ ID: 2-5 are useful in the detection of Mycobacterium

infection. DINAR assay employing primer set having nucleotide sequence as set forth in SEQ ID NO: 2-5 is sensitive and easy to use for the detection of Mycobacterium infection in patients.
Further experiments were conducted and it was observed that the primer set SEQ ID NO: 2-5 detect DNA of Mycobacterium tuberculosis and Mycobacterium bovis but not Mycobacterium avium strain.
Other reaction conditions employed for the above described process employed aimealing and ligation temperatures varying from 55°C to 74° C for duration of 1 min and using different primer sets. The results obtained were similar as for the above described reaction set up. Other primer sets were tested with the same set of samples with similar results. The enzyme concentration for thermostable ligase was varied from 1-10 units with consistent and reproducible results.
The results obtained above have also been corroborated by MTb culture on LJ media and PCR using 1S6110 region.
A) Culture method: The decontaminated samples were inoculated on Lowenstein-Jensen slants and 7M9 Middiebrook's Hquid media for growth and incubated at 37°C for 3-4 weeks. Growth of MTB colonies was evident in all cases.
B) PCR method: Reference (Ogusku. Mauricio Analise de diferen tMeso prriismhie,r est ault.ilizados na PCR visando ao diagnostico da tuberculose no Estado do Amazonas in Jomal Brasileiro de Pneumologia 30(4) - Jul/Ago de 2004). primers for amplifying 541bp region in 1S6110 gene were used.
Example 2
Dual isothermal nucleic acid amplification reaction (DINAR) for
detecting Mycobacterium DNA using oligonucleotide set (Set 1)

The oligonucleotide set (Set 1) as provided in example 1 was used for the detection of Mycobacterium tuberculosis. The DINAR for detecting Mycobacterium DNA was performed in two steps as given below.
STEP 1
The isothemial nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 2-5 for detection of Mycobacterium DNA in samples. The total volume of the reaction mixture was 20 µl. The final concentration of the components of the reaction mixture was 2 µl buffer (10X), 1 µl Thermostable ligase (5U/fil), 1 µl each of oligonucleotides lA. IB. IC and ID (SEQ ID NO: 2-5) at concentration 2.5ng each, l00ng of template DNA and ultrapure water to bring the reaction volume to 20 µl. The cycling reaction employed is as follows: first cycle at 95°C for 10 min and 60°C for 3 min followed by 14 cycles at 95°C for 1 min and 60''C for 1 min. Various samples and controls were used for detection of Mycobacterium DNA. The description of the different reactions (reactions 1 -7) used as template DNA is given below.
Reaction 1: NC-Negative control- no template DNA in the reaction mixture
Reaction 2: HGD-Negative control- template DNA from healthy subject (not
infected TB patient)
Reaction 3: PCI-Positive control- 3.2 Kb plasmid (pPBPCl) with 250 bp from
the region of 62716-62765 of Mycobacterium genome having accession
number AE000516
Reaction 4: SS-template DNA from sputum sample of confimied
Mycobacterium infected patient
Reaction 5: S9- template DNA from sputum sample of suspected
Mycobacterium infected patient
Reaction 6: SIO- template DNA from sputum sample of suspected
Mycobacterium infected patient

Reaction 7: SU- template DNA from sputum sample of suspected Mycobacterium infected patient
After completion of 15 cycles of reaction in the thermocycler, the resultant reaction mixture was used as a template for the second isothermal nucleic acid amplification reaction without any processing.
STEP 2
In the second step, isothermal nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO: 2-5). The reaction mixture used for perfonning the second isothermal nucleic acid amplification reaction was 8 µl of the final reaction mixture of reactions 1-7 obtained from resulting reaction mixture (non-processed) of step 1, 2 µl buffer (10X), 1 µL Thermostable ligase (5U/ µl), µl each of oligonucleotides lA, 1B, IC and ID (SEQ ID NO: 2-5) at concentrafion 2.5ng each and ultrapure water to bring the reaction volume to 20 µl. The cycling reaction was carried out as follows: 23 cycles 95°C for 1 min and 60°C for 1 min.
After completion of the 23 cycles of reaction in the thermocycler, the entire reaction mixture of reactions 1-7 was electrophoresed on a 2.5% agarose gel at l00V for 45 min and the DNA products were identified using methods known in the art. The gel picture was captured on a gel documentation system.
The amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles. solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.

The results indicate that there was no non-specific amplification of 50 bp fragment observed in the reaction 1 marked as lane NC (negative control sample) and reaction 2 marked as lane HGD (template DNA from healthy subject). A fragment of 25bp was obtained in reaction 1 and 2 and these correspond to primer annealing as expected. There was amplification of 50 bp fragment observed in reaction 3 marked as lane PCI (posifive control) and the reaction 4 marked as lane S8 (sample containing Mycobacterium DNA). Amplification of 50 bp fragment was observed in reactions 5-7 marked as lane S9-S11 confirming presence of Mycobacterium DNA in the suspected patients. This clearly indicates that the primer set having nucleotide sequence as set forth in SEQ ID: 2-5 are useful in the detection of Mycobacterium infection. DINAR assay employing primer set having nucleotide sequence as set forth in SEQ ID NO: 2-5 is sensitive and easy to use for the detection of Mycobacterium infection in patients.
Further experiments were conducted and it was observed that the primer set SEQ ID NO: 2-5 detect DNA of Mycobacterium tuberculosis and Mycobacterium bovis but not Mycobacterium avium strain.
Other reaction conditions employed for the above described process employed armealing and ligation temperatures varying from 60° to 74° C for duration of 1 min and using different primer sets. The results obtained were similar as for the above described reaction set up. Other primer sets were tested with the same set of samples with similar results. The enzyme concentration for thermostable ligase was varied from 1-10 units with consistent and reproducible results.
The results obtained above have also been corroborated by MTb culture on LJ media and PCR using IS6110 region.
A) Culture method: The decontaminated samples were inoculated on Lowenstein-Jensen slants and 7H9 Middlebrook's liquid media for growth and

incubated at 37°C for 3-4weeks. Growth of MTB colonies was evident in all cases.
B) PCR method: Reference (Ogusku. Mauricio Analise de diferen tMeso prriismhie,r est ault.ilizados na PCR visando ao diagnostico da tuberculose no Estado do Amazonas in Jomal Brasileiro de Pneumologia 30(4) - Jul/Ago de 2004). primers for amplifying 541bp region in IS6110 gene were used.
Example 3
Dual isothermal nucleic acid ampUHcation reaction (DINAR) for detecting Mycobacterium DNA using oligonucleotide Set 2 (SEQ ID NO: 7-10)
The oligonucleotide set (Set 2) having nucleotide sequence as set forth in SEQ ID NO: 7- 10 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 85252-85301 (SEQ ID NO: 6) of the DNA sequence of Mycobacterium tuherculosis CDC1551 (Accession number AK000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis. This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region: 2
(Sequence Removed)
A phosphate group was attached to the 5" end of the oligonucleotides as set forth in SEQ ID NO: 8 and SEQ ID NO: 9. The oligonucleotides as set forth in SEQ ID NO: 8 and SEQ ID NO: 9 were modified at 3" end by adding phosphate group.

The DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example \. The amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID; 7-10 are useful in the detection of Mycobacterium infection.
Example 4
Dual isothermal nucleic acid amplification reaction (DINAR) for detecting Mycobacterium DNA using oligonucleotide Set 2 (SEQ ID NO:
7-10)
The oligonucleotide set (Set 2) as provided in example 3 was used in the detection of Mycobacterium tuberculosis and Mycobacterium bovis. The DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 2. The amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 2. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 7-10 are useful in the detection of Mycobacterium infection.
Example 5
Dual isothermal nucleic acid amplification reaction (DINAR) for detecting Mycobacterium DNA using oligonucleotide Set 3 (SEQ ID NO: 12-15)
The oligonucleotide sequences (Set 3) having nucleotide sequence as set forth in SEQ ID NO: 12-15 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 82712-82761 (SEQ ID NO: 11) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.

Region: 3
(Sequence Removed)
A phosphate group was attached to the 5" end of the oligonucleotides as set forth in SEQ ID NO: 13 and SEQ ID NO: 14. The oligonucleotides as set forth in SEQ ID NO: 13 and SEQ ID NO: 14 were modified at 3' end by adding phosphate group.
The oligonucleotide set as set forth in SEQ ID NO: 12-15 was tested with blood, milk, sputum, pleural effusion, urine, stool, lung tissue, cotyledons, semen, ascitic fluid, bronchial washing samples and pure culture of Mycobacterium species. The DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 1. The amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 12-15 are useful in the detection of Mycobacterium infection.
Example 6
Dual isothermal nucleic acid amplification reaction (DINAR) for detecting Mycobacterium DNA using oligonucleotide Set 3 (SEQ ID NO: 12-15)
The oligonucleotide set (Set 3) as provided in example 5 was used in the detection of Mycobacterium luherculosis and Mycobacterium hovis. The DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 2. The amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1.

The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 12-15 are useful in the detection of Mycobacterium infection.
Example 7
Dual isothermal nucleic acid amplification reaction (DINAR) for detecting Mycobacterium DNA using oligonucleotide Set 4 (SEQ ID NO: 17-20)
The oligonucleotide sequences (Set 4) having nucleotide sequence as set forth in SEQ ID NO: 17-20 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 2041-2088 (SEQ ID NO: 16) of the DNA sequence of Mycobacterium tuberculosis CDC1551 (Accession number AE000516). This region is specific to detect Mycobacterium tuberculosis and Mycobacterium bovis.
Region 4:
(Sequence Removed)
A phosphate group was attached to the 5" end of the oligonucleotides as set forth in SEQ ID NO: 18 and SEQ ID NO: 19. The oligonucleotides as set forth in SEQ ID NO: 18 and SEQ ID NO: 19 were modified at 3' end by adding phosphate group.
The oligonucleotide set as set forth in SEQ ID NO: 17-20 was tested with blood, milk, sputum, pleural effusion, urine, stool, lung tissue, cotyledons, semen, ascitic fluid, bronchial washing samples and pure culture of Mycobacterium species. The DINAR for detecting Mycobacterium DNA was

performed in two steps as discussed in example 1. The amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The resuh clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 17-20 are useful in the detection of Mycobacterium infection.
Example 8
Dual isothermal nucleic acid amplification reaction (DINAR) for detecting Mycobacterium DNA using oligonucleotide Set 4 (SEQ ID NO: 17-20)
The oligonucleotide set (Set 4) as provided in example 7 was used in the detection of Mycobacterium tuberculosis and Mycobacterium hovis. The DINAR for detecting Mycobacterium DNA was performed in two steps as discussed in example 2. The amplified DNA products obtained can also be detected by various other methods known in the art as provided in example 1. The result clearly indicates that the oligonucleotide set having nucleotide sequence as set forth in SEQ ID: 17-20 are useful in the detection of Mycobacterium infection.
Example 9
Dual isothermal nucleic acid amplification reaction (DINAR) for Acitcing Mycobacterium DNA using oligonucleotide set (Set 17)
The oligonucleotide set (Set 17) having nucleotide sequence as set forth in SEQ ID NO: 87-90 were synthesized using the methods well known in the art. These oligonucleotides were designed from nucleotide position 484256 to 484207 (SEQ ID NO: 86) of the DNA sequence of Mycobacterium tuberculosis CDC 1551 (Accession number AE000516).
Region 17:
(Sequence Removed)
A phosphate group was attached to the 5' end of the oligonucleotides as set forth in SEQ ID NO: 88 and SEQ ID NO: 89.
The oligonucleotides set as set forth in SEQ ID NO: 87, SEQ ID NO: 88. SEQ ID NO: 89 and SEQ ID NO: 90 were tested with sputum, blood, ascitic fluid, bronchial washing samples, pleural fluid, urine, semen, tissue samples, milk, serum and pure culture of Mycobacterium species.
The DINAR for detecting Mycohacterium DNA was performed in two steps using the oligonucleotide set (Set 17) having nucleotide sequence as set forth in SEQ ID NO: 87-90. The detailed procedure is given below.
STEP l
The isothermal nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 87-90 for detection of Mycobacterium DNA in samples. The total volume of the reaction mixture was 30 \x\. The final concentration of the components of the reaction mixture was 3 µl buffer (10X), 1 µl Thermostable ligase (5U/µl), 1 µl of each oligonucleotide 17A, 17B. 17C and 17D (SEQ ID NO: 87-90) at concentration 2.5ng each, 100ng of template DNA and ultrapure water to bring the reaction volume to 30 µl. The cycling reaction employed is as follows: first cycle at 95°C for 10 min and 72°C for 3 min followed by 14 cycles at 95°C for 1 min and 72°C for 1 min. Various samples and controls were used for detection of Mycobacterium DNA. The description of the different reactions (reactions 1-8) used as template DNA is given below.
Reaction 1: NHD-Negative control- template DNA from healthy subject (not infected TB patient)

Reaction 2: Unknown sputum sample L1
Reaction 3: Unknown sputum sample L2
Reaction 4: Unknown sputum sample L3
Reaction 5: Unknown sputum sample L4
Reaction 6: Unknown sputum sample L5
Reaction 7: DNA isolated from H37Rv culture (PRv)
Reaction 8: Positive control (PC) for the region for IS 6110 region-3.2kb
plasmid with 250bp from the region 484256 to 484207 of Mycobacterium
genome having accession number AE000516
After completion of 15 cycles ol' reaction in the thermocycler, the resultant reaction mixture so obtained was subjected to the second step.
STEP 2
In the second step, isothemial nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO: 87-90). The reaction mixture used for performing the second isothermal nucleic acid amplification reaction was 10 ^1 of the final reaction mixture of reactions 1-8 of step 1. 3 1^1 buffer (lOX). 1 \x\ Thennostable ligase (5U/ |.il), \\Ji\ each of oligonucleotides 17A. 17B. 17C and 17D (SEQ ID NO: 87-90) at concentration 2.5ng each and ultrapure water to bring the reaction volume to 30 1^1. The cycling reaction was carried out as follows: 23 cycles 95°C for 1 min and 72°C for 1 min.
After completion of the 23 cycles of reaction in the thermocycler. the entire reaction mixture of reactions 1-8 was electrophoresed on a 2.5% agarose gel at lOOV for 45 min and the DNA products were identified using methods known in the art. The gel picture was captured on a gel documentation system as shown in Figure 2.
The amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using

enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.
The results (Figure 2) indicate that there was no non-specific amplification of 50 bp fragment observed in the reaction 1 marked as lane NC (negative control sample). A fragment of 25bp was obtained in the reaction 1 that corresponds to primer annealing as expected. A similar fragment of 25bp was obtained in the reaction 2 and 3 with unknown samples LI and L2 respectively showing that they are tuberculosis negative. There was an amplification band of 50 bp fragment observed in reaction 4 (Unknown sample L3), reaction 5 (Unknown sample L4), reaction 6 (Unknown sample L5), reaction 7 (DNA isolated from the lab culture of H37Rv) and reaction 8 (positive control). The amplification of 50 bp fragment so observed in the reactions 4-6 confirms the presence of Mycobacterium DNA in the suspected patients while absence of amplification in the reactions 2 and 3 indicates absence of Mycobacterium DNA in the suspected patients. This clearly indicates that the primer set having nucleotide sequence as set forth in SEQ ID: 87-90 are useful in the detection of Mycobacterium infection. DINAR assay employing primer set having nucleotide sequence as set forth in SEQ ID NO: 87-90 is sensitive and easy to use for the detection of Mycobacterium infection in patients.
Further experiments were conducted and it was observed that the primer set SEQ ID NO: 87-90 detect DNA of Mycobacterium tuberculosis and Mycobacterium bovis but not Mycobacterium avium strain.
Other reaction conditions employed for the above described process employed annealing and ligation temperatures varying from 55°C to 74° C for duration of 1 min and using different primer sets. The results obtained were similar as for the above described reaction set up. Other primer sets were tested with the

same set of samples with similar results. The enzyme concentration for thermostable ligase was varied from 1-10 units with consistent and reproducible results.
The results obtained above have also been corroborated by. smear examination, MTb culture on LJ media and PCR using 1S6110 region.
A) Culture method: The decontaminated samples were inoculated on
Lowenstein-Jensen slants and 7H9 Middlebrook's liquid media for growth and
incubated at 37°C for 3-4 weeks. Growth of MTB colonies was evident in all
cases.
B) PCR method: Reference (Ogusku. Mauricio Analise de diferen tMeso
prriismhie,r est ault.ilizados na PCR visando ao diagnostico da tuberculose no
Estado do Amazonas in Jomal Brasileiro de Pneumologia 30(4) - Jul/Ago de
2004), primers for amplifying 541bp region in IS6110 gene were used.
Example 10
Dual isothermal nucleic acid amplification reaction (DINAR) for detecting Insertion/deletion of a region that may be associated with risk of prostate Cancer using oligonucleotide set (Set 18 and 19)
The oligonucleotide set (Set 18) having nucleotide sequence as set forth in SEQ ID NO: 92-95 and the oligonucleotide set (Set 19) having nucleotide sequence as set forth in SEQ ID NO: 97-100 were synthesized using the methods well known in the art.
Region 18:
(Sequence Removed)
In this case, a 15 base pair sequence INDELl is present in the gene MSRl. The insertion of INDEL1 can be detected using the oligonucleotide set 18 (SEQ ID NO: 92-95).
The oligonucleotide set 18 as set forth in SEQ ID NO: 92-95 is designed to include the INDELl region in the MSRl gene that corresponds to nucleotide position -14458bp (SEQ ID NO: 91) of the DNA sequence of Homo sapiens chromosome 8 (Accession number NT_030737). This region is specific to detect presence/ absence of marker INDELl which is an MSRl sequence variant and maybe implicated in association with prostate cancer risk.
Region 19:
(Sequence Removed)
In this case, the 15 base pair sequence INDEL 1 is deleted in the gene MSRl. This mutation by deletion can be detected using the oligonucleotide set 19 (SEQ ID NO: 97-100).
A phosphate group was attached to the 5" end of the oligonucleotides as set forth in SEQ ID NO: 98 and SEQ ID NO: 99.
The oligonucleotide sets 18 and 19 as set forth in
(Sequence Removed)
were tested with
a) Synthetic control of 250 bp containing the 15bp INDELl region having the following sequence:
SEQ ID NO: 101

aaactacaaa gcatttagtg tatttcatat gtacttgtga acatatatgt ttttcactca tggaaaattt agcagaaatc cctatttttt gattatcgaa aaaaaccaaa ccaaattattgctgatacaa taaagcattc atctcatcat acacacacag acacacaaat atatatcaca cacatgcatg cacacacaca cacagagtac acacataaca atcaatagaa acaattctgg aaaaaacatt
b) Synthetic control of 235bp where the 15bp INDELl region is deleted having the following sequence:
SEQIDNO: 102
aaactacaaa gcatttagtg tatttcatat gtacttgtga acatatatgt ttttcactca tggaaaattt agcagaaatc cctatttttt gattatcgaa aaaaaccaaa ccaaattatt gctgaatctc atcatacaca cacagacaca caaatatata tcacacacat gcatgcacac acacacacag agtacacaca taacaatcaa tagaaacaat tctggaaaaa acatt
STEPl
The isothermal nucleic acid amplification reaction was performed using oligonucleotide having nucleotide sequences as set forth in SEQ ID NO: 92-95 and 97-100 for detection of presence/ absence of the INDELl region in the sample. The total volume of the reaction mixture was 30 µl. The final concentration of the components of the reaction mixture was 3.0^1 buffer (10X), 1 µl Thermostable ligase (5U/µl). 1 µl of each oligonucleotide (SEQ ID NO: 92-95 with reaction 1 and 2 at concentration 2.5ng each for sequences 18A and 18C and lOng for sequences 18B and 18D and SEQ ID NO: 97-100 at concentration 1.6ng each for sequences 19A, 19B, 19C and 19D with reaction 3 and 4), 100ng of template DNA and ultrapure water to bring the reaction volume to 30 |al. The cycling reaction employed is as follows: first cycle at 95°C for 10 min and 65"C for 3 min followed by 17 cycles at 95°C for 1 min and 65°C for 1 min. The description of the different reactions (reactions 1-4) used as template DNA is given below:
Sample 1 (SI): Synthetic control with INDELl region with the primer set as set forth in SEQ ID: 92-95

Sample 2 (S2): Synthetic control without INDELl region with the primer set
as set forth in SEQ ID: 92-95
Sample 3 (S3): Synthetic control with INDELl region with the primer set as
set forth in SEQ ID: 97-100
Sample 4 (S4): Synthetic control without INDELl region with the primer set
as set forth in SEQ ID: 97-100.
After completion of 18 cycles of reaction in the thermocycler, the resultant
reaction mixture so obtained was subjected to the second step.
STEP 2
In the second step, isothemial nucleic acid amplification reaction was performed using the same primer set as used in the first step (SEQ ID NO; 92-95 with reaction 1 and 2 at concentration 2.5ng each for sequences 18A and 18C and lOng for sequences 18B and 18D and SEQ ID NO: 97-100 at concentration 1.6ng each for sequences 19A, 19B, 19C and 19D with reaction 3 and 4). The reaction mixture used for performing the second isothermal nucleic acid amplification reaction was 10 |al of the final reaction mixture of reactions 1-4 of step 1, 3 µl buffer (10X). 1 µl Thermostable ligase (5U/ µl). lµl of each oligonucleotide (SEQ ID NO: 92-95 with reaction 1 and 2 at concentration 2.5ng each for sequences 18A and 18C and lOng for sequences 18B and 18D and SEQ ID NO: 97-100 at concentration 1.6ng each for sequences 19A, 19B, 19C and 191) with reaction 3 and 4) and ultrapure water to bring the reaction volume to 30 µl The cycling reaction was carried out as follows: 23 cycles 95°C for 1 min and 65''C for 1 min.
After completion of the 23 cycles of reaction in the thermocycler, the entire reaction mixture of reactions 1-4 was electrophoresed on a 2.5% agarose gel at 1OOV for 45 min and the DNA products were identified using methods known in the art. The gel picture was captured on a gel documentation system as shown in Figure 3.

The amplified DNA products obtained can also be detected by various other methods known in the art such as solution phase colorimetric detection using enzymes and photoactivity assays, solid phase colorimetric detection using enzymes and photoactivity assays, solution phase fluorimetric detection, solid phase fluorimetric detection, solution phase chemiluminiscent detection, solid phase chemiluminiscent detection, solution phase using nanoparticles, solid phase using nanoparticles, solution phase using radioactive detection and solid phase using radioactive detection method.
The results are shown in Figure 3. Amplification of a 50bp fragment is seen in reaction 1 and reaction 4 while no amplification and only a 25 bp band is observed in the reaction 2. A very faint amplification is visible in the reaction 3. Amplificafion in reaction 1 and no amplification in reaction 2 which were set with primer sequences as set forth in SEQ ID NO: 92-95 indicate that reaction 1 contains the target INOHLl sequence insertion while reaction 2 does not contain the target INDELl sequence i.e the INDELl is deleted.
Good amplification signal in reaction 4 and a minimal amplification signal in reaction 3 are observed which were set with primer sequences as set forth in SEQ ID NO: 97-100 indicate that reaction 4 contains the target DNA with INDELl deletion while reaction 3 which contains the target DNA with INDELl sequence insertion is giving a background signal.

I/We Claim:
1. A process for detecting a target nucleic acid in a sample using dual
isothermal nucleic acid amplification reactions, said process comprising:
(a) providing a reaction mixture comprising a sample containing or suspected of containing a target nucleic acid; a set of oligonucleotides containing at least four oligonucleotides, wherein a first oligonucleotide of said set is complementary to a third oligonucleotide and a second oligonucleotide of said set is complementary to a fourth oligonucleotide; and a thermostable ligase;
(b) subjecting said reaction mixture under isothermal conditions to obtain a first resultant reaction mixture thereby amplifying said target nucleic acid, wherein said isothemial conditions comprise of one cycle of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 10 minutes; and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes; and 8 to 25 cycles of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes:
(c) subjecting said first resultant reaction mixture to the following isothermal conditions using said set of oligonucleotides, and said thermostable ligase to obtain a second resultant reaction mixture, wherein said isothermal conditions comprise 8-32 cycles of denaturation at a temperature ranging from about 90°C to 99°C for 30 seconds to 3 minutes and annealing and amplification at a temperature ranging from about 55°C to 74°C for 30 seconds to 3 minutes: and (d) detecting the amplified nucleic acid.
2. A process for detecting a target nucleic acid in a sample using dual
isothermal nucleic acid amplification reactions, said process comprising:


(a) providing a reaction mixture comprising a sample containing or
suspected of containing a target nucleic acid; a set of oligonucleotides
containing at least four oligonucleotides, wherein a first oligonucleotide of
said set is complementary to a third oligonucleotide and a second
oligonucleotide of said set is complementary to a fourth oligonucleotide;
and thermostable ligase;
(b) subjecting said reaction mixture under isothermal conditions to obtain a first resultant reaction mixture, wherein said isothemial conditions are one cycle of denaturation at 95°C for 10 minutes; and annealing and amplification at 65°C for 3 minutes; and 14 cycles of denaturation at 95°C for 1 minute and atmealing and amplification at GS^C for 1 minute; and
(c) subjecting a part or whole of the said first resultant reaction mixture to following isothermal conditions using said set of oligonucleotides, and thermostable ligase to obtain a second resultant reaction mixture, wherein said isothermal conditions are 23 cycles at 95°C for 1 minute and 65°C for 1 minute; and
(d) detecting the amplified nucleic acid

3. The process as claimed in claim 1 or 2, wherein step (c) optionally comprises passing said first resultant reaction mixture tlirough a purification column to obtain flowthrough and subjecting said flowthrough under said isothennal conditions to obtain a second resultant reaction mixture.
4. The process as claimed in claim 1 or 2, wherein a phosphate group is attached to the 5' end of said second and third oligonucleotides.
5. The process as claimed in claim 1 or 2, wherein the 3" end of said second and third oligonucleotides are optionally modified.
6. The process as claimed in claim 5. wherein said modification is carried out by adding a phosphate, deoxy. alkyl or aryl group at the 3' end.
7. The process as claimed in claim 5. wherein said modification is carried out by adding phosphate group at the 3" end.


8. The process as claimed in claim 1 or 2, wherein at least one oligonucleotide of said set of oligonucleotides is optionally attached to a probe selected from the group consisting of radioactive, colorimetric, enzymatic, fluorescent, chemiluminiscent, and photo-active probes.
9. The process as claimed in claim 1 or 2. wherein said process detects a target nucleic acid of disease or non-disease related conditions selected from the group consisting of infectious diseases, genetically transmitted diseases, cancer, SNP variations, mutations and drug resistance, and combinations thereof.
10. The process as claimed in claim 1 or 2. wherein said sample is of human, veterinary, plant or microorganism origin.
11. The process as claimed in claim 1 or 2, wherein said sample is selected from the group consisting of blood, sputum, tissue, saliva, cerebro-spinal fluid, pleural fluid, lymph, synovial fluid, semen, other body fluids, milk and other body secretions, urine, other body excretions, broncho-alveolar lavage and other washings from a subject.
12. The process as claimed in claim 1 or 2. wherein said sample is of plant
origin.
13. The process as claimed in claim 9. wherein said cancer is prostate cancer.
14. The process as claimed in claim 10, wherein said micro-organism is selected from the group consisting of bacteria, viruses, fungi, archaea protozoans, and combinations thereof
15. The process as claimed in claim 10. wherein said micro-organism is selected from the group consisting of M. tuberculosis. M. hovis , M avium. Hepatitis A virus, Hepatitis B virus. Hepatitis C virus, Hepatitis D virus and Hepatitis E virus.
16. A set of oligonucleotides for detection of sequence specific regions that are implicated in susceptibility to prostate cancer in a sample, wherein the nucleotide sequence of said set of oligonucleotides is selected from the


group consisting of the nucleotide sequence as set forth in SEQ ID NO:
92-95 and SEQ ID NO: 97-100. 17. A kit for detection of sequence specific regions that are implicated in
susceptibility to prostate cancer, wherein said kit comprises the set of
oligonucleotides as set forth in SEQ ID NO: 92-95 and SEQ ID NO: 97-
100.

Documents

Application Documents

# Name Date
1 45-DEL-2008-Form-5-(05-01-2009).pdf 2009-01-05
2 45-DEL-2008-Form-3-(05-01-2009).pdf 2009-01-05
3 45-DEL-2008-Form-2-(05-01-2009).pdf 2009-01-05
4 45-DEL-2008-Form-1-(05-01-2009).pdf 2009-01-05
5 45-DEL-2008-Drawings-(05-01-2009).pdf 2009-01-05
6 45-DEL-2008-Description (Complete)-(05-01-2009).pdf 2009-01-05
7 45-DEL-2008-Correspondence-Others-(05-01-2009).pdf 2009-01-05
8 45-DEL-2008-Claims-(05-01-2009).pdf 2009-01-05
9 45-DEL-2008-Abstract-(05-01-2009).pdf 2009-01-05
10 45-del-2008-form-3.pdf 2011-08-21
11 45-del-2008-form-2.pdf 2011-08-21
12 45-del-2008-form-1.pdf 2011-08-21
13 45-del-2008-drawings.pdf 2011-08-21
14 45-del-2008-Description (Provisional).pdf 2011-08-21
15 45-del-2008-correspondence-others.pdf 2011-08-21