Abstract: The present disclosure relates to identical multi-repeat DNA sequences and a method for identification of the said sequences. The disclosure further relates to employing the primers set forth as SEQ ID No. 1 and SEQ ID No.2 to detect Plasmodium, preferably Plasmodium Falciparum strain including but not limiting to Pf 3D7, Pf NF54, Pf K1 PfDd2 and Pf HB3 in a sample. The disclosure furthermore relates to a kit comprising the said primers for the detection of the said infection.
1. Nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2.
2. The nucleotide sequences as claimed in claim 1, wherein the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer
3. A method of identifying presence or absence of Plasmodium in a sample, said method comprising acts of: a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent; b) providing conditions suitable for amplification and observing presence or absence of amplified product to identify presence or absence of the Plasmodium in the sample.
4. The method as claimed in claim 3, wherein the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer.
5. The method as claimed in claim 3, wherein the sample is a liquid or solid media having or suspected of having Plasmodium.
6. The method as claimed in claim 3, wherein the nucleic acid amplification reagent is selected from a group comprising polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
7. The method as claimed in claim 3, wherein the conditions suitable for amplification comprises steps of a) subjecting the sample to denaturation at a temperature ranging from about 90°C to about 100°C for about 5minutes to about lOminutes, b) subsequently allowing the denatured sample to about 30 amplification cycles to about 40 amplification cycles of further denaturation, annealing and extension, wherein said denaturation is at a temperature ranging from about 90°C to about 100°C for about 10 seconds to about 100 seconds, said annealing is at a temperature ranging from about 50°C to about 100°C for about 10 seconds to about 100 seconds and extension is at a temperature ranging from about 50°C to about 100°C for about to about lminute to about 3 minutes.
8. The method as claimed in claim 3, wherein the observing presence or absence of the amplified product is carried by a process selected from a group comprising electrophoresis, sequencing, gel elution and blot technique, or any combination thereof.
9. The method as claimed in claim 3, wherein the method identifies Plasmodium falciparum strain selected from a group comprising P/3D7, iyNF54, PfKl, PfDd2 and PfHB3, or any combination thereof.
10. The method as claimed in claim 3, wherein the amplification of the nucleotide sequences by the SEQ ID No. 1 and the SEQ ID No.2 results in reduction in cycle threshold by about 8 cycles when compared to amplification carried out in absence of the SEQ ID No. 1 and the SEQ ID No.2.
11. A method of distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said method comprising acts of: a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent to amplify complimentary sequence in the sample; b) providing conditions suitable for amplification and observing the amplified product to distinguish Plasmodium falciparum from other species of Plasmodium.
12. The method as claimed in claim 11, wherein the sample is a liquid or solid media having or suspected of having plasmodium.
13. The method as claimed in claim 11, wherein the other species of Plasmodium is selected from a group comprising Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium brasilianum, Plasmodium cynomolgi, Plasmodium cynomolgibastianelli, Plasmodium inui, Plasmodium rhodiani, Plasmodium schweitzi, Plasmodium semiovale and Plasmodium simium, or any combination thereof.
14. The method as claimed in claim 11, wherein the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer. The method as claimed in claim 11, wherein the nucleic acid amplification reagent is selected from a group comprising polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
15. The method as claimed in claim 11, wherein the conditions suitable for amplification comprises steps of a) subjecting the sample to denaturation at a temperature ranging from about 90°C to about 100°C for about 5minutes to about lOminutes, b) subsequently allowing the denatured sample to about 30 amplification cycles to about 40 amplification cycles of further denaturation, annealing and extension, wherein said denaturation is at a temperature ranging from about 90°C to about 100°C for about 10 seconds to about 100 seconds, said annealing is at a temperature ranging from about 50°C to about 100°C for about 10 seconds to about 100 seconds and extension is at a temperature ranging from about 50°C to about 100°C for about to about lminute to about 3 minutes.
16. The method as claimed in claim 11, wherein the observing presence or absence of the amplified product is carried by a technique selected from a group comprising electrophoresis, sequencing, gel elution and blot technique, or any combination thereof.
17. The method as claimed in claim 11, wherein the amplification of the nucleotide sequences by the SEQ ID No. 1 and the SEQ ID No.2 results in reduction in cycle threshold by about 8 cycles when compared to amplification carried out in absence of the SEQ ID No. 1 and the SEQ ID No.2.
18. A kit for identifying presence of Plasmodium in a sample or for distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said kit comprising a nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No. 2 along with reagents and buffers; optionally along with instruction manual.
19. The kit as claimed in claim 18, wherein the sample is a liquid or solid media having or suspected of having microorganisms.
20. A method for assembling a kit as claimed in claim 18, said method comprising act of collating nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No.2 with reagents and buffers for the identification; optionally along with instruction manual.
21. The kit and the method as claimed in claim 18 or 20, wherein the SEQ ID No.l and SEQ ID No.2 are individually forward primer or reverse primer or a combination thereof.
22. The kit and the method as claimed in any of the preceding claims, wherein the Plasmodium falciparum strain selected from a group comprising Pf3D7, iyNF54, Pf Kl PfDd2 andiyHB3, or any combination thereof.
TECHNICAL FIELD
The present disclosure relates to multi-repeat nucleic acid sequences and a method for identification of said sequences. The disclosure further relates to a method of identifying Plasmodium, preferably Plasmodium falciparum by the primers set forth as SEQ ID No. 1 and SEQ ID No.2 and a kit comprising the said primer sequence(s) for detection of the parasitic infection.
BACKGROUND OF THE DISCLOSURE
Plasmodium falicparum is the predominantly known species of Plasmodium and widely spread across the globe leading to multiple complications. Having said the above, there is considerable amount of gene overlapping among various species of Plasmodium and Plasmodium falciparum, which makes it difficult to identify Plasmodium falciparum from other species of Plasmodium. This difficulty in identifying or distinguishing Plasmodium falciparum further limits the study and research on P.falciparum with minimal genetic information. Thus there is a need to overcome this limitation of identification or distinguishing Plasmodium falciparum in a liquid or solid media having microorganism, wherein such media is having or suspected of having Plasmodium falciparum alongside other Plasmodium species. Although there are conventional methods for identification of Plasmodium falciparum from a sample or media by using 18SrRNA primers or other conventionally known primers, the use of such primers for identification or distinguishing Plasmodium falciparum is a tedious and time consuming process with minimal outcome. Also the conventional processes are not able to identify or distinguish Plasmodium falciparum in a sample or liquid or solid media which is very minimal in quantity. On the other hand, the disclosure of the instant invention is able to circumvent all the complexities and limitations of the conventional methods of identification and distinguishing Plasmodium falciparum, which is described in detail in this specification herein below.
STATEMENT OF THE DISCLOSURE
Accordingly the present disclosure relates to Nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2; a method of identifying presence or absence of Plasmodium in a sample, said method comprising acts of: a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent, b) providing conditions suitable for amplification and observing presence or absence of amplified product to identify presence or absence of the Plasmodium in the sample; a method
of distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said method comprising acts of: a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent to amplify complimentary sequence in the sample, b) providing conditions suitable for amplification and observing the amplified product to distinguish Plasmodium falciparum from other species of Plasmodium; a kit for identifying presence of Plasmodium in a sample or for distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said kit comprising a nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No. 2 along with reagents and buffers; optionally along with instruction manual; and a method for assembling a kit as mentioned above, said method comprising act of collating nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No.2 with reagents and buffers for the identification; optionally along with instruction manual.
BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES
In order that the disclosure may be readily understood and put into practical effect, reference will now be made to exemplary embodiments as illustrated with reference to the accompanying figures. The figures together with a description below are incorporated in and form part of the specification, and serve to further illustrate the embodiments and explain various principles and advantages, in accordance with the present disclosure where:
Figure 1 illustrates the multi repeat nucleic acid sequences as occurring in the 14 chromosomes of Plasmodium falciparum genome.
Figure 2 illustrates the representation of the amplified products of genomic DNA of Plasmodium falciparum and human genomic DNA.
Figure 3 illustrates the amplification curves by the primers of the instant disclosure and 18SrRNA.
Figure 4 illustrates the amplification of Plasmodium Falciparum strain iyKl by primers of the present disclosure and 18SrRNA.
DETAILED DESCRIPTION OF THE DISCLOSURE
The present disclosure relates to nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID
No. 2.
In an embodiment of the present disclosure, the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer
The present disclosure further relates to a method of identifying presence or absence of Plasmodium in a sample, said method comprising acts of:
a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent;
b) providing conditions suitable for amplification and observing presence or absence of amplified product to identify presence or absence of the Plasmodium in the sample.
In an embodiment of the present disclosure, the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer.
In another embodiment of the present disclosure, the sample is a liquid or solid media having or suspected of having Plasmodium.
In yet another embodiment of the present disclosure, the nucleic acid amplification reagent is selected from a group comprising polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
In still another embodiment of the present disclosure, the conditions suitable for amplification comprises steps of
a. subjecting the sample to denaturation at a temperature ranging from about
90°C to about 100°C for about 5minutes to about lOminutes,
b. subsequently allowing the denatured sample to about 30 amplification cycles
to about 40 amplification cycles of further denaturation, annealing and
extension, wherein said denaturation is at a temperature ranging from about
90°C to about 100°C for about 10 seconds to about 100 seconds, said
annealing is at a temperature ranging from about 50°C to about 100°C for
about 10 seconds to about 100 seconds and extension is at a temperature
ranging from about 50°C to about 100°C for about to about lminute to about
3 minutes.
In still another embodiment of the present disclosure, the observing presence or absence of the amplified product is carried by a process selected from a group comprising electrophoresis, sequencing, gel elution and blot technique, or any combination thereof.
In still another embodiment of the present disclosure, the method identifies Plasmodium falciparum strain selected from a group comprising P/3D7, /yNF54, Pf Kl, PfDd2 and Pf HB3, or any combination thereof.
In still another embodiment of the present disclosure, the amplification of the nucleotide sequences by the SEQ ID No. 1 and the SEQ ID No.2 results in reduction in cycle threshold by about 8 cycles when compared to amplification carried out in absence of the SEQ ID No. 1 and the SEQ ID No.2.
The present disclosure further relates to a method of distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said method comprising acts of:
a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent to amplify complimentary sequence in the sample;
b) providing conditions suitable for amplification and observing the amplified product to distinguish Plasmodium falciparum from other species of Plasmodium.
In an embodiment of the present disclosure, the sample is a liquid or solid media having or suspected of having plasmodium.
In another embodiment of the present disclosure, the other species of Plasmodium is selected from a group comprising Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium brasilianum, Plasmodium cynomolgi, Plasmodium cynomolgibastianelli, Plasmodium inui, Plasmodium rhodiani, Plasmodium schweitzi, Plasmodium semiovale and Plasmodium simium, or any combination thereof.
In yet another embodiment of the present disclosure, the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer.
In still another embodiment of the present disclosure, the nucleic acid amplification reagent is selected from a group comprising polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
In still another embodiment of the present disclosure, the conditions suitable for amplification comprises steps of
c. subjecting the sample to denaturation at a temperature ranging from about
90°C to about 100°C for about 5minutes to about lOminutes,
d. subsequently allowing the denatured sample to about 30 amplification cycles
to about 40 amplification cycles of further denaturation, annealing and
extension, wherein said denaturation is at a temperature ranging from about
90°C to about 100°C for about 10 seconds to about 100 seconds, said
annealing is at a temperature ranging from about 50°C to about 100°C for
about 10 seconds to about 100 seconds and extension is at a temperature
ranging from about 50°C to about 100°C for about to about lminute to about
3 minutes.
In still another embodiment of the present disclosure, the observing presence or absence of the amplified product is carried by a technique selected from a group comprising electrophoresis, sequencing, gel elution and blot technique, or any combination thereof.
In still another embodiment of the present disclosure, the amplification of the nucleotide sequences by the SEQ ID No. 1 and the SEQ ID No.2 results in reduction in cycle threshold by about 8 cycles when compared to amplification carried out in absence of the SEQ ID No.
1 and the SEQ ID No.2.
The present disclosure further relates to a kit for identifying presence of Plasmodium in asample or for distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said kit comprising a nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No.
2 along with reagents and buffers; optionally along with instruction manual.
In an embodiment of the present disclosure, the sample is a liquid or solid media having or suspected of having microorganisms.
The present disclosure relates to a method for assembling a kit, said method comprising act of collating nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No.2 with reagents and buffers for the identification; optionally along with instruction manual.
In an embodiment of the present disclosure, the SEQ ID No.l and SEQ ID No.2 are individually forward primer or reverse primer or a combination thereof.
In another embodiment of the present disclosure, the Plasmodium falciparum strain selected from a group comprising P/3D7, iyNF54, PfKl PfDd2 and PfHB3, or any combination thereof.
The present disclosure relates to identical multi repeat nucleic acid sequences (IMRS) in the genome of Plasmodium species.
In an embodiment of the present disclosure, the identical multi repeat nucleic acid sequences are DNA sequences repeating at multiple sites in the genome of Plasmodium falciparum.
In another embodiment of the present disclosure, the identical multi repeat DNA sequences belong to Plasmodium falciparum strain, preferably selected from a group comprising but not limiting to Plasmodium falciparum3D7 (Pf3D7) having a MR4 number of MRA 102 of a West African origin, wherein the Pf 3D7 is cloned from NF54, Plasmodium falciparum NF54 (Pf NF54), Plasmodium falciparum Kl (Pf Kl), Plasmodium falciparum Dd2 and Plasmodium falciparum HB3 or any combination thereof. These strains have been employed in the instant disclosure for purpose of experimentation only and hence should not be construed to be limited to these strains of Plasmodium falciparum alone.
In an embodiment of the present disclosure, Plasmodium falciparum3D7 (Pf3D7) is having a MR4 number of MRA 102 from a West African origin, wherein the Pf 3D7 is cloned from NF54, Plasmodium falciparum NF54 CP/NF54) is having a MR4 number of MRA 1000 from a West African origin and Plasmodium falciparum Kl (iyKl) is having a MR number MRA-159 from a Thailand origin.
In yet another embodiment, the identical multi repeat nucleic acid sequences from the strains of Plasmodium falciparum including but not limiting to Pf3D7, iyNF54, PfKl PfDd2 and iyHB3 do not have any cross reactivity.
In still another embodiment of the present disclosure, the 3D7 genome of Plasmodium falciparum comprises 14 chromosomes and the identical multi repeat DNA sequences are identified to be present on all the chromosomes, excluding the occurrence on chromosome 14.
In still another embodiment of the present disclosure, the identical multi repeat DNA sequences are present at the 5' end of the plus strand (sense strand) and at the minus strand (antisense strand) of said chromosomes. Similarly, identical multi repeat DNA sequences are present at the 3' end of both plus as well as minus strands of said chromosomes.
In still another embodiment of the present disclosure, the identical multi repeat DNA sequences present at the 5' end of plus and minus strand, repeats about 152 times in the genome of P.falciparum.
In still another embodiment of the present disclosure, the identical multi repeat DNA sequences present at the 5' end of the plus strand occur on all the chromosomes of P.falciparum, with the exception of chromosomes 6 and 14, which is illustrated in Table 1.
In still another embodiment of the present disclosure, the identical multi repeat DNA sequences present at the 5' end of the minus strand occur on all the chromosomes of P.falciparum, with the exception of chromosomes 5, 11 and 14, illustrated in Table 2.
In still another embodiment of the present disclosure, the identical multi repeat DNA sequences present at the 3' end of the both plus and minus strand, repeats about 123 times in the genome oi P.falciparum.
In still another embodiment of the present disclosure, the identical multi repeat DNA sequences present at the 3' end of the plus strand occur on all the chromosomes of P.falciparum, with the exception of chromosomes 5, 11 and 14, illustrated in Table 3.
In still another embodiment of the present disclosure, the identical multi repeat DNA sequences present at the 3' end of the minus strand occur on all the chromosomes of P.falciparum, with the exception of chromosomes 5, 6, 13 and 14, illustrated in Table 4.
The identical multi repeat DNA sequences in the genome of P.falciparum strains including but not limiting to Pf 3D7, iyNF54, PfYA PfDd2 and iyHB3 are identified by an in-silico
model, wherein said model enables detecting the identical multi repeating DNA sequences in the genome of P.falciparum. The said in-silico model identifies varying lengths of identical multi repeat units, determines their location and also identifies the number of times the said multi repeat DNA sequences are repeating in the genome of P.falciparum strains including but not limiting to P/3D7, P/NF54, P/Kl PfDd2 and P/HB3.
In an embodiment, the term "sample" employed within the purview of the present disclosure refers to any liquid or solid media, having or suspected of having microorganisms including but not limiting to any plasmodium species such as Plasmodium falciparum,Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium brasilianum, Plasmodium cynomolgi, Plasmodium cynomolgi bastianelli, Plasmodium inui, Plasmodium rhodiani, Plasmodium schweitzi, Plasmodium semiovale, and Plasmodium simium; wherein the said liquid or solid media supports growth and/or survival of said microorganisms. In an exemplary embodiment, such media includes but is not limited to water, saline, blood, urine, serum, and saliva.
In an exemplary embodiment, the media is a general purpose growth media including but not limited to RPMI 1640.
The present disclosure further relates to a method for identification of multi repeat DNA sequences in the P.falciparum genome by using the in-silico model, said method comprises acts not limiting to:
a. identifying the sequences with specific window size, at discrete locations throughout
the genome in very specified and strategic manner which varies Genome to Genome;
b. comparing all the identified sequences and grouping them based on number of repeats
as word count;
c. allowing the sequences, which have word count > 1 to grow further on both sides
throughout the genome wherever it occurs, and repeating the step two on grown
sequence and continuing the same for all the sequences. Updating the sequence list to
grown list along with word count, each time at the end of step three; and
d. looping step three till it achieves the word count = 1 for all the sequences.
The present disclosure further relates to primer sequence(s)to amplify the region(s) adjacent to identical multi repeat sequences identified in the genome of P.falciparum strains including but not limiting to P/3D7, P/NF54, PfKl PJDd2 and P/HB3.
In an alternate embodiment, the primer sequence(s) of the present disclosure bind to the genomic DNA of the P.falciparum strains including but not limiting to Pf 3D7, Pf NF54 and PfKl, wherein the binding is with respect to the complementary region(s) of the identical multi repeat sequences in the genome of P. falciparum strains including but not limiting to Pf 3D7, P/NF54, PfKl PfDd2 andP/HB3.
In an embodiment, the primer sequence(s) of the present disclosure individually act both as a forward and reverse primer(s).
In another embodiment, the present disclosure relates to a primer sequence set forth as SEQ ID No.l, which independently acts as both forward and reverse primer, respectively.
In yet another embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 1 binds to the complementary regions of the identical multi repeat DNA sequences occurring at 5' end of both plus and minus strand in the genome of P.falciparum strains including but not limiting to P/3D7, P/NF54, PfKl PfDd2 and P/HB3.
In an alternate embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 1 binds to complementary regions of the identical multi repeat DNA sequences occurring at any position(s) of both plus and minus strand in the genome of the P.falciparum strains including but not limiting to P/3D7, P/NF54, PfKl PfDd2 and P/HB3.
In another alternate embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 1 binds at single or multiple complementary regions of the identical multi repeat DNA sequences occurring at any position (s) of both plus and minus strand in the genome of the P.falciparum strains including but not limiting to Pf3D7, P/NF54, PfKl PfDd2 and Pf HB3.
In still another embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 1 amplifies the region adjacent to the identical multi repeat sequences in the genome
of P.falciparum strains including but not limiting to P/3D7, PfNF54, Pf Kl PfDd2 and Pf HB3.
In another embodiment, the present disclosure relates to a primer sequence set forth as SEQ ID No. 2, which independently acts as both forward and reverse primer, respectively.
In yet another embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 2 binds to the complementary regions of the identical multi repeat DNA sequences occurring at 3' end of both plus and minus strand in the genome of P.falciparum strains including but not limiting to P/3D7, P/NF54, Pf Kl PfDd2 and P/HB3.
In an alternate embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 2 binds to complementary regions of the identical multi repeat DNA sequences occurring at any position (s) of both plus and minus strand in the genome of the P.falciparum strains including but not limiting to P/3D7, P/NF54, PfKl PfDd2 and P/HB3.
In another alternate embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 2 binds at single or multiple complementary regions of the identical multi repeat DNA sequences occurring at any position (s) of both plus and minus strand in the genome of the P.falciparum strains including but not limiting to Pf3B7, P/NF54, Pf Kl PfDd2 and Pf HB3.
In still another embodiment of the present disclosure, the primer sequence set forth as SEQ ID No. 2 amplifies the region adjacent to the identical multi repeat sequences in the genome of P.falciparum strains including but not limiting to Pf3B7, iyNF54, Pf Kl PfDd2 and Pf HB3.
In still another embodiment of the present disclosure, the primers set forth as SEQ ID No.l or SEQ ID No.2 of the present disclosure are chemically synthesized and these sequences are non-naturally occurring in any form therefrom.
The present disclosure also relates to identification of infection in a sample infected with or suspected of being infected with a species of Plasmodium, preferably with Plasmodium falciparum strain including but not limiting to Pf3B7, P/NF54, Pf Kl PfDd2 and iyHB3, wherein the said identification involves the identification of presence of Plasmodium
falciparum strain including but not limiting to Pf 3D7, P/NF54, Pf Kl PfDdl and iyHB3 in the sample.
In an embodiment of the present disclosure, the identification of infection in the sample suspected to be infected with or infected with a species of Plasmodium preferably with Plasmodium falciparum strain including but not limiting to Pf3D7, iyNF54, PfKl PfDd2 and iyHB3, is carried out by the primers set forth as SEQ ID No. land SEQ ID No.2 of the present disclosure.
In an embodiment of the present disclosure, a method of distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said method comprising acts of:
c) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagents to amplify complimentary sequence in the sample;
d) providing conditions suitable for amplification and observing the amplified product to distinguish Plasmodium falciparum from other species of Plasmodium.
In an exemplary embodiment of the present disclosure, the nucleic acid amplification reagents is selected from a group comprising of polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
In another exemplary embodiment of the present disclosure, the conditions suitable comprises steps of subjecting the sample for denaturation at a temperature of about 90°C to about 100°C for about 5minutes to about lOminutes, subsequently allowing the denatured sample for denaturation, annealing and extension for about 30 cycles to about 40cycles, wherein denaturation is at a temperature of about 90°C to about 100°C for about lOseconds to about 100 seconds, annealing is at a temperature of about 50°C to about 100°C for about 10 seconds to about 100 seconds and extension is at a temperature of about 50°C to about 100°C for about to about lminute to about 3 minutes.
In another exemplary embodiment of the present disclosure, the observing presence or absence of the amplified product is carried by a process selected from a group comprising electrophoresis, sequencing, gel elution and blot technique, or any combination thereof.
In an alternate embodiment of the present disclosure, the process of identification of Plasmodium falciparum strain including but not limiting to P/3D7, iyNF54, PfKl PfDd2 and Pf HB3 in the sample suspected to have infection or having infection, not limiting to malarial infection comprises acts of;
a) contacting the reaction mixture comprising the sample, nucleic acid amplification reagents and nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No. 2;
b) binding the SEQ ID No. 1 and the SEQ ID No.2 to regions complementary to said sequences in the genome of Plasmodium falciparumstvam including but not limiting to P/3D7, P/NF54, PfKl PfDd2 and P/HB3;
c) amplifying nucleotide sequences between the regions of step (b) to obtain an amplified product; and
d) subjecting the amplified product to gel electrophoresis to identify the amplified product followed by optionally quantifying the product, thereby identifying presence of the Plasmodium falciparumstvam in the sample.
e) optionally, the amplified product is monitored in real time, thereby identifying and quantifying the Plasmodium falciparum.
In yet another embodiment of the present disclosure, the method or process of identification of Plasmodium falciparum strain including but not limiting to Pf 3D7, Pf NF54 and PfKlin the sample further includes amplification comprising steps of initial denaturation at a temperature of about 90°C to about 100°C for about 5minutes to about lOminutes, subsequently allowing the denatured sample for denaturation, annealing and extension for about 30 cycles to about 40cycles, wherein denaturation is at a temperature of about 90°C to about 100°C for about lOseconds to about 100 seconds, annealing is at a temperature of about 50°C to about 100°C for about 10 seconds to about 100 seconds and extension is at a temperature of about 50°C to about 100°C to about lminute to about 3 minutes.
In an embodiment, the sample is any biological material comprising plurality of Plasmodium species, preferably Plasmodium falciparum strain including but not limiting to Pf 3D7, Pf NF54, Pf Kl PfDd2 and-P/"HB3, optionally alongside microorganism.
In still another embodiment of the present disclosure, the above described process of identification involves employing DNA intercalating dye selected from a group comprising SYBR Green, EVA green and SYTO wherein fluorescence is measured during binding of the dye to DNA at the time of extension step during amplification.
In an alternate embodiment of the present disclosure, amplification of the genome of Plasmodium falciparum strain including but not limiting to P/3D7, iy~NF54, PfKl PfDd2 and Pf HB3 by the primers set forth as SEQ ID No. 1 and SEQ ID No.2 of the present disclosure is by multi nested loop amplification.
The amplification of the genome of the Plasmodium falciparum strain by the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 is multi nested loop amplification, because the base pair distance between the multi repeat DNA sequences of the 5' end and the 3' end in the genome of P.falciparum falls within the base pair length limit of the amplification reaction. Hence, during amplification, a nesting-like process occurs, i.e.an amplified product of one pair of primer yields product that can act as template for many pairs of primers in contrast to the fact that in conventional primer PCRs, the product can act as template for only one-pair of the primer. Hence in the current amplification procedure there is a nesting (many templates created within one amplification) and a loop (the process goes on like a loop) and therefore construed to be multi nested loop amplification.
In an embodiment of the present disclosure, the amplified products obtained by the above described process upon employing the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 are of varying length. This is a unique feature of the amplification employed in the present disclosure, which is in contrast to conventional PCR based amplification, wherein a pair of single copy of primers gives rise to specified length of amplified product.
In yet another embodiment of the present disclosure, one of the ordinary skilled in the art will appreciate that the above described steps of amplification can be optimized depending on the nature of quantification required with respect to the gene or genome while analysing the sample without deviating from the scope of the invention. Further, one of the ordinary skilled will also appreciate that the process steps illustrated herein are performed under ideal laboratory condition and they will vary with optimization when the same are performed in the field/market or in large scale, wherein the sample is any biological material comprising
plurality of Plasmodium species, preferably Plasmodium falciparum strain including but not limiting to Pf 3D7, Pf NF54 and Pf Kl, optionally alongside microorganism.
The present disclosure further relates to a method or process of identification of P.falciparum strain including but not limiting to Pf3D7, iyNF54, Pf Kl PfDd2 and iyHB3 from a sample which involves subjecting the sample to Nucleic Acid Lateral Flow strip detection, wherein the strip comprises SEQ ID No.land SEQ ID No.2 optionally along with an identifying agent, wherein the sample is any biological material comprising plurality of Plasmodium species, preferably Plasmodium falciparum strain including but not limiting to Pf 3D7, Pf NF54, PfKl PfDd2 andiyHB3, optionally alongside microorganism.
In an embodiment, the primers of the present disclosure set forth as SEQ ID No. 1 and SEQ ID No. 2 during identification of the infection are able to detect the infection in the sample by amplifying 8 to 10 cycles earlier than the use of the conventional primers in detection of the said infection. The threshold cycle of detecting the amplification by the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 is significantly lower than the conventional primers and thereby the primers of the instant disclosure are able to detect the infection in the sample earlier in comparison to the use of the conventional primers.
In another embodiment of the present disclosure, the sensitivity of detection of infection in the sample using the process and primer sequence(s) is significantly high. The present disclosure uses more than hundred repeats acting in a multi-nested looped amplification which causes the amplification to be detected at an average of about 10 cycles earlier than the single copy approach, thus enabling faster detection of Plasmodium falciparumm the sample.
In yet another embodiment, the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 of the present disclosure are able to amplify the genome in a sample as less as O.lpg and thereby enabling identification of the infection in the sample with higher sensitivity; wherein the genome is of P.falciparum strain including but not limiting to Pf3D7, iyNF54, Pf'Kl PfDd2 andPfBB3.
In an alternate embodiment, primers of the present disclosure are employed to identify Plasmodium in a minimal sample as less as O.lpg and having plurality of Plasmodium species alongside microorganism.
In another alternate embodiment of the present disclosure, polymorphs of SEQ ID No.l and SEQ ID No.2are used to identify P.falciparum strains including but not limiting to P/3D7, Pf NF54, Pf Kl PfDd2 andP/HB3 in the sample.
The present disclosure also relates to a kit for identifying Plasmodium falciparum strain including but not limiting to Pf 3D7, P/NF54, Pf Kl PfDd2 and P/HB3, wherein said kit comprises primers set forth as SEQ ID No.l and SEQ ID No.2 as single or multiple pairs in a suitable buffer which preserves or maintains said primers in a functionally ordered manner. The kit further comprises identifying agents or amplification reagents or instruction manual or a combination thereof.
In an alternate embodiment, kit of the present disclosure comprising SEQ ID No.l and SEQ ID No.2 distinguishes the Plasmodium falciparum from other species of Plasmodium, wherein said other species of Plasmodium is selected from a group comprising Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium brasilianum, Plasmodium cynomolgi, Plasmodium cynomolgi bastianelli, Plasmodium inui, Plasmodium rhodiani, Plasmodium schweitzi, Plasmodium semiovale and Plasmodium simium, or any combination thereof
In another alternate embodiment, the present disclosure relates to assembling a kit for identification ofPlasmodium falciparum strain including but not limiting to Pf3D7, iyNF54, Pf Kl PfDd2 mdPf~HB3, wherein said assembling comprises-
a) collating primers set forth as SEQ ID No.l and SEQ ID No.2 in single or multiple pairs or a combination thereof in a suitable buffer which preserves or maintains said primers in a functionally ordered manner; wherein said primers are in a single or multiple vial(s) in a predetermined volume, capable of amplifying target sequence; and
b) collating identification reagents or amplification reagents optionally alongside a suitable buffer in a predetermined volume which aids in the amplification of the target sequence by the primers as provided in step a.
optionally along with an instruction manual, indicating how to use the primers and the identification reagents or amplification reagents provided in the kit.
In an embodiment, the primers in the kit of the present disclosure alongside identification reagents or amplification reagents or combination thereof, optionally along with an instruction manual amplifies the target sequence in the sample, preferably amplifies the sequences 8 to 10 cycles earlier than the conventional known kit having primers.
In another embodiment, the kit having primers alongside identification reagents or amplification reagents or combination thereof, optionally along with an instruction manual amplifies the genome of Plasmodium falciparum strain including but not limiting to P/3D7, P/NF54, P/Kl PfDdl and iyHB3, wherein the amplification is 8 to 10 cycles earlier than the conventional known kit having primers for said amplification.
In yet another embodiment, the kit having primers alongside identification reagents or amplification reagents or combination thereof, optionally along with an instruction manual is able to amplify the genome in a sample as less as O.lpg, thereby enabling identification of infection in the sample with high sensitivity; wherein the genome is of P.falciparumstvam including but not limiting to P/3D7, P/NF54, P/Kl PfDd2 and P/HB3.
In still another embodiment of the present disclosure, primers set forth as SEQ ID No. 1 and SEQ ID No.2 or kit or a combination thereof enable in distinguishing Plasmodium falciparum from other species of Plasmodium, wherein the other species of Plasmodium include but are not limited to Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium know le si, Plasmodium brasilianum, Plasmodium cynomolgi, Plasmodium cynomolgi bastianelli, Plasmodium inui, Plasmodium rhodiani, Plasmodium schweitzi, Plasmodium semiovale and Plasmodium simium.
In an alternate embodiment, the present disclosure relates to a method of distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said method comprising acts of:
e) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent to amplify complimentary sequence in the sample;
f) providing conditions suitable for amplification and observing the amplified product to distinguish Plasmodium falciparum from other species of Plasmodium.
In an exemplary embodiment, the nucleic acid amplification reagent is selected from a group comprising polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
In an exemplary embodiment, the conditions suitable for amplification comprises steps of subjecting the sample to denaturation at a temperature ranging from about 90°C to about 100°C for about 5minutes to about lOminutes, subsequently allowing the denatured sample to about 30 amplification cycles to about 40 amplification cycles of further denaturation, annealing and extension, wherein said denaturation is at a temperature ranging from about 90°C to about 100°C for about 10 seconds to about 100 seconds, said annealing is at a temperature ranging from about 50°C to about 100°C for about 10 seconds to about 100 seconds and extension is at a temperature ranging from about 50°C to about 100°C for about to about lminute to about 3 minutes.
In another exemplary embodiment, wherein the observing presence or absence of the amplified product is carried by a technique selected from a group comprising electrophoresis, sequencing, gel elution and blot technique, or any combination thereof.
In another alternate embodiment, the present disclosure relates to method of distinguishing Plasmodium falciparum from other species of Plasmodium, wherein said method comprises acts of:
a) contacting a reaction mixture comprising the sample, nucleic acid amplification reagents and nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No. 2;
b) binding the SEQ ID No. 1 and the SEQ ID No.2 to regions complementary to said sequences in the genome of Plasmodium species;
c) amplifying nucleotide sequences between the regions of step (b) to obtain an amplified product; and
d) subjecting the amplified product to gel electrophoresis to identify the amplified product followed by optionally quantifying the product, thereby distinguishing the presence of the Plasmodium falciparum in the sample from other species of Plasmodium.
In still another embodiment of the present disclosure, in the method of distinguishing Plasmodium falciparum from other species of Plasmodium, the primer sequences set forth as
SEQ ID No.l and SEQ ID No.2 bind and amplify only the genome of Plasmodium falciparum.
In still another embodiment of the present disclosure, the sample in the method of distinguishing Plasmodium falciparum from other species of Plasmodium is any biological material comprising plurality of Plasmodium species, optionally alongside other microorganism.
In an embodiment, the method of distinguishing Plasmodium falciparum from other species of Plasmodium, wherein the said method amplifies the nucleotide sequences by the SEQ ID No. 1 and the SEQ ID No.2 resulting in reduction in cycle threshold by about 8 cycles when compared to amplification carried out in absence of the SEQ ID No. 1 and the SEQ ID No.2, thereby distinguishing Plasmodium falciparum from other species of Plasmodium is quicker and convenient when compared to the conventional methods and primers.
In an embodiment of the present disclosure, easy diagnosis and diagnosis of parasitic infection such as malaria in early stages of the infection is made possible by employing the methods of the instant disclosure and such diagnosis has huge impact on healthcare.
In the present disclosure, 'nucleic acid sequence' and 'nucleotide sequence' are used interchangeably, wherein both the phrases define the same concept of succession of letters that indicate the order of nucleotides within a DNA or RNA molecule.
The invention is further illustrated by the following examples. The following examples are provided for illustrative purposes only and are not intended to limit the scope of the invention.
EXAMPLES
Example 1: Identifying and confirming presence of Multi repeat DNA sequences in the genome of P.falciparum
The isolated P.falciparum genomic DNA and human genomic DNA isolated are subjected to PCR amplification employing the primers of the instant disclosure alongside 18SrRNA (specific to the P.falciparum) and GAPDH primers (specific to human genomic DNA), respectively to evaluate the multi repeat DNA sequences in the genome of P. faciparum. PCR amplification products are analyzed on ethidium bromide stained 1% agarose gel.
The results of the above mentioned experiment is illustrated in figure 3, wherein-
Lane 1 and 2 recite amplification results of both P.falciparum and human genomic DNA
when taken in equal quantity of 60ng each hence showcasing no bias in the products.
Lane 3 recites the amplification of human genomic DNA with the primers of the instant disclosure and it is observed that there is no amplification of the human genomic DNA.
Lane 4 recites the amplification oiP.falciparum genomic DNA when subjected to primers of the instant disclosure. The amplification product appears like a smear/streak, as the amplified products are not of same size/length but varied sizes unlike conventional PCR products, thereby confirming the present of identical multi repeat sequence in P.falciparum genome.
As no significant amplification products are observed in lane 3 but are observed in lane 4, it is clear that no amplification product is obtained in the human genomic DNA sample and thus IMRS (Identical multi repeat sequences) are specific to P.falciparum genome.
Lane 5 recites the amplification of human genomic DNA with 18SrRNA primer and it is observed that there is no amplification of the human genomic DNA.
Lane 6 recites the amplification oi P.falciparum genomic DNA with 18SrRNA primer and the amplification of specific region on the F'.falciparum!^ observed unlike the multiple
amplification products (as a streak) observed upon subjecting the P.falciparum to primers set forth of SEQ ID No. 1 and SEQ ID No. 2 of the instant disclosure.
Lane 7 recites the amplification of human genomic DNA with GAPDH primer and the amplification of specific region on the human genomic DNA is observed.
Lane 8relates to amplification of F'.falciparum genomic DNA with GAPDH primer and it is observed that there is no amplification of the P.falciparum.
Example 2: Evaluating the sensitivity of primers set forth as SEQ ID No. 1 and SEQ ID No. 2 of the instant disclosure
About lpg and about O.lpg of P.falciparum genomic DNA of 3D7are subjected to
amplification as described in the embodiments of the instant disclosure, wherein the
condition for amplification with both 18SrRNA primer and the primers of the instant
disclosure, respectively is provided below:
Prm Hi firms for am nlifi ration-
Wherein, data acquisition is done at the cycle of 72°C for 30 seconds.
Observation:
• The cycle threshold value of the amplification of lpg of Pf 3D7 gDNA by the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 is about 27.16 (figure 4, amplification curve 1), whereas the cycle threshold value of the amplification of lpg of Pf 3D7 gDNA by 18SrRNA is about 35.15 (figure 4, amplification curve 2).
• The cycle threshold value of the amplification of O.lpg of Pf 3D7 gDNA by the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 is about 32.65 (figure 4, amplification curve 3), whereas the cycle threshold value of the amplification of O.lpg of Pf 3D7 gDNA by 18SrRNA is greater than 40 (figure 4, amplification curve 4).
From the above observation it is evident that the cycle threshold for the amplification of genomic DNA of' F'.falciparum by the primers set forth as SEQ ID No.l and SEQ ID No.2 is 8 cycles lesser than the amplification of genomic DNA of P.falciparum by 18SrRNA
primers, which implies that there is faster detection of the Plasmodium falciparum in the sample by the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 of the present disclosure.
Example 3: Amplification of Plasmodium falciparum strain 7jfNF54 by the primer set forth as SEQ ID No. 1,SEQ ID No. 2 and 18SrRNA primer.
About 0.2pg of P.falciparum strain iyNF54 genomic DNA is subjected to amplification as described in the embodiments of the instant disclosure, wherein the condition for amplification with both 18SrRNA primer and the primers of the instant disclosure, respectively are provided below: Conditions for amplification:
Wherein, data acquisition is done at the cycle of 72°C for 30 seconds.
Observation:
• The cycle threshold value of the amplification of 0.2pg of P/NF54gDNA by the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 is about 24.9, whereas the cycle threshold value of the amplification of 0.2 pg of P/NF54 gDNA by 18SrRNA is about 33.3.
Example 4: Amplification of Plasmodium falciparum strain Pf Kl by the primer set forth as SEQ ID No. 1, SEQ ID No. 2 and 18SrRNA primer.
About 0.2pg of P.falciparum strain PfK.\ genomic DNA is subjected to amplification as described in the embodiments of the instant disclosure, wherein the condition for amplification with both 18SrRNA primer and the primers of the instant disclosure, respectively is provided below: Conditions for amplification:
Wherein, data acquisition is done at the cycle of 72°C for 30 seconds.
Observation:
• The cycle threshold value of the amplification of 0.2pg of Pf Kl gDNA by the primers set forth as SEQ ID No. 1 and SEQ ID No. 2 is about 22.7 (figure 6, amplification curve 1), whereas the cycle threshold value of the amplification of 0.2 pg of iyKl gDNA by 18SrRNA is about 31.2 (figure 6, amplification curve 2).
From the above observation it is evident that the cycle threshold for the amplification of genomic DNA of P.falciparum strain PfKl by the primers set forth as SEQ ID No. 1 and SEQ ID No.2 is 8 cycles lesser than the amplification genomic DNA of P.falciparum by 18SrRNA primers, which implies that there is faster detection of the Plasmodium falciparum strain PfKl'm the sample by the primers set forth as SEQ ID No.l and SEQ ID No. 2.
Example 5: Identification of Plasmodium Falciparum in a sample
About 0.1 ml to about 10ml of saline sample is subjected to amplification as described in the embodiments of the instant disclosure, wherein the condition for amplification with the primers set forth as SEQ ID No. 1 and SEQ ID No.2 of the instant disclosure, respectively is provided below: Conditions for amplification:
Wherein, data acquisition is done at the cycle of 72°C for 30 seconds.
Observation: Amplification is observed only in the sequence corresponding to Plasmodium Falciparum, thereby leading to identification of Plasmodium falciparum from the sample.
Example 6: Distinguishing Plasmodium Falciparum from other species of Plasmodium in a sample
About 0.1ml to about 10ml of sample having plurality of Plasmodium species is subjected to amplification as described in the embodiments of the instant disclosure, wherein the condition for amplification with the primers set forth as SEQ ID No. 1 and SEQ ID No.2 of the instant disclosure, respectively is provided below: Conditions for amplification (approximate values):
Wherein, data acquisition is done at the cycle of 72°C for 30 seconds.
Observation: Amplification is observed only in the sequence corresponding to Plasmodium Falciparum, thereby leading to distinguishing Plasmodium falciparum from other Plasmodium species in the biological material.
SEQUENCE LISTING
<110>Jigsawbio Solution
<120> Nucleotide Sequences, a Method and kit thereof
<130> IP22557
<160> 2
<170>PatentIn version 3.5
<210> 1
<211> 25
<212> DNA
<213> Plasmodium falciparum
<220>
<221>primer <222> (1)..(25)
<400> 1 taacataggtcttaacttgactaac
<210> 2
<211> 24
<212> DNA
<213> Plasmodium falciparum
<220>
<221>primer <222> (1)..(24)
<400> 2 gacctaagttagtaccttaatgac
We Claim:
1. Nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2.
2. The nucleotide sequences as claimed in claim 1, wherein the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer
3. A method of identifying presence or absence of Plasmodium in a sample, said method comprising acts of:
a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent;
b) providing conditions suitable for amplification and observing presence or absence of amplified product to identify presence or absence of the Plasmodium in the sample.
4. The method as claimed in claim 3, wherein the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer.
5. The method as claimed in claim 3, wherein the sample is a liquid or solid media having or suspected of having Plasmodium.
6. The method as claimed in claim 3, wherein the nucleic acid amplification reagent is selected from a group comprising polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
7. The method as claimed in claim 3, wherein the conditions suitable for amplification comprises steps of
a) subjecting the sample to denaturation at a temperature ranging from about 90°C to about 100°C for about 5minutes to about lOminutes,
b) subsequently allowing the denatured sample to about 30 amplification cycles to about 40 amplification cycles of further denaturation, annealing and extension, wherein said denaturation is at a temperature ranging from about 90°C to about 100°C for about 10 seconds to about 100 seconds, said annealing is at a temperature ranging from about 50°C to about 100°C for about 10 seconds to about 100 seconds and extension is at a temperature ranging from about 50°C to about 100°C for about to about lminute to about 3 minutes.
8. The method as claimed in claim 3, wherein the observing presence or absence of the
amplified product is carried by a process selected from a group comprising
electrophoresis, sequencing, gel elution and blot technique, or any combination
thereof.
9. The method as claimed in claim 3, wherein the method identifies Plasmodium falciparum strain selected from a group comprising P/3D7, iyNF54, PfKl, PfDd2 and PfHB3, or any combination thereof.
10. The method as claimed in claim 3, wherein the amplification of the nucleotide sequences by the SEQ ID No. 1 and the SEQ ID No.2 results in reduction in cycle threshold by about 8 cycles when compared to amplification carried out in absence of the SEQ ID No. 1 and the SEQ ID No.2.
11. A method of distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said method comprising acts of:
a) contacting the sample with nucleotide sequences set forth as SEQ ID No. 1 and SEQ ID No. 2 in presence of nucleic acid amplification reagent to amplify complimentary sequence in the sample;
b) providing conditions suitable for amplification and observing the amplified product to distinguish Plasmodium falciparum from other species of Plasmodium.
12. The method as claimed in claim 11, wherein the sample is a liquid or solid media having or suspected of having plasmodium.
13. The method as claimed in claim 11, wherein the other species of Plasmodium is selected from a group comprising Plasmodium vivax, Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium brasilianum, Plasmodium cynomolgi, Plasmodium cynomolgibastianelli, Plasmodium inui, Plasmodium rhodiani, Plasmodium schweitzi, Plasmodium semiovale and Plasmodium simium, or any combination thereof.
14. The method as claimed in claim 11, wherein the SEQ ID No.l and the SEQ ID No.2 are individually forward primer or reverse primer. The method as claimed in claim 11, wherein the nucleic acid amplification reagent is selected from a group comprising polymerase, buffer, cationic metal and dNTPS, or any combination thereof.
15. The method as claimed in claim 11, wherein the conditions suitable for amplification comprises steps of
a) subjecting the sample to denaturation at a temperature ranging from about 90°C to about 100°C for about 5minutes to about lOminutes,
b) subsequently allowing the denatured sample to about 30 amplification cycles to about 40 amplification cycles of further denaturation, annealing and extension, wherein said denaturation is at a temperature ranging from about
90°C to about 100°C for about 10 seconds to about 100 seconds, said annealing is at a temperature ranging from about 50°C to about 100°C for about 10 seconds to about 100 seconds and extension is at a temperature ranging from about 50°C to about 100°C for about to about lminute to about 3 minutes.
16. The method as claimed in claim 11, wherein the observing presence or absence of the amplified product is carried by a technique selected from a group comprising electrophoresis, sequencing, gel elution and blot technique, or any combination thereof.
17. The method as claimed in claim 11, wherein the amplification of the nucleotide sequences by the SEQ ID No. 1 and the SEQ ID No.2 results in reduction in cycle threshold by about 8 cycles when compared to amplification carried out in absence of the SEQ ID No. 1 and the SEQ ID No.2.
18. A kit for identifying presence of Plasmodium in a sample or for distinguishing Plasmodium falciparum from other species of Plasmodium in a sample, said kit comprising a nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No. 2 along with reagents and buffers; optionally along with instruction manual.
19. The kit as claimed in claim 18, wherein the sample is a liquid or solid media having or suspected of having microorganisms.
20. A method for assembling a kit as claimed in claim 18, said method comprising act of collating nucleotide sequence set forth as SEQ ID No. 1 and SEQ ID No.2 with reagents and buffers for the identification; optionally along with instruction manual.
21. The kit and the method as claimed in claim 18 or 20, wherein the SEQ ID No.l and SEQ ID No.2 are individually forward primer or reverse primer or a combination thereof.
22. The kit and the method as claimed in any of the preceding claims, wherein the Plasmodium falciparum strain selected from a group comprising Pf3D7, iyNF54, Pf Kl PfDd2 andiyHB3, or any combination thereof.
| # | Name | Date |
|---|---|---|
| 1 | IP22557-final copy [provisional].pdf | 2013-03-08 |
| 2 | IP22557-FIGURE 1.pdf | 2013-03-08 |
| 3 | FORM 5.pdf | 2013-03-08 |
| 4 | FORM 3.pdf | 2013-03-08 |
| 5 | 893-CHE-2013 FORM-1 29-08-2013.pdf | 2013-08-29 |
| 6 | 893-CHE-2013 CORRESPONDENCE OTHERS 29-08-2013.pdf | 2013-08-29 |
| 7 | 893-CHE-2013 FORM-1 16-09-2013.pdf | 2013-09-16 |
| 8 | 893-CHE-2013 CORRESPONDENCE OTHERS 16-09-2013.pdf | 2013-09-16 |
| 9 | 893-CHE-2013 REQUEST FOR POST DATING 19-02-2014.pdf | 2014-02-19 |
| 10 | IP22557 Figures.pdf | 2014-09-11 |
| 11 | IP22557 Complete Specification.pdf | 2014-09-11 |
| 12 | 893-CHE-2013 POWER OF ATTORNEY 15-09-2014.pdf | 2014-09-15 |
| 13 | 893-CHE-2013 CORRESPONDENCE OTHERS 15-09-2014.pdf | 2014-09-15 |
| 14 | 893-CHE-2013-FORM FOR SMALL ENTITY [18-08-2017(online)].pdf | 2017-08-18 |
| 15 | 893-CHE-2013-FORM 18 [18-08-2017(online)].pdf | 2017-08-18 |
| 16 | 893-CHE-2013-EVIDENCE FOR REGISTRATION UNDER SSI [18-08-2017(online)].pdf | 2017-08-18 |
| 17 | 893-CHE-2013-FER.pdf | 2020-03-20 |
| 1 | 2020-02-2616-32-39_26-02-2020.pdf |