OUIGONUCUEOTIDE COMPOSITIONS AND METHODS OF USE THEREOF

CROSS-REFERENCE TO REUATED APPUICATIONS

[0001] This application claims priority to United States Provisional Application Nos. 62/911,340, fried October 6, 2019, 62/983,736, fried March 1, 2020, and 63/069,704, fried August 24, 2020, and International Application No. PCT/US2020/032244, fried May 8, 2020, the entirety of each of which is incorporated herein by reference.

BACKGROUND

[0002] Oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, and/or research applications, including but not limited to treatment of various conditions, disorders or diseases.

SUMMARY

[0003] The present disclosure provides oligonucleotides, and compositions thereof, that can reduce levels of C9orf72 transcripts (or products thereof). In some embodiments, provided oligonucleotides and compositions can preferentially reduce levels of disease-associated transcripts of C9orf72 (or products thereof) over non- or less-disease-associated transcripts of C9orf72 (see, e.g. , Figure 1). Example C9orf72 transcripts include transcripts from either strand of the C9orf72 gene and from various starting points. In some embodiments, at least some C9orf72 transcripts are translated into proteins; in some embodiments, at least some C9orf72 transcripts are not translated into proteins. In some embodiments, certain C9orf72 transcripts contain predominantly intronic sequences.

[0004] A hexanucleotide repeat expansion in C9orf72 (Chromosome 9, open reading frame 72) is reportedly the most frequent genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). C9orf72 gene variants comprising the repeat expansion and/or products encoded thereof are also associated with other C9orf72-related disorders, such as corticobasal degeneration syndrome (CBD), atypical Parkinsonian syndrome, olivopontocerebellar degeneration (OPCD), primary lateral sclerosis (PLS), progressive muscular atrophy (PMA), Huntington’s disease (HD) phenocopy, Alzheimer’s disease (AD), bipolar disorder, schizophrenia, and other non-motor disorders. In some embodiments, the present disclosure provides compositions and methods related to oligonucleotides which target a C9orf72 target (e.g., a C9orf72 oligonucleotide) and are capable of knocking down or decreasing expression, level and/or activity of the C9orf72 target gene and/or a gene product thereof (a transcript, particularly a repeat expansion containing transcript, a protein, etc.).

[0005] In some embodiments, an oligonucleotide targets a pathological or disease-associated

C9orf72 mutation or variant comprising a repeat expansion. In some embodiments, a C9orf72 gene product

is a RNA (e.g., a mRNA, mature RNA or pre-mRNA) transcribed from a C9orf72 gene, a protein translated from a C9orf72 RNA transcript (e.g., a dipeptide repeat protein translated from the hexanucleotide repeat), or a focus (plural: foci) (which reportedly comprises RNA comprising the repeat expansion bound by RNA-binding proteins). In some embodiments, a C9orf72 oligonucleotide is capable of mediating preferential knockdown of a repeat expansion-containing C9orf72 RNA relative to a non-repeat expansion-containing C9orf72 RNA (a C9orf72 RNA which does not contain a repeat expansion). In some embodiments, a C9orf72 oligonucleotide decreases the expression, activity and/or level of a deleterious C9orf72 gene product (e.g., a RNA comprising a repeat expansion, a dipeptide repeat protein or a focus) without decreasing (or while decreasing to a much lower extent) the expression, activity and/or level of a wild-type or non-deleterious C9orf72 gene product. In some embodiments, a C9orf72 oligonucleotide decreases the expression, activity and/or level of a deleterious C9orf72 gene product, but does not decrease the expression, activity and/or level of a wild-type or non-deleterious C9orf72 protein enough to eliminate or significantly suppress a beneficial and/or necessary biological activity or activities of C9orf72 protein. Beneficial and/or necessary activities of C9orf72 protein are widely known and include but not limited to restricting inflammation, preventing autoimmunity and preventing premature mortality.

[0006] Among other things, the present disclosure encompasses the recognition that controlling structural elements of C9orf72 oligonucleotides can have a significant impact on oligonucleotide properties and/or activities, including knockdown of a C9orf72 target gene. In some embodiments, knockdown of a target gene is mediated by RNase H or steric hindrance affecting translation. In some embodiments, controlled structural elements of C9orf72 oligonucleotides include but are not limited to: base sequence, chemical modifications (e.g., modifications of a sugar, base and/or intemucleotidic linkage) or patterns thereof, alterations in stereochemistry (e.g., stereochemistry of a backbone chiral intemucleotidic linkage) or patterns thereof, wing structure, core structure, wing-core structure, wing-core-wing structure, or core wing structure, and/or conjugation with an additional chemical moiety (e.g., a carbohydrate moiety, a targeting moiety, etc.). In some embodiments, the present disclosure provides technologies (e.g., compounds, methods, etc.) for improving C9orf72 oligonucleotide stability while maintaining or increasing oligonucleotide activity, including compositions of improved-stability oligonucleotides. In some embodiments, provided oligonucleotides target C9orf72 or products thereof. In some embodiments, a target gene is a C9orf72.

[0007] In some embodiments, the present disclosure encompasses the recognition that various optional additional chemical moieties, such as carbohydrate moieties, targeting moieties, etc., when incorporated into C9orf72 oligonucleotides, can improve one or more properties. In some embodiments, an additional chemical moiety is selected from: glucose, GluNAc (N -acetyl amine glucosamine) and anisamide moieties. These and other moieties are described in more detail herein, e.g., in Examples 1 and 2. In some embodiments, an oligonucleotide can comprise two or more additional chemical moieties, wherein the additional chemical moieties are identical or non-identical, or are of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.) or not of the same category. In some embodiments, certain additional chemical moieties facilitate delivery of oligonucleotides to desired cells, tissues and/or organs, including but not limited to particular cells, parts or portions of the central nervous system (e.g., cerebral cortex, hippocampus, spinal cord, etc.). In some embodiments, certain additional chemical moieties facilitate internalization of oligonucleotides. In some embodiments, certain additional chemical moieties increase oligonucleotide stability. In some embodiments, the present disclosure provides technologies for incorporating various additional chemical moieties into oligonucleotides. In some embodiments, the present disclosure provides, for example, reagents and methods, for introducing additional chemical moieties through intemucleotidic linkages, sugars and/or nucleobases (e.g., by covalent linkage, optionally via a linker, to a site on a sugar, a nucleobase, or an intemucleotidic linkage).

[0008] In some embodiments, the present disclosure demonstrates that surprisingly high target specificity can be achieved with oligonucleotides, e.g., C9orf72 oligonucleotides, whose structures include one or more features as described herein [including, but not limited to, base sequences disclosed herein (wherein each U can be optionally and independently substituted by T and vice versa), and/or chemical modifications and/or stereochemistry and/or patterns thereof and/or combinations thereof.

[0009] In some embodiments, the present disclosure demonstrates that certain provided structural elements, technologies and/or features are particularly useful for oligonucleotides that knock down C9orf72. Regardless, however, the teachings of the present disclosure are not limited to oligonucleotides that participate in or operate via any particular biochemical mechanism. In some embodiments, the present disclosure provides oligonucleotides capable of operating via a mechanism such as double -stranded RNA interference, single-stranded RNA interference or which acts as an antisense oligonucleotide which decreases the expression, activity and/or level of a C9orf72 gene or a gene product thereof via a RNase H-mediated mechanism or steric hindrance of translation.

[0010] Further, the present disclosure pertains to any C9orf72 oligonucleotide which operates through any mechanism, and which comprises any sequence, structure or format (or portion thereof) described herein, wherein the oligonucleotide comprises at least one non-naturally -occurring modification of a base, sugar or intemucleotidic linkage. In some embodiments, the present disclosure pertains to any C9orf72 oligonucleotide which comprises at least one stereocontrolled intemucleotidic linkage (including but not limited to a phosphorothioate linkage in the Sp or Rp configuration). In some embodiments, the present disclosure pertains to any C9orf72 oligonucleotide which operates through any mechanism, and which comprises at least one stereocontrolled intemucleotidic linkage (including but not limited to a phosphorothioate linkage in the Sp or Rp configuration). In some embodiments, the present disclosure

provides a C9orf72 oligonucleotide which comprises any sequence, structure or format (or portion thereof) described herein, an optional additional chemical moiety (including but not limited to a carbohydrate moiety, and a targeting moiety), stereochemistry or patterns of stereochemistry, intemucleotidic linkage or pattern of intemucleotidic linkages; modification of sugar(s) or pattern of modifications of sugars; modification of base(s) or patterns of modifications of bases. In some embodiments, a modification of a sugar, nucleobase or intemucleotidic linkage is a non-naturally-occurring modification.

[0011] In some embodiments, a C9orf72 disorder-associated target allele contains a hexanucleotide repeat expansion in intron 1, including but not limited to G4C2 or (GGGGCC)ng, wherein ng is 30 or more. In some embodiments, ng is 50 or more. In some embodiments, ng is 100 or more. In some embodiments, ng is 150 or more. In some embodiments, ng is 200 or more. In some embodiments, ng is 300 or more. In some embodiments, ng is 500 or more.

[0012] The C9orf72 G4C2 repeat expansion in intron 1 reportedly accounts for 1 in 10 ALS cases among European-ancestry populations. G4C2 repeats are reportedly of only about -10% of the transcripts (e.g., transcripts V3 and VI of the pathological allele illustrated in Figure 1), with gain of function toxicities, at least partially mediated by the dipeptide repeat proteins and foci formation by, for example, repeat-expansion containing transcripts and/or spliced-out repeat-expansion containing introns and/or antisense transcription of the repeat-expansion containing region and various nucleic-acid binding proteins. In some embodiments, VI is reportedly transcribed at very low levels (around 1% of the total C9orf72 transcript level) and does not contribute significantly to the levels of transcripts comprising hexanucleotide repeat expansions. Reportedly, intron nucleic acid containing repeat expansions can be retained as pre-mRNA, partially spliced RNA, and/or spliced out introns, and RNA foci comprising these nucleic acids are associated with RNA binding protein sequestration. C9orf72 RNA foci are described in, for example, Liu et al, 2017, Cell Chemical Biology 24, 1-8; Niblock et al. Acta Neuropathologica Communications (2016) 4: 18. Aberrant protein products comprising dipeptide repeat proteins (DPR proteins) are reportedly produced from the repeat expansion, with toxicity to neurons. In some embodiment, the present disclosure provides oligonucleotides and compositions and methods of use thereof which target an intron sequence close to the G4C2 repeats, and can reduce levels of repeat expansion-containing transcripts, proteins encoded thereby, and/or related foci. In some embodiment, the present disclosure provides C9orf72 oligonucleotides and compositions thereof which target an intron sequence close to the G4C2 repeats, to specifically knockdown the repeat expansion-containing transcripts via RNAse-H, with minimal impact on normal C9orf 72 transcripts. In some embodiments, compared to existing data, the present disclosure demonstrates that provided technologies targeting an intron sequence (e.g., between the repeats and exon lb) can effectively and/or preferentially reduce levels of repeat expansion-containing products.

[0013] Without wishing to be bound by any particular theory, the present disclosure notes that

several possible mechanisms for the deleterious and disease-associated effects of the repeat expansion have been proposed in the literature. See for example: Edbauer et al. 2016 Curr. Opin. Neurobiol. 36: 99-106; Conlon et al. Elife. 2016 Sep 13;5. pii: el7820; Xi et al. 2015 Acta Neuropathol. 129: 715-727; Cohen-Hada etal. 2015 Stem Cell Rep. 7: 927-940; and Burguete et al. eLife 2015;4:e08881. Among other things, the present disclosure provides technologies that can reduce or remove one or more or all deleterious and disease-associated C9orf72 products and/or disease-associated effects.

[0014] Without wishing to be bound by any particular theory, the present disclosure notes that a possible mechanism of a deleterious effect of repeat expansion-containing C9orf72 transcripts is the generation of foci. Reportedly, the repeat expansion results in retention of intron 1 -containing C9orf72 mRNA. The majority of intron 1-retaining C9orf72 mRNA accumulates in the nucleus where it is targeted to a specific degradation pathway unable to process G4C2 RNA repeats. The RNAs subsequently aggregate into foci, which also comprise RNA-binding proteins, sequestering them from their normal functions. Niblock Acta Neuropathol Commun. 2016; 4: 18. Reportedly antisense foci comprising antisense C9orf72 products are present at a significantly higher frequency in cerebellar Purkinje neurons and motor neurons, whereas sense foci are present at a significantly higher frequency in cerebellar granule neurons. Cooper-Knock et al. Acta Neuropathol (2015) 130:63-75. In some embodiments, the present disclosure provides technologies for reducing levels of foci. In some embodiments, provided technologies reduce levels of or remove antisense foci and/or sense foci in one or more types of neurons.

[0015] Without wishing to be bound by any particular theory, the present disclosure notes that another possible mechanism of a deleterious effect of repeat expansion-containing C9orf72 transcripts is the generation of dipeptide repeat (DPR) proteins. A small proportion of intron 1-retaining C9orf72 mRNA is exported to the cytoplasm for RAN (repeat-associated non-AUG translation) translation in all six reading frames into DPRs. Niblock Acta Neuropathol Commun. 2016; 4: 18. Cooper-Knock et al. also reported that inclusions containing sense or antisense derived dipeptide repeat proteins were present at significantly higher frequency in cerebellar granule neurons or motor neurons, respectively; and in motor neurons, which are the primary target of pathology in ALS, the presence of antisense foci but not sense foci correlated with mislocalisation of TDP-43, which is a hallmark of ALS neurodegeneration. In some embodiments, provided technologies reduce levels of one or more or all of C9orf72 DPR protein products.

[0016] In some embodiments, gain- and/or loss-of-function mechanisms lead to neurodegeneration in a C9orf72-related disorder. See, for example: Mizielinska et al. 2014 Science 345: 1192-94; Chew et al. 2015 Science 348: 1151-1154; Jiang et al. 2016 Neuron 90: 535-550; and Liu et al.

2016 Neuron 90: 521-534; Gendron et al. Cold Spring Harb. Perspect. Med. 2017 Jan 27. pii: a024224; Haeusler et al. Nat Rev Neurosci. 2016 Jun; 17(6):383-95; Koppers et al. Ann. Neurol. 2015;78:426-438; Todd et al. J. Neurochem. 2016 138 (Suppl. 1) 145-162. In some embodiments, provided technologies

reduce undesired gained functions, and/or restore or enhance desired functions.

[0017] In some embodiments, provided oligonucleotides and compositions and methods of use thereof are useful for treatment of any of several C9orf72-related disorders, including but not limited to amyotrophic lateral sclerosis (ALS). In some embodiments, ALS is MIM: 612069. Amyotrophic lateral sclerosis (ALS) is a reportedly a fatal neurodegenerative disease characterized clinically by progressive paralysis leading to death, often from respiratory failure, typically within two to three years of symptom onset (Rowland and Shneider, N. Engl. J. Med., 2001, 344, 1688-1700). ALS reportedly is the third most common neurodegenerative disease in the Western world (Hirtz et al., Neurology, 2007, 68, 326-337), and there are currently no effective therapies. Approximately 10% of cases are familial in nature, whereas the bulk of patients diagnosed with the disease are classified as sporadic as they appear to occur randomly throughout the population (Chio et al., Neurology, 2008, 70, 533-537). Clinical, genetic, and epidemiological data reportedly support the hypothesis that ALS and frontotemporal dementia (LTD) represent an overlapping continuum of disease, characterized pathologically by the presence of TDP-43 positive inclusions throughout the central nervous system (Lillo and Hodges, J. Clin. Neurosci., 2009, 16, 1131-1135; Neumann et al., Science, 2006, 314, 130-133). A number of genes have been discovered as potentially causative for classical familial ALS, for example, SOD1, TARDBP, PUS, OPTN, and VCP (Johnson et al., Neuron, 2010, 68, 857-864; Kwiatkowski et al., Science, 2009, 323, 1205-1208; Maruyama et al., Nature, 2010, 465, 223-226; Rosen et al., Nature, 1993, 362, 59-62; Sreedharan et al., Science, 2008, 319, 1668-1672; Vance et al., Brain, 2009, 129, 868-876). Linkage analysis of kindreds involving multiple cases of ALS, LTD, and ALS-PTD had reportedly suggested that there was an important locus for the disease on the short arm of chromosome 9, identified as C9orf72 (Boxer et al, J. Neurol. Neurosurg. Psychiatry, 2011, 82, 196-203; Morita et al., Neurology, 2006, 66, 839-844; Pearson et al. J. Neurol., 2011, 258, 647-655; Vance et al., Brain, 2006, 129, 868-876). This mutation had been found to be the most common genetic cause of ALS and LTD. In some embodiments, ALS-PTD causing mutation is a large hexanucleotide (e.g., GGGGCC or G4C2) repeat expansion in the first intron of the C9orf72 gene on chromosome 9 (Renton et al., Neuron, 2011, 72, 257-268; DeJesus-Hemandez et al., Neuron, 2011, 72, 245-256). A founder haplotype, covering the C9orf72 gene, is present in the majority of cases linked to this region (Renton etak, Neuron, 2011, 72, 257-268). This locus on chromosome 9p21 accounts for nearly half of familial ALS and nearly one-quarter of all ALS cases in a cohort of 405 Pinnish patients (Laaksovirta et al, Lancet Neurol., 2010, 9, 978-985). The incidence of ALS is reportedly 1:50,000. Pamilial ALS reportedly represents 5-10% of all ALS cases; C9orf72 mutations reportedly can be the most common cause of ALS (40-50%). ALS is reportedly associated with degeneration of both upper and lower motor neurons in the motor cortex of the brain, the brain stem, and the spinal cord. Symptoms of ALS reportedly include: muscle weakness and/or muscle atrophy, trouble swallowing or breathing, cramping, stiffness. Respiratory failure is reportedly the main cause of death. In some embodiments, provided technologies reduces severity and/or removes one or more of symptoms related to ALS or other C9orf72 related conditions, disorders and/or diseases.

[0018] In some embodiments, provided oligonucleotides and compositions and methods of use thereof are useful for treatment of any of several C9orf72-related disorders, including but not limited to frontotemporal dementia (FTD). In some embodiments, FTD is referred to as frontotemporal lobar degeneration or FTLD, MIM: 600274. Frontotemporal dementia, reportedly the second most common form of presenile dementia, is reportedly associated with focal atrophy of the frontal or temporal lobes. Boxer et al. 2005 Alzheimer Dis. Assoc. Disord. 19 (Suppl 1):S3-S6. FTD shares extensive clinical, pathological, and molecular overlap with amyotrophic lateral sclerosis. As reported by Gijselinck, Cold Spring Harb. Perspect. Med. 2017 Jan 27. pii: a026757, there are reportedly families and individual patients in which both diseases occur (ALS-FTD) (Lomen-Hoerth et al. 2002 Neurology 59: 1077-1079), and TDP-43 inclusions (Arai et al. 2006 Biochem. Biophys. Res. Comm. 351: 602-611; Neumann et al. 2006 Science 314: 130-133) in ALS and FTLD patients can be indistinguishable (Tsuji etal. 2012 Brain 135: 3380-3391), despite the pathological distribution being different for ALS and FTLD patients. There is reportedly evidence that common disease pathways may be involved in ALS and FTLD because their clinical and pathological hallmarks overlap; hence, the pure forms of these diseases are considered the two extremes of one disease continuum (Lillo and Hodges 2009 J. Clin. Neurosci. 16: 1131-1135). Genetic studies reportedly identified mutations in the same genes in FTLD and ALS — for example, TBK1, TARDBP, FUS, VCP (Neumann et al. 2006; Kovacs et al. 2009 Mov. Disord. 24: 1843-1847; Johnson et al. 2010 Neuron 68: 857-864; Van Langenhove et al. 2010 Neurology 74: 366-371; Cirulli et al. 2015 Science 347: 1436-1441; Freischmidt et al. 2015 Nat. Neurosci. 18: 631-636; Pottier et al. 2015 Acta Neuropathol. 130: 77-92). Genetic evidence for a common disease pathomechanism was reportedly provided by the identification of the repeat expansion mutations in C9orf72 in patients with ALS, FTLD, and ALS-FTD (Gijselinck et al.

2010 Arch. Neurol. 67: 606-616; De Jesus-Hemandez et al. 2011 Neuron 72: 245-256; Renton et al. 2011 Neuron 72: 257-268).

[0019] In some embodiments, a C9orf72 target is a specific allele (e.g., one with a repeat expansion) and level, expression and/or activity of one or more products (e.g., RNA and/or protein products such as dipeptide repeat proteins or DPRs) are intended to be altered. In many embodiments, a C9orf72 target allele is one whose presence and/or expression is associated (e.g., correlated) with presence, incidence, and/or severity, of one or more diseases and/or conditions, including but not limited to ALS and FTD or other C9orf72-related disorders, or a symptom thereof. Alternatively or additionally, in some embodiments, a C9orf72 target allele is one for which alteration of expression, level and/or activity of one or more gene products correlates with improvement (e.g., delay of onset, reduction of severity,

responsiveness to other therapy, etc.) in one or more aspects of a disease and/or condition, including but not limited to ALS and FTD or other C9orf72-related disorders.

[0020] In some embodiments, a neurological disease is characterized by neuronal hyperexcitability. In some embodiments, a 50% reduction in C9orf72 activity, due to and/or in the presence of the (GGGGCC)n expansion, reportedly increases neurotransmission through the glutamate receptors NMDA, AMPA, and kainite. In addition, glutamate receptors reportedly accumulate on neurons. The increased neurotransmission and accumulation of glutamate receptors reportedly leads to glutamate-induced excitotoxicity due to the neuronal hyperexcitability. Inhibiting glutamate receptors would reportedly treat the neuronal hyperexcitability. Clearance of dipeptide repeat proteins generated from the expansion reportedly is impaired, enhancing their neurotoxicity. C9orf72 reportedly promotes early endosomal trafficking through activation of RAB5, which requires phosphatidylinositol 3-phosphase (PI3P). PIKFYVE converts PI3P to phosphatidylinositol (3,5)-bisphosphate (PI(3,5)P2). Inhibiting PIKFYVE reportedly would compensate for altered RAB5 levels by increasing PI3P levels to enable early endosomal maturation, which would ultimately lead to the clearance of dipeptide repeat proteins. Neurons reportedly also use endosomal trafficking to regulate sodium and potassium ion channel localization. Inhibiting PIKFYVE reportedly may also treat neuronal hyperexcitability. In some embodiments, provided technologies reduce neuronal hyperexcitability. In some embodiments, provided technologies may be administered as part of the same treatment regime as an inhibitor of PIKFYVE.

[0021] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a first plurality of oligonucleotides which share:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that a non-random or controlled level of the oligonucleotides in the composition have the common base sequence and length, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

[0022] In some embodiments, the present disclosure provides a C9orf72 oligonucleotide composition comprising a first plurality of oligonucleotides capable of directing C9orf72 knockdown, wherein oligonucleotides are of a particular oligonucleotide type characterized by:

1) a common base sequence and length;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers;

which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and length, for oligonucleotides of the particular oligonucleotide type.

[0023] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides which share the same constitution or structure, wherein the oligonucleotides comprises one or more (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) chirally controlled intemucleotidic linkages. In some embodiments, base sequence of each oligonucleotide of the plurality comprises a 15, 16, 17, 18, 19, 20 or more consecutive nucleobases that are identical with or complementary to the base sequence or a portion thereof of a C9orf72 gene or a transcript thereof.

[0024] In some embodiments, when aligned with its target sequence for maximum complementarity, the base sequence of a provided oligonucleotide comprises one or more mismatches (e.g., not AT, AU or CG). In some embodiments, a mismatch is at the 3 ’-end. In some embodiments, no more than 1, 2, or 3 mismatches are present. As demonstrated herein, oligonucleotides whose base sequences comprise one or more mismatches when aligned with their target sequences may unexpectedly provide higher activities (e.g., when contacted with target transcripts and R ase H to reduce levels of the target transcripts), lower toxicity, etc. compared to oligonucleotides whose base sequences are fully complementary to their target sequences.

[0025] In some embodiments, a provided oligonucleotide (which can target C9orf72 or target a target other than C9orf72) comprises one or more blocks. In some embodiments, a block comprises one or more consecutive nucleosides, and/or nucleotides, and/or sugars, or bases, and/or intemucleotidic linkages. In some embodiments, a provided oligonucleotide comprises three or more blocks, wherein the blocks on either end are not identical and the oligonucleotide is thus asymmetric. In some embodiments, a block is a wing or a core.

[0026] In some embodiments, a C9orf72 oligonucleotide comprises at least one wing and at least one core, wherein a wing differs structurally from a core in that a wing comprises a structure [e.g., stereochemistry, additional chemical moiety, or chemical modification at a sugar, base or intemucleotidic linkage (or pattern thereof)] different than the core, or vice versa. In some embodiments, a provided oligonucleotide comprises a wing-core-wing stmcture. In some embodiments, a provided oligonucleotide comprises a wing-core, core-wing, or wing-core-wing stmcture, wherein one wing differs in stmcture [e.g., stereochemistry, additional chemical moiety, or chemical modification at a sugar, base or intemucleotidic linkage (or pattern thereof)] from the other wing and the core (for example, an asymmetrical oligonucleotide). In some embodiments, an oligonucleotide has or comprises a wing-core, core-wing, or wing-core-wing stmcture, and a block is a wing or core. In some embodiments, a core is also referenced to as a gap.

[0027] In general, properties of oligonucleotide compositions as described herein can be assessed

using any appropriate assay.

[0028] Those of skill in the art will be aware of and/or will readily be able to develop appropriate assays for particular oligonucleotide compositions.

BRIEF DESCRIPTION OF THE DRAWING

[0029] Figure 1. Figure 1 describes example C9orf72 transcripts. V3, V2 and VI transcripts produced from a healthy and a pathological C9orf72 allele are illustrated, wherein the pathological allele contains a hexanucleotide repeat expansion [horizontal bar, indicated by (GGGGCC)3o+]. The downward pointing arrow indicates the position of some example C9orf72 oligonucleotides targeting intron 1.

DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

Definitions

[0030] As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M.B. and March, T, John Wiley & Sons, New York: 2001.

[0031] As used herein in the present disclosure, unless otherwise clear from context, (i) the term

“a” or “an” may be understood to mean “at least one”; (ii) the term “or” may be understood to mean “and/or”; (iii) the terms “comprising”, “comprise”, “including” (whether used with “not limited to” or not), and “include” (whether used with “not limited to” or not) may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; (iv) the term “another” may be understood to mean at least an additional/second one or more; (v) the terms “about” and “approximately” may be understood to permit standard variation as would be understood by those of ordinary skill in the art; and (vi) where ranges are provided, endpoints are included.

[0032] Unless otherwise specified, description of oligonucleotides and elements thereof (e.g., base sequence, sugar modifications, intemucleotidic linkages, linkage phosphorus stereochemistry, etc.) is from 5 ’ to 3 ’ . As those skilled in the art will appreciate, in some embodiments, oligonucleotides may be provided and/or utilized as salt forms, particularly pharmaceutically acceptable salt forms, e.g., sodium salts. As those skilled in the art will also appreciate, in some embodiments, individual oligonucleotides within a composition may be considered to be of the same constitution and/or structure even though, within such composition (e.g., a liquid composition), particular such oligonucleotides might be in different salt form(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e.g., in a liquid

composition) at a particular moment in time. For example, those skilled in the art will appreciate that, at a given pH, individual intemucleotidic linkages along an oligonucleotide chain may be in an acid (H) form, or in one of a plurality of possible salt forms (e.g., a sodium salt, or a salt of a different cation, depending on which ions might be present in the preparation or composition), and will understand that, so long as their acid forms (e.g., replacing all cations, if any, with I ) are of the same constitution and/or structure, such individual oligonucleotides may properly be considered to be of the same constitution and/or structure.

[0033] Aliphatic : As used herein, “aliphatic” means a straight-chain (i.e.. unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or combinations thereof. In some embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalky l)alkenyl .

[0034] Alkyl·. As used herein, the term “alkyl” is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, an alkyl has 1-100 carbon atoms. In certain embodiments, a straight chain or branched chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C1-C20 for straight chain, C2-C20 for branched chain), and alternatively, about 1-10. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure where such rings are monocyclic, bicyclic, or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure. In some embodiments, an alkyl group may be a lower alkyl group, wherein a lower alkyl group comprises 1-4 carbon atoms (e.g., C1-C4 for straight chain lower alkyls).

[0035] Animal: As used herein, the term “animal” refers to any member of the animal kingdom.

In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and/or worms. In some embodiments, an animal may be a transgenic animal, a genetically-engineered animal and/or a clone.

[0036] Approximately: As used herein, the terms “approximately” or “about” in reference to a number are generally taken to include numbers that fall within a range of 5%, 10%, 15%, or 20% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value). In some embodiments, use of the term “about” in reference to dosages means ± 5 mg/kg/day.

[0037] Aryl: The term “aryl", as used herein, used alone or as part of a larger moiety as in

“aralkyl,” “aralkoxy,” or “aryloxyalkyl,” refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic. In some embodiments, an aryl group is a monocyclic, bicyclic or polycyclic ring system having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members. In some embodiments, an aryl group is a biaryl group. The term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present disclosure, “aryl” refers to an aromatic ring system which includes, but not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.

[0038] Comparable: The term “comparable” is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed. In some embodiments, comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will appreciate that sets of conditions are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied.

[0039] Cycloaliphatic: The term “cycloaliphatic,” “carbocycle,” “carbocyclyl,” “carbocyclic radical,” and “carbocyclic ring,” are used interchangeably, and as used herein, refer to saturated or partially unsaturated, but non-aromatic, cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having, unless otherwise specified, from 3 to 30 ring members. Cycloaliphatic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbomyl, adamantyl, and cyclooctadienyl. In some

embodiments, a cycloaliphatic group has 3-6 carbons. In some embodiments, a cycloaliphatic group is saturated and is cycloalkyl. The term “cycloaliphatic” may also include aliphatic rings that are fused to one or more aromatic or nonaromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, a cycloaliphatic group is bicyclic. In some embodiments, a cycloaliphatic group is tricyclic. In some embodiments, a cycloaliphatic group is polycyclic. In some embodiments, “cycloaliphatic” refers to C3-C6 monocyclic hydrocarbon, or CVCm bicyclic or polycyclic hydrocarbon, that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule, or a C9-C16 polycyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.

[0040] Dosing regimen: As used herein, a “dosing regimen” or “therapeutic regimen” refers to a set of unit doses (typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regime comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, all doses within a dosing regimen are of the same unit dose amount. In some embodiments, different doses within a dosing regimen are of different amounts. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount different from the first dose amount. In some embodiments, a dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount same as the first dose amount.

[0041] Heteroaliphatic. The term “heteroaliphatic”, as used herein, is given its ordinary meaning in the art and refers to aliphatic groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). In some embodiments, one or more units selected from C, CH, CEE, and CH3 are independently replaced by one or more heteroatoms (including oxidized and/or substituted form thereof). In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.

[0042] Heteroalkyl·. The term “heteroalkyl”, as used herein, is given its ordinary meaning in the art and refers to alkyl groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). Examples of heteroalkyl groups include, but are not limited to, alkoxy, polyethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.

[0043] Heteroaryl: The terms “heteroaryl” and “heteroar-”, as used herein, used alone or as part of a larger moiety, e.g., “heteroaralkyl,” or “heteroaralkoxy,” refer to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments 5, 6, 9, or 10 ring atoms. In some embodiments, a heteroaryl group has 6, 10, or 14 p electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. In some embodiments, a heteroaryl is a heterobiaryl group, such as bipyridyl and the like. The terms “heteroaryl” and “heteroar-”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H quinolizinyl. carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]-l,4-oxazin-3(4H)-one. A heteroaryl group may be monocyclic, bicyclic or polycyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl group, wherein the alkyl and heteroaryl portions independently are optionally substituted.

[0044] Heteroatom: The term “heteroatom", as used herein, means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quatemized form of any basic nitrogen or a substitutable nitrogen of a heterocyclic ring (for example, N as in 3.4-dihydro-2//-pyrrolyl). NH (as in pyrrolidinyl) or NR+ (as in N-substituted pyrrolidinyl); etc.).

[0045] Heterocycle: As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical,” and “heterocyclic ring", as used herein, are used interchangeably and refer to a monocyclic, bicyclic or polycyclic ring moiety (e.g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10-membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3

heteroatoms selected from oxygen, sulfur and nitrogen, the nitrogen may be N (as in 3.4-dihydro-2// pyrrolyl), NH (as in pyrrolidinyl), or ~NR (as in A'' substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3// indolyl. chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be monocyclic, bicyclic or polycyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.

[0046] In vitro : As used herein, the term “in vitro ” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant and/or microbe).

[0047] In vivo: As used herein, the term “in vivo ” refers to events that occur within an organism

(e.g., animal, plant and/or microbe).

[0048] Optionally Substituted : As described herein, compounds, e.g., oligonucleotides, of the disclosure may contain optionally substituted and/or substituted moieties. In general, the term “substituted,” whether preceded by the term “optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an “optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. In some embodiments, an optionally substituted group is unsubstituted. Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term “stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein.

[0049] Suitable monovalent substituents on a substitutable atom, e.g. , a suitable carbon atom, are independently halogen; -(CH2)0-4Ro; -(CH2)0-4ORo; -O(CH2)0-4R°, -O-(CH2)0^C(O)OR°; -(CH2)0_ 4CH(OR°)2; -(CH2)o-4Ph, which may be substituted with R°; -(CH2)o^tO(CH2)o-iPh which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)o^tO(CH2)o-i-pyridyl which

may be substituted with R°; -N02; -CN; -N3; -(CH2)o-4N(R°)2; -(CH2)o-4N(R0)C(0)R°; -N(R°)C(S)R°; -(CH2)O-4N(R0)C(0)NR02; -N(R°)C(S)NR°2; -(CH2)0^N(RO)C(O)OR°; -N(R°)N(R°)C(0)R°;

-N(R°)N(RO)C(0)NR°2; -N(R°)N(R°)C(0)0R°; -(CH2)0-4C(O)Ro; -C(S)R°; -(CH2)0-4C(O)ORo; -(CH2)O-4C(0)SR°; -(CH2)0-4C(O)OSIR°3; -(CH2)0^OC(O)Ro; -OC(0)(CH2)O_4SR, -SC(S)SR°; -(CH2)0_ 4SC(0)Ro; -(CH2)O^C(0)NR°2; -C(S)NR°2; -C(S)SR°; -SC(S)SR°, -(CH2)0_

40C(0)NRo2; -C(0)N(0R°)R°; -C(0)C(0)R°; -C(0)CH2C(0)Ro; -C(NOR°)R°; -(CH2)0^SSRo; -(CH2)0_ 4S(0)2Ro; -(CH2)O^S(0)2OR°; -(CH2)0-4OS(O)2Ro; -S(0)2NR°2; -(CH2)0^S(O)Ro; -N(R°)S(0)2NR°2; -N(R°)S(0)2R°; -N(OR°)R°; -C(NH)NR°2; -Si(R°)3; -OSi(R°)3; -B(R°)2; -OB(R°)2; -OB(OR°)2; -P(R°)2; -P(0Ro)2; -0P(Ro)2; -0P(0Ro)2; -P(0)(Ro)2; -P(0)(0Ro)2; -0P(0)(Ro)2; -0P(0)(0Ro)2; -0P(0)(0R°)(SR°); -SP(0)(R°)2; -SP(0)(0R°)2; -N(R°)P(0)(R°)2; -N(R°)P(0)(0R°)2;

-P(R°)2[B(R°)3]; -P(0RO)2[B(R°)3]; -0P(RO)2[B(R°)3]; -OP(OR°)2[B(R°)3]; -(CI-4 straight or branched alkylene)0-N(R°)2; or -(Ci_4 straight or branched alkylene)C(0)0-N(R°)2, wherein each R° may be substituted as defined below and is independently hydrogen, Ci_2o aliphatic, Ci_2o heteroaliphatic having 1-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, -CH2-(C6-i4 aryl), -0(CH2)o-i(C6-i4 aryl), -CH2-(5-14 membered heteroaryl ring), a 5-20 membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 5-20 membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated or aryl ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which may be substituted as defined below.

[0050] Suitable monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen, -(CH2)o_2R*, -(haloR*), -(CH2)O-2OH, -(CH2)O-2OR#, -(CH2)0-2CH(OR#)2; -0(haloR#), -CN, -N3, -(CH2)0-2C(O)R#, -(CH2)O-2C(0)OH, -(CH2)O-2C(0)OR·, -(CH2)O-2SR#, -(CH2)O-2SH, -(CH2)O-2NH2, -(CH2)O-2NHR#, -(CH2)O-2NR#2, -N02, -SiR*3, -OSiR*3, -C(0)SR* -(Ci_4 straight or branched alkylene)C(0)OR*, or -SSR* wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently selected from Ci_4 aliphatic, -CH2Ph, -0(CH2)o_iPh, and a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on a saturated carbon atom of R° include =0 and =S.

[0051] Suitable divalent substituents, e.g., on a suitable carbon atom, are independently the following: =0, =S, =NNR%. =NNHC(0)R\ =NNHC(0)OR\ =NNHS(0)2R\ =NR*, =NOR*, 0(C(R 2))2 30 — , or -S(C(R*2))2-3S-, wherein each independent occurrence of R* is selected from hydrogen, Ci_

6 aliphatic which may be substituted as defined below, and an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group include: -0(CR*2)2-30-, wherein each independent occurrence of R* is selected from hydrogen, Ci_6 aliphatic which may be substituted as defined below, and an unsubstituted 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0052] Suitable substituents on the aliphatic group of R* are independently halogen,

-R·, -(haloR*), -OH, -OR*, -0(haloR#), -CN, -C(0)OH, -C(0)OR#, -NH2, NHR\ -NRV or -N02, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently Ci^t aliphatic, -CH2PI1, -0(CH2)o-iPh, or a 5-6-membered saturated, partially unsaturated, or aryl ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0053] Oral: The phrases “oral administration” and “administered orally” as used herein have their art-understood meaning referring to administration by mouth of a compound or composition.

[0054] Parenteral: The phrases “parenteral administration” and “administered parenterally” as used herein have their art-understood meaning referring to modes of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal, and intrastemal injection and infusion.

[0055] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.

[0056] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or

sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

[0057] Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable” refers to those compounds, materials, compositions and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0058] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically -acceptable material, composition or vehicle, such as a liquid or solid fdler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, com oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0059] Pharmaceutically acceptable salt: The term “pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, i. e.. salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzene sulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethane sulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, /Moluenesulfonate. undecanoate, valerate salts, and the like. In some embodiments, a provided compound comprises one or more acidic groups, e.g., an oligonucleotide, and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R)3, wherein each R is independently defined and described in the present disclosure) salt. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, a pharmaceutically acceptable salt is a sodium salt. In some embodiments, a pharmaceutically acceptable salt is a potassium salt. In some embodiments, a pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. In some embodiments, a provided compound comprises more than one acid groups, for example, a provided oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and/or modified intemucleotidic linkages). In some embodiments, a pharmaceutically acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or generally, a salt), all ionizable hydrogen in the acidic groups are replaced with cations. In some embodiments, a pharmaceutically acceptable salt is a sodium salt of a provided oligonucleotide. In some embodiments, a pharmaceutically acceptable salt is a sodium salt of a provided oligonucleotide, wherein each acidic linkage group (e.g., each natural phosphate linkage, each phosphorothioate intemucleotidic linkage, etc.) independently exists as a sodium salt form (all sodium salt).

[0060] Protecting group: The term “protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rd edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially adapted for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al. 06/2012, the entirety of Chapter 2 is incorporated herein by reference. Suitable amino-protecting groups include methyl carbamate, ethyl carbamante, 9-fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl

carbamate, 9-(2,7-dibromo)fluoroenylmethyl carbamate, 2.7-di-/-butyl-| 9-( 10.10-dioxo- 10.10.10.10-tetrahydrothioxanthyl)]methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2-trichloroethyl carbamate (Troc), 2-trimethylsilylethyl carbamate (Teoc), 2-phenylethyl carbamate (hZ), 1-(l-adamantyl)-l-methylethyl carbamate (Adpoc), l,l-dimethyl-2-haloethyl carbamate, 1,1-dimethyl-2,2-dibromoethyl carbamate (DB-/-BOC). l,l-dimethyl-2,2,2-trichloroethyl carbamate (TCBOC), 1-methyl-l-(4-biphenylyl)ethyl carbamate (Bpoc), 1 -(3.5-di-/-butyl phenyl )- 1-methylethyl carbamate (/ Bumeoc), 2-(2’- and 4’-pyridyl)ethyl carbamate (Pyoc), 2-(A.A-dicyclohexylcarboxamido)ethyl carbamate, /-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1-isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coe), 4-nitrocinnamyl carbamate (Noe), 8-quinolyl carbamate, A'-hydroxypipcridinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz). /-mcthoxybcnzyl carbamate (Moz). /-nitobcnzyl carbamate /-bromobenzyl carbamate, /-chlorobcnzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsulfmylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2-methylthioethyl carbamate, 2-methylsulfonylethyl carbamate, 2-(/-tolucncsulfonyl)cthyl carbamate, [2-(l,3-dithianyl)]methyl carbamate (Dmoc), 4-methylthiophenyl carbamate (Mtpc), 2,4-dimethylthiophenyl carbamate (Bmpc), 2-phosphonioethyl carbamate (Peoc), 2-triphenylphosphonioisopropyl carbamate (Ppoc), l,l-dimethyl-2-cyanoethyl carbamate, ra-chloro- >-acyloxybenzyl carbamate, >-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3,5-dimethoxybenzyl carbamate, o- nitrobenzyl carbamate, 3,4-dimethoxy-6-nitrobenzyl carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl-(10)-carbonyl derivative, Ar-/-tolucncsulfonylaminocarbonyl derivative, A' -phcnylaminothiocarbonyl derivative, /-amyl carbamate, .S-bcnzyl thiocarbamate, p cyanobcnzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, /J-dccyloxybcnzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(A'.A-dimcthylcarboxamido)bcnzyl carbamate, l,l-dimethyl-3-(A'.A-dimcthylcarboxamido)propyl carbamate, 1,1-dimethylpropynyl carbamate, di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p ’-methoxyphenylazo)benzyl carbamate, 1-methylcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1 -methyl- 1 -cyclopropylmethyl carbamate, l-methyl-l-(3,5-dimethoxyphenyl)ethyl carbamate, 1 -methyl- l-(p-phenylazophenyl)ethyl carbamate, 1-methyl- 1-phenylethyl carbamate, 1 -methyl- l-(4-pyridyl)ethyl carbamate, phenyl carbamate, >-(phenylazo)benzyl carbamate, 2,4,6-tri-/-butylphenyl carbamate, 4-(trimethylammonium)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, trifluoroacetamide, phenylacetamide, 3-phenylpropanamide, picolinamide, 3-pyridylcarboxamide, N-benzoylphenylalanyl derivative, benzamide, /J-phcnylbcnzamidc. o-nitophenylacetamide, o-

nitrophenoxyacetamide, acetoacetamide, (A'-dithiobcnzyloxycarbonylamino)acctamidc. 3 -(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o-phenylazophenoxy)propanamide, 4-chlorobutanamide, 3-methyl-3-nitrobutanamide, o-nitrocinnamide, L- acetyl meth ion inc derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide, 4,5-diphenyl-3-oxazolin-2-one, A'-phthalimidc. A'-d i th i as lice i n i m i dc (Dts), A-2.3 -d i ph c ny 1 m al c i m i dc . A-2.5-dimcthyl pyrrole. A- 1.1 ,4,4-tetramethyldisilylazacyclopentane adduct (STABASE), 5-substituted l,3-dimethyl-l,3,5-triazacyclohexan-2-one, 5-substituted 1,3— dibenzyl-1, 3, 5-triazacyclohexan-2-one, 1-substituted 3,5-dinitro-4-pyridone, A'-mcthylaminc. N-allylamine, A'-|2-(trimcthylsilyl)cthoxy |mcthylaminc (SEM), A-3-acetoxypropylamine, A' ( 1-isopropyl-4-nitro-2-oxo-3-pyroobn-3-yl)amine, quaternary ammonium salts, A'-benzylamine. A—d i (4 methoxyphenyl)methylamine, A-5 -dibenzos ubc ry 1 am inc. A'-t riphenylmethylamine (Tr), A'-| (4-methoxyphenyl)diphenylmethyl]amine (MMTr), A- 9- p h c n y 1 fl uo rc n y 1 am i n c (PhF), A-2.7-d i ch 1 o ro-9-fluorenylmethyleneamine, A'-fc rrocc n y 1 m c thy 1 am i n o (Fcm), A-2-picoK lamino A' -oxide. A- 1.1-dimethylthiomethyleneamine, A'-b c n z y 1 i dc n c am i n c . A' /j-mcthoxybcnzylidcncaminc. N-diphenylmethyleneamine, A'-|(2-pyridyl)mcsityl |mcthylcncaminc. N-(N '.N -dimethylaminomethylene)amine, A'. A' - i s o p ro p y 1 i dc n c d i am i n c . A'
n i t rob c n zy 1 i dc n c am i n c . N-salicylideneamine, A' 5 -ch 1 o ro s al i cy 1 i dc n c am i n c . A'-(5-chloro-2-hydroxyphenyl)phenylmethyleneamine, A'-cx clohcxylidcncaminc. A'-(5.5-dimcthyl-3-oxo- 1-cyclohexenyl)amine, A'-boranc derivative, A'-diphcnylborinic acid derivative, N-[phenyl(pentacarbonylchromium- or tungsten)carbonyl]amine, A'-copper chelate, A'-zinc chelate, N-nitroamine, A'-nitrosoaminc. amine A' oxide diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyl phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate, benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4-dinitrobenzenesulfenamide, pentachlorobenzenesulfenamide, 2-nitro-4-methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3-nitropyridinesulfenamide (Npys), /-to 1 uc n c s ul fo n am i dc (Ts), benzenesulfonamide, 2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2, 3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte), 4-methoxybenzenesulfonamide (Mbs), 2,4,6-trimethylbenzenesulfonamide (Mts), 2,6-dimethoxy-4-methylbenzenesulfonamide (iMds), 2, 2, 5,7,8-pentamethylchroman-6-sulfonamide (Pmc), methane sulfonamide (Ms), b-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4’,8’-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0061] Suitably protected carboxylic acids further include, but are not limited to, silyl— , alkyl-,

alkenyl-, aryl-, and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran-2-yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyl, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0062] Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), /-butylthiomethyl. (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), /J-mcthoxybcnzyloxymcthyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t-butoxymethyl. 4-pentenyloxymethyl (POM), siloxymethyl, 2-methoxyethoxymethyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxy cyclohexyl, 4-methoxytetrahydropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxide, l-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl (CTMP), l,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7-methanobenzofuran-2-yl, 1-ethoxyethyl, l-(2-chloroethoxy)ethyl, 1 -methyl- 1-methoxyethyl, 1 -methyl- 1-benzyloxyethyl, 1-methyl-l-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, /J-chlorophenyl. /-mcthoxy phenyl. 2,4-dinitrophenyl, benzyl, /-mcthoxybcnzyl. 3,4-dimethoxybenzyl, o- nitrobenzyl, /-nitrobenzyl. /-halobcnzyl. 2,6-dichlorobenzyl, /J-cyanobcnzyl. p-phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2-picolyl A-oxido. diphenylmethyl, p.p -dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, a-naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, di(/-mcthoxyphcnyl)phcnylmcthyl. tri(/-methoxyphenyl)methyl, 4-(4’-bromophenacyloxyphenyl)diphenylmethyl, 4, 4’, 4’ ’-tris(4,5-dichlorophthalimidophenyl)methyl, 4, 4’, 4’ -tris(levulinoyloxyphenyl)methyl, 4,4’,4”-tris(benzoyloxyphenyl)methyl, 3-(imidazol-l-yl)bis(4’,4”-dimethoxyphenyl)methyl, l,l-bis(4-methoxyphenyl)-r-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, l,3-benzodithiolan-2-yl, benzisothiazolyl S,S-dioxido, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthexylsilyl, t-butyldimethylsilyl (TBDMS), t-butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri- >-xylylsilyl, triphenylsilyl, diphenylmethylsilyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxy acetate, phenoxyacetate, p-chlorophenoxyacetate, 3-phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4-methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimethylbenzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2-(triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl p nitrophenyl carbonate, alkyl benzyl carbonate, alkyl /j-methoxybenzyl carbonate, alkyl 3,4-dimethoxybenzyl carbonate, alkyl o- nitrobenzyl carbonate, alkyl /j-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4-ethoxy- 1-napththyl carbonate, methyl dithiocarbonate, 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2,6-dichloro-4-(l, l,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(l,l-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (/-')— 2— methyl-2-butenoate, o-(methoxycarbonyl)benzoate, a-naphthoate, nitrate, alkyl N.N.N'.N'-tetramethylphosphorodiamidate, alkyl A'-phcnylcarbamatc. borate, dimethylphosphinothioyl, alkyl 2,4-dinitrophenylsulfenate, sulfate, methanesulfonate (mesylate), benzylsulfonate, and tosylate (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1 -t-butylethylidene ketal, 1-phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal, 2,2,2-trichloroethylidene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, /J-methoxybenzylidene acetal, 2,4-dimethoxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2-nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimethoxymethylene ortho ester, 1-methoxy ethylidene ortho ester, 1 -ethoxy ethylidine ortho ester, 1,2-dimethoxyethylidene ortho ester, a-methoxybenzylidene ortho ester, 1 -( 'JV-dimethylamino)ethylidene derivative, a-(A'.A'' -dimcthylamino)bcnzylidcnc derivative, 2-oxacyclopentylidene ortho ester, di-/-butylsilylcnc group (DTBS), 1, 3— (1, 1,3,3— tetraisopropyldisiloxanylidene) derivative (TIPDS), tctra-/-butoxydisiloxanc- 1 3-diylidcnc derivative (TBDS), cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronate.

[0063] In some embodiments, a hydroxyl protecting group is acetyl, t-butyl, tbutoxymethyl, methoxymethyl, tetrahydropyranyl, 1 -ethoxyethyl, 1 -(2-chloroethoxy)ethyl, 2- trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2,6- dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifmoroacetyl, pivaloyl, 9- fluorenylmethyl carbonate, mesylate, tosylate, triflate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4"-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2- (4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3,5-dichlorophenyl, 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6-trimethylphenyl, 2-(2-nitrophenyl)ethyl, butylthiocarbonyl, 4, 4', 4"-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9-phenylxanthen-9-yl (pixyl) or 9-(p-methoxyphenyl)xanthine-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is, independently selected from acetyl, benzyl, t- butyldimethylsilyl, t-butyldiphenylsilyl and 4,4'-dimethoxytrityl. In some embodiments, the hydroxyl protecting group is selected from the group consisting oftrityl, monomethoxytrityl and 4,4'-dimethoxytrityl group. In some embodiments, a phosphorous linkage protecting group is a group attached to the phosphorous linkage (e.g., an intemucleotidic linkage) throughout oligonucleotide synthesis. In some embodiments, a protecting group is attached to a sulfur atom of an phosphorothioate group. In some embodiments, a protecting group is attached to an oxygen atom of an intemucleotide phosphorothioate linkage. In some embodiments, a protecting group is attached to an oxygen atom of the intemucleotide phosphate linkage. In some embodiments a protecting group is 2-cyanoethyl (CE or Cne), 2-trimethylsilylethyl, 2-nitroethyl, 2-sulfonylethyl, methyl, benzyl, o- nitrobenzyl, 2-(/ nitrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(A''-/ -butylcarboxamido)- 1 -propyl. 4-oxopentyl, 4-methylthio-l-butyl, 2-cyano-l,l-dimethylethyl, 4-A-methylaminobutyl. 3-(2-pyridyl)-l-propyl, 2-|A'-methyl-A'-(2-pyridyl) |aminoethyl. 2 - ( A'-fo rm y 1. A'- m c th y 1 ) am i n o c t h y 1. or 4 - 1 A'- m c t h y 1 - A'- (2.2.2-trifluoroacetyl)amino]butyl .

[0064] Sample : A “sample” as used herein is a specific organism or material obtained therefrom.

In some embodiments, a sample is a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, a source of interest comprises an organism, such as an animal or human. In some embodiments, a biological sample comprises biological tissue or fluid. In some embodiments, a biological sample is or comprises bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions and/or excretions; and/or cells therefrom, etc. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, a sample is a “primary sample” obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc. In some embodiments, as will be clear from context, the term “sample” refers to a preparation that is obtained by processing (e.g. , by removing one or more components of and/or by adding

one or more agents to) a primary sample. For example, filtering using a semi -permeable membrane. Such a “processed sample” may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc. In some embodiments, a sample is an organism. In some embodiments, a sample is a plant. In some embodiments, a sample is an animal. In some embodiments, a sample is a human. In some embodiments, a sample is an organism other than a human.

[0065] Subject: As used herein, the term “subject” or “test subject” refers to any organism to which a provided compound or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject may be suffering from and/or susceptible to a disease, disorder and/or condition.

CLAIMS

1. An oligonucleotide comprising at least one modification of a sugar, base or intemucleotidic linkage, wherein the base sequence of the oligonucleotide is or comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is at least 80% identical with or complementary to a base sequence of a C9orf72 gene or a transcript thereof, and the nucleobase on the 3 ’ end of the oligonucleotide is optionally replaced by a replacement nucleobase selected from I, A, T, U, G and C.

2. The oligonucleotide of claim 1, comprising at least one modification of a sugar, base or intemucleotidic linkage, wherein the base sequence of the oligonucleotide comprises at least 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 contiguous bases of a base sequence that is identical with or complementary to a base sequence of a C9orf72 gene or a transcript thereof.

3. The oligonucleotide claim 2, wherein the base sequence of the oligonucleotide is ACTCACCCACTCGCCACCGC .

4. The oligonucleotide of claim 3, wherein the oligonucleotide reduces level of a repeat expansion-containing C9orf72 transcript when administered to a system comprising the C9orf72 transcript, wherein the repeat expansion-containing C9orf72 transcript comprises at least 30, 50, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 GGGGCC repeats.

5. The oligonucleotide of claim 4, wherein the reduction of level of the repeat-expansion-containing C9orf72 transcript as measured by percentage is at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.5, 3, 4, 5, 6, 7, 8, 9, or 10 fold of the reduction of level of the non-repeat-expansion-containing C9orf72 transcript as measured by percentage.

6. The oligonucleotide of claim 3, wherein the oligonucleotide comprises or consists of a 5 ’-wing-core-wing-3’ structure, wherein each wing sugar independently comprises a 2’-OR modification, wherein R is optionally substituted Ci-6 aliphatic.

7. The oligonucleotide of claim 6, wherein the 5’-wing comprises one or more phosphorothioate intemucleotidic linkages and one or more non-negatively charged intemucleotidic linkages.

8. The oligonucleotide of claim 7, wherein the 3 ’-wing comprises one or more phosphorothioate intemucleotidic linkages and one or more non-negatively charged intemucleotidic linkages.

9. The oligonucleotide of claim 8, wherein each of 5 ’-wing and the 3 ’-wing independently comprises 3, 4, 5, 6, 7, 8, 9, or 10 nucleobases.

10. The oligonucleotide of claim 9, wherein each core sugar independently comprises two 2’-H.

11. The oligonucleotide of claim 10, wherein the oligonucleotide or the core comprises a pattern of backbone chiral centers (linkage phosphoms) of:

(A'p)t| (Gp//Zp)n(.Yp)m |y.

wherein:

t is 1-50;

n is 1-10;

m is 1-50;

y is 1-10;

Np is either Rp or