Nucleic Acid Extraction
FIELD OF THE INVENTION
The present invention relates to methods and products for extraction of nucleic acids
from biological samples, primarily biological samples comprising cellular material.
Aspects of the invention further relate to methods for preparing nucleic acids from
biological samples for nucleic acid amplification.
BACKGROUND TO THE INVENTION
One of the main challenges for diagnostics using nucleic acid amplification technology
is the pretreatment of cellular material in order to extract nucleic acids prior to the
amplification process. Silica based and magnetic bead based technologies are
inefficient (£10%) and require optimisation for specific target types; the same process
is generally not compatible with other sample types. High yield processes using phenol
chloroform are not suited because of the toxicity of components. Detergent based
methods offer a simple lysis process, but require elevated temperatures (95 C), which
are not compatible with single step RT-PCR since the reverse transcriptase is not
thermal stable.
Current methods involve the isolation of nucleic acids in a purified form, away from
other cellular material. This generally requires breaking of cells using enzymes such as
lysozyme or detergents. Mycobacterium requires a harsh NALC-NaOH pre-treatment to
rupture cells. Proteins are removed by digestion using appropriate proteases (e.g.
Proteinase K). Nucleic acids are bound to a support resin or charged matrix (e.g.
magnetic particles) and washed. Nucleic acids are removed from the charged support
through pH change into an appropriate buffer. This results in high purity nucleic acids.
State of the art systems from e.g. Cepheid, Enigma Diagnostics, Roche, Geneprobe,
BD, etc integrate this conventional laboratory nucleic acid extraction process in toto
into their diagnostic instruments. This is however complex, expensive and directed to
specific sample types.
We describe herein a process that removes the complexity of this process, delivering
nucleic acids capable of being amplified by PCR in a simple, disposable, paper based
system that works at room temperature, is capable of rupturing bacterial, fungal and
viral cells, and releases nucleic acids into solution for direct-to-PCR analysis.
International patent applications WO00/62023 and WO02/16383 to Whatman, Inc,
describe methods for lysing cells and isolating nucleic acids using coated filter media.
The filter media is FTA-treated nitrocellulose, which is coated with an anionic
detergent, for example SDS. The coating lyses the cells, and the FTA-treated filter
adsorbs nucleic acids thereto. The coating is not covalently bound to the filter, and may
be removed by washing. Nucleic acids can be eluted from the filter for subsequent
processing.
International patent application WO2008/1 34464 to 3M Innovative Properties Company
describes a substrate with functional groups attached, a lysing material, a matrix
material, and a saccharide, for use in isolating nucleic acids from samples.
US patent application 2007/0185322 to Akhavan-Tafti describes methods for extraction
of RNA from a sample involving the use of an acidic solution and a solid phase binding
material which can liberate nucleic acids without performing preliminary lysis of cells.
The use of quaternary ammonium salts to bind nucleic acids is mentioned. US
application 2005/0042661 to Tarkkanen et al also describes use of quaternary
ammonium compounds to selectively release nucleic acids from cells.
International patent applications WO2004/087226 and WO2006/071 191 to Appeartex
AB, and US patent 5,064,613 to Higgs et al describe antimicrobial compositions
including quaternary ammonium salts.
SUMMARY OF THE INVENTION
According to a first aspect of the invention, there is provided a method of preparing
nucleic acids from a biological sample comprising a) cellular material having a cell
membrane, or b) cellular material having a cell wall, or c) viral material having a viral
envelope or d) viral material having a viral capsid; the method comprising contacting
the sample with a substrate, the substrate being functionalised with a biocidal agent
which is capable of i) weakening the cell membrane, cell wall, viral envelope, or viral
capsid; or ii) lysing cellular or viral material.
The method may further comprise the step of subjecting the sample to heat after the
contacting step. For example, the sample may be directly added to a nucleic acid
amplification reaction. The heat step will serve to lyse weakened cell wall, cell
membrane, viral envelope, or viral capsid, to release nucleic acid. The heat step may
not always be necessary to release nucleic acid, for example if the biocidal agent is
capable of lysing cellular or viral material.
In this way, the method permits rapid and easy preparation of nucleic acid from a
biological sample for further processing.
The substrate is preferably a cellulose material; for example, a cellulose filter paper or
a cellulose matrix. The cellulose material may be a composite paper; for example, a
composite cellulose paper may comprise a lateral flow layer, to remove liquid and low
molecular weight contaminants and inhibitors from the sample which is deposited on a
surface of the paper. Cellulose has the advantage that it has a number of exposed
hydroxyl groups to which biocidal agents may be attached. In certain embodiments, the
cellulose material may further comprise reagents for carrying out desired actions on the
sample; for example, RNAses, proteases, and the like, for sample cleanup. A preferred
substrate is a cotton-derived cellulose paper, and in particular FP 2992 paper from
Hahnemuhle FineArt GmbH (Germany).
Other substrate materials may be used, preferably those which have exposed hydroxyl
groups. For example, the substrate may be glass, plastics, or the like. Although in a
preferred embodiment the substrate is a filter paper, which may be directly added to a
nucleic acid amplification reaction, in other embodiments the substrate may take the
form of a microfluidic channel or a reaction vessel or other container, along which or
within which the biological sample may be passed or contained.
The biocidal agent preferably comprises multiple functional groups. The functional
groups preferably include a binding moiety, which is involved in binding the agent to the
substrate; a hydrophobic moiety; and a charged moiety. The hydrophobic moiety is
able to interact with and penetrate the cell wall or cell membrane. In preferred
embodiments, the hydrophobic moiety may be an alkyl chain, for example C5-C30
alkyl, preferably C 10-C20 alkyl. As the alkyl chain penetrates the delicate cell wall, the
wall is weakened and punctured. The charged moiety is preferably positively charged,
and is able to attract a charged cell wall, and can disrupt ion flow and homeostasis on
contacting a cell membrane, thereby helping to disrupt the cell and release the nucleic
acids. The charged moiety is preferably a quaternary ammonium group. The binding
moiety may comprise a hydroxyl group.
In preferred embodiments, the functional groups are preferably an alkyl chain (the
hydrophobic moiety), a silyl group (the binding moiety), and an ammonium chloride
group (the charged moiety).
Preferred biocidal agents include silylated quaternary ammonium compounds
(SiQACs); in particular 3-(trimethoxysilyl) propyldimethyloctadecyl ammonium chloride
(3-TPAC). Other biocidal agents include benzyl ammonium chlorides. The lethal mode
of action of SiQACs is generally accepted to proceed by adsorption of the positively
charged molecule onto the negatively charged cell surface, disruption of the cell
membrane by a lipophilic chain on the SiQAC molecule, and diffusion through the
membrane leading to cell lysis.
The skilled person will be aware of other suitable biocidal agents which may be used.
The selection of a particular agent will be guided by the presence of the preferred
functional groups described above, and the nature of the intended biological sample -
for example, where the sample to be processed is a mammalian cellular sample, then
there is no cell wall to penetrate, and other functional groups may be appropriate.
Examples of other biocidal agents which may be used in the present invention include:
a) telechelic poly(2-alkyl-1 ,3-oxazolines);
b) cellulose with an antimicrobial DDA group grafted via PEtOx, which kills
approaching microbial cells on contact (Bieser et al (201 1) , Contact-Active
Antimicrobial and Potentially Self-Polishing Coatings Based on Cellulose. Macromol.
Biosci., 11, 111-1 2 1) ;
c) saponins are steroid or triterpenoid glycosides, common in a large number of
plants, and have long been known to have a lytic action on erythrocyte membrane and
many saponins are known to be antimicrobial (Francis et al, British Journal of Nutrition
(2002), 88, 587-605). Extensive research has been carried out into the membranepermeabilising
properties of saponins. These structurally diverse compounds have also
been observed to kill protozoans and to act as anti-fungal and antiviral agents. Isolated
cell membranes from human erythrocytes when treated with saponin developed pores
of 40-50 A° diameter as against the 80 A° pores produced in artificial membranes
(Seeman et al. 1973 Structure of membrane holes in osmotic and saponin hemolysis.
Journal of Cell Biology 56, 519-527).
For a review of other compositions which may be used, see "Antimicrobial Polymers in
Solution and on Surfaces", Siedenbiedel and Tiller (2012) Polymers, 4, 46-71 .
Preferably, the biological sample may comprise cellular material having a cell wall. For
example, the cellular material may be prokaryotic cells, such as bacterial cells; or may
be plant or fungal cells. Alternatively, the biological sample comprises cellular material
having a cell membrane, and no cell wall. For example, the cellular material may be
eukaryotic animal cells, including mammalian or insect cells. Alternatively, the
biological sample may comprise viral material.
A further aspect of the present invention provides a method of amplifying nucleic acids
in a biological sample, the method comprising: preparing nucleic acids according to the
method of the above first aspect of the invention; and subjecting the prepared acids to
a nucleic acid amplification step, preferably a polymerase chain reaction (PCR)
amplification.
The amplification may be carried out for diagnostic purposes.
A further aspect of the invention provides a device for preparing nucleic acids from a
biological sample comprising a) cellular material having a cell membrane, or b) cellular
material having a cell wall, or c) viral material having a viral envelope or d) viral
material having a viral capsid; the device comprising a substrate functionalised with a
biocidal agent which is capable of i) weakening the cell membrane, cell wall, viral
envelope, or viral capsid; or ii) lysing cellular or viral material.
The substrate is preferably a cellulose material.
In certain embodiments, the substrate may be integrated into a sample preparation
cartridge or the like. Thus, the device may further comprise a reaction vessel for
receiving the substrate, or a portion of the substrate. The device may yet further
comprise means for separating a portion of the substrate from the remaining substrate;
this may allow a piece of the substrate to be separated once the sample has been
added, and the separated piece then allowed to enter the reaction vessel and used in a
PCR.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the structure of a SiQAC molecule, 3-TPAC.
Figure 2 illustrates the functionalisation of cellulose by a SiQAC.
Figure 3 is a schematic of the mode of action of a SiQAC on a cell.
Figure 4 shows the detection of Plasmodium species from blood treated with a SiQAC.
Figure 5 compares different paper processing methods for extraction of Mycobacterium
DNA.
Figure 6 shows accuracy data for clinical samples.
Figure 7 shows multiple repeat tests of MTB at different concentrations extracted from
sputa using the process described, the y axis showing the peak melt temperature and
the x axis showing the peak height.
Figure 8 shows the optimised process workflow for production of SiQAC functionalised
paper and sample analysis.
Figure 9 shows the isolation of microbial DNA from whole dairy milk.
Figure 10 shows the amplification of nucleic acid obtained from HIV positive plasma
samples.
Figure 11 shows the sequences obtained from the amplified HIV nucleic acid.
DETAILED DESCRIPTION OF THE DRAWINGS
The present invention operates generally as follows. A substrate, such as cellulose
filter paper, is functionalised with a biocidal agent, preferably a SiQAC, more preferably
3-TPAC. The functionalised substrate may be used in sample preparation to extract
nucleic acids from a cellular sample for use in PCR reactions.
Cellular material is deposited onto the top layer of the paper. Liquid flows through the
paper and the cellular material becomes trapped on the surface. The liquid phase and
any low molecular weight inhibitory ions are dispersed in a secondary lateral flow layer
located below the surface functionalised cellulose layer.
Microbial cells in the sample (or plant, animal, or fungal cells) interact with the SiQAC
functionalised cellulose and are weakened and/or lysed, releasing their cellular content
typically within 5 minutes of contact.
A plug of composite paper may be excised from the substrate, and added directly to a
PCR reaction after a 10 minute period. The initial heat of the PCR can serve to
additionally lyse any remaining cells to release further nucleic acid.
The structure of a SiQAC molecule [3-(trimethoxysilyl) propyldimethyloctadecyl
ammonium chloride (3-TPAC)] is shown in Figure 1. 3-TPAC was first described in
1972 (see Isquith et al ( 1972), Appl. Microbiol, 24:6 859-863,
†pv neb; ni n; v prr:C/a c es/P C380667 pdf;appirn cro00052 0033 p ).
There are many versions of the basic chemistry (e.g. benzyl ammonium chlorides
BAC), but all share similar key ingredients: ammonium chloride variant (the active
antimicrobial), silicon as a binding agent (the silyl part) and an alkane chain. The
ammonium chloride is a quaternary ammonium group which is attached to two methyl
groups and effectively two longer chain alkyl groups. This cationic function confers antimicrobial
properties which result in the breaking of bacterial, fungal and viral
membranes, releasing the nucleic acid content. The hydrophobic alkane chain
penetrates cell walls. The trimethoxysilyl group binds the molecule to a substrate (e.g.
cellulose) via the active hydroxyl group.
Quaternary ammonium compounds are lethal to a wide variety of organisms including
bacteria, fungi and coated viruses, and to a lesser extent to endospores,
Mycobacterium tuberculosis and non-enveloped viruses. Many biocidal polymers are
known with quaternary ammonium groups. Quaternary ammonium (QA) compounds
are among the most widely used antibacterial agents for medical and public health
applications, and have been shown to be effective against both gram negative and
gram positive bacteria (Tashiro (2001) Macromol. Mater. Eng.; 286, 63-87).
Cationic polymers with QA groups generally exhibit higher antimicrobial activities than
their corresponding low molecular weight monomers [Ikeda and Tazuke, 1983,
Makromol. Chem., Rapid Commun. 4 ( 1983) 459-461]. The higher activity is attributed
to greater electrostatic attraction between the cell and polymer due to the greater
charge density of the polymer.
SiQACs work through a two-step process. The positively charged action on the SiQAC
molecule attracts the negatively charged cell wall of the microorganism. Initially, the
hydrophobic alkyl chain penetrates the similarly hydrophobic cell wall of an organism
that it comes in contact with. As the alkyl chain penetrates the delicate cell wall, the
wall is weakened and punctured. Second, as the cationic quaternary ammonium group
comes in contact with the cell wall it disrupts the ion flow and causes leakage into or
out of the cell wall, usually resulting in the cell losing its contents or bursting depending
on the ionic environment. The charged quaternary ammonium alkyl group remains
unchanged and is available to repeat the process indefinitely.
Because of this "physical" and "electrical" killing mechanism, microbes do not get an
opportunity to develop resistance or immunity to the SiQAC.
Quaternary ammonium compounds are widely used as disinfectants, antiseptics,
pharmaceutical products, and cosmetics and could be an alternative in fruit and
vegetables disinfection. All quaternary ammonium compounds (QACs) are cationic
compounds that possess a basic structure (NH4+). These compounds penetrate into
the bacteria cell wall, reacting with the cytoplasmic membrane inducing wall lysis
caused by autolytic enzymes (McDonnell, G. & Russell, A. D. 1999 Antiseptics and
disinfectants: activity, action and resistance. Clinical Microbiology Reviews 12, 147-
179).
The trimethoxysilyl groups react with hydroxyl groups on surfaces such as glass and
cotton to form covalent bonds that retain the QA compound at the surface and prevent
it from dissolving in water. The trimethoxysilyl groups can also react with each other to
form a highly stable cross-linked silane coating bound to treated surfaces. These
coatings have been shown to impart biocidal activity to surfaces in many applications
without the release of chemical agents into the surrounding environment [Isquith et al,
1972; Isquith et al, 1973 U. S. Patent 3,730,701 ; Speier and Malek, 1982 J of Colloid
and Interface Science 89, 68; Walters et al., 1973, J., Appl. Microbiol. 25, 253].
While these coatings were very effective as a fungicide and an antibacterial agent, they
have been ineffective against spores.
Figure 2 illustrates the functionalisation of cellulose with a SiQAC molecule, 3-TPAC. In
unaltered native cellulose, X represents hydrogen, forming a number of pendant
hydroxyl (OH) groups. In the faster initial stage a bond forms between the molecule
and the hydroxyl group forming a silyl ether. In the second slower step cross-links are
formed between adjacent dimethoxysilyl groups to form a random silicone ether
polymer aligned parallel to the substrate surface.
The cationic moiety plays no part in the surface binding but is available yet bound to
the substrate surface. Its structure is analogous to the quaternary ammonium
compounds recognised as topical antiseptics of which didecyldimethylammonium
chloride (DDAC) is a typical example.
The mechanism whereby the SiQAC molecule becomes bound to the substrate surface
is similar chemically to that in the cross-linking of polyethene to form PEX.
Figure 3 is a schematic diagram showing the method of action of the SiQAC
functionalised cellulose. SiQAC chains bind to the cellulose fibres and become oriented
and cross-linked (labelled A) to form an active layer. The hydrophobic alkyl chain
(labelled B) penetrates the similarly hydrophobic cell wall of the micro-organism. As the
alkyl chain penetrates the delicate cell wall, the wall is weakened and punctured. Then
the cationic quaternary ammonium group (C) comes in contact with the cell wall, and
disrupts the ion flow and causes leakage into or out of the cell wall, usually resulting in
the cell losing its contents or, depending on the ionic environment, bursting the cell
completely. In its weakened state the rapid drying process of the cells further weakens
the cell wall such that during the early cycling of PCR, nucleic acid material is released
into the solution and is amplified during the PCR.
Thus, the mode of action of SiQAC molecules involves a number of distinct elements.
There is perturbation of cytoplasmic and outer membrane lipid bilayers and cell walls
via the alkyl chain, resulting in generalised and progressive leakage of cytoplasmic
material resulting in cell lysis, partial or complete depending on ionic strength of the
surrounding solution. This is increased by the positively charged ammonium group
which associates with negatively charged membrane phospholipid. Even at low
concentration of the active components, leakage of low molar mass cytoplasmic
components occurs (e.g. K+, nucleic acids and amino acids). SiQAC compounds are
considerably more potent than a non-silylated quaternary ammonium compound
because the silyl group bonds to surfaces causing the antimicrobial portion to become
locally concentrated and orientated.
The process of cell lysis by SiQAC compounds works at room temperature, unlike
other processes in the current state of the art. SiQAC functionalised cellulose is
suitable to weaken and/or destroy cell walls of bacteria, fungi and protein coat of virus
particles. In preferred embodiments, it provides lysed cellular material that is PCRready
within 5 minutes. The functionalised substrates and methods of the present
invention enable nucleic acid extraction of DNA and RNA combined with
decontamination of other potentially harmful agents within the sample in a single step.
It is also possible to extract of RNA from viral particles, providing a single step process
negating the need for complex sample processing to access RNA ahead of RT-PCR.
The methods could be used as a means of selecting cell types for lysis e.g. data here
shows after 24 hours incubation in blood that whole blood cells remain intact, whilst
white erythrocytes become lysed.
We believe that the SiQAC process is compatible with at least the following micro
organisms:
Bacteria: MRSA, CA-MRSA; Micrococcus sp.; Staphylococcus epidermis; Enterobacter
agglomerans; Acinetobacter calcoaceticus; Staphylococcus aureus (pigmented);
Staphylococcus aureus (non-pigmented); Klibsiella pneumonial moniae ;
Pseudomonas aeruginosa ; Streptococcus faecalis; Escherichia coli; Proteus mirabilis;
Citrobacter diversus; Salmonella typhosa; Salmonella choleraesuis; Cornyebacterium
bovis; Mycobacterium smegmatis; Mycobacterium tuberculosis; Brucella canis;
Brucella abortus; Brucella suis; Streptococcus mutans; Bacillus subtilis; Clostridium
perfringens; Haemophilus influenzae; Haemophilus suis; Lactobacillus easel;
Leuconostoc lactis; Listeria monocytogenes; Propionibacterium acnes; Proteus
vulgaris.
Fungi: Alternaria; Aspergillus flavus; Aspergillus fumigatus; Aspergillus niger;
Aspergillus terreus; Aspergillus versicolor; Aureobadisium pullulans; Cephaldascus
fragrans; Chaetomium globosum; Cladosporium herbarum; Epidermophyton; Fusarium
nigrum; Fusarium solani; Glicocladium roseum; Mucor; Oospora lactis; Pencillium
albicans; Tricophyton mentagraphophytes; Pencillium elegans; Pencillium funiculosum;
Pencillium humicola; Pencillium notatum; Pullularia pullulans; Penicillium variabile;
Rhizopus nigricans; Ricoderm; Stachybotrys atra; Trichophyton interdigitalie;
Trichderma flavus; Penicillium citrinum.
Yeast and Algae: Saccharomyces cerevisiae; Candida albicans; Oscillatoria borneti
LB143; Anabaena cylindrica; Selenastrum gracile B-325; Pleurococcus LB1 1;
Schenedesmus quadricuada; Gonium LB 9c; Volvox LB 9; Chlorella vulgaris;
Cyanophyta (blue-green); Chrysophyta (brown); Chlorophyta (green) Seienastum;
Chlorophyta (green) Protococcus.
Viruses; HIV; Dengue; Influenza A/B; SARS; H 1N 1 (swine flu); H3N2; Herpes Simplex
Type 1
Others: Plasmodium malariae.
Details of antimicrobial action of SiQACs can be found in Isquith et al ( 1972).
EXAMPLES
The paper used in all examples was the cotton-derived cellulose paper FP 2992 from
Hahnemuhle FineArt GmbH (Germany), unless otherwise stated.
Example 1: Paper based purification of bacterial cultures with SiQAC solution and PCR
product characterisation
Protocol :
1. Prepare a O/N culture of a given bacteria {K. pneumoniae, S. aureus and M.
Tuberculosis* ) and take 50m I. [*MTB culture had been incubated for two weeks (O.D.
1.1)]
2. Prepare three sets of cards to be dried O/N
i . Untreated paper
ii. Functionalised with 5m I of SiQAC (3-TPAC) solution diluted in 15m I of water
iii. Functionalised with 5m I of SiQAC (3-TPAC) solution diluted in 15m I of TRIS-CI
[pH 7.5]
3. Add 20m I of the cultures to each set of treated and untreated paper and dry at room
temperature for 10 minutes [x4 repeats on different paper for each culture]
4. Remove a paper-punched disk using a sterile biopsy punch ( 1 .5mm).
5. Add the punched disk to the PCR mix (20m I final volume)
6. Carry out 35 cycles of 16S universal for each of the tests; K. pneumoniae and S.
aureus, GD' s MTB/RIF
7. Use standard pyrosequencing of PCR products for K. pneumoniae and S. aureus
Results:
1. PCR from std pads (set 1) for K. pneumoniae yielded an average 18 high quality bp
readouts in pyro
2. PCR from pads enriched with 5m I of SiQAC (3-TPAC) solution added to 15m I of
water (set 2) for K. pneumoniae yielded an average 24 medium quality bp readouts in
pyro
3. PCR from pads enriched with 5m I of SiQAC (3-TPAC) solution added to 15m I
of TRIS-CI [pH 7.5] (set 3) for K. pneumoniae yielded an average 28 high quality bp
readouts in pyro
4. PCR from untreated pads (set 1) for S. aureus yielded an average 16 high quality bp
readouts in pyro
5. PCR from pads enriched with 5m I of SiQAC (3-TPAC) solution added to 15m I of
water (set 2) for S.aureus yielded an average 20 medium quality bp readouts in pyro
6. PCR from pads enriched with 5m I of SiQAC (3-TPAC) solution added to 15m I
of TRIS-CI [pH 7.5] (set 3) for S. aureus yielded an average 25 high quality bp readouts
in pyro
7. GD' s MTB/RIF: MTB identification was correct for the three sets of samples,
including RIF identification in samples processed through pads enriched with 5m I
of SiQAC (3-TPAC) solution diluted with 15m I of TRIS-CI [pH 7.5]
Conclusions :
Paper enriched with SiQAC (3-TPAC) solution successfully lysed the bacterial cells
allowing PCR from the extracted nucleic acid. This was confirmed by the raw length of
sequence obtained through pyrosequencing, and the end-point detection of MTB-RIF
from Mycobacterium tuberculosis which is a difficult cell to break open, conventionally
requiring harsh treatments with NALC-NaOH to achieve the same level of cell
disruption. Untreated paper did not yield the same results. TRIS-CI [pH 7.5] is needed
to buffer the SiQAC.
Example 2: Detection of Plasmodium species from blood treated with SiQAC solution.
Figure 4 shows the results of detection of nucleic acids from different Plasmodium
species in blood samples obtained from infected patients.
Example 3: Paper functionalisation and use methods
Three alternative paper functionalisation methods are given:
Process A
Paper functionalised with 20m I SiQAC (3-TPAC) solution, dried for 24 hours and then
washed in 20m I 5mM TRIS-CI [pH 9.0], 0.2mM MgCI2 then dried and either;
i . Apply the sample, dry for 20', remove disc and add 20m I of miliQ water for
PCR, or
ii. Apply the sample, dry for 20', remove disc and rinse in 20m I of miliQ water
using gentle pipetting, use 20m I in PCR
Process B
Paper functionalised with 20m I SiQAC (3-TPAC) solution, dried for 30' and washed in
5mM TRIS-CI [pH 9.0], 0.2mM MgCI2 then dried and either;
i . Apply the sample, dry for 20', remove disc and add 20m I of miliQ water for
PCR, or
ii. Apply the sample, dry for 20', remove disc and rinse in 20m I of miliQ water
using gentle pipetting, use 20m I in PCR
Process C
Paper functionalised with 20m I SiQAC (3-TPAC) and dried for 30' and either;
i . Apply the sample, dry for 20', remove disc and rinse in 20m I of miliQ water
using gentle pipetting, use 20m I in PCR, or
ii. Apply the sample, dry for 20', remove disc and add 20m I of 5mM TRIS-CI [pH
9.0], 0.2mM MgCI2 for PCR; or
iii. Apply the sample, dry for 20', remove disc and rinse in 20m I of 5mM TRIS-CI
[pH 9.0], 0.2mM MgCI2 using gentle pipetting, use 20m I in PCR
The various different paper processing methods were compared for extraction of
Mycobacterium tuberculosis DNA from clinical samples of raw sputum and results
obtained using the standard Cepheid GeneXpert® MTB processing using NALCNaOH.
The results are shown in Figure 5. (MTB = Mycobacterium rpoB gene detected;
RIFs or RIFr = rifampicin mutations detected; FAILED = no detection). The three
processing methods released nucleic acids to varying degree into solution for PCR
allowing detection of the multi-copy and single copy rpoB gene and to detect the
rifampicin mutation. All processes gave comparative data to the GeneXpert® gold
standard system. Process C gave 'better than' results in comparison to the gold
standard, giving a high degree of cellular disruption and stability of high quality DNA for
the PCR analysis, further confirmed by pyrosequencing. Pyrosequencing showed
sequence variations observed in 30bp of sequence from amplicons from the V2
ribosomal DNA, long yellow & blue reads illustrate the absence of mutations in the
sequence confirming the presence of good, amplification products.
Figure 6 shows the cumulative accuracy data from 5 clinical sputum samples (4x RIFs
and 1x RIFr), processed using the 7 different modifications described (i.e. 35 tests).
Measurement of melt temperatures for MTB (light blue) and rpoB mutations indicating
RIF status (RIFs, RIFr) and associated error bars representing standard deviation
across the data points measured show that the process does not influence the
accuracy of the melt peak determination which is within ± 0.5 °C. Standard
methodologies can influence accuracy of measurement.
Figure 7 shows multiple repeat tests of MTB at different concentrations extracted from
sputa using the process described, the y axis showing the peak melt temperature and
the x axis showing the peak height.
In light of these examples, Figure 8 shows the optimised process for paper
functionalisation with SiQAC compounds and sample analysis.
Example 4. Pyrosequencing of Mycobacterium tuberculosis extracted using SiQAC
from sputum samples
Three sputum samples were processed using SiQAC (3-TPAC) functionalised
composite cards. 1.5mm discs were added to a standard 16S ribosomal DNA
amplification with no hot start (i.e. cycling only) and the resulting amplicons were
analysed using pyrosequencing. The results showed good amplification of core
sequence regions providing >25 nucleotide read lengths indicative of good extraction
and amplification:
Search mode: Full search
Mean identity score: 100%
Search engine: PyroMark Q96 ID
Reference database: HULPII
Reference sequence: M . microti ATCC19422.
Sample 1 > CGGCTGCTGGCACGTAGTTGGCCGGTCCTTCTT
Sample 2 > CGGCTGCTGGCACGTAGTTGGCCGGTCCTTCTT
Sample 3 > CGGCTGCTGGCACGTAGTTGGCCGGTCC
Example 5: Isolation of microbial DNA from whole milk
Whole milk is a difficult sample type for PCR with many inhibitors. Composite paper
was functionalised using the preferred method (illustrated in Figure 8). A single 1.5mm
disc of functionalised paper plus dried milk sample was added to a standard PCR mix
with primers for universal 16S ribosomal DNA amplification. Amplified DNA was run on
a standard gel. Figure 9 shows the results. (Lane 1: Molecular weight marker; Lane 2:
5m I E. coli reference gDNA + 1m I 100% Si-QAC (3-TPAC) solution; Lane 3: 5m I E. coli
reference gDNA + 1m I 10% Si-QAC (3-TPAC) solution; Lane 4: 5m I E. coli reference
gDNA + 1m I 1% Si-QAC (3-TPAC) solution; Lane 5: 1.5mm disc functionalised with
10% Si-QAC (3-TPAC) solution + 20m I of whole dairy milk; Lane 6: 1.5mm disc
functionalised with 1% Si-QAC (3-TPAC) solution + 20m I of whole dairy milk; Lane 7:
1.5mm disc functionalised + 20m I of whole dairy milk; Lane 8: 1m I whole dairy milk).
The data shown demonstrates that functionalisation with 1% Si-QAC (3-TPAC)
enhances amplification compared to untreated paper (lanes 6 & 7).
Discs were checked for residual bacteria by inoculating enrichment media for lactic
bacteria (tryptone 5g/l, dextrose 1g/l, yeast extract 2.5g/l and skimmed milk powder
1g/l) plus 4% agar - R.C. MARSHALL (1993) Standard Methods for the Microbiological
examination of dairy products, 16th Ed. (American Public Health Association).
Overnight culture showed no bacterial growth on discs treated with Si-QAC (3-TPAC)
but confluent growth on culture plates of untreated discs confirming that the
functionalised paper decontaminated the liquid within 15 minutes.
Example 6: rt-pcr from RNA extracted from HIV virus from serum using functionalised
cards
SUMMARY
Functionalised cards worked for RT-nested PCR of HIV K103 amplicon with a plasma
sample from a positively diagnosed anonymous patient. Parallel assay with a full blood
sample from a different patient (also positively diagnosed) gave no results either in
PCR (no fragments were detected in 1% agarose gels) or pyro.
ASSAY DESCRIPTION
Two cards were functionalized using purification solution (PF solution, containing 3-
TPAC) following the standardized protocol:
1. Open the card and apply 20 microl. of 1/1 00 PF solution diluted in buffer (5 mM Tris
HCI (pH 9.0), 0'2 mM MgCI2)
2. Dry for 15 minutes
3. Apply 20 microl. of sample*
4. Dry for 15 minutes
5. Punch a single disc and add to RT
*Samples were plasma from peripheral HIV positive blood ( 1 ) and peripheral HIV
positive blood (2)
RT mix used was Applied Biosystems Superscript VILO cDNA synthesis kit as
described in the user's manual adjusting to a final volume of 30microl.
PCR was later prepared in the following way:
H20 - 5.8 m I
10x PCR buffer - 5 m I
MgCI2 [50mM] - 2 m I
dNTPs O ΊM· - 1.2 m I
1849+ · 10mM· - 1 m I
3500- · 10mM· - 1 m I
Ultratools Taq polymerase [ 1u/ m I] - 1 m I
cDNA from Superscript VILO cDNA synthesis kit - 30 m I
Primers used were:
1849+ 5'-GATGACAGCATGTCAGGGAG
3500- 5'-CTATTAAGTATTTTG ATGGGTCATAA
PCR program:
94 °C 2 min, followed by 45 cycles of
94 °C 30 sec
50°C 30 sec
72°C 1min 30 sec ; followed by
72°C 5min
10°C °
The product of this PCR is 1702 bp long and contains the gag-pro-pol region of HIV1 .
This amplicon was used as a template for the second PCR.
Second PCR was prepared in the following way:
H20 - 20 m I
10x PCR buffer - 4 m I
MgCI2 [50mM] - 1.6 m I
dNTPs · 10h M· - 0.8 m I
K103 · 10mM· - 3.2 m I
BioK103F · 10mM· - 3.2 m I
Biotools Taq polymerase [ 1u/ m I] - 0.5 m I
PCR product from the nested PCR - 5 m I
Primers used were:
K 193F 5'-GGAATACCACATCCYGCAGG
BioK1 03R 5'-[Biotin]AATATTGCTGGTGATCCTTTCC
PCR program:
95°C 5 min; followed by 30 cycles of
95°C 30 sec
55°C 30 sec
72°C 30 sec ; followed by
72°C 5min
10°C
The PCR product from the second PCR is 203bp and was used in the pyrosequencing
reaction following the enrichment approach shown in Figure 10.
RESULTS
Only the plasma sample gave good signals in the pyrosequencer, the blood sample
gave no result at all following the protocol described. The sequencing primer used was
K103F (5'-GGAATACCACATCCYGCAGG) and the sequence obtained was matched
against the complete HIV genome using the BLAST tool of the NCBI. The sequence
successfully matched to the HIV - see Figure 11.

CLAIMS:
1. A method of preparing nucleic acids from a biological sample comprising a) cellular
material having a cell membrane, or b) cellular material having a cell wall, or c) viral
material having a viral envelope or d) viral material having a viral capsid; the method
comprising contacting the sample with a substrate, the substrate being functionalised
with a biocidal agent which is capable of i) weakening the cell membrane, cell wall, viral
envelope, or viral capsid; or ii) lysing cellular or viral material; wherein the biocidal
agent comprises multiple functional groups, the multiple functional groups comprising a
binding moiety, which is involved in binding the agent to the substrate; a hydrophobic
moiety; and a charged moiety.
2. The method of claim 1, further comprising the step of subjecting the sample to heat
after the contacting step.
3. The method of claim 1 or 2, wherein the substrate is a cellulose material; preferably
a cellulose filter paper or a cellulose matrix.
4. The method of claim 3 wherein the cellulose material is a composite paper.
5. The method of claim 4 wherein the composite paper comprises a lateral flow layer,
to remove liquid and low molecular weight contaminants and inhibitors from the sample
which is deposited on a surface of the paper.
6. The method of any of claims 1 or 2 wherein the substrate is glass or plastic.
7. The method of any preceding claim wherein the substrate is in the form of a
microfluidic channel or a reaction vessel or other container.
8. The method of any preceding claim wherein the hydrophobic moiety comprises an
alkyl chain, for example C5-C30 alkyl, preferably C10-C20 alkyl.
9. The method of any preceding claim wherein the charged moiety is positively
charged.
10. The method of any any preceding claim wherein the charged moiety is a quaternary
ammonium group.
11. The method of any preceding claim wherein the binding moiety comprises a
hydroxyl group.
12. The method of any preceding claim wherein the functional groups are an alkyl
chain, a silyl group, and an ammonium chloride group.
13. The method of any preceding claim wherein the biocidal agent is a silylated
quaternary ammonium compound (SiQAC).
14. The method of any preceding claim wherein the biocidal agent is 3-(trimethoxysilyl)
propyldimethyloctadecyl ammonium chloride.
15. The method of any of claims 1 to 11 wherein the biocidal agent is selected from
a) telechelic poly(2-alkyl-1 ,3-oxazolines);
b) cellulose with an antimicrobial DDA group;
c) a saponin
16. The method of any preceding claim wherein the biological sample comprises
cellular material having a cell wall.
17. The method of any preceding claim wherein the cellular material comprises a
prokaryotic cell.
18. The method of any of claims 1 to 16 wherein the cellular material comprises plant
or fungal cells.
19. The method of any of claims 1 to 15 wherein the biological sample comprises
eukaryotic animal cells.
20. The method of any of claims 1 to 15 wherein the biological sample comprises viral
material.
2 1. A method of amplifying nucleic acids in a biological sample, the method comprising:
preparing nucleic acids according to the method of any of claims 1 to 20; and
subjecting the prepared acids to a nucleic acid amplification step, preferably a
polymerase chain reaction (PCR) amplification.
22. A device for preparing nucleic acids from a biological sample comprising a) cellular
material having a cell membrane, or b) cellular material having a cell wall, or c) viral
material having a viral envelope or d) viral material having a viral capsid; the device
comprising a substrate functionalised with a biocidal agent which is capable of i)
weakening the cell membrane, cell wall, viral envelope, or viral capsid; or ii) lysing
cellular or viral material, wherein the biocidal agent comprises multiple functional
groups, the multiple functional groups comprising a binding moiety, which is involved in
binding the agent to the substrate; a hydrophobic moiety; and a charged moiety.
23. The device of claim 22, wherein the substrate is a cellulose material; preferably a
cellulose filter paper or a cellulose matrix.
24. The device of claim 23 wherein the cellulose material is a composite paper.
25. The device of claim 22 wherein the substrate is glass or plastic.
26. The device of any of claims 22 to 25 wherein the substrate is in the form of a
microfluidic channel or a reaction vessel or other container.
27. The device of any of claims 22 to 26 wherein the hydrophobic moiety comprises an
alkyl chain, for example C5-C30 alkyl, preferably C10-C20 alkyl.
28. The device of any of claims 22 to 27 wherein the charged moiety is positively
charged.
29. The device of any of claims 22 to 28 wherein the charged moiety is a quaternary
ammonium group.
30. The device of any of claims 22 to 29 wherein the binding moiety comprises a
hydroxyl group.
3 1. The device of any of claims 22 to 30 wherein the functional groups are an alkyl
chain, a silyl group, and an ammonium chloride group.
32. The device of any of claims 22 to 3 1 wherein the biocidal agent is a silylated
quaternary ammonium compound (SiQAC).
33. The device of any of claims 22 to 32 wherein the biocidal agent is 3-
(trimethoxysilyl) propyldimethyloctadecyl ammonium chloride.
34. The device of claim 22 wherein the biocidal agent is selected from
a) telechelic poly(2-alkyl-1 ,3-oxazolines);
b) cellulose with an antimicrobial DDA group;
c) a saponin
35. The device of any of claims 22 to 34 wherein the substrate is integrated into a
sample preparation cartridge or the like.