Sign In to Follow Application
View All Documents & Correspondence

O Phosphoserine Producing Microorganism And Method For Producing O Phosphoserine Or L Cysteine Using Same

Abstract: The present invention relates to a microorganism of which the activity of polypeptides having an ability to export O phosphoserine (OPS) is enhanced and to a method for producing O phosphoserine cysteine or a cysteine derivative.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
01 February 2017
Publication Number
15/2017
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2021-12-14
Renewal Date

Applicants

CJ CHEILJEDANG CORPORATION
330 Dongho ro Jung gu Seoul 04560

Inventors

1. KIM Sol
202 18 Irwol ro 18beon gil Paldal gu Suwon si Gyeonggi do 16424
2. YOO In Hwa
382 2104 17 Cheongnahanul ro Seo gu Incheon 22749
3. CHANG Jin Sook
206 704 47 Heojun ro Gangseo gu Seoul 07524
4. KIM Hye Won
417 506 206 Baekhyeon ro Bundang gu Seongnam si Gyeonggi do 13607

Specification

DESCRIPTION
InventionTitle
MICROORGANISM PRODUCING O-PHOSPHOSERINE AND A METHOD FOR PRODUCING O-PHOSPHOSERINEORL-CYSTEINE USING THE SAME
TechnicalField
The present invention relates to a microorganism capable of producing O-phosphoserine, and a method of producing O-phosphoserine, cysteine, or a cysteine derivative using the microorganism.
BackgroundArt
L-cysteine, an amino acid playing an important role in the metabolism of sulfur in allliving organisms, is used not only in the synthesis of biological proteins such as hair keratin, glutathione, biotin, methionine, and other sulfur-containing metabolites, but also as a precursor for biosynthesis of coenzyme A.
Known methods of producing L-cysteine using microorganisms include:1)a method of biologically converting D,L-ATC to L-cysteine using microorganisms, 2) a method of producing L-cysteine by direct fermentation using E. coli (EP0885962B; Wada M and Takagi H, Appl. Microbiol. Biochem., 73:48-54, 2006), and 3)a method of producing O-phosphoserine(“OPS”, hereinafter)by fermentationusing microorganisms, and converting OPS intoL-cysteineby reacting OPS with a sulfideunder the catalytic action of O-phosphoserine sulfhydrylase (“OPSS”, hereinafter)(Korean Patent No. 1381048).
In particular, for the production of cysteine by the method 3) at high yield, the precursor, OPS, should be produced in excessive amounts. In this regard, the present inventorshave made extensive efforts to discover an appropriate exportfactor that enables O-phosphoserine produced in an OPS-producing microorganism to be exported from cells smoothly.
Disclosure
WO 2016/024771 PCT/KR2015/008336
3
TechnicalProblem
Under these circumstances, the present inventors discovered two novel OPS-producing polypeptides, YhhSandMdtD, and confirmed that OPS can be effectively exported from an OPS-producing microorganism by activating the two polypeptides, thereby completing the present invention.
TechnicalSolution
It is therefore an object of the present invention to provide an OPS-producing microorganism, wherein the activity of a polypeptide capable of exporting OPS is enhanced compared to its endogenous activity.
Another object of the present invention is to provide a method for producing OPSincluding; culturing an OPS-producing microorganism in a medium, and separating OPSfrom the OPS-producingmicroorganism or its culture.
Still another object of the present invention is to provide uses of the OPSproduction or export by the polypeptide.
Still another object of the present invention is to provide a method for producing cysteine or its derivative including: a) producing OPS by culturingan OPS-producing microorganism, wherein the activity of a polypeptide capable of exporting OPS is enhanced compared to its endogenous activity, in a medium; andb) reacting the OPS produced in a) or a culture containing the same with a sulfide, in the presence of OPS sulfhydrylase or a microorganism capable of expressing the same.
Advantageous Effectsof the Invention
The novel polypeptide with an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 of the present invention has an excellent OPS-exporting capability. Accordingly, when the novel polypeptide of the present invention is applied to a microorganism capable of producing OPS, it can result in high yield of OPS production, and also can be effectively used for the synthesis of L-cysteine, etc.
Description of Drawings
FIG. 1 shows a graph illustrating the measurement result of intracellular level of OPSby high performance liquid chromatography (HPLC), after removing all
WO 2016/024771 PCT/KR2015/008336
4
OPSexportedfrom the culture of the recombinant microorganism of the present invention where the functions of YhhSandMdtD proteins were enhanced.
Best Mode
In an aspect, the present invention provides an OPS-producing microorganism, wherein the activity of a polypeptide, which has an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and is capable of exporting O-phosphoserine, is enhanced compared to its endogenous activity.
As used herein, the term “O-phosphoserine”(“OPS”, hereinafter) refers to an ester of serine and phosphoric acid that is a component of many proteins. In particular, the OPS is a precursor of L-cysteine and can be converted to cysteine by reacting with a sulfide under the catalytic action of OPS sulfhydrylase (hereinafter described as “OPSS”) (Korean Patent No. 1381048). Accordingly, it is an important factor to increase OPS productionin cysteineproduction, and thus it has been required to develop transporters that enable intracellular OPS to be effectively secreted from OPS-producing strains.
As used herein, the term “a polypeptidehaving the activity of exporting O-phosphoserine” refers to a membrane protein which has the activity of exporting the OPS in a cell to the outside of the cell, and specifically may be a membrane protein derived from E. coli. Two kinds of membrane proteins were identified from E. coli where growth inhibition is removed in a condition where an excess amount of OPS is present. Specifically, the thus-identified membrane proteins with OPS-exporting capability areYhhS MFS(major facilitator superfamily) transporter having an amino sequence of SEQ ID NO: 1, and YegB MFS transporter having an amino sequence of SEQ ID NO: 2. In the present invention, the YegB MFS transporter may be interchangeably used with MdtD. The OPS-exporting capability of the protein has not been known until first verified in the present invention.
Additionally, the polypeptide may be an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, and may include, without limitation, membrane proteins having a sequence homology of at least 70% to the above sequences, specifically at least 80%, more specifically at least 90%, and even more specifically at least 95%, as long as they have an OPS-exporting capability, which is substantially the same as or equivalent to that of the polypeptide. Furthermore, it is obvious that polypeptide variants, in which part of the
WO 2016/024771 PCT/KR2015/008336
5
sequence is deleted, modified, substituted, or inserted, should be included in the scope of the present invention, as long as they areamino acid sequences having these homologies and the OPS-exporting capability.
Additionally, the polynucleotide sequence of the polypeptide exhibiting OPS-exporting capability may include polynucleotide sequences encoding the amino acids represented by SEQ ID NO: 1 or SEQ ID NO: 2.Additionally, considering the codons preferred by organisms to express the polypeptide based on the genetic code degeneracy, various modifications may be executed on the coding region within the scope not changing the amino acid sequence of the polypeptide. The polynucleotide sequence may be an amino acid sequence represented by SEQ ID NO: 3 or SEQ ID NO: 4, and may includenucleotide sequences having a sequence homology of at least 70% to these sequences, but is not limited thereto.
As used herein, the term “homology” refers to a degree of identity with a given polypeptide sequence or polynucleotide sequence, and may be indicated in percentage.As used herein, the homologous sequence having the same or similar activity with the given polypeptide sequence or polynucleotide sequence may be indicated in terms of “% homology”. The % homology may be confirmed using standard software, i.e., BLAST 2.0, for calculating parameters such as score, identity, and similarity, or by comparing sequences via southern hybridization experiments, and the appropriate hybridization condition to be defined may be determined by a method known to a skilled person in the art (e.g.,Sambrook et al., 1989, infra).
In an exemplary embodiment of the present invention, it was confirmed that when the activities of YhhSprotein (SEQ ID NO: 1) orMdtDprotein (SEQ ID NO: 2) were enhanced in a microorganism capable of producing OPS, the microorganism was shown to have superiorOPS-exporting capabilitytothe strain where the RhtBproteinwas enhanced (Korean Patent Application Publication No. 10-2012-0041115)(a positive control), or the strainwhere the activities of MFS transporters of EmrDorYcaD were enhanced (an experimental group). The “RhtB” is a membrane protein,encoded by rhtBgene, whichcan export homoserine/homoserinelactone. Since it was already confirmed that the enhancement of the RhtB activity in an OPS-producing strain increases theOPS-exporting capability in the strain (Korean Patent No. 138104), this was used as a positive control. When the activities of the RhtB protein and the YhhSandMdtDproteins of the present
WO 2016/024771 PCT/KR2015/008336
6
invention were enhanced in an OPS-producing strain, respectively, the RhtB protein and the YhhSandMdtDproteins of the present inventionexhibited excellentOPS-exporting capabilities to the RhtB protein. Additionally, the terms “EmrD” and “YcaD” refer to MFS transporter proteins of E. coli, and are encoded by emrD gene and ycaDgene, respectively. The EmrDandYcaD, being proteins belonging to MFS transporters as in the YhhSandMdtD proteins, were used as an experimental group to examine whether other proteins belong to the MFS transporter can also exhibit OPS-exporting capabilities. As a result, it was confirmed that EmrDandYcaD proteins,unlike YhhSandMdtD proteins, did not exhibit OPS-exporting capabilities.
Meanwhile, the polypeptide of the present invention has the OPS-exporting capability, and thus, when the activity of the polypeptide is enhanced compared to its endogenous activity in a microorganism having an OPS-producing capability, OPScan be producedeffectively.
As used herein, the term“OPS production”not only refers to the production of OPS within a strain, but also to the export of the OPS in a cell to the outside of the cell, for example, to a medium, and specifically, the export of OPS from the inside to the outside of a cell.
As used herein, the term “endogenous activity” refers to an active state of a polypeptide in a microorganism in a natural state, i.e., in a non-modified state.
As used herein, the term“enhancement compared to its endogenous activity” refers to an increased activity of a polypeptide in a microorganismwhen compared with that possessed in its natural state, and is a concept including rendering the activity of a particular polypeptide in a microorganism which does not possess the activity of the particular polypeptide.
As used herein, the term “enhancement of activity” refers to, although is not particularly limited to, not only the drawing of a higher effect than the original function due to the increase in the activity of the polypeptide itself, but also the increase in the activity of the protein due to the increase in endogenous gene activity, endogenous gene amplification by the internal or external factors, replacement, modification, or mutation of a promoter, etc. Specifically, the enhancement of activity may be performed by methods such as a method of increasing copy number of a gene encoding the polypeptide in a cell, a method of modifying
WO 2016/024771 PCT/KR2015/008336
7
the regulation sequence of a gene encoding the polypeptide, a method of substituting the gene encoding the polypeptide on the chromosome with a mutated gene to increase the activity of the polypeptide, a method of introducing a modification in the gene encoding the polypeptide on the chromosome to enhance the activity of the polypeptide, etc., but is not limited thereto. These methods of enhancing activity may be referenced in the same manner to enhance the activities of other polypeptides of the present invention.
In the above, the increase in gene copy number, although not particularly limited thereto, may be performed in a state operably connected to a vector, or by being inserted into the chromosome within a host cell.Specifically, the method may be executed by introducing a vector, by which a polynucleotide encoding the protein of the present invention is operably connected to a host cell, and can be replicated and function irrespective of a host, into a cell of the host; or introducing a vector, to which the polynucleotide is operably connected, capable of inserting the polynucleotide into the chromosome of the host cell, into the host cell. The insertion of the polynucleotide into the chromosome may be performed using a known method in the art, for example, by homologous recombination. Since the vector of the present invention can be inserted into the chromosome via homologous recombination, a selection marker for confirmation of the insertion into the chromosome may be further included. The selection marker is used for selection of a transformed cell, i.e., in order to confirm whether the target polynucleotide has been inserted, and markers capable of providing selectable phenotypes such as drug resistance, nutrient requirement, resistance to cytotoxic agents, and expression of surface proteins may be used, but are not limited thereto. Under the circumstances where selective agents are treated, only the cells capable of expressing the selection markers can survive or express other phenotypic traits, and thus the transformed cells can be easily selected.
The vector may be a DNA construct including the polynucleotide sequence of the polynucleotide encoding the target protein, which is operably connected to a suitable regulation sequence so that the target protein can be expressed in an appropriate host. The regulation sequence includes a promoter capable of initiating transcription, a random operator sequence for regulation of the transcription, a sequence encoding a suitable mRNA ribosome-binding domain, and a sequence for regulation of transcription and translation. The vector, after being transformed into a suitable host cell, may be replicated or function irrespective of the host genome, or may be integrated into the host genome itself.
WO 2016/024771 PCT/KR2015/008336
8
The vector used in the present invention may not be particularly limited as long as the vector is replicable in the host cell, and any vector known in the art may be used. Examples of the vector may include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, as a phage vector or cosmid vector, pWE15, M13, λMBL3, λMBL4, λIXII, λASHII, λAPII, λt10, λt11, Charon4A, Charon21A, etc., may be used; and as a plasmid vector, those based onpBR, pUC, pBluescriptII, pGEM, pTZ, pCL,pET, etc., may be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc., may be used.
As used herein, the term “transformation” refers to a process of introducing a vector including a polynucleotide encoding a target protein into a host cell, thereby enabling the expression of the polynucleotide encoded by the protein in the host cell. For the transformed polynucleotide, it does not matter whether it is inserted into the chromosome of a host cell and located therein orlocated outside the chromosome, as long as it can be expressed in the host cell. Additionally, the polynucleotide includes DNA and RNA which encode the target protein. The polynucleotide may be inserted in any form insofar as it can be introduced into a host cell and expressed therein. For example, the polynucleotide may be introduced into a host cell in the form of an expression cassette, which is a genetic construct including all essential elements required for self-expression, but is not limited thereto. The expression cassette may conventionally include a promoter operably connected to the polynucleotide, a transcription termination signal, a ribosome-binding domain, and a translation termination signal. The expression cassette may be in the form of an expression vector capable of self-replication. Additionally, the polynucleotide may be introduced into a host cell as it is, and operably connected to a sequence essential for its expression in the host cell.
Additionally, as used herein, the term “operably connected” refers to a functional connection between a promoter sequence, which initiates and mediates the transcription of the polynucleotide encoding the target protein of the present invention, and the above gene sequence.
Then, the modification of the expression regulation sequence for increasing the expression of the polynucleotide, although not particularly limited thereto, may be performed by inducing a variation in the polynucleotide sequence via deletion, insertion, conservative substitution, non-conservative substitution, or a combination thereof so as to further enhance
WO 2016/024771 PCT/KR2015/008336
9
the activity of the expression regulation sequence; or by replacing the polynucleotide sequence with a polynucleotide sequence with a stronger activity. The expression regulation sequence, although not particularly limited thereto, may include a promoter, an operator sequence, a sequence encoding a ribosome-binding domain, and a sequence for regulating termination of transcription and translation, etc.
A strong promoter, instead of the original promoter, may be connected to the upper end of the expression unit of the polynucleotide, but is not limited thereto. Examples of the known strong promoters may include cj1promoter (Korean Patent No. 0620092), lac promoter, trppromoter, trcpromoter, tac promoter, lambda phagePRpromoter, PLpromoter, andtetpromoter.
Furthermore, the modification of the polynucleotide sequence on the chromosome, although not particularly limited thereto, may be performed by inducing a variation on the expression regulation sequence of the polynucleotide sequence via deletion, insertion, conservative substitution, non-conservative substitution, or a combination thereof so as to further enhance the activity of the polynucleotide sequence; or by replacing the polynucleotide sequence with an enhanced polynucleotide sequence with a stronger activity.
Generally, the introduction and enhancement of the protein activity may increase the activity or concentration of the corresponding protein relative to the activity or concentration of a wild-type protein or in a microorganism strain from at least 1%, 10%, 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, or 500%, to a maximumof 1000% or 2000%, but is not limited thereto.
As used herein, the term “OPS-producing microorganism” refers to a prokaryotic or eukaryotic microbial strain capable of producing OPS therein, and specifically a microorganism capable of accumulating OPS therein by genetic engineering.
In an exemplary embodiment of the present invention, the microorganism is not particularly limited but may be any prokaryotic or eukaryotic microorganism that can produce OPSwhen the activity of the polypeptide of SEQ ID NO: 1 or 2 is enhanced, and specificallya prokaryoticmicroorganism. Examples of the microorganism may include microbial strains belonging to the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium and the genus Brevibacterium. Specifically, the microorganism may be a microorganism of the genus Escherichia. More specifically, it may be E. coli. Particularly, a microorganism of the Escherichia or the genus
WO 2016/024771 PCT/KR2015/008336
10
Corynebacterium can produce OPS and L-serine, because it contains SerA, SerC and SerB proteins that are enzymes in the biosynthesis pathway of L-serine (Ahmed Zahoor, Computational and Structural Biotechnology Journal, vol. 3, 2012 October; Wendisch VF et al., CurrOpinMicrobiol. 2006 Jun;9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. 2005 Nov;71(11):7139-44).
Additionally, in the OPS-producing microorganism, the activity of phosphoserine phosphatase (SerB)may be further weakened compared to its endogenous activity.
The SerB has an activity of converting OPS to L-serine, and thus the microorganism modified to reduce the SerB activity has the property of accumulating OPS therein, thus being useful for the production of OPS.The SerBmay be a protein having an amino acid sequence represented by SEQ ID NO: 17 or SEQ ID NO: 18, but is not limited thereto. Additionally, the SerBmay include an amino acid sequence having a sequence identity of 80% or higher, specifically, 90% or higher, more specifically 95% or higher, and even more specifically 99% or higher, as long as it shows the SerB activity, but is not limited thereto. Additionally, the polynucleotide sequence encoding SerBmay have a polynucleotide sequence encoding the amino acids represented by SEQ ID NO: 17 or SEQ ID NO: 18.
Considering the codons preferred by organisms to express the polypeptide based on the genetic code degeneracy, various modifications on the polynucleotide may be executed on the coding region within the scope not changing the amino acid sequence of the polypeptide. The polynucleotide sequence may be an amino acid sequence represented by SEQ ID NO: 19 or SEQ ID NO: 20, and may includenucleotide sequences having a sequence homology of 80% to these sequences, and specifically at least 90%, but is not limited thereto.
As used herein, the term “the attenuation compared to its endogenous activity” refers to a reduction of the protein activity when compared with that possessed in its natural state, and also includes when its activity is removed.
The attenuation is a concept referring to a case when the activity of a protein is reduced compared with that originally possessed by the microorganism due to a modificationin the protein-encoding gene, etc., a case when the level of overall protein expression is lower than that of the natural type strain of the microorganism due to inhibition of expression or inhibition of translation of the gene encoding the same, or a case when the
WO 2016/024771 PCT/KR2015/008336
11
gene is not expressed at all, and a case when the gene is expressed but exhibits no activity.
The attenuation or inactivation of a protein activity may be achieved by various methods well known in the art. Examples of the methods may include a method of substituting the gene encoding the protein on the chromosome with a gene mutated so that the enzyme activity can be reduced including the case when the protein activity is removed; a method of modifying the expression regulation sequence of the gene encoding the protein; a method of deleting part or the entirety of a gene encoding the protein on the chromosome; a method of introducing an antisense oligonucleotide(e.g., antisense RNA), which inhibits the translation from the mRNA into a protein via a complementary binding to the transcript of the gene on the chromosome; a method of making the attachment of ribosome impossible by forming a secondary structure by artificially adding a Shine-Dalgarno (SD) sequence and its complementary sequence on the front end of the SD sequence of the gene encoding the protein; a method of reverse transcription engineering (RTE), which adds a promoter so as to be reversely transcribed on the 3’ terminus of the open reading frame (ORF) of the corresponding sequence, etc., and also include a combination thereof, but are not limited thereto.
Specifically, the method of deleting part or the entirety of a gene encoding the protein may be executed by replacing the polynucleotide encoding the endogenous target protein within the chromosome with a polynucleotide or a marker gene having a partially deleted nucleic acid sequence, using a vector for inserting chromosomesinto bacteria. In an exemplary embodiment, the gene may be deleted by homologous recombination. Additionally,as used herein, the term “part”, although it may vary depending on the kinds of polynucleotide, may specifically refer to 1 nucleotide to 300 nucleotides, more specifically 1 nucleotide to 100 nucleotides, and even more specifically 1 nucleotide to 50 nucleotides, but is not limited thereto.
Additionally, the method of modifying the expression regulation sequence may be performed by inducing a variation in the expression regulation sequence via deletion, insertion, conservative substitution, non-conservative substitution, or a combination thereof so as to further weaken the activity of the expression regulation sequence; or by replacing the sequence with a nucleic acid sequencehaving a weaker activity. The expression regulation sequence includes a promoter, an operator sequence, a sequence encoding ribosome-binding domain, and a sequence for regulating transcription and translation.
WO 2016/024771 PCT/KR2015/008336
12
Additionally, the method of modifying the gene sequence may be performed by inducing a variation in the gene sequence via deletion, insertion, conservative substitution, non-conservative substitution, or a combination thereof so as to further weaken the activity of the protein; or by replacing the sequence with a gene sequence improved to have a weaker activity or a gene sequence improved to have no activity at all.
Additionally, theOPS-producing microorganism may be one in which the activities of phosphoglycerate dehydrogenase (SerA) or phosphoserine aminotransferase(SerC) are further enhanced compared to their endogenous activities.
The SerAis a protein capable of converting 3-phosphoglycerate into 3-phospho-hydroxypyruvate, and for SerA, a wild-type or a variant, wherethe feedback on serine is removed, may be used. Additionally, the SerCis a protein capable of converting3-phospho-hydroxypyruvate toOPS. Accordingly, any microorganism with enhanced SerAand/or SerCactivities may be effectively used as an OPS-producing microorganism.
The SerAmay have an amino acid sequence selected from the group consisting of SEQ ID NOS: 21 to 26, although is not limited thereto. The SEQ ID NO: 21 is a sequence of wild-type SerA, and SEQ ID NOS: 22to 26 are sequences of variants where the feedback on serine is removed. Additionally, those amino acid sequences which have at least 80% sequence identity to the above amino acids, specifically at least 90%, more specifically at least 95%, and even more specificallyat least 99% may be included as long as they exhibit the activities of the wild-type SerA or SerA variants wherethe feedback on serine is removed, but are not limited thereto. The variants where the feedback is removed represent those proteins in which a modification is introduced on the SerA-encoding gene by insertion, substitution, etc., thereby enabling maintaining of the activity from the feedback inhibition by serine or glycine, or having enhanced activities thereof, and those variants wherethe feedback is removed are already well known (Grant GA et al., J. Biol. Chem., 39: 5357-5361, 1999; Grant GA et al., Biochem., 39: 7316-7319, 2000; Grant GA et al., J. Biol. Chem., 276: 17844-17850, 2001; Peters-Wendisch P et al., Appl. Microbiol. Biotechnol., 60: 437-441, 2002; EP Pat. No. EP0943687B).
Additionally, the polynucleotide sequence encoding the wild-type SerA or the variants, wherethe feedback on serine is removed, may be a polynucleotide sequence encoding any one amino acid sequence represented by SEQ ID NOS: 21 to 26, but is not limited thereto.Due to the genetic code degeneracy or considering the codons preferred by
WO 2016/024771 PCT/KR2015/008336
13
organisms to express the polypeptide, various modifications on the polynucleotide may be executed on the coding region within the scope not changing the amino acid sequence of the polypeptide. The polynucleotide sequence may be, for example, any one of polynucleotide sequences represented by SEQ ID NOS: 27 to 32, and may have a nucleotide sequence having a homology of at least 80% to the polynucleotide sequences, and specifically at least 90%, but is not limited thereto.
The SerCmay be a protein having an amino acid sequence which is, for example, represented by SEQ ID NO: 33, but is not limited thereto. Additionally, the amino acid sequence, as long as it exhibits the activity of SerC,may also include amino acid sequences which have a sequence identity of at least 80% to the above amino acid sequence, specifically at least 90%,more specifically at least 95%,and even more specifically at least 99%,but is not limited thereto.
Additionally, the polynucleotide sequence encoding the SerCmay be the polynucleotide sequence encoding the amino acid represented by SEQ ID NO: 33. Due to the genetic code degeneracy or considering the codons preferred by organisms to express the polypeptide, various modifications on the polynucleotide may be executed on the coding region within the scope not changing the amino acid sequence of the polypeptide. The polynucleotide sequence may be, for example, one represented bySEQ ID NO: 34, and may have a nucleotide sequence having a homology of at least 80% to the polynucleotide sequences, and specifically at least 90%, but is not limited thereto.
Additionally, the microorganism may be one in which the capability of introducing or decomposing OPS into a cell is further weakened.
Regarding the contents on the OPS-producing microorganism,the disclosure in Korean Patent No. 1381048 orUS Patent Application Publication No. 2012-0190081 may be used as references of the present invention, in addition to those described above.
In another aspect, the present invention provides a method of producing OPS, including culturing a microorganism capable of producing O-phosphoserine in whichan activity of a polypeptide, which has an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and is capable of exporting O-phosphoserine, is enhanced, in a medium; and separating O-phosphoserine from the microorganism capable of producing O-phosphoserine, or the medium for the same.
WO 2016/024771 PCT/KR2015/008336
14
As used herein, the term “culturing” refers to growing the microorganism in an appropriately adjusted environment. The cultureprocess may be performed according to the appropriate medium and conditions for culture known in the art. The culture process may be easily adjusted for use by one of ordinary skill in the art according to the strain to be selected. Specifically, the culture may be a batch culture, a continuous culture, and a fetch culture, but is not limited thereto.
In culturing the recombinant microorganism having reduced SerB activity compared to its endogenous activity, the medium may further contain glycine or serine, because the serine requirement of the recombinant microorganism is induced. Glycine may be provided in the form of purified glycine, a glycine-containing yeast extract, or tryptone. The concentration of glycine in the medium is generally 0.1g/L to 10 g/L, and specifically 0.5g/L to 3 g/L. Additionally, serine may be provided in the form of purified serine, a serine-containing yeast extract, or tryptone. The concentration of serine in the medium is generally 0.1g/L to 5 g/L, and specifically 0.1g/L to 1 g/L.
Examples of the carbon source to be contained in the medium may include carbohydrates and saccharides such as glucose, sucrose, lactose, fructose, maltose, starch, and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, and coconut oil; fatty acids such as palmitic acid, stearic acid, and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These carbon sources may be used alone or in combination, but are not limited thereto.Examples of the nitrogen source to be contained in the medium may include organic nitrogen sources such as peptone, yeast extract, gravy, malt extract, corn steep liquor (CSL), and bean flour; and inorganic nitrogen sources such as urea, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. These nitrogen sources may be used alone or in combination, but are not limited thereto. As a phosphorous source,the culture media may further include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, and corresponding sodium-containing salts, but are not limited thereto. The culture media may include metals such as magnesium sulfate and iron sulfate. Additionally, amino acids, vitamins and appropriate precursors may be included. These culture media or precursors may be added to the culture in the form of a batch culture or continuous culture, but are not limited thereto.
Additionally, the pH of the culture may be adjusted by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid
WO 2016/024771 PCT/KR2015/008336
15
during cultivation in an appropriate manner. Additionally, bubble formation may be prevented during the cultivation using an antifoaming agent such as fatty acid polyglycol ester. Additionally, an oxygen gas or a gas containing an oxygen gas may be added to a culture in order to maintain aerobic conditions in a culture liquid;no air may be addedto maintain anaerobic conditions or microaerobic conditions; or nitrogen gas, hydrogen gas, or carbon dioxide may be injected.The culture temperature may be from 27°Cto37°C, and specifically from30°C to35°C. The cultivation may be continued until the production of desired material can be obtained, and specifically for 10 hours to 100 hours.
In the present invention, the OPS produced during the cultivation may be further separated and purified. The intended OPS may be recovered from the culture using an appropriate method known in the art, according to the culture method, e.g., a batch culture, a continuous culture, and a fetch culture, but is not limited thereto.
In another aspect, the present invention provides uses ofOPS production and OPS export by the polypeptide, which has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO:2.
In still another aspect, the present invention providesa method for producingcysteine or a derivative thereof including a) producing O-phosphoserine(OPS) by culturing a microorganism, in which an activity of a polypeptide which has an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and is capable of exporting O-phosphoserine is enhanced compared to its endogenous activity, in a medium; and b) reacting the O-phosphoserine(OPS) produced in a) or a culture containing the same with a sulfide in the presence of O-phosphoserine sulfhydrylase (OPSS) or a microorganism capable of expressing the same.
As used herein, the term “O-phosphoserine sulfhydrylase” (“OPSS”, hereinafter) refers to apolypeptide that catalyzes a reaction in which a thiol (SH) group is provided to OPS to convert OPS into cysteine. The enzyme was first found in Aeropyrumpernix, Mycobacterium tuberculosis, Mycobacterium smegmatics, and Trichomonas vaginalis (Mino K and Ishikawa K, FEBS Letters, 551: 133-138, 2003; Burns KE et al., J. Am. Chem. Soc., 127: 11602-11603, 2005). In addition, the scope of OPSS includes not only wild-type OPSS protein, but also variants that includedeletion, substitution, or addition in part ofthe
WO 2016/024771 PCT/KR2015/008336
16
polynucleotide sequence encoding the OPSS, which show activity that is equal to or higher than the biological activity of wild-type OPSS protein, for example,and includes the OPSSproteins disclosed in Korean Patent Nos. 1381048and 1208267 and their variants.
The sulfide to be used in the present invention may be any sulfide provided not only in a solid form generally used in the art, but also in a liquid or gas form due to the difference in pH, pressure, and solubility, and thus can be converted to a thiol (SH) group in the form of, for example, sulfide (S2-) or thiosulfate (S2O32-).Specifically, the sulfide to be used in the present invention may be Na2S, NaSH, H2S, (NH4)2S, or Na2S2O3, which can provide a thiol group to OPS. In the reaction, a single thiol group is supplied to a single reactive OPS group to produce a single cysteine or a derivative thereof. In this reaction, a sulfide is specifically added in an amount of 0.1 mol to 3 mol, and specifically 1 mol to 2 mol per 1 mol of OPS.
In addition, the method of the present invention further includesseparating and purifying the cysteine produced in reaction of step b). Herein, the desired cysteine can be recovered by isolating and purifying it from the reaction solution by a suitable reaction known in the art.
Additionally, the present invention relates to a high-yield production of OPSobtained by enhancing the activity of the polypeptide of SEQ ID NO: 1 or SEQ ID NO: 2 in an OPS-producing microorganism, followed by reacting the thus-produced OPS with OPSS, thereby effectively producing cysteine. The thus-prepared cysteine may be synthesized in various kinds of cysteine derivativesviaa chemical synthesis reaction known in the art by modifying a hydrogen atom or a particular atom group.
As used herein, the term “derivatives” refers to similar compounds obtained by chemically modifying a portion of any compound. Usually, the term refers to compounds in which a hydrogen atom or an atom group is substituted with another hydrogen atom or atom group.
As used herein, the term “cysteine derivatives” refers to compounds in which a hydrogen atom or atom group in cysteine is substituted with another atom or atom group. For example, the cysteine derivatives may have a form in which the nitrogen atom of the amine group (-NH2) or the sulfur atom of the thiol group (-SH) in cysteine has another atom or atom group attached thereto. Examples of cysteine derivatives includeN-acetylcysteine(NAC), S-carboxymethylcysteine(SCMC), Boc-Cys(Me)-OH, (R)-S-(2-amino-2-carboxyethyl)-L-homocysteine, (R)-2-amino-3-sulfopropionic acid, D-2-amino-4-(ethylthio)butyric acid, 3-sulfino-L-alanine, Fmoc-Cys(Boc-methyl)-OH, seleno-L-cysteine, S-(2-thiazolyl)-L-cysteine, S-(2-thienyl)-L-cysteine, S-(4-tolyl)-L-cysteine, but are not
WO 2016/024771 PCT/KR2015/008336
17
limited thereto. Cysteine can be easily synthesized into N-acetylcysteine(NAC) by reaction with an acetylation agent, and in basic conditions, it can be synthesized into S-carboxymethylcysteine(SCMC) by a reaction with a haloacetic acid. These cysteine derivatives are used mainly as pharmaceutical materials for antitussive agents, cough-relieving agents, and therapeutic agents for bronchitis, bronchial asthma,laryngopharyngitis, etc.
Mode for Invention
Hereinafter, the present invention will be described in more detail with reference to the following Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.
Example 1: Identification of YhhS MFS transporter andYegB MFS transporter
In order to identify Escherichia colimembrane proteins involved in the export of OPS, a genomic DNA library of Escherichia coliK12_W3110(ATCC27325) was screened.
Specifically, to set up the conditions in which the growth of E. coli is inhibited by OPS, a platform strain producing OPS was constructed. The platform strain for screening was a recombinant microorganism modified to reduce the activity of endogenous phosphoserine phosphatase (SerB) in the wild-type E. coli strain W3110, and was designated as “KCCM11212P” (also called “CA07-0012”; Korean Patent No. 10-1381048; US Patent Application Publication No. 2012-0190081).Using the OPS-producing strain KCCM11212P, optimal screening conditions showing growth inhibition were established by culturing the KCCM11212P, which is an OPS-producing strain, in a mediumcontaining OPS.
Then, the genomic library plasmids of W3110 were transformed into CA07-0012 by electroporation (van der Rest et al. 1999), and colonies showing the removal of growth inhibition under medium conditions containing an excessive amount of OPSwere selected. Plasmids were obtained from the selected colonies, and the nucleotide sequences thereof were analyzed by a sequencing technique. As a result, two E. coli membrane proteins involved in removing growth inhibition under medium conditions containing an excessive amount of OPS were identified.
The two E. coli membrane proteins were identified to be yhhSandmdtD, which encode YhhS major facilitator superfamily (MFS) transporter (an amino acid sequence of SEQ ID NO: 1 and a nucleotide sequence of SEQ ID NO: 3) andYegB MFS transporter (an amino acid sequence of SEQ ID NO: 2and a nucleotide sequence of SEQ ID NO: 4),
WO 2016/024771 PCT/KR2015/008336
18
respectively (Pao SS, Paulsen IT, Saier MH (1998). “Major facilitator superfamily.”MicrobiolMolBiol Rev 1998; 62(1); 1-34. PMID: 9529885).
Example 2: Construction of yhhS-andmdtD-overexpressing vectors
In order to examine whether OPS-exporting capability is enhanced when the YhhS MFS transporter andYegB MFS transporter, which are involved in removing growth inhibition by OPS, are enhanced in OPS-producing strains, vectors that overexpress each of the genes were constructed.Additionally, since the present inventors confirmed that the concentration of OPS increased when the homoserine/homoserine lactone transporter RhtB was enhanced in the OPS-producing strain (Korean Patent No. 138104), the RhtB-enhanced strain was used as a positive control. In addition, the multidrug efflux transporters EmrD and YcaD MFS belonging to the major facilitator superfamily (MFS), to which MacB belongs, were also evaluated.In the same manner as in YhhSandMdtD, multidrug effluxtransporter EmrD andYcaD MFS transporter, which are E. coli membrane proteins belonging to the major facilitator superfamily (MFS), were also evaluated.In this Example, fragments of the gene yhhS(SEQ ID NO: 3, Accession Numbers: b3473) encoding YhhS MFS transporterand fragments of the gene mdtD(SEQ ID NO: 4, Accession Numbers: b2077) encoding YegB MFS transporter were obtained by PCR using the genomic DNA of W3110 as a template.
The primer sequences used for constructing overexpression vectors for each of genes for the membrane proteins are shown in Table 1 below.
[Table 1]
Gene
Primer (5'->3')
SEQ ID NO
Vector
yhhS
GATATCATGCCCGAACCCGTAGC
5
pCL-PrhtB-yhhS
AAGCTTTTAAGATGATGAGGCGGCCT
6
mdtD
GATATCATGACAGATCTTCCCGACAGC
7
pCL-PrhtB-mdtD
AAGCTTTCATTGCGCGCTCCTTT
8
rhtB
GATATCATGACCTTAGAATGGTGG
9
pCL-PrhtB-rhtB
AAGCTTTCACGCATGCCTCGCCGA
10
emrD
GATATCATGAAAAGGCAAAGAAACGTCAA
11
pCL-PrhtB-emrD
AAGCTTTTAAACGGGCTGCCCCT
12
ycaD
GATATCATGTCCACGTATACCCAGCCTG
13
pCL-PrhtB-
WO 2016/024771 PCT/KR2015/008336
19
AAGCTTTTACACGTGAGCAACGGGTTT
14
ycaD
pCL-1920
AAGCTTCGGGCCTCTTCGCTATTACGC
15
pCL-PrhtB
AAGCTTAGGCTTACCCGTCTTACTGTC
16
Specifically, a PCR reactionfor yhhS was performed using the primers of SEQ ID NOS: 5 and 6, whereasa PCR reaction for mdtD was performed using the primers of SEQ ID NOS: 7 and 8. The primers used in the PCR reactions were constructed based on the information of the K12 W3110 gene (GenBankAccession Number AP 003471) deposited in the NIH GenBank and surrounding nucleotide sequences.
Additionally, the fragments of rhtB, emrD,andycaD genes were amplified via PCT reactions using the respective primer pairs shown in Table 1 below.
Each of the amplified gene fragments was treated with the restriction enzymes EcoRV and HindIII, and cloned into the EcoRV and HindIII restriction enzyme sites of thepCL-PrhtB vector, whichincludes the promoter (PrhtB)of E. coli rhtB gene inserted into a pCL1920 vector (GenBank No AB236930), thereby constructing pCL-PrhtB-rhtB, pCL-PrhtB-yhhS, pCL-PrhtB-mdtD, pCL-PrhtB-emrD, and pCL-PrhtB-ycaD, respectively.
Example 3: Construction of a strain with enhanced YhhS MFS transporter andYegB MFS transporter and evaluation of OPS-producing capability

Each of the five kinds of plasmids constructed in Example 2 was introduced into the OPS-producing strain CA07-0012, and then the OPSproduction capabilities of the resulting strains were evaluated.
Specifically, each of the strains was plated on an LB solid medium and cultured overnight in an incubator at 33°C. Each of the strains cultured overnight on the LB solid medium was inoculated into a 25mL titer medium shown in Table 2 below, and then incubated in an incubator at 34.5°C and 200 rpm for 40 hours. The results are shown in Table 3.
[Table 2]
WO 2016/024771 PCT/KR2015/008336
20
Composition
Conc. (per 1 L)
Glucose
50 g
KH2PO4
6 g
(NH4)2SO4
17 g
MgSO4·7H2O
1 g
FeSO4·7H2O
5 mg
MnSO4·4H2O
10 mg
L-Glycine
2.5 g
Yeast extract
3 g
Calcium carbonate
30 g
pH
6.8
[Table 3]
Strain
OD562nm
Glucose consumption
(g/L)
O-phosphoserine
(g/L)
CA07-0012
35
32
1.1
CA07-0012/pCL-PrhtB-rhtB
40
35
1.3
CA07-0012/pCL-PrhtB-yhhS
37
34
2.1
CA07-0012/pCL-PrhtB-mdtD
41
32
1.8
CA07-0012/pCL-PrhtB-emrD
38
34
1.2
CA07-0012/pCL-PrhtB-ycaD
37
33
0.9
As shown in Table 3 above, among the cases where the E. coli membrane protein genes were further introduced to the E. coli CA07-0012 strain, respectively, the strains having enhanced rhtB, emrD, or ycaD showed significant increases in OPS production, compared to the CA07-0012 strain, and in particular, the strains having enhancedYhhSandMdtD showed an at least 150% increase in OPSconcentration. On the contrary, the strains having enhancedEmrDandYcaD, which were used as experimental group, failed to show any increase in OPSconcentration.
The strain designated as “CA07-0012/pCL-PrhtB-yhhS” was named as “Escherichia coliCA07-0266(CA07-0266)”and deposited with the Korean Culture Center of Microorganisms, recognized as an international depositary authority under the Budapest
WO 2016/024771 PCT/KR2015/008336
21
Treaty, on December 9, 2013 under the Accession Number KCCM11495P.
Additionally, the strain designated as “CA07-0012/pCL-PrhtB-mdtD” was named as “Escherichia coliCA07-0267(CA07-0267)”and deposited with the Korean Culture Center of Microorganisms, recognized as an international depositary authority under the Budapest Treaty, on December 9, 2013 under the Accession Number KCCM11496P.

Additionally, the effects of the E. coli membrane protein genes were examined using the OPS-producing strain,CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC(Korean Patent Application Publication No. 10-2012-004111), in which the activities of D-3-phosphoglycerate dehydrogenase(SerA) and 3-phosphoserine aminotransferase(SerC) as OPSbiosynthesis routes were enhanced.The results are shown in Table 4 below.
[Table 4]
Strain
OD562nm
Glucose consumption
(g/L)
O-phosphoserine
(g/L)
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC
30
27
2.4
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-PrhtB-rhtB
32
28
2.8
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-PrhtB-yhhS
28
26
4.0
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-PrhtB-mdtD
27
27
3.5
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-PrhtB-emrD
33
29
2.3
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-PrhtB-ycaD
34
28
1.9
WO 2016/024771 PCT/KR2015/008336
22
As shown in Table 4 above, it was confirmed again that, among the strains where the E. coli membrane protein genes were further introduced to the CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerCstrain,the strains having enhanced YhhSandMdtDof the present invention and the strain having enhanced RhtB (positive control)showed increases in OPS production, compared to theE. coli-derived CA07-0012 strain. In particular, the strains having enhanced YhhSandMdtDof the present invention showed an at least 145% increase in OPSconcentration, similarly to the results shown in Table 3 above. On the contrary, the strains having enhanced ErmD and YcaD showed a decrease in OPSconcentration, relative to that of the control group.

Additionally, in order to examine whether the enhancement of promoter strength can increase the export capability,the membrane proteins YhhS and MdtD with increased OPSconcentrationwere compared to the control group, by further introducing yhhSandmdtDgenes into CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC, using atrcpromoter(Ptrc), which is a stronger promoter than the rhtBpromoter(PrhtB).
Each of the fragments of yhhSand mdtDgenes was treated with the restriction enzymes EcoRV and HindIII, and cloned into the EcoRV and HindIII restriction enzyme sites of thepCL-Ptrc-GFP vector, whichincludes the trcpromoterinserted into a pCL1920 vector, thereby constructing pCL-Ptrc-yhhS andpCL-Ptrc-mdtD, respectively. Then, PCR reactions were performed using each plasmid as a template along with primer pairs of SEQ ID NO: 15 and SEQ ID NO: 16, and the resultants were treated with HindIIIand then cloned into the HindIII restriction site of pCL-Prmf-SerA*(G336V)-(RBS)SerC.
[Table 5]
Strain
OD562nm
Glucose consumption
(g/L)
O-phosphoserine
(g/L)
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC
31
30
2.7
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-
28
33
5.5
WO 2016/024771 PCT/KR2015/008336
23
Ptrc-yhhS
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-Ptrc-mdtD
29
31
4.3
As a result, as shown in Table 5 above, when the expression of membrane proteins of E. coli was increased by enhancing the promoter, there was an at least 150% increase in yield compared to the control group, and an at least 120% increase compared to when the rhtBpromoter was used.

Additionally, in order to examine whether replacement of the promoters for yhhSandmdtDgenes with stronger promoterson the chromosome can enhance export capability, the OPSproduction capability was evaluated by constructing a strain, where the self-promoter was replaced with cj1promoter(Korean Patent No. 0620092). The introduction of the cj1promoter into the E. colichromosome was executed by a conventional method as described below. For the replacement of self-promoters of yhhSandmdtDon the chromosome, the constructed recombinant vector was transformed into an OPS-producing strain, CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC(Korean Patent No. 138104), and the above promoter sequence on the vector and the self-promoter sequences were replaced via homologous recombination, and thereby the cj1promoter sequence was inserted into the chromosome.
Each strain was plated on an LB solid medium and cultured overnight in an incubator at 33°C. Each of the strains cultured overnight on the LB solid medium was inoculated into a 25mL titer medium shown in Table 2 above, and then incubated in an incubator at 34.5°C and 200 rpm for 40 hours. The results are shown in Table 6 below.
[Table 6]
Strain
OD562nm
Glucose consumption
(g/L)
O-phosphoserine
(g/L)
CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC
30
29
2.7
WO 2016/024771 PCT/KR2015/008336
24
CA07-0022::Pcj1yhhs/pCL-Prmf-SerA*(G336V)-(RBS)SerC
28
30
3.5
CA07-0022::Pcj1mdtD/pCL-Prmf-SerA*(G336V)-(RBS)SerC
29
31
3.2
As shown in Table 6 above, when the expression of each membrane protein on the chromosome was increased, the yield relative to that of the control group was increased by up to 130%.
Example 4: Confirmation of OPS-exporting function of YhhS MFS transporter and YegB MFS transporter
Among the flask samples, in whichOPSproduction was confirmed in Example 3,after all OPS exported in the medium was removed using CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC, which is a negative control where the membrane proteins were not enhanced, and samplesCA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-Ptrc-yhhSand CA07-0022/pCL-Prmf-SerA*(G336V)-(RBS)SerC-Ptrc-mdtD, in which the membrane proteins YhhSandMdtDwere enhanced, only the cells were collected, and the cellswere crushed.The OPS concentration inside the cell was measured by high performance liquid chromatography(HPLC), and the results are shown in FIG. 1.
As a result, as shown in FIG. 1, the strains with enhanced YhhSandMdtD of the present invention showed a decrease in intracellular OPS concentration by 30% to 40%, compared to that of the control group, thus confirming that YhhsandMdtD proteins play a role in exportingOPS to the outside of the cell. Accordingly, it was confirmed that the enhancement of YhhsandMdtD proteins can smoothly export OPSin the cell to the outside,thereby enhancing the OPS-producing capability.
From the foregoing, a skilled person in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present invention. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present invention. On the contrary, the present invention is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents and other embodiments that may be included within the spirit and scope of the present invention as defined by the appended claims.

WE CLAIM:
Claim 1
A microorganism capable of producing O-phosphoserine (OPS), in which an activity of a polypeptide, which has an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and is capable of exporting O-phosphoserine, is enhanced compared to its endogenous activity.
Claim 2
The microorganism of claim 1, in which an activity of phosphoserine phosphatase (SerB) is further weakened compared to its endogenous activity.
Claim 3
The microorganism of claim 1, in which an activity of phosphoglycerate dehydrogenase (SerA) or phosphoserine aminotransferase (SerC) is further enhanced compared to its endogenous activity.
Claim 4
The microorganism of claim 1, wherein the microorganism capable of producing O- phosphoserine is Escherichia coli.
Claim 5
A method for producing O-phosphoserine(OPS), comprising:
culturing a microorganism capable of producing O-phosphoserine, in which an activity of a polypeptide which has an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 and is capable of exporting O-phosphoserine is enhanced, in a medium; and
separating O-phosphoserine from the microorganism capable of producing O-phosphoserine, or the medium for the same.
Claim 6
The method of claim 5, wherein, in the microorganism capable of producing O-phosphoserine, an activity of phosphoserine phosphatase (SerB) is further weakened compared to its endogenous activity.
WO 2016/024771 PCT/KR2015/008336
28
Claim 7
The method of claim 5, wherein, in the microorganism capable of producing O-phosphoserine, an activity of phosphoglycerate dehydrogenase (SerA) or phosphoserine aminotransferase (SerC) is further enhanced compared to its endogenous activity.
Claim 8
The method of claim 5, wherein the microorganism capable of producing O- phosphoserine is Escherichia coli.
Claim 9
A method for producingcysteine or a derivative thereof, comprising:
a)producing O-phosphoserine(OPS) by culturing the microorganism according toany of claims 1 to 4 in a medium; and
b)reacting the O-phosphoserine(OPS) produced in a) or a culture containing thesame with a sulfide, in the presence of O-phosphoserine sulfhydrylase (OPSS) ora microorganism capable of expressing the same.Claim 10The method of claim 9, wherein the sulfide is at least one selected from the group consisting of Na2S, NaSH, (NH4)2S, H2S, and Na2S2O3.

Documents

Orders

Section Controller Decision Date

Application Documents

# Name Date
1 Sequence listing(PDF) [01-02-2017(online)].pdf 2017-02-01
2 Sequence listing [01-02-2017(online)].txt 2017-02-01
3 Sequence listing [01-02-2017(online)].pdf 2017-02-01
4 Form 5 [01-02-2017(online)].pdf 2017-02-01
5 Form 3 [01-02-2017(online)].pdf 2017-02-01
6 Form 18 [01-02-2017(online)].pdf_189.pdf 2017-02-01
7 Form 18 [01-02-2017(online)].pdf 2017-02-01
8 Drawing [01-02-2017(online)].pdf 2017-02-01
9 Description(Complete) [01-02-2017(online)].pdf_188.pdf 2017-02-01
10 Description(Complete) [01-02-2017(online)].pdf 2017-02-01
11 201717003761.pdf 2017-02-07
12 abstract.jpg 2017-02-08
13 Other Patent Document [13-02-2017(online)].pdf_43.pdf 2017-02-13
14 Other Patent Document [13-02-2017(online)].pdf 2017-02-13
15 201717003761-Power of Attorney-130217.pdf 2017-02-15
16 201717003761-OTHERS-130217.pdf 2017-02-15
17 201717003761-Correspondence-130217.pdf 2017-02-15
18 Form 3 [01-05-2017(online)].pdf 2017-05-01
19 201717003761-FER.pdf 2019-11-25
20 201717003761-certified copy of translation [24-02-2020(online)].pdf 2020-02-24
21 201717003761-certified copy of translation [24-02-2020(online)]-1.pdf 2020-02-24
22 201717003761-RELEVANT DOCUMENTS [23-05-2020(online)].pdf 2020-05-23
23 201717003761-RELEVANT DOCUMENTS [23-05-2020(online)]-1.pdf 2020-05-23
24 201717003761-PETITION UNDER RULE 137 [23-05-2020(online)].pdf 2020-05-23
25 201717003761-PETITION UNDER RULE 137 [23-05-2020(online)]-1.pdf 2020-05-23
26 201717003761-OTHERS [23-05-2020(online)].pdf 2020-05-23
27 201717003761-FORM 3 [23-05-2020(online)].pdf 2020-05-23
28 201717003761-FER_SER_REPLY [23-05-2020(online)].pdf 2020-05-23
29 201717003761-ENDORSEMENT BY INVENTORS [23-05-2020(online)].pdf 2020-05-23
30 201717003761-DRAWING [23-05-2020(online)].pdf 2020-05-23
31 201717003761-COMPLETE SPECIFICATION [23-05-2020(online)].pdf 2020-05-23
32 201717003761-CLAIMS [23-05-2020(online)].pdf 2020-05-23
33 201717003761-ABSTRACT [23-05-2020(online)].pdf 2020-05-23
34 201717003761-US(14)-HearingNotice-(HearingDate-15-11-2021).pdf 2021-10-22
35 201717003761-Written submissions and relevant documents [26-11-2021(online)].pdf 2021-11-26
36 201717003761-Information under section 8(2) [26-11-2021(online)].pdf 2021-11-26
37 201717003761-FORM 3 [26-11-2021(online)].pdf 2021-11-26
38 201717003761-Annexure [26-11-2021(online)].pdf 2021-11-26
39 201717003761-PatentCertificate14-12-2021.pdf 2021-12-14
40 201717003761-IntimationOfGrant14-12-2021.pdf 2021-12-14
41 201717003761-FORM 4 [11-08-2022(online)].pdf 2022-08-11
42 201717003761-RELEVANT DOCUMENTS [28-09-2022(online)].pdf 2022-09-28
43 201717003761-RELEVANT DOCUMENTS [09-09-2023(online)].pdf 2023-09-09

Search Strategy

1 Document1_11-10-2019.pdf

ERegister / Renewals

3rd: 28 Jan 2022

From 10/08/2017 - To 10/08/2018

4th: 28 Jan 2022

From 10/08/2018 - To 10/08/2019

5th: 28 Jan 2022

From 10/08/2019 - To 10/08/2020

6th: 28 Jan 2022

From 10/08/2020 - To 10/08/2021

7th: 28 Jan 2022

From 10/08/2021 - To 10/08/2022

8th: 11 Aug 2022

From 10/08/2022 - To 10/08/2023

9th: 25 May 2023

From 10/08/2023 - To 10/08/2024

10th: 11 Jun 2024

From 10/08/2024 - To 10/08/2025

11th: 26 May 2025

From 10/08/2025 - To 10/08/2026

12th: 29 May 2026

From 10/08/2026 - To 10/08/2027