Sign In to Follow Application
View All Documents & Correspondence

Oligonucleotide Compositions And Methods Thereof

Abstract: Among other things, the present disclosure provides oligonucleotides, compositions, and methods for preventing and/or treating various conditions, disorders or diseases. In some embodiments, provided oligonucleotides comprise nucleobase modifications, sugar modifications, internucleotidic linkage modifications and/or patterns thereof, and have improved properties, activities and/or selectivities. In some embodiments, the present disclosure provides oligonucleotides, compositions and methods for HTT-related conditions, disorders or diseases, such as Huntington's disease.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
27 August 2021
Publication Number
50/2021
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
IPRDEL@LAKSHMISRI.COM
Parent Application

Applicants

WAVE LIFE SCIENCES LTD.
7 Straits View #12-00, Marina One East Tower Singapore 018936
BROWN, Jeffrey Matthew
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
BERKOVITCH, Shaunna Syu-Mei
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
IWAMOTO, Naoki
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
VARGEESE, Chandra
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
AKLILU, Kidist M.
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
FRANK-KAMENETSKY, Maria David
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
BROWN, Duncan Parley
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138

Inventors

1. BROWN, Jeffrey Matthew
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
2. BERKOVITCH, Shaunna Syu-Mei
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
3. IWAMOTO, Naoki
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
4. VARGEESE, Chandra
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
5. AKLILU, Kidist M.
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
6. FRANK-KAMENETSKY, Maria David
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138
7. BROWN, Duncan Parley
c/o WAVE LIFE SCIENCES LTD. 733 Concord Avenue Cambridge, Massachusetts 02138

Specification

[0001] This application claims priority to United States Provisional Application Nos.62/800,409, filed February 01, 2019, and 62/911,335, filed October 06, 2019, the entirety of each of which is incorporated herein by reference.

BACKGROUND

[0002] Oligonucleotides targeting a particular gene are useful in various applications, e.g., therapeutic, diagnostic, and/or research applications, including but not limited to treatment of various disorders related to the target gene.

SUMMARY

[0003] In some embodiments, the present disclosure provides oligonucleotides and compositions thereof that have significantly improved properties and/or activities. Among other things, the present disclosure provides technologies for designing, manufacturing and utilizing such oligonucleotides and compositions. Particularly, in some embodiments, the present disclosure provides useful patterns of internucleotidic linkages [e.g., types, modifications, and/or configuration (Rp or Sp) of chiral linkage phosphorus, etc.] and/or patterns of sugar modifications (e.g., types, patterns, etc.), which, when combined with one or more other structural elements described herein, e.g., base sequence (or portion thereof), nucleobase modifications (and patterns thereof), internucleotidic linkage modifications (and patterns thereof), additional chemical moieties, etc., can provide oligonucleotides and compositions with high activities and/or desired properties, including but not limited to allele-specific knockdown of mutant allele of a HTT (Huntingtin) gene, wherein the mutant allele is on the same chromosome as (in phase with) an expanded CAG repeat region associated with Huntington’s Disease.

[0004] In some embodiments, a target HTT nucleic acid is a mutant that comprises both a differentiating position and mutation such as an expanded CAG repeat region (e.g., greater than about 36 CAG), which is associated with Huntington’s Disease. In some embodiments, a reference or non-target HTT nucleic acid is wild-type and comprises a different variant of a differentiating position and lacks an expanded CAG repeat region (e.g., the CAG repeat region is less than about 35 CAG and is not associated with Huntington’s Disease. In some embodiments, a HTT oligonucleotide (an oligonucleotide that targets a HTT target HTT nucleic acid) is capable of differentiating the target HTT nucleic acid and the reference HTT nucleic acid, and is capable of mediating allele-specific knockdown of the target HTT nucleic acid. In some embodiments, a differentiating position is a single-nucleotide polymorphism (SNP) site, point

mutation, etc. In some embodiments, a target HTT nucleic acid sequence and a reference HTT nucleic acid sequence comprise a different base at a SNP site. In some embodiments, a site in a target HTT nucleic acid is fully complementary to a site in an oligonucleotide of the present disclosure while the corresponding site in a reference HTT nucleic acid is not. For example, in some embodiments, a target HTT nucleic acid sequence comprises rs362273 and is A at this SNP position, and its allele comprises expanded CAG repeats (e.g., 36 or more) and it is associated with Huntington’s disease; a reference HTT nucleic acid sequence comprises rs362273 and is G at this SNP position, and its allele comprises fewer CAG repeats (e.g., 35 or fewer) and it is less or is not associated with Huntington disease. In some embodiments, sequences of provided oligonucleotides, e.g., GUUGATCTGTAGCAGCAGCT, are complementary to a target HTT nucleic acid sequence at a particular site, e.g., a SNP site (e.g., for GUUGATCTGTAGCAGCAGCT, T is complementary to A at the SNP rs362273 position).

[0005] In some embodiments, a HTT oligonucleotide has a base sequence which is not different in a target mutant HTT nucleic acid and a wild-type HTT nucleic acid. In some embodiments, such an oligonucleotide is capable of knocking down the level, expression and/or activity of both a mutant and a wild-type HTT; and the oligonucleotide may be designed as a pan-specific oligonucleotide or non-allele-specific oligonucleotide.

[0006] In some embodiments, provided oligonucleotides and compositions are useful for preventing and/or treating various conditions, disorders or diseases, particularly HTT-related conditions, disorders or diseases, including Huntington’s Disease. In some embodiments, provided oligonucleotides and compositions selectively reduce levels of HTT transcripts and/or products encoded thereby that are associated with Huntington’s Disease. In some embodiments, provided oligonucleotides and compositions selectively reduce levels of HTT transcripts comprising expanded CAG repeats (e.g., 36 or more) and/or products encoded thereby.

[0007] Among other things, the present disclosure encompasses the recognition that controlling structural elements of HTT oligonucleotides can have a significant impact on oligonucleotide properties and/or activities, including knockdown (e.g., a decrease in the activity, expression and/or level) of an HTT target gene (or a product thereof). In some embodiments, Huntington’s Disease is associated with the presence of a mutant HTT allele which comprises a CAG expansion (e.g., an increase in the length of the region comprising multiple CAG repeats). In some embodiments, knockdown is allele-specific (wherein the mutant allele of HTT is preferentially knocked down relative to the wild-type). In some embodiments, the knockdown is pan-specific (wherein both the mutant and wild-type alleles of HTT are significantly knocked down). In some embodiments, knockdown of an HTT target gene is mediated by RNase H and/or steric hindrance affecting translation. In some embodiments, knockdown of an HTT target gene is mediated by a mechanism involving RNA interference. In some embodiments, controlled structural elements of HTT

oligonucleotides include but are not limited to: base sequence, chemical modifications (e.g., modifications of a sugar, base and/or internucleotidic linkage) or patterns thereof, alterations in stereochemistry (e.g., stereochemistry of a backbone chiral internucleotidic linkage) or patterns thereof, structure of a first or second wing or core, and/or conjugation with an additional chemical moiety (e.g., a carbohydrate moiety, a targeting moiety, etc.). Particularly, in some embodiments, the present disclosure demonstrates that control of stereochemistry of backbone chiral centers (stereochemistry of linkage phosphorus), optionally with controlling other aspects of oligonucleotide design and/or incorporation of carbohydrate moieties, can greatly improve properties and/or activities of HTT oligonucleotides.

[0008] In some embodiments, the present disclosure pertains to any HTT oligonucleotide which operates through any mechanism, and which comprises any sequence, structure or format (or portion thereof) described herein, wherein the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar or internucleotidic linkage.

[0009] In some embodiments, the present disclosure provides a oligonucleotide composition comprising a plurality of oligonucleotides, wherein the oligonucleotides comprise at least one chirally controlled internucleotidic linkage [an internucleotidic linkage whose linkage phosphorus is in or is enriched for the Rp or Sp configuration (e.g., 80-100%, 85%-100%, 90%-100%, 95%-100%, or 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more of all oligonucleotides of the same constitution in the composition share the same stereochemistry at the linkage phosphorus) but not a random mixture of the Rp and Sp, such an internucleotidic linkage also a“stereodefined internucleotidic linkage”], e.g., a phosphorothioate linkage whose linkage phosphorus is Rp or Sp. In some embodiments, the number of chirally controlled internucleotidic linkages is 1-100, 1-50, 1-40, 1-35, 1-30, 1-25, 1-20, 5-100, 5-50, 5-40, 5-35, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25. In some embodiments, at least 1 internucleotidic linkage is chirally controlled internucleotidic linkage and is Sp, and/or at least 1 internucleotidic linkage is chirally controlled internucleotidic linkage and are Rp. In some embodiments, pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., a core) is or comprises Rp(Sp)2. In some embodiments, pattern of backbone chiral centers of an oligonucleotide or a portion thereof (e.g., a core) is or comprises (Np)t[(Rp)n(Sp)m]y, wherein each of t, n, m, and y is independently as described herein.

[0010] In some embodiments, the present disclosure demonstrates that oligonucleotides comprising an Rp chirally controlled internucleotidic linkage at a -1, +1 or +3 position relative to a differentiating position (a position whose base or whose complementary base can differentiate a target mutant HTT nucleic acid and a reference wild-type HTT nucleic acid) can provide high activities and/or selectivities and, in some embodiments, can be particularly useful for reducing levels of disease-associated transcripts and/or products encoded thereby. Unless otherwise specified, for Rp internucleotidic linkage

positioning,“-” is counting from the nucleoside at a differentiating position toward the 5’-end of an oligonucleotide with the internucleotidic linkage at the -1 position being the internucleotidic linkage bonded to the 5’-carbon of the nucleoside at the differentiating position, and“+” is counting from the nucleoside at a differentiating position toward the 3’-end of an oligonucleotide with the internucleotidic linkage at the +1 position being the internucleotidic linkage bonded to the 3’-carbon of the nucleoside at the differentiating position. In some embodiments, Rp at -1 position provided increased activity and selectivity. In some embodiments, Rp at +1 position provided increased activity and selectivity. In some embodiments, Rp at +3 position provided increased activity. For example, as shown herein, HTT oligonucleotides WV-12281 (one phosphorothioate in the Rp configuration at position -1 relative to the SNP position), WV-12282 (+1), and WV-12284 (+3) can provide high selectivity when utilized in allele-specific knockdown of the mutant allele.

[0011] In some embodiments, the present disclosure pertains to an HTT oligonucleotide composition wherein the HTT oligonucleotides comprise at least one chiral internucleotidic linkage which is not chirally controlled.

[0012] In some embodiments, oligonucleotides comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) non-negatively charged internucleotidic linkages. In some embodiments, oligonucleotides comprise one or more neutral internucleotidic linkages. In some embodiments, an HTT oligonucleotide comprises a non-negatively charged or neutral internucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises at least 10 contiguous bases of a base sequence that is identical to or complementary to a base sequence of an HTT gene or a transcript thereof, wherein the oligonucleotide comprises at least one non-negatively charged internucleotidic linkage, and wherein the oligonucleotide is capable of decreasing the level, expression and/or activity of an HTT target gene or a gene product thereof.

[0013] In some embodiments, the present disclosure encompasses the recognition that various optional additional chemical moieties, such as carbohydrate moieties, targeting moieties, etc., when incorporated into oligonucleotides, can improve one or more properties and/or activities.

[0014] In some embodiments, an additional chemical moiety is selected from: GalNAc, glucose, GluNAc (N-acetyl amine glucosamine) and anisamide moieties and derivatives thereof, or any additional chemical moiety described herein and/or known in the art. In some embodiments, an oligonucleotide can comprise two or more additional chemical moieties, wherein the additional chemical moieties are identical or non-identical, or are of the same category (e.g., carbohydrate moiety, sugar moiety, targeting moiety, etc.) or not of the same category. In some embodiments, certain additional chemical moieties facilitate delivery of oligonucleotides to desired cells, tissues and/or organs; and/or facilitate internalization of oligonucleotides; and/or increase oligonucleotide stability.

[0015] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides which share:

1) a common base sequence;

2) a common pattern of backbone linkages; and

3) a common pattern of backbone chiral centers, which composition is a substantially pure preparation of a single oligonucleotide in that a non-random or controlled level of the oligonucleotides in the composition have the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone chiral centers.

[0016] In some embodiments, an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides of a particular oligonucleotide type, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence and pattern of chiral internucleotidic linkages, for oligonucleotides of the particular oligonucleotide type.

[0017] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides capable of directing HTT knockdown, wherein oligonucleotides of the plurality are of a particular oligonucleotide type, which composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same base sequence, for oligonucleotides of the particular oligonucleotide type.

[0018] In some embodiments, a provided oligonucleotide comprises one or more blocks. In some embodiments, a block comprises one or more consecutive nucleosides, and/or nucleotides, and/or sugars, or bases, and/or internucleotidic linkages which share a common chemistry (e.g., at least one common modification of sugar, base or internucleotidic linkage, or combination or pattern thereof, or pattern of stereochemistry) which is not present in an adjacent block, or vice versa. In some embodiments, an HTT oligonucleotide comprises three or more blocks, wherein the blocks on either end are not identical and the oligonucleotide is thus asymmetric. In some embodiments, a block is a wing or a core. In some embodiments, a core is also referenced to as a gap.

[0019] In some embodiments, an oligonucleotide comprises at least one wing and at least one core, wherein a wing differs structurally from a core in that a wing of an oligonucleotide comprises a structure [e.g., stereochemistry, or chemical modification at a sugar, base or internucleotidic linkage (or pattern thereof), etc.] not present in the core, or vice versa. In some embodiments, the structure of an oligonucleotide comprises a wing-core-wing structure. In some embodiments, the structure of an oligonucleotide comprises a wing-core, core-wing, or wing-core-wing structure, wherein one wing differs in structure [e.g., stereochemistry, additional chemical moiety, or chemical modification at a sugar, base or internucleotidic linkage (or pattern thereof)] from the other wing and the core (for example, an asymmetrical oligonucleotide).

[0020] In some embodiments, a wing comprises a sugar modification or a pattern thereof that is absent from a core. In some embodiments, a wing comprises a sugar modification that is absent from a core. In some embodiments, one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) sugars of a wing is/are independently modified. In some embodiments, each wing sugar is independently modified. In some embodiments, each sugar in a wing is the same. In some embodiments, at least one sugar in a wing is different from another sugar in the wing. In some embodiments, one or more sugar modifications and/or patterns of sugar modifications in a first wing of an oligonucleotide (e.g., a 5’-wing) is/are different from one or more sugar modifications and/or patterns of sugar modifications in a second wing of the oligonucleotide (e.g., a 3’-wing). In some embodiments, a modification is a 2’-OR modification, wherein R is as described herein. In some embodiments, R is optionally substituted C1-4 alkyl. In some embodiments, a modification is 2’-OMe. In some embodiments, a modification is a 2’-MOE. In some embodiments, a modified sugar is a high-affinity sugar, e.g., a bicyclic sugar (e.g., a LNA sugar), 2’-MOE, etc. In some embodiments, a sugar of a 3’-wing is a high-affinity sugar. In some embodiments, a 3’-wing comprises one or more high-affinity sugars. In some embodiments, each sugar of a 3’-wing is independently a high-affinity sugar. In some embodiments, a high-affinity sugar is a 2’-MOE sugar. In some embodiments, a high-affinity sugar is bonded to a non-negatively charged internucleotidic linkage.

[0021] In some embodiments, a wing comprises one or more non-negatively charged internucleotidic linkages. In some embodiments, a non-negatively charged internucleotidic linkage is a neutral internucleotidic linkage. In some embodiments, each non-negatively charged internucleotidic linkage is independently a neutral internucleotidic linkage. In some embodiments, as demonstrated herein, oligonucleotides that comprise wings comprising one or more non-negatively charged internucleotidic linkages can deliver high activities and/or selectivities. In some embodiments, for description of internucleotidic linkages and patterns thereof (including stereochemical patterns), internucleotidic linkages linking a wing nucleoside and a core nucleoside is considered part of the core. In some embodiments, a non-negatively charged internucleotidic linkage is chirally controlled and is Rp or Sp.

[0022] In some embodiments, a core sugar is a natural DNA sugar which comprises no substitution at the 2’ position (two -H at 2’-carbon). In some embodiments, each core sugar is a natural DNA sugar which comprises no substitution at the 2’ position (two -H at 2’-carbon).

[0023] In some embodiments, a differentiating position (e.g., a SNP location or other mutation which differentiates a wild-type target sequence from a disease-associated or mutant sequence) is position 4, 5 or 6 from the 5’-end of a core region. In some embodiments, the 4th, 5th, or 6th nucleobase of a core region (from the 5’ end of a core) is characteristic of a sequence and differentiates a sequence from another sequence (e.g., a SNP). In some embodiments, a differentiating position is position 4 from the 5’-end of a core region. In some embodiments, a differentiating position is position 5 from the 5’-end of a core region. In some embodiments, a differentiating position is position 6 from the 5’-end of a core region. In some embodiments, a differentiating position is position 9, 10 or 11 from the 5’-end of an oligonucleotide. In some embodiments, a differentiating position is position 9 from the 5’-end of an oligonucleotide. In some embodiments, a differentiating position is position 10 from the 5’-end of an oligonucleotide. In some embodiments, a differentiating position is position 11 from the 5’-end of an oligonucleotide.

[0024] In some embodiments, an oligonucleotide or oligonucleotide composition is useful for preventing or treating a condition, disorder or disease. In some embodiments, an HTT oligonucleotide or HTT oligonucleotide composition is useful for a method of treatment of an HTT-related condition, disorder or disease, such as Huntington’s Disease, in a subject in need thereof.

[0025] In some embodiments, an oligonucleotide or oligonucleotide composition is useful for the manufacture of a medicament for treatment of a condition, disorder or disease, such as Huntington’s Disease, in a subject in need thereof. In some embodiments, an HTT oligonucleotide or HTT oligonucleotide composition is useful for the manufacture of a medicament for treatment of an HTT-related condition, disorder or disease, such as Huntington’s Disease, in a subject in need thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figures 1A-1D. Figures 1A-1D shows various formats which can be used, in whole or in part, for oligonucleotides, e.g., HTT oligonucleotides.

DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS

[0027] Technologies of the present disclosure may be understood more readily by reference to the following detailed description of certain embodiments.

Definitions

[0028] As used herein, the following definitions shall apply unless otherwise indicated. For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in "Organic Chemistry", Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith, M.B. and March, J., John Wiley & Sons, New York: 2001.

[0029] As used herein in the present disclosure, unless otherwise clear from context, (i) the term “a” or“an” may be understood to mean“at least one”; (ii) the term“or” may be understood to mean “and/or”; (iii) the terms“comprising”,“comprise”,“including” (whether used with“not limited to” or not), and“include” (whether used with“not limited to” or not) may be understood to encompass itemized

components or steps whether presented by themselves or together with one or more additional components or steps; (iv) the term“another” may be understood to mean at least an additional/second one or more; (v) the terms“about” and“approximately” may be understood to permit standard variation as would be understood by those of ordinary skill in the art; and (vi) where ranges are provided, endpoints are included.

[0030] Unless otherwise specified, description of oligonucleotides and elements thereof (e.g., base sequence, sugar modifications, internucleotidic linkages, linkage phosphorus stereochemistry, etc.) is from 5’ to 3’. Unless otherwise specified, oligonucleotides described herein may be provided and/or utilized in a salt form, particularly a pharmaceutically acceptable salt form. As those skilled in the art will appreciate after reading the present disclosure, in some embodiments, oligonucleotides may be provided as salts, e.g., sodium salts. As those skilled in the art will appreciate, in some embodiments, individual oligonucleotides within a composition may be considered to be of the same constitution and/or structure even though, within such composition (e.g., a liquid composition), particular such oligonucleotides might be in different salt form(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e.g., in a liquid composition) at a particular moment in time. For example, those skilled in the art will appreciate that, at a given pH, individual internucleotidic linkages along an oligonucleotide chain may be in an acid (H) form, or in one of a plurality of possible salt forms (e.g., a sodium salt, or a salt of a different cation, depending on which ions might be present in the preparation or composition)), and will understand that, so long as their acid forms (e.g., replacing all cations, if any, with H) are of the same constitution and/or structure, such individual oligonucleotides may properly be considered to be of the same constitution and/or structure.

[0031] Aliphatic: As used herein,“aliphatic” means a straight-chain (i.e., unbranched) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation, or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or combinations thereof. In some embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl, alkynyl groups and hybrids thereof such as (cycloalkyl)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

[0032] Alkenyl: As used herein, the term“alkenyl” refers to an aliphatic group, as defined herein, having one or more double bonds.

[0033] Alkyl: As used herein, the term“alkyl” is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, an alkyl has 1-100 carbon atoms. In certain embodiments, a straight chain or branched chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C1-C20 for straight chain, C2-C20 for branched chain), and alternatively, about 1-10. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure where such rings are monocyclic, bicyclic, or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure. In some embodiments, an alkyl group may be a lower alkyl group, wherein a lower alkyl group comprises 1-4 carbon atoms (e.g., C1-C4 for straight chain lower alkyls).

[0034] Alkynyl: As used herein, the term“alkynyl” refers to an aliphatic group, as defined herein, having one or more triple bonds.

[0035] Analog: The term“analog” includes any chemical moiety which differs structurally from a reference chemical moiety or class of moieties, but which is capable of performing at least one function of such a reference chemical moiety or class of moieties. As non-limiting examples, a nucleotide analog differs structurally from a nucleotide but performs at least one function of a nucleotide; a nucleobase analog differs structurally from a nucleobase but performs at least one function of a nucleobase; etc.

[0036] Animal: As used herein, the term“animal” refers to any member of the animal kingdom. In some embodiments,“animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish and/or worms. In some embodiments, an animal may be a transgenic animal, a genetically-engineered animal and/or a clone.

[0037] Antisense: The term“antisense", as used herein, refers to a characteristic of an oligonucleotide or other nucleic acid having a base sequence complementary or substantially complementary to a target HTT nucleic acid to which it is capable of hybridizing. In some embodiments, a target HTT nucleic acid is a target gene mRNA. In some embodiments, hybridization is required for or results in at one activity, e.g., a decrease in the level, expression or activity of the target HTT nucleic acid or a gene product thereof. The term“antisense oligonucleotide”, as used herein, refers to an oligonucleotide complementary to a target HTT nucleic acid. In some embodiments, an antisense oligonucleotide is capable of directing a decrease in the level, expression or activity of a target HTT nucleic acid or a product thereof.

In some embodiments, an antisense oligonucleotide is capable of directing a decrease in the level, expression or activity of the target HTT nucleic acid or a product thereof, via a mechanism that involves RNaseH, steric hindrance and/or RNA interference.

[0038] Aryl: The term“aryl", as used herein, used alone or as part of a larger moiety as in “aralkyl,”“aralkoxy,” or“aryloxyalkyl,” refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic. In some embodiments, an aryl group is a monocyclic, bicyclic or polycyclic ring system having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members. In some embodiments, an aryl group is a biaryl group. The term “aryl” may be used interchangeably with the term“aryl ring.” In certain embodiments of the present disclosure,“aryl” refers to an aromatic ring system which includes, but is not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term“aryl,” as it is used herein, is a group in which an aromatic ring is fused to one or more non–aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenanthridinyl, or tetrahydronaphthyl, and the like.

[0039] Chiral control: As used herein,“chiral control” refers to control of the stereochemical designation of the chiral linkage phosphorus in a chiral internucleotidic linkage within an oligonucleotide. As used herein, a chiral internucleotidic linkage is an internucleotidic linkage whose linkage phosphorus is chiral. In some embodiments, a control is achieved through a chiral element that is absent from the sugar and base moieties of an oligonucleotide, for example, in some embodiments, a control is achieved through use of one or more chiral auxiliaries during oligonucleotide preparation as described in the present disclosure, which chiral auxiliaries often are part of chiral phosphoramidites used during oligonucleotide preparation. In contrast to chiral control, a person having ordinary skill in the art appreciates that conventional oligonucleotide synthesis which does not use chiral auxiliaries cannot control stereochemistry at a chiral internucleotidic linkage if such conventional oligonucleotide synthesis is used to form the chiral internucleotidic linkage. In some embodiments, the stereochemical designation of each chiral linkage phosphorus in each chiral internucleotidic linkage within an oligonucleotide is controlled.

[0040] Chirally controlled oligonucleotide composition: The terms “chirally controlled oligonucleotide composition”,“chirally controlled nucleic acid composition”, and the like, as used herein, refers to a composition that comprises a plurality of oligonucleotides (or nucleic acids) which share 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern of backbone phosphorus modifications, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphorus stereochemistry at one or more chiral internucleotidic linkages (chirally controlled or stereodefined internucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition

(“stereodefined”), not a random Rp and Sp mixture as non-chirally controlled internucleotidic linkages). Level of the plurality of oligonucleotides (or nucleic acids) in a chirally controlled oligonucleotide composition is pre-determined/controlled (e.g., through chirally controlled oligonucleotide preparation to stereoselectively form one or more chiral internucleotidic linkages). In some embodiments, about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition are oligonucleotides of the plurality. In some embodiments, about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone phosphorus modifications are oligonucleotides of the plurality. In some embodiments, a level is about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a composition, or of all oligonucleotides in a composition that share a common base sequence (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or of all oligonucleotides in a composition that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications, or of all oligonucleotides in a composition that share a common base sequence, a common patter of base modifications, a common pattern of sugar modifications, a common pattern of internucleotidic linkage types, and/or a common pattern of internucleotidic linkage modifications. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 1-50 (e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10-20, 10-25, 10-30, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20) chiral internucleotidic linkages. In some embodiments, the plurality of oligonucleotides share the same stereochemistry at about 1%-100% (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%,

45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of chiral internucleotidic linkages. In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same constitution. In some embodiments, level of the oligonucleotides (or nucleic acids) of the plurality is about 1%-100%, (e.g., about 5%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides (or nucleic acids) in a composition that share the same constitution as the oligonucleotides (or nucleic acids) of the plurality. In some embodiments, each chiral internucleotidic linkage is a chiral controlled internucleotidic linkage, and the composition is a completely chirally controlled oligonucleotide composition. In some embodiments, oligonucleotides (or nucleic acids) of a plurality are structurally identical. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%, typically at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 95%. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 96%. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 97%. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 98%. In some embodiments, a chirally controlled internucleotidic linkage has a diastereopurity of at least 99%. In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chirally controlled internucleotidic linkages as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is 95%-100%. For example, when DS is 99% and nc is 10, the percentage is or is at least 90% ((99%)10 » 0.90 = 90%). In some embodiments, level of a plurality of oligonucleotides in a composition is represented as the product of the diastereopurity of each chirally controlled internucleotidic linkage in the oligonucleotides. In some embodiments, diastereopurity of an internucleotidic linkage connecting two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereopurity of an internucleotidic linkage of a dimer connecting the same two nucleosides, wherein the dimer is prepared using comparable conditions, in some instances, identical synthetic cycle conditions (e.g., for the linkage between Nx and Ny in an oligonucleotide….NxNy….., the dimer is NxNy). In some embodiments, not all chiral internucleotidic linkages are chiral controlled internucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition. In some embodiments, a non-chirally controlled internucleotidic linkage has

a diastereopurity of less than about 80%, 75%, 70%, 65%, 60%, 55%, or of about 50%, as typically observed in stereorandom oligonucleotide compositions (e.g., as appreciated by those skilled in the art, from traditional oligonucleotide synthesis, e.g., the phosphoramidite method). In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same type. In some embodiments, a chirally controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acids types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one and no more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises multiple oligonucleotide types. In some embodiments, a chirally controlled oligonucleotide composition is a composition of oligonucleotides of an oligonucleotide type, which composition comprises a non-random or controlled level of a plurality of oligonucleotides of the oligonucleotide type.

[0041] Comparable: The term“comparable” is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed. In some embodiments, comparable sets of conditions or circumstances are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will appreciate that sets of conditions are comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied.

[0042] Cycloaliphatic: The term“cycloaliphatic,”“carbocycle,”“carbocyclyl,”“carbocyclic radical,” and“carbocyclic ring,” are used interchangeably, and as used herein, refer to saturated or partially unsaturated, but non-aromatic, cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having, unless otherwise specified, from 3 to 30 ring members. Cycloaliphatic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbornyl, adamantyl, and cyclooctadienyl. In some embodiments, a cycloaliphatic group has 3–6 carbons. In some embodiments, a cycloaliphatic group is saturated and is cycloalkyl. The term“cycloaliphatic” may also include aliphatic rings that are fused to one or more aromatic or nonaromatic rings, such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, a cycloaliphatic group is bicyclic. In some embodiments, a cycloaliphatic group is tricyclic. In some embodiments, a cycloaliphatic group is polycyclic. In some embodiments,“cycloaliphatic” refers to C3-C6 monocyclic hydrocarbon, or C8-C10 bicyclic or polycyclic hydrocarbon, that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule, or a C9-C16 polycyclic hydrocarbon that is completely

saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.

[0043] Gapmer: as used herein, the term“gapmer” refers to an oligonucleotide characterized in that it comprises a core flanked by a 5’ and a 3’ wing. In some embodiments, in a gapmer, at least one internucleotidic phosphorus linkage of the oligonucleotide is a natural phosphate linkage. In some embodiments, more than one internucleotidic phosphorus linkage of the oligonucleotide strand is a natural phosphate linkage. In some embodiments, a gapmer is a sugar modification gapmer, wherein each wing sugar independently comprises a sugar modification, and no core sugar comprises a sugar modification found in a wing sugar. In some embodiments, each core sugar comprises no modification and are 2’-unsubstituted (as in natural DNA). In some embodiments, each wing sugar is independently a 2’-modified sugar. In some embodiments, at least one wing sugar is a bicyclic sugar. In some embodiments, sugar units in each wing have the same sugar modification (e.g., 2’-OMe (a 2’-OMe wing), 2’-MOE (a 2’-MOE wing), etc.). In some embodiments, each wing sugar has the same modification. Core and wing can have various lengths. In some embodiments, a wing is 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleosides (in many embodiments, 3, 4, 5, or 6 or more) in length, and a core is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleosides (in many embodiments, 8, 9, 10, 11, 12, or more) in length. In some embodiments, an oligonucleotide comprises or consists of a wing-core-wing structure of 2-9-6, 3-9-3, 3-9-4, 3-9-5, 4-7-4, 4-9-4, 4-9-5, 4-10-5, 4-11-4, 4-11-5, 5-7-5, 5-8-6, 5-9-3, 5-9-5, 5-10-4, 5-10-5, 6-7-6, 6-8-5, or 6-9-2. In some embodiments, an oligonucleotide is a gapmer.

[0044] Heteroaliphatic: The term“heteroaliphatic”, as used herein, is given its ordinary meaning in the art and refers to aliphatic groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). In some embodiments, one or more units selected from C, CH, CH2, and CH3 are independently replaced by one or more heteroatoms (including oxidized and/or substituted forms thereof). In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.

[0045] Heteroalkyl: The term“heteroalkyl”, as used herein, is given its ordinary meaning in the art and refers to alkyl groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidinyl, morpholinyl, etc.

[0046] Heteroaryl: The terms“heteroaryl” and“heteroar–”, as used herein, used alone or as part of a larger moiety, e.g.,“heteroaralkyl,” or“heteroaralkoxy,” refer to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments 5, 6, 9, or 10 ring atoms. In some embodiments, a heteroaryl group has 6, 10, or 14 p electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five heteroatoms. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, indolizinyl, purinyl, naphthyridinyl, and pteridinyl. In some embodiments, a heteroaryl is a heterobiaryl group, such as bipyridyl and the like. The terms“heteroaryl” and“heteroar–”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the heteroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 4H–quinolizinyl, carbazolyl, acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3– b]–1,4–oxazin–3(4H)–one. A heteroaryl group may be monocyclic, bicyclic or polycyclic. The term “heteroaryl” may be used interchangeably with the terms“heteroaryl ring,”“heteroaryl group,” or “heteroaromatic,” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl group, wherein the alkyl and heteroaryl portions independently are optionally substituted.

[0047] Heteroatom: The term“heteroatom", as used herein, means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including any oxidized form of nitrogen, sulfur, phosphorus, or silicon; the quaternized form of any basic nitrogen or a substitutable nitrogen of a heterocyclic ring (for example, N as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl) or NR+ (as in N-substituted pyrrolidinyl); etc.); in some embodiments, a heteroatom is oxygen, sulfur or nitrogen.

[0048] Heterocycle: As used herein, the terms“heterocycle,”“heterocyclyl,”“heterocyclic radical,” and“heterocyclic ring", as used herein, are used interchangeably and refer to a monocyclic, bicyclic or polycyclic ring moiety (e.g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5– to 7– membered monocyclic or 7– to 10–membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0–3 heteroatoms selected from oxygen, sulfur and nitrogen, the nitrogen may be N (as in 3,4–dihydro–2H– pyrrolyl), NH (as in pyrrolidinyl), or +NR (as in N–substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl, piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms“heterocycle,”“heterocyclyl,”“heterocyclyl ring,”“heterocyclic group,”“heterocyclic moiety,” and “heterocyclic radical,” are used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H–indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be monocyclic, bicyclic or polycyclic. The term“heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl, wherein the alkyl and heterocyclyl portions independently are optionally substituted.

[0049] Homology:“Homology” or“identity” or“similarity” refers to sequence similarity between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence which can be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar nucleic acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology/similarity or identity refers to a function of the number of identical or similar nucleic acids at positions shared by the compared sequences. In some embodiments, a sequence which is“unrelated” or“non-homologous” shares less than 40% identity, less than 35% identity, less than 30% identity, or less than 25% identity with a sequence described herein. In comparing two sequences, the absence of residues (amino acids or nucleic acids) or presence of extra residues also decreases the identity and homology/similarity. In some embodiments, polymeric molecules (e.g., oligonucleotides, nucleic acids, proteins, etc.) are considered to be“homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymeric molecules are considered to be“homologous” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar.

[0050] In some embodiments, the term“homology” describes a mathematically based comparison of sequence similarities which is used to identify genes with similar functions or motifs. The nucleic acid sequences described herein can be used as a“query sequence” to perform a search against public databases, for example, to identify other family members, related sequences or homologs. In some embodiments, such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. In some embodiments, BLAST nucleotide searches can be performed

with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to nucleic acid molecules of the disclosure. In some embodiments, to obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res.25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and BLAST) can be used (See www.ncbi.nlm.nih.gov).

[0051] Identity: As used herein, the term“identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared. When a position in the first sequence is occupied by the same residue (e.g., nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.

[0052] Internucleotidic linkage: As used herein, the phrase“internucleotidic linkage” refers generally to a linkage linking nucleoside units of an oligonucleotide or a nucleic acid. In some embodiments, an internucleotidic linkage is a phosphodiester linkage, as extensively found in naturally occurring DNA and RNA molecules (natural phosphate linkage (-OP(=O)(OH)O-), which as appreciated by those skilled in the art may exist as a salt form). In some embodiments, an internucleotidic linkage is a modified internucleotidic linkage (not a natural phosphate linkage). In some embodiments, an

internucleotidic linkage is a“modified internucleotidic linkage” wherein at least one oxygen atom or -OH of a phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such an organic or inorganic moiety is selected from =S, =Se, =NR’,–SR’,–SeR’,–N(R’)2, B(R’)3,–S–,– Se–, and–N(R’)–, wherein each R’ is independently as defined and described in the present disclosure. In some embodiments, an internucleotidic linkage is a phosphotriester linkage, phosphorothioate linkage (or phosphorothioate diester linkage, -OP(=O)(SH)O-, which as appreciated by those skilled in the art may exist as a salt form), or phosphorothioate triester linkage. In some embodiments, a modified internucleotidic linkage is a phosphorothioate linkage. In some embodiments, an internucleotidic linkage is one of, e.g., PNA (peptide nucleic acid) or PMO (phosphorodiamidate Morpholino oligomer) linkage. In some embodiments, a modified internucleotidic linkage is a non-negatively charged internucleotidic linkage. In some embodiments, a modified internucleotidic linkage is a neutral internucleotidic linkage (e.g., n001 in certain provided oligonucleotides). It is understood by a person of ordinary skill in the art that an internucleotidic linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage. In some embodiments, a modified internucleotidic linkages is a modified internucleotidic linkages designated as s, s1, s2, s3, s4, s5, s6, s7, s8, s9, s10, s11, s12, s13, s14, s15, s16, s17 and s18 as described in WO 2017/210647.

[0053] In vitro: As used herein, the term“in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant and/or microbe).

[0054] In vivo: As used herein, the term“in vivo” refers to events that occur within an organism (e.g., animal, plant and/or microbe).

[0055] Linkage phosphorus: as defined herein, the phrase“linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in the internucleotidic linkage, which phosphorus atom corresponds to the phosphorus atom of a phosphodiester internucleotidic linkage as occurs in naturally occurring DNA and RNA. In some embodiments, a linkage phosphorus atom is in a modified internucleotidic linkage, wherein each oxygen atom of a phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, a linkage phosphorus atom is the P of Formula I as defined herein. In some embodiments, a linkage phosphorus atom is chiral. In some embodiments, a linkage phosphorus atom is achiral (e.g., as in natural phosphate linkages).

[0056] Linker: The terms“linker”,“linking moiety” and the like refer to any chemical moiety which connects one chemical moiety to another. As appreciated by those skilled in the art, a linker can be bivalent or trivalent or more, depending on the number of chemical moieties the linker connects. In some embodiments, a linker is a moiety which connects one oligonucleotide to another oligonucleotide in a

multimer. In some embodiments, a linker is a moiety optionally positioned between the terminal nucleoside and the solid support or between the terminal nucleoside and another nucleoside, nucleotide, or nucleic acid. In some embodiments, in an oligonucleotide a linker connects a chemical moiety (e.g., a targeting moiety, a lipid moiety, a carbohydrate moiety, etc.) with an oligonucleotide chain (e.g., through its 5’-end, 3’-end, nucleobase, sugar, internucleotidic linkage, etc.)

[0057] Lower alkyl: The term“lower alkyl” refers to a C1-4 straight or branched alkyl group. Example lower alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, and tert-butyl.

[0058] Lower haloalkyl: The term“lower haloalkyl” refers to a C1-4 straight or branched alkyl group that is substituted with one or more halogen atoms.

[0059] Modified nucleobase: The terms "modified nucleobase", "modified base" and the like refer to a chemical moiety which is chemically distinct from a nucleobase, but which is capable of performing at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase which comprises a modification. In some embodiments, a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. In some embodiments, a modified nucleobase is substituted A, T, C, G, or U, or a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobase in the context of oligonucleotides refer to a nucleobase that is not A, T, C, G or U.

[0060] Modified nucleoside: The term "modified nucleoside" refers to a moiety derived from or chemically similar to a natural nucleoside, but which comprises a chemical modification which differentiates it from a natural nucleoside. Non-limiting examples of modified nucleosides include those which comprise a modification at the base and/or the sugar. Non-limiting examples of modified nucleosides include those with a 2’ modification at a sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (which lack a nucleobase). In some embodiments, a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.

[0061] Modified nucleotide: The term“modified nucleotide” includes any chemical moiety which differs structurally from a natural nucleotide but is capable of performing at least one function of a natural nucleotide. In some embodiments, a modified nucleotide comprises a modification at a sugar, base and/or internucleotidic linkage. In some embodiments, a modified nucleotide comprises a modified sugar, modified nucleobase and/or modified internucleotidic linkage. In some embodiments, a modified nucleotide is capable of at least one function of a nucleotide, e.g., forming a subunit in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.

[0062] Modified sugar: The term“modified sugar” refers to a moiety that can replace a sugar. A modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical

property of a sugar. In some embodiments, as described in the present disclosure, a modified sugar is substituted ribose or deoxyribose. In some embodiments, a modified sugar comprises a 2’-modification. Examples of useful 2’-modification are widely utilized in the art and described herein. In some embodiments, a 2’-modification is 2’-OR, wherein R is optionally substituted C1-10 aliphatic. In some embodiments, a 2’-modification is 2’-OMe. In some embodiments, a 2’-modification is 2’-MOE. In some embodiments, a modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc.). In some embodiments, in the context of oligonucleotides, a modified sugar is a sugar that is not ribose or deoxyribose as typically found in natural RNA or DNA.

[0063] Nucleic acid: The term“nucleic acid”, as used herein, includes any nucleotides and polymers thereof. The term“polynucleotide”, as used herein, refers to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxyribonucleotides (DNA) or a combination thereof. These terms refer to the primary structure of the molecules and, thus, include double- and single-stranded DNA, and double- and single-stranded RNA. These terms include, as equivalents, analogs of either RNA or DNA comprising modified nucleotides and/or modified polynucleotides, such as, though not limited to, methylated, protected and/or capped nucleotides or polynucleotides. The terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and/or modified nucleobases; nucleic acids derived from sugars and/or modified sugars; and nucleic acids derived from phosphate bridges and/or modified internucleotidic linkages. The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified internucleotidic linkages. Examples include, and are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units and wherein the prefix oligo- refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.

[0064] Nucleobase: The term“nucleobase” refers to the parts of nucleic acids that are involved in the hydrogen-bonding that binds one nucleic acid strand to another complementary strand in a sequence specific manner. The most common naturally-occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a naturally-occurring nucleobases are modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a naturally-occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase comprises a heteroaryl ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, a nucleobase comprises a heterocyclic ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some

embodiments, a nucleobase is a“modified nucleobase,” a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a modified nucleobase is substituted A, T, C, G or U. In some embodiments, a modified nucleobase is a substituted tautomer of A, T, C, G, or U. In some embodiments, a modified nucleobases is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the property of hydrogen-bonding that binds one nucleic acid strand to another in a sequence specific manner. In some embodiments, a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex. As used herein, the term“nucleobase” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, a nucleobase is optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U. In some embodiments, a“nucleobase” refers to a nucleobase unit in an oligonucleotide or a nucleic acid (e.g., A, T, C, G or U as in an oligonucleotide or a nucleic acid).

[0065] Nucleoside: The term“nucleoside” refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments, a nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a“nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid.

[0066] Nucleoside analog: The term "nucleoside analog" refers to a chemical moiety which is chemically distinct from a natural nucleoside, but which is capable of performing at least one function of a nucleoside. In some embodiments, a nucleoside analog comprises an analog of a sugar and/or an analog of a nucleobase. In some embodiments, a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising a complementary sequence of bases.

[0067] Nucleotide: The term“nucleotide” as used herein refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more internucleotidic linkages (e.g., phosphate linkages in natural DNA and RNA). The naturally occurring bases [guanine, (G), adenine, (A), cytosine, (C), thymine, (T), and uracil (U)] are derivatives of purine or pyrimidine, though it should be understood that naturally and non-naturally occurring base analogs are also included. The naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included. Nucleotides are linked via internucleotidic linkages to form nucleic acids, or polynucleotides. Many internucleotidic linkages are known in the art (such as, though not limited to, phosphate, phosphorothioates, boranophosphates and the like). Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates, H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates and other variants of the phosphate backbone of native nucleic acids, such as those described herein. In some embodiments, a natural nucleotide comprises a naturally occurring base, sugar and internucleotidic linkage. As used herein, the term“nucleotide” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, a“nucleotide” refers to a nucleotide unit in an oligonucleotide or a nucleic acid.

[0068] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides, and may contain any combination of natural and non-natural nucleobases, sugars, and internucleotidic linkages.

[0069] Oligonucleotides can be single-stranded or double-stranded. A single-stranded oligonucleotide can have double-stranded regions (formed by two portions of the single-stranded oligonucleotide) and a double-stranded oligonucleotide, which comprises two oligonucleotide chains, can have single-stranded regions for example, at regions where the two oligonucleotide chains are not complementary to each other. Example oligonucleotides include, but are not limited to structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double-stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, Ul adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immuno-stimulatory oligonucleotides, and decoy oligonucleotides.

[0070] Oligonucleotides of the present disclosure can be of various lengths. In particular embodiments, oligonucleotides can range from about 2 to about 200 nucleosides in length. In various related embodiments, oligonucleotides, single-stranded, double-stranded, or triple-stranded, can range in length from about 4 to about 10 nucleosides, from about 10 to about 50 nucleosides, from about 20 to about 50 nucleosides, from about 15 to about 30 nucleosides, from about 20 to about 30 nucleosides in length. In some embodiments, the oligonucleotide is from about 9 to about 39 nucleosides in length. In some embodiments, the oligonucleotide is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 4 nucleosides in

length. In some embodiments, the oligonucleotide is at least 5 nucleosides in length. In some embodiments, the oligonucleotide is at least 6 nucleosides in length. In some embodiments, the oligonucleotide is at least 7 nucleosides in length. In some embodiments, the oligonucleotide is at least 8 nucleosides in length. In some embodiments, the oligonucleotide is at least 9 nucleosides in length. In some embodiments, the oligonucleotide is at least 10 nucleosides in length. In some embodiments, the oligonucleotide is at least 11 nucleosides in length. In some embodiments, the oligonucleotide is at least 12 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 15 nucleosides in length. In some embodiments, the oligonucleotide is at least 16 nucleosides in length. In some embodiments, the oligonucleotide is at least 17 nucleosides in length. In some embodiments, the oligonucleotide is at least 18 nucleosides in length. In some embodiments, the oligonucleotide is at least 19 nucleosides in length. In some embodiments, the oligonucleotide is at least 20 nucleosides in length. In some embodiments, the oligonucleotide is at least 25 nucleosides in length. In some embodiments, the oligonucleotide is at least 30 nucleosides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands of at least 18 nucleosides in length. In some embodiments, the oligonucleotide is a duplex of complementary strands of at least 21 nucleosides in length. In some embodiments, each nucleoside counted in an oligonucleotide length independently comprises A, T, C, G, or U, or optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G or U.

[0071] Oligonucleotide type: As used herein, the phrase“oligonucleotide type” is used to define an oligonucleotide that has a particular base sequence, pattern of backbone linkages (i.e., pattern of internucleotidic linkage types, for example, phosphate, phosphorothioate, phosphorothioate triester, etc.), pattern of backbone chiral centers [i.e., pattern of linkage phosphorus stereochemistry (Rp/Sp)], and pattern of backbone phosphorus modifications (e.g., pattern of“-XLR1” groups in Formula I as defined herein). In some embodiments, oligonucleotides of a common designated“type” are structurally identical to one another.

[0072] One of skill in the art will appreciate that synthetic methods of the present disclosure provide for a degree of control during the synthesis of an oligonucleotide strand such that each nucleotide unit of the oligonucleotide strand can be designed and/or selected in advance to have a particular stereochemistry at the linkage phosphorus and/or a particular modification at the linkage phosphorus, and/or a particular base, and/or a particular sugar. In some embodiments, an oligonucleotide strand is designed and/or selected in advance to have a particular combination of stereocenters at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and/or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and/or selected to have a particular combination of bases. In some embodiments, an

oligonucleotide strand is designed and/or selected to have a particular combination of one or more of the above structural characteristics. In some embodiments, the present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions). In some embodiments, all such molecules are of the same type (i.e., are structurally identical to one another). In some embodiments, however, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre-determined relative amounts.

[0073] Optionally Substituted: As described herein, compounds, e.g., oligonucleotides, of the disclosure may contain optionally substituted and/or substituted moieties. In general, the term “substituted,” whether preceded by the term“optionally” or not, means that one or more hydrogens of the designated moiety are replaced with a suitable substituent. Unless otherwise indicated, an“optionally substituted” group may have a suitable substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with more than one substituent selected from a specified group, the substituent may be either the same or different at every position. In some embodiments, an optionally substituted group is unsubstituted. Combinations of substituents envisioned by this disclosure are preferably those that result in the formation of stable or chemically feasible compounds. The term“stable,” as used herein, refers to compounds that are not substantially altered when subjected to conditions to allow for their production, detection, and, in certain embodiments, their recovery, purification, and use for one or more of the purposes disclosed herein. Certain substituents are described below.

[0074] Suitable monovalent substituents on a substitutable atom, e.g., a suitable carbon atom, are independently halogen; –(CH2)0–4Ro;–(CH2)0–4OR o; -O(CH2)0-4Ro, –O–(CH2)0–4C(O)OR°; –(CH2)0– 4CH(OR o)2;–(CH2)0–4Ph, which may be substituted with R°; -(CH2)0–4O(CH2)0–1Ph which may be substituted with R°;–CH=CHPh, which may be substituted with R°;–(CH2)0–4O(CH2)0–1-pyridyl which may be substituted with R°;–NO2;–CN;–N3; -(CH2)0–4N(R o)2;–(CH2)0–4N(R o)C(O)R o;–N(R o)C(S)R o; -(CH2)0–4N(R o)C(O)NR o2; -N(R o)C(S)NR o2; –(CH2)0–4N(R o)C(O)OR o; –N(R o)N(R o)C(O)R o; -N(R o)N(R o)C(O)NR o2; -N(R o)N(R o)C(O)OR o; –(CH2)0–4C(O)R o; –C(S)R o; –(CH2)0–4C(O)OR o; -(CH2)0–4C(O)SR o; -(CH2)0–4C(O)OSiR o3; –(CH2)0–4OC(O)R o; –OC(O)(CH2)0–4SR°, -SC(S)SR°; -(CH2)0–4SC(O)R o;–(CH2)0–4C(O)NR o2;–C(S)NR o2;–C(S)SR°; -(CH2)0–4OC(O)NR o2; -C(O)N(OR o)R o; –C(O)C(O)R o;–C(O)CH2C(O)R o; -C(NOR o)R o; -(CH2)0–4SSR o;–(CH2)0–4S(O)2R o;–(CH2)0–4S(O)2OR o; –(CH2)0–4OS(O)2R o; -S(O)2NR o2; -(CH2)0–4S(O)R o;–N(R o)S(O)2NR o2;–N(R o)S(O)2R o;–N(OR o)R o; -C(NH)NR o2;–Si(R o)3;–OSi(R o)3; -B(R o)2; -OB(R o)2; -OB(OR o)2; -P(R o)2; -P(OR o)2; -P(R o)(OR o); -OP(R o)2; -OP(OR o)2; -OP(R o)(OR o); -P(O)(R o)2; -P(O)(OR o)2; -OP(O)(R o)2; -OP(O)(OR o)2; -OP(O)(OR o)(SR o); -SP(O)(R o)2; -SP(O)(OR o)2; -N(R o)P(O)(R o)2; -N(R o)P(O)(OR o)2;

-P(R o)2[B(R o)3]; -P(OR o)2[B(R o)3]; -OP(R o)2[B(R o)3]; -OP(OR o)2[B(R o)3];–(C1–4 straight or branched alkylene)O–N(R o)2; or–(C1–4 straight or branched alkylene)C(O)O–N(R o)2, wherein each R o may be substituted as defined herein and is independently hydrogen, C1–20 aliphatic, C1–20 heteroaliphatic having 1– 5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, -CH2-(C6-14 aryl),–O(CH2)0–1(C6-14 aryl), -CH2-(5-14 membered heteroaryl ring), a 5–20 membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated or aryl ring having 0–5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the definition above, two independent occurrences of R o, taken together with their intervening atom(s), form a 5–20 membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated or aryl ring having 0–5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, which may be substituted as defined below.

[0075] Suitable monovalent substituents on R o (or the ring formed by taking two independent occurrences of R o together with their intervening atoms), are independently halogen,–(CH2)0–2R●,– (haloR●),–(CH2)0–2OH,–(CH2)0–2OR●,–(CH2)0–2CH(OR●)2; -O(haloR●),–CN,–N3,–(CH2)0–2C(O)R●,– (CH2)0–2C(O)OH,–(CH2)0–2C(O)OR●,–(CH2)0–2SR●,–(CH2)0–2SH,–(CH2)0–2NH2,–(CH2)0–2NHR●,– (CH2)0–2NR●

2,–NO2,–SiR●

3, -OSiR●

3, -C(O)SR●

,–(C1–4 straight or branched alkylene)C(O)OR●, or– SSR● wherein each R● is unsubstituted or where preceded by“halo” is substituted only with one or more halogens, and is independently selected from C1–4 aliphatic,–CH2Ph,–O(CH2)0–1Ph, and a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents on a saturated carbon atom of R o include =O and =S.

[0076] Suitable divalent substituents, e.g., on a suitable carbon atom, are independently the following: =O, =S, =NNR* 2=NNHC(O)R*, =NNHC(O)OR*, =NNHS(O)2R*, =NR*, =NOR*,–O(C(R* ))2– 3O–, or–S(C(R* ))2–3S–, wherein each independent occurrence of R* is selected from hydrogen, C1– 6 aliphatic which may be substituted as defined below, and an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Suitable divalent substituents that are bound to vicinal substitutable carbons of an“optionally substituted” group include:–O(CR* 22–3O–, wherein each independent occurrence of R* is selected from hydrogen, C1–6 aliphatic which may be substituted as defined below, and an unsubstituted 5–6–membered saturated, partially unsaturated, and aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0077] Suitable substituents on the aliphatic group of R* are independently halogen, -R●, -(haloR●),–OH,–OR●,–O(haloR●),–CN,–C(O)OH,–C(O)OR●,–NH2,–NHR●,–NR●

2, or–NO2, wherein each R● is unsubstituted or where preceded by“halo” is substituted only with one or more halogens, and is independently C1–4 aliphatic,–CH2Ph,–O(CH2)0–1Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0078] In some embodiments, suitable substituents on a substitutable nitrogen are independently –R†,–NR† –C(O)R†,–C(O)OR†,–C(O)C(O)R†,–C(O)CH2C(O)R†,–S(O)2R†, -S(O)2NR† 2,-C(S)NR† 2,-C(NH)NR† or–N(R†)S(O)2R†; wherein each R† is independently hydrogen, C1–6 aliphatic which may be substituted as defined below, unsubstituted–OPh, or an unsubstituted 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R†, taken together with their intervening atom(s) form an unsubstituted 3–12–membered saturated, partially unsaturated, or aryl mono– or bicyclic ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0079] Suitable substituents on the aliphatic group of R† are independently halogen, -R●, -(haloR●),–OH,–OR●,–O(haloR●),–CN,–C(O)OH,–C(O)OR●,–NH2,–NHR●,–NR●

2, or–NO2, wherein each R● is unsubstituted or where preceded by“halo” is substituted only with one or more halogens, and is independently C1–4 aliphatic,–CH2Ph,–O(CH2)0–1Ph, or a 5–6–membered saturated, partially unsaturated, or aryl ring having 0–4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0080] Oral: The phrases“oral administration” and“administered orally” as used herein have their art-understood meaning referring to administration by mouth of a compound or composition.

[0081] P-modification: as used herein, the term“P-modification” refers to any modification at the linkage phosphorus other than a stereochemical modification. In some embodiments, a P-modification comprises addition, substitution, or removal of a pendant moiety covalently attached to a linkage phosphorus. In some embodiments, the“P-modification” is–X–L–R1 wherein each of X, L and R1 is independently as defined and described in the present disclosure.

[0082] Parenteral: The phrases“parenteral administration” and“administered parenterally” as used herein have their art-understood meaning referring to modes of administration other than enteral and topical administration, usually by injection, and include, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticulare, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0083] Partially unsaturated: As used herein, the term“partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. The term“partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.

[0084] Pharmaceutical composition: As used herein, the term“pharmaceutical composition” refers to an active agent, formulated together with one or more pharmaceutically acceptable carriers. In

some embodiments, an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary, cream, or foam; sublingually; ocularly; transdermally; or nasally, pulmonary, and to other mucosal surfaces.

[0085] Pharmaceutically acceptable: As used herein, the phrase“pharmaceutically acceptable” refers to those compounds, materials, compositions and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0086] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be“acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and/or polyanhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0087] Pharmaceutically acceptable salt: The term“pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. In some embodiments, a provided compound comprises one or more acidic groups, e.g., an oligonucleotide, and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R)3, wherein each R is independently defined and described in the present disclosure) salt. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, a pharmaceutically acceptable salt is a sodium salt. In some embodiments, a pharmaceutically acceptable salt is a potassium salt. In some embodiments, a pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmaceutically acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. In some embodiments, a provided compound comprises more than one acid groups, for example, an oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and/or modified internucleotidic linkages). In some embodiments, a pharmaceutically acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different. In some embodiments, in a pharmaceutically acceptable salt (or generally, a salt), all ionizable hydrogen (e.g., in an aqueous solution with a pKa no more than about 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2; in some embodiments, no more than about 7; in some embodiments, no more than about 6; in some embodiments, no more than about 5; in some embodiments, no more than about 4; in some embodiments, no more than about 3) in the acidic groups are replaced with cations. In

some embodiments, each phosphorothioate and phosphate group independently exists in its salt form (e.g., if sodium salt, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O-, respectively). In some embodiments, each phosphorothioate and phosphate internucleotidic linkage independently exists in its salt form (e.g., if sodium salt, -O-P(O)(SNa)-O- and -O-P(O)(ONa)-O-, respectively). In some embodiments, a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide. In some embodiments, a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide, wherein each acidic phosphate and modified phosphate group (e.g., phosphorothioate, phosphate, etc.), if any, exists as a salt form (all sodium salt).

[0088] Protecting group: The term“protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rd edition, John Wiley & Sons, 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially adapted for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L. Beaucage et al.06/2012, the entirety of Chapter 2 is incorporated herein by reference. Suitable amino–protecting groups include but are not limited to described herein and/or in: WO 2018/022473, WO 2018/098264, WO 2018/223056, WO 2018/223073, WO 2018/223081, WO 2018/237194, WO 2019/032607, WO 2019/055951, and/or WO 2019/075357, the description of the protecting groups of each of which is independently incorporated herein by reference.

[0089] Subject: As used herein, the term“subject” or“test subject” refers to any organism to which a provided compound (e.g., a provided oligonucleotide) or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic and/or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject is a human. In some embodiments, a subject may be suffering from and/or susceptible to a disease, disorder and/or condition.

[0090] Substantially: As used herein, the term“substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. A base sequence which is substantially complementary to a second sequence is not identical to the second sequence, but is mostly or nearly identical to the second sequence. In addition, one of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term“substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and/or chemical phenomena.

[0091] Sugar: The term“sugar” refers to a monosaccharide or polysaccharide in closed and/or open form. In some embodiments, sugars are monosaccharides. In some embodiments, sugars are polysaccharides. Sugars include, but are not limited to, ribose, deoxyribose, pentofuranose, pentopyranose, and hexopyranose moieties. As used herein, the term“sugar” also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“GNA”), etc. As used herein, the term“sugar” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, a sugar is a RNA or DNA sugar (ribose or deoxyribose). In some embodiments, a sugar is a modified ribose or deoxyribose sugar, e.g., 2’-modified, 5’-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and/or nucleic acids, modified sugars may provide one or more desired properties, activities, etc. In some embodiments, a sugar is optionally substituted ribose or deoxyribose. In some embodiments, a“sugar” refers to a sugar unit in an oligonucleotide or a nucleic acid.

[0092] Susceptible to: An individual who is“susceptible to” a disease, disorder and/or condition is one who has a higher risk of developing the disease, disorder and/or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition is predisposed to have that disease, disorder and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition may not have been diagnosed with the disease, disorder and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition may exhibit symptoms of the disease, disorder and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder and/or condition may not exhibit symptoms of the disease, disorder and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will develop the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and/or condition will not develop the disease, disorder, and/or condition.

[0093] Therapeutic agent: As used herein, the term“therapeutic agent” in general refers to any agent that elicits a desired effect (e.g., a desired biological, clinical, or pharmacological effect) when administered to a subject. In some embodiments, an agent is considered to be a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population. In some embodiments, an appropriate population is a population of subjects suffering from and/or susceptible to a disease, disorder or condition. In some embodiments, an appropriate population is a population of model organisms. In some embodiments, an appropriate population may be defined by one or more criterion such as age group, gender, genetic background, preexisting clinical conditions, prior exposure to therapy. In some embodiments, a therapeutic agent is a substance that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms or features of a disease, disorder, and/or condition in a subject when administered to the subject in an effective amount. In some embodiments, a“therapeutic agent” is an agent that has been or is required to be approved by a

government agency before it can be marketed for administration to humans. In some embodiments, a “therapeutic agent” is an agent for which a medical prescription is required for administration to humans. In some embodiments, a therapeutic agent is a provided compound, e.g., a provided oligonucleotide.

[0094] Therapeutically effective amount: As used herein, the term“therapeutically effective amount” means an amount of a substance (e.g., a therapeutic agent, composition, and/or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen. In some embodiments, a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and/or condition, to treat, diagnose, prevent, and/or delay the onset of the disease, disorder, and/or condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc. For example, the effective amount of compound in a formulation to treat a disease, disorder, and/or condition is the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of the disease, disorder, and/or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0095] Treat: As used herein, the term“treat,”“treatment,” or“treating” refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of, reduce severity of, and/or reduce incidence of one or more symptoms or features of a disease, disorder, and/or condition. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and/or condition. In some embodiments, treatment may be administered to a subject who exhibits only early signs of the disease, disorder, and/or condition, for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and/or condition.

[0096] Unsaturated: The term "unsaturated," as used herein, means that a moiety has one or more units of unsaturation.

[0097] Wild-type: As used herein, the term“wild-type” has its art-understood meaning that refers to an entity having a structure and/or activity as found in nature in a“normal” (as contrasted with mutant, diseased, altered, etc.) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different forms (e.g., alleles).

[0098] For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 67th Ed., 1986-87, inside cover.

[0099] As those skilled in the art will appreciate, methods and compositions described herein relating to provided compounds (e.g., oligonucleotides) also apply to pharmaceutically acceptable salts of

such compounds.

Description of Certain Embodiments

[00100] Oligonucleotides are useful tools for a wide variety of applications. For example, HTT oligonucleotides are useful in therapeutic, diagnostic, and research applications, including the treatment of a variety of HTT-related conditions, disorders, and diseases, including Huntington’s Disease. The use of naturally occurring nucleic acids (e.g., unmodified DNA or RNA) is limited, for example, by their susceptibility to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings and/or to further improve various properties and activities. These include synthetic oligonucleotides that contain chemical modifications, e.g., base modifications, sugar modifications, backbone modifications, etc., which, among other things, render these molecules less susceptible to degradation and improve other properties and/or activities. From a structural point of view, modifications to internucleotidic linkages can introduce chirality, and certain properties may be affected by configurations of linkage phosphorus atoms of oligonucleotides. For example, binding affinity, sequence specific binding to complementary RNA, stability to nucleases, cleavage of target HTT nucleic acids, delivery, pharmacokinetics, etc. can be affected by, inter alia, chirality of backbone linkage phosphorus atoms. Among other things, the present disclosure provides technologies for controlling and/or utilizing various structural elements, e.g., sugar modifications and patterns thereof, nucleobase modifications and patterns thereof, modified internucleotidic linkages and patterns thereof, linkage phosphorus stereochemistry and patterns thereof, additional chemical moieties (moieties that are not typically in an oligonucleotide chain) and patterns thereof, etc., and various combinations of one or more or all of such structural elements, in oligonucleotides.

[00101] In some embodiments, provided oligonucleotides are oligonucleotides targeting HTT, and can reduce levels of mutant HTT transcripts and/or one or more products encoded thereby. Such oligonucleotides are particularly useful for preventing and/or treating HTT-related conditions, disorders and/or diseases, including Huntington’s Disease.

[00102] In some embodiments, an HTT oligonucleotide comprises a sequence that is completely or substantially identical to or is completely or substantially complementary to 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, typically 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more, contiguous bases of an HTT genomic sequence or a transcript therefrom (e.g., pre-mRNA, mRNA, etc.). Those skilled in the art will appreciate that a“HTT oligonucleotide” may have a nucleotide sequence that is identical (or substantially identical) or complementary (or substantially complementary) to an HTT base sequence (e.g., a genomic sequence, a transcript sequence, a mRNA sequence, etc.) or a portion thereof.

[00103] In some embodiments, the present disclosure provides an HTT oligonucleotide as disclosed

herein, e.g., in a Table, or an HTT oligonucleotide which has a base sequence comprising at least 10 contiguous bases of an oligonucleotide disclosed herein.

[00104] In some embodiments, the present disclosure provides an HTT oligonucleotide having a base sequence disclosed herein, e.g., in a Table, or a portion thereof comprising at least 10 contiguous bases, wherein the HTT oligonucleotide is stereorandom or not chirally controlled.

[00105] In some embodiments, internucleotidic linkages of an oligonucleotide comprise or consist of 1-5, 1-10, 1-15, 1-20, 1-25, 1-30, 1-40, 1-50, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more chirally controlled internucleotidic linkages. In some embodiments, an oligonucleotide composition of the present disclosure comprises oligonucleotides of the same constitution, wherein one or more internucleotidic linkages are chirally controlled and one or more internucleotidic linkages are stereorandom (not chirally controlled). In some embodiments, the present disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotides comprise at least one chirally controlled internucleotidic linkage. In some embodiments, the present disclosure provides an HTT oligonucleotide composition wherein the HTT oligonucleotides are stereorandom or not chirally controlled. In some embodiments, in an HTT oligonucleotide, at least one internucleotidic linkage is stereorandom and at least one internucleotidic linkage is chirally controlled.

[00106] In some embodiments, internucleotidic linkages of an oligonucleotide comprise or consist of one or more negatively charged internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages, natural phosphate linkages, etc.). In some embodiments, internucleotidic linkages of an oligonucleotide comprise or consist of one or more negatively charged chiral internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages). In some embodiments, internucleotidic linkages of an oligonucleotide comprise or consist of one or more non-negatively charged internucleotidic linkages. In some embodiments, internucleotidic linkages of an oligonucleotide comprise or consist of one or more neutral chiral internucleotidic linkages. In some embodiments, the present disclosure pertains to an HTT oligonucleotide which comprises at least one neutral or non-negatively charged internucleotidic linkage as described in the present disclosure.

HTT

[00107] In some embodiments, HTT refers to a gene or a gene product thereof (including but not limited to, a nucleic acid, including but not limited to a DNA or RNA, or a wild-type or mutant protein encoded thereby), from any species, and which may be also known as: HTT, HD, IT15, huntingtin, Huntingtin, or LOMARS; External IDs: OMIM: 613004, MGI: 96067, HomoloGene: 1593, GeneCards: HTT; Species: Human: Entrez: 3064; Ensembl: ENSG00000197386; UniProt: P42858; RefSeq (mRNA): NM_002111; RefSeq (protein): NP_002102; Location (UCSC): Chr 4: 3.04– 3.24 Mb; Species: Mouse: Entrez: 15194; Ensembl: ENSMUSG00000029104; UniProt: P42859; RefSeq (mRNA): NM_010414;

RefSeq (protein): NP_034544; Location (UCSC): Chr 5: 34.76– 34.91 Mb. Additional HTT sequences, including variants thereof, from human, mouse, rat, monkey, etc., are readily available to those of skill in the art. In some embodiments, HTT is a human or mouse HTT, which is wild-type or mutant.

[00108] In some embodiments, an HTT protein is unmodified or modified. In some embodiments, an HTT protein has any one or more modifications of: 9 N6-acetyllysine; 176 N6-acetyllysine; 234 N6-acetyllysine; 343 N6-acetyllysine; 411 Phosphoserine; 417 Phosphoserine; 419 Phosphoserine; 432 Phosphoserine; 442 N6-acetyllysine; 640 Phosphoserine; 643 Phosphoserine; 1179 Phosphoserine; 1199 Phosphoserine; 1870 Phosphoserine; or 1874 Phosphoserine.

[00109] Without wishing to be bound by any particular theory, the present disclosure notes that a mutation (e.g., a CAG repeat expansion) in HTT is reportedly a key factor in diseases and disorders such as Huntington’s Disease.

[00110] In some embodiments, a mutant HTT is designated mHTT, muHTT, m HTT, mu HTT, MU HTT, or the like, wherein m or mu indicate mutant. In some embodiments, a wild type HTT is designated wild-type HTT, wtHTT, wt HTT, WT HTT, WTHTT, or the like, wherein wt indicates wild-type. In some embodiments, a mutant HTT comprises an expanded CAG repeat region (e.g., 36-121, 36-250, 37-121, 40-121, repeats or longer). In some embodiments, a mutant HTT comprises a mutant allele of one or more SNP (the allele on the same DNA strand or chromosome as the expanded CAG repeats). In some embodiments, a mutant HTT comprises both an expanded CAG repeat region and a mutant allele of a particular SNP on the same chromosomal strand.

[00111] In some embodiments, a human HTT is designated hHTT. In some embodiments, a mutant HTT is designated mHTT. In some embodiments, when a mouse is utilized, a mouse HTT may be referred to as mHTT as those skilled in the art will appreciate.

[00112] In some embodiments, an HTT oligonucleotide is complementary to a portion of an HTT nucleic acid sequence, e.g., an HTT gene sequence, an HTT mRNA sequence, etc. In some embodiments, the base sequence of such a portion is characteristic of HTT in that no other genomic or transcript sequences have the same sequence as the portion. In some embodiments, a portion of a gene that is complimentary to an oligonucleotide is referred to as the target sequence of the oligonucleotide.

[00113] In some embodiments, an HTT gene sequence (or a portion thereof, e.g., complementary to an HTT oligonucleotide) is an HTT gene sequence (or a portion thereof) known in the art or reported in the literature. Certain nucleotide and amino acid sequences of a human HTT can be found in public sources, for example, one or more publicly available databases, e.g., GenBank, UniProt, OMEVI, etc. Those skilled in the art will appreciate that, for example, where a described nucleic acid sequence may be or include a genomic sequence, transcripts, splicing products, and/or encoded proteins, etc., may readily be appreciated from such genomic sequence.

[00114] In some embodiments, an HTT gene (or a portion thereof with a sequence complementary to an HTT oligonucleotide) includes a single nucleotide polymorphism or SNP. Numerous HTT SNPs have been reported and may be found at, for example, NCBI dbSNP (see, e.g., www.ncbi.nlm.nih.gov/snp). Non-limiting examples of SNPs within the HTT gene may be found at, NCBI dbSNP Accession, and include, for example, those described herein. In some embodiments, an HTT oligonucleotide targets a SNP allele which is on the same chromosome as (e.g., in phase with) the CAG repeat expansion and not present on the wild-type allele (which does not comprise the CAG repeat expansion).

[00115] Huntinton's disease (HD) is a neurodegenerative disorder reportedly caused by a mutation of the HTT (huntingtin) gene. Alteration of this widely expressed single gene reportedly results in a progressive, neurodegenerative disorder with a large number of characteristic symptoms. In some embodiments, a HD-related mutation is an expansion of a CAG repeat region in the HTT gene, wherein a larger expansion reportedly results in greater severity of the disease and an earlier age of onset. The mutation reportedly results in a variety of motor, emotional and cognitive symptoms, and results in the formation of huntingtin aggregates in brain.

[00116] The CAG expansion reportedly results in the expansion of a poly-glutamine tract in the huntingtin protein, a 350 kDa protein (Huntington Disease Collaborative Research Group, 1993. Cell. 72:971-83). The normal and expanded HD allele sizes have reportedly been found to be, e.g., CAG 6-37 and CAG 35-121 repeats or longer, respectively. Longer repeat sequences are reportedly associated with earlier disease onset. The absence of an HD phenotype in individuals deleted for one copy of huntingtin, or increased severity of disease in those homozygous for the expansion reportedly suggests that the mutation does not result in a loss of function (Trottier et al., 1995, Nature Med., 10:104-110). Transcriptional deregulation and loss of function of transcriptional coactivator proteins have reportedly been implicated in HD pathogenesis. Mutant huntingtin has reportedly been shown specifically to disrupt activator-dependent transcription in the early stages of HD pathogenesis (Dunah et al., 2002. Science 296:2238-2243).

[00117] In one report gene profiling of human blood identified 322 mRNAs that show significantly altered expression in HD blood samples as compared to normal or presymptomatic individuals. Expression of marker genes was similarly substantially altered in post-mortem brain samples from HD caudate, suggesting that upregulation of genes in blood samples reflects disease mechanisms found in brain. Monitoring of gene expression may provide a sensitive and quantitative method to monitor disease progression, especially in the early stages of disease in both animal models and human patients (Borovecki et al., 2005, Proc. Natl. Acad. Sci. USA 102:11023-11028).

[00118] Huntington’s disease has been reported to be an autosomal dominant disorder, with an onset generally in mid-life, although cases of onset from childhood to over 70 years of age have been documented. An earlier age of onset is reportedly associated with paternal inheritance, with 70% of juvenile cases being inherited through the father.

[00119] In some embodiments, symptoms of Huntington’s Disease have an emotional, motor and cognitive component. One symptom, chorea is a characteristic feature of the motor disorder and is defined as excessive spontaneous movements which are irregularly timed, randomly distributed and abrupt. It can vary from being barely perceptible to severe. Other frequently observed symptoms or abnormalities include dystonia, rigidity, bradykinesia, ocularmotor dysfunction, tremor, etc. Voluntary movement disorders as symptoms include fine motor incoordination, dysathria, and dysphagia. Emotional disorders or symptoms commonly include depression and irritability, and cognitive component comprises subcortical dementia (Mangiarini et al. 1996. Cell 87:493-506). It is reported that changes in HD brains are widespread and include neuronal loss and gliosis, particularly in the cortex and striatum (Vonsattel and DiFiglia. 1998. J. Neuropathol. Exp. Neurol.57:369-384).

[00120] Certain information related to HTT and HTT-related conditions, disorders or diseases has been reported in, for example: Kremer et al.1994. N. E. J. Med.330: 1401; Kordasiewicz et al.2012 Neuron 74: 1031-1044; Carroll et al. 2011 Mol. Ther. 19: 2178-2185; Warby et al. 2009 Am. J. Hum. Genet. 84: 351-366; Pfister et al. 2009 Current Biol. 19: 774-778; Kay et al. 2015 Mol. Ther. 23: 1759-1771; Kay et al.2014 Clin. Genet.86: 29-36; Lee et al.2015. Am. J. Hum. Genet.97: 435-444; Skotte et al.2014. PLOS ONE 9: e107434; Southwell et al. 2014. Mol. Ther. 22: 2093-2106; Australian Pat. Publications AU2017276286 and AU2007210038; European Pat. Publications EP3277814 and EP3210633; International Pat. Publication WO2018145009; and US Pat. Publication US20180273945.

[00121] In some embodiments, an HTT oligonucleotide capable of decreasing the level, activity and/or expression of an HTT gene is useful in a method of preventing or treating an HTT-related condition, disorder or disease, e.g., Huntington’s Disease, and/or delaying the onset of and/or the severity of one or more symptoms of Huntington’s Disease.

[00122] In some embodiments, the present disclosure provides methods for preventing or treating an HTT-related condition, disorder or disease, by administering to a subject suffering from or susceptible to such a condition, disorder or disease a therapeutically effective amount of a provided HTT oligonucleotide or a composition thereof. In some embodiments, a composition is a chirally controlled oligonucleotide composition.

HTT Oligonucleotides

[00123] Among other things, the present disclosure provides oligonucleotides of various designs, which may comprises various nucleobases and patterns thereof, sugars and patterns thereof, internucleotidic linkages and patterns thereof, and/or additional chemical moieties and patterns thereof as described in the present disclosure. In some embodiments, provided oligonucleotides are HTT oligonucleotides. In some

embodiments, provided HTT oligonucleotides can direct a decrease in the expression, level and/or activity of an HTT gene and/or one or more of its products (e.g., transcripts, mRNA, proteins, etc.). In some embodiments, provided HTT oligonucleotides can direct a decrease in the expression, level and/or activity of an HTT gene and/or one or more of its products in any cell of a subject or patient. In some embodiments, a cell is a any cell that normally expresses HTT or produces HTT protein. In some embodiments, provided HTT oligonucleotides can direct a decrease in the expression, level and/or activity of an HTT target gene or a gene product and has a base sequence which consists of, comprises, or comprises a portion (e.g., a span of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or more contiguous bases) of the base sequence of an HTT oligonucleotide disclosed herein, and the oligonucleotide comprises at least one non-naturally-occurring modification of a base, sugar and/or internucleotidic linkage.

[00124] In some embodiments, an HTT oligonucleotide comprises one or more carbohydrate moieties. In some embodiments, an HTT oligonucleotide comprises one or more lipid moieties. In some embodiments, an HTT oligonucleotide comprises one or more targeting moieties. Non-limiting examples of such additional chemical moieties which can be conjugated to an oligonucleotide chain are described herein.

[00125] In some embodiments, provided oligonucleotides can direct a decrease in the expression, level and/or activity of a target gene, e.g., an HTT target gene, or a product thereof. In some embodiments, provided oligonucleotides can direct a decrease in the expression, level and/or activity of an HTT target gene or a product thereof via RNase H-mediated knockdown. In some embodiments, provided oligonucleotides can direct a decrease in the expression, level and/or activity of an HTT target gene or a product thereof by sterically blocking translation after binding to an HTT target gene mRNA, and/or by altering or interfering with mRNA splicing. Regardless, however, the present disclosure is not limited to any particular mechanism. In some embodiments, the present disclosure provides oligonucleotides, compositions, methods, etc., capable of operating via double-stranded RNA interference, single-stranded RNA interference, RNase H-mediated knock-down, steric hindrance of translation, or a combination of two or more such mechanisms.

[00126] In some embodiments, HTT oligonucleotides are antisense oligonucleotides (ASOs), in that they are oligonucleotides which have a base sequence which is antisense (e.g., complementary) to a target HTT sequence. In some embodiments, HTT oligonucleotides are double-stranded siRNAs. In some embodiments, HTT oligonucleotides are single-stranded siRNAs. Provided oligonucleotides and compositions thereof may be utilized for many purposes. For example, provided HTT oligonucleotides can be co-administered or be used as part of a treatment regimen along with one or more treatment for Huntington’s Disease or a symptom thereof, including but not limited to: aptamers, lncRNAs, lncRNA inhibitors, antibodies, peptides, small molecules, other oligonucleotides to HTT or other targets, and/or other agents capable of inhibiting the expression of an HTT transcript, reducing the level and/or activity of an HTT gene product, and/or inhibiting the expression of a gene or reducing a gene product thereof which increases the expression, activity and/or level of an HTT transcript or an HTT gene product, or a gene or gene product which is associated with an HTT-related disorder.

[00127] In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, comprises a structural element or a portion thereof described herein, e.g., in a Table. In some embodiments, an oligonucleotide,e.g., an HTT oligonucleotide, comprises a base sequence (or a portion thereof), a chemical modification or a pattern of chemical modifications (or a portion thereof), and/or a format or a portion thereof described herein. In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, comprises the base sequence (or a portion thereof), pattern of chemical modifications (or a portion thereof), and/or a format of an oligonucleotide disclosed herein, e.g., in Table 1 or in the Figures, or otherwise disclosed herein. In some embodiments, such oligonucleotides, e.g., HTT oligonucleotides reduce expression, level and/or activity of a gene, e.g., an HTT gene, or a gene product thereof.

[00128] Among other things, provided oligonucleotides may hybridize to their target HTT nucleic acids (e.g., pre-mRNA, mature mRNA, etc.). For example, in some embodiments, an HTT oligonucleotide can hybridize to an HTT nucleic acid derived from a DNA strand (either strand of the HTT gene). In some embodiments, an HTT oligonucleotide can hybridize to an HTT transcript. In some embodiments, an HTT oligonucleotide can hybridize to an HTT nucleic acid in any stage of RNA processing, including but not limited to a pre-mRNA or a mature mRNA. In some embodiments, an HTT oligonucleotide can hybridize to any element of an HTT nucleic acid or its complement, including but not limited to: a promoter region, an enhancer region, a transcriptional stop region, a translational start signal, a translation stop signal, a coding region, a non-coding region, an exon, an intron, an intron/exon or exon/intron junction, the 5' UTR, or the 3' UTR.

[00129] In some embodiments, an oligonucleotide hydridizes to two or more variants of transcripts derived from a sense strand. In some embodiments, an HTT oligonucleotide hybridizes to two or more variants of HTT derived from the sense strand. In some embodiments, an HTT oligonucleotide hybridizes to all variants of HTT derived from the sense strand. In some embodiments, an HTT oligonucleotide hybridizes to two or more variants of HTT derived from the antisense strand. In some embodiments, an HTT oligonucleotide hybridizes to all variants of HTT derived from the antisense strand.

[00130] In some embodiments, an HTT target of an HTT oligonucleotide is an HTT RNA which is not a mRNA.

[00131] In some embodiments, HTT oligonucleotides contain increased levels of one or more isotopes. In some embodiments, provided oligonucleotides are labeled, e.g., by one or more isotopes of one or more elements, e.g., hydrogen, carbon, nitrogen, etc. In some embodiments, provided

oligonucleotides in provided compositions, e.g., oligonucleotides of a plurality of a composition, comprise base modifications, sugar modifications, and/or internucleotidic linkage modifications, wherein the oligonucleotides contain an enriched level of deuterium. In some embodiments, provided oligonucleotides are labeled with deuterium (replacing -1H with -2H) at one or more positions. In some embodiments, one or more 1H of an oligonucleotide chain or any moiety conjugated to the oligonucleotide chain (e.g., a targeting moiety, etc.) is substituted with 2H. Such oligonucleotides can be used in compositions and methods described herein.

[00132] In some embodiments, the present disclosure provides an oligonucleotide composition comprising a plurality of oligonucleotides which:

1) have a common base sequence complementary to a target sequence (e.g., an HTT target sequence) in a transcript; and

2) comprise one or more modified sugar moieties and/or modified internucleotidic linkages.

[00133] In some embodiments, oligonucleotides, e.g., HTT oligonucleotides, having a common base sequence may have the same pattern of nucleoside modifications, e.g.¸ sugar modifications, base modifications, etc. In some embodiments, a pattern of nucleoside modifications may be represented by a combination of locations and modifications. In some embodiments, a pattern of backbone linkages comprises locations and types (e.g., phosphate, phosphorothioate, substituted phosphorothioate, etc.) of each internucleotidic linkage.

[00134] In some embodiments, a modified internucleotidic linkage has a structure of Formula I. In some embodiments, a modified internucleotidic linkage has a structure of Formula I-a. In some embodiments, an internucleotidic linkage has the structure of Formula I, I-a, I-b, I-c, I-n-1, I-n-2, I-n-3, I-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, or II-d-2, or a salt form thereof.

[00135] In some embodiments, a HTT oligonucleotide comprises one or more internucleotidic linkage, each of which independently has the structure of Formula I, I-a, I-b, I-c, I-n-1, I-n-2, I-n-3, I-n-4, II, II-a-1, II-a-2, II-b-1, II-b-2, II-c-1, II-c-2, II-d-1, or II-d-2.

[00136] In some embodiments, oligonucleotides of a plurality, e.g., in provided compositions, are of the same oligonucleotide type. In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of sugar modifications. In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of base modifications. In some embodiments, oligonucleotides of an oligonucleotide type have a common pattern of nucleoside modifications. In some embodiments, oligonucleotides of an oligonucleotide type have the same constitution. In some embodiments, oligonucleotides of an oligonucleotide type are identical. In some embodiments, oligonucleotides of a plurality are identical. In some embodiments, oligonucleotides of a plurality share the same constitution. [00137] In some embodiments, as exemplified herein, oligonucleotides, e.g., HTT oligonucleotides, are chiral controlled, comprising one or more chirally controlled internucleotidic linkages. In some embodiments, provided oligonucleotides are stereochemically pure. In some embodiments, provided oligonucleotides are substantially separated from other stereoisomers.

[00138] In some embodiments, oligonucleotides, e.g., HTT oligonucleotides, comprise one or more modified nucleobases, one or more modified sugars, and/or one or more modified internucleotidic linkages.

[00139] In some embodiments, oligonucleotides, e.g., HTT oligonucleotides, comprise one or more modified sugars. In some embodiments, oligonucleotides of the present disclosure comprise one or more modified nucleobases. Various modifications can be introduced to a sugar and/or nucleobase in accordance with the present disclosure. For example, in some embodiments, a modification is a modification described in US 9006198. In some embodiments, a modification is a modification described in US 9394333, US 9744183, US 9605019, US 9982257, US 20170037399, US 20180216108, US 20180216107, US 9598458, WO 2017/062862, WO 2018/067973, WO 2017/160741, WO 2017/192679, WO 2017/210647, or WO 2018/098264, the sugar, base, and internucleotidic linkage modifications of each of which are independently incorporated herein by reference.

[00140] As used in the present disclosure, in some embodiments, one or more is one. In some embodiments, one or more is two. In some embodiments, one or more is three. In some embodiments, one or more is four. In some embodiments, one or more is five. In some embodiments, one or more is six. In some embodiments, one or more is seven. In some embodiments, one or more is eight. In some embodiments, one or more is nine. In some embodiments, one or more is ten. In some embodiments, one or more is at least one. In some embodiments, one or more is at least two. In some embodiments, one or more is at least three. In some embodiments, one or more is at least four. In some embodiments, one or more is at least five. In some embodiments, one or more is at least six. In some embodiments, one or more is at least seven. In some embodiments, one or more is at least eight. In some embodiments, one or more is at least nine. In some embodiments, one or more is at least ten.

[00141] In some embodiments, an HTT oligonucleotide is or comprises an HTT oligonucleotide described in a Table or Figure.

[00142] As demonstrated in the present disclosure, in some embodiments, a provided oligonucleotide (e.g., an HTT oligonucleotide) is characterized in that, when it is contacted with the transcript in a knockdown system, knockdown of its target (e.g., an HTT transcript for an HTT oligonucleotide, a mutant HTT transcript comprising expanded CAG repeats, etc.) is improved relative to that observed under reference conditions (e.g., selected from the group consisting of absence of the composition, presence of a reference composition, and combinations thereof). In some embodiments, knockdown is increased 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 fold or more.

[00143] In some embodiments, oligonucleotides are provided as salt forms. In some embodiments, oligonucleotides are provided as salts comprising negatively-charged internucleotidic linkages (e.g., phosphorothioate internucleotidic linkages, natural phosphate linkages, etc.) existing as their salt forms. In some embodiments, oligonucleotides are provided as pharmaceutically acceptable salts. In some embodiments, oligonucleotides are provided as metal salts. In some embodiments, oligonucleotides are provided as sodium salts. In some embodiments, oligonucleotides are provided as metal salts, e.g., sodium salts, wherein each negatively-charged internucleotidic linkage is independently in a salt form (e.g., for sodium salts, -O-P(O)(SNa)-O- for a phosphorothioate internucleotidic linkage, -O-P(O)(ONa)-O- for a natural phosphate linkage, etc.).

[00144] In some embodiments, a HTT oligonucleotide or a HTT oligonucleotide composition is chirally controlled (e.g., stereopure).

[00145] In some embodiments, a HTT oligonucleotide or a HTT oligonucleotide is stereorandom.

[00146] In some embodiments, a HTT oligonucleotide targets HTT SNP rs362272, rs362273, rs362273, rs362307, rs362331, or rs363099.

[00147] In some embodiments, a HTT oligonucleotide targets SNP rs362272 and has a base sequence which comprises: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC, wherein each T can be independently substituted with U or vice versa.

[00148] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which comprises: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00149] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which comprises: GTTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00150] In some embodiments, a HTT oligonucleotide targets SNP rs362307 and has a base sequence which comprises: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC,

GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC, wherein each T can be independently substituted with U or vice versa.

[00151] In some embodiments, a HTT oligonucleotide targets SNP rs362331 and has a base sequence which comprises: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA, wherein each T can be independently substituted with U or vice versa.

[00152] In some embodiments, a HTT oligonucleotide targets SNP rs363099 and has a base sequence which comprises: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, wherein each T can be independently substituted with U or vice versa.

[00153] In some embodiments, a HTT oligonucleotide targets SNP rs362272 and has a base sequence which is: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC, wherein each T can be independently substituted with U or vice versa.

[00154] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which is: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00155] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which is: GTTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00156] In some embodiments, a HTT oligonucleotide targets SNP rs362307 and has a base sequence which is: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC, wherein each T can be independently substituted with U or vice versa.

[00157] In some embodiments, a HTT oligonucleotide targets SNP rs362331 and has a base sequence which is: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA, wherein each T can be independently substituted with U or vice versa.

[00158] In some embodiments, a HTT oligonucleotide targets SNP rs363099 and has a base sequence which is: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT,

CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, wherein each T can be independently substituted with U or vice versa.

[00159] In some embodiments, a HTT oligonucleotide targets SNP rs362272 and has a base sequence which comprises at least 15 contiguous bases, including the position of the SNP, of: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC, wherein each T can be independently substituted with U or vice versa.

[00160] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which comprises at least 15 contiguous bases, including the position of the SNP, of: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00161] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which comprises at least 15 contiguous bases, including the position of the SNP, of: GTTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00162] In some embodiments, a HTT oligonucleotide targets SNP rs362307 and has a base sequence which comprises at least 15 contiguous bases, including the position of the SNP, of: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC, wherein each T can be independently substituted with U or vice versa.

[00163] In some embodiments, a HTT oligonucleotide targets SNP rs362331 and has a base sequence which comprises at least 15 contiguous bases, including the position of the SNP, of: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA, wherein each T can be independently substituted with U or vice versa.

[00164] In some embodiments, a HTT oligonucleotide targets SNP rs363099 and has a base sequence which comprises at least 15 contiguous bases, including the position of the SNP, of: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, wherein each T can be independently substituted with U or vice versa. [00165] In some embodiments, a HTT oligonucleotide targets SNP rs362272 and has a base sequence which comprises at least 10 contiguous bases, including the position of the SNP, of: ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC, wherein each T can be independently substituted with U or vice versa.

[00166] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which comprises at least 10 contiguous bases, including the position of the SNP, of: AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00167] In some embodiments, a HTT oligonucleotide targets SNP rs362273 and has a base sequence which comprises at least 10 contiguous bases, including the position of the SNP, of: GTTGATCTGTAGCAGCAGCT, wherein each T can be independently substituted with U or vice versa.

[00168] In some embodiments, a HTT oligonucleotide targets SNP rs362307 and has a base sequence which comprises at least 10 contiguous bases, including the position of the SNP, of: CACAAGGGCACAGACTTCCA, GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, GGCACAAGGGCACAGACTT, or GGCACAAGGGCACAGACTTC, wherein each T can be independently substituted with U or vice versa.

[00169] In some embodiments, a HTT oligonucleotide targets SNP rs362331 and has a base sequence which comprises at least 10 contiguous bases, including the position of the SNP, of: AGTGCACACAGTAGATGAGG, GTGCACACAGTAGATGAGGG, or TGCACACAGTAGATGAGGGA, wherein each T can be independently substituted with U or vice versa.

[00170] In some embodiments, a HTT oligonucleotide targets SNP rs363099 and has a base sequence which comprises at least 10 contiguous bases, including the position of the SNP, of: AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, wherein each T can be independently substituted with U or vice versa.

[00171] In some embodiments, a HTT oligonucleotide does not target a SNP, wherein each U can be independently substituted with T and vice versa.

[00172] In some embodiments, a HTT oligonucleotide does not target a SNP and is pan-specific, wherein each U can be independently substituted with T and vice versa.

[00173] In some embodiments, a HTT oligonucleotide does not target a SNP and is pan-specific, and has a base sequence which comprises, which is, which comprises at least 15 contiguous bases of, or which comprises at least 10 contiguous bases of: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT, wherein each U can be independently substituted with T and vice versa.

[00174] In some embodiments, a HTT oligonucleotide has a base sequence comprising the sequence of: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT, wherein each U can be independently substituted with T and vice versa.

[00175] In some embodiments, a HTT oligonucleotide has a base sequence which is the sequence of: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT, wherein each U can be independently substituted with T and vice versa.

[00176] In some embodiments, a HTT oligonucleotide has a base sequence comprising at least 15 contiguous bases of the sequence of: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT, wherein each U can be independently substituted with T and vice versa.

[00177] In some embodiments, a HTT oligonucleotide has a base sequence comprising at least 10 contiguous bases of the sequence of: ACCGCCATCCCCGCCGTAGC, CCGCCATCCCCGCCGTAGCC, CGCCATCCCCGCCGTAGCCT, CTCAGTAACATTGACACCAC, GCCATCCCCGCCGTAGCCTG, GGCTCTGGGTTGCTGGGTCA, GGTGTCCCTCATGGGCTCTG, or GTTACCGCCATCCCCGCCGT, wherein each U can be independently substituted with T and vice versa.

[00178] In some embodiments, a HTT oligonucleotide is any HTT oligonucleotide disclosed herein, or a salt thereof.

[00179] In some embodiments, a HTT oligonucleotide is any of: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof, wherein each U can be independently substituted with T and vice versa.

[00180] In some embodiments, a HTT oligonucleotide is any of stereopure (chirally controlled) HTT oligonucleotide which comprises the base sequence of any of: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof, wherein each U can be independently substituted with T and vice versa.

[00181] In some embodiments, a HTT oligonucleotide is any of stereopure (chirally controlled) HTT oligonucleotide which has the base sequence of any of: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof, wherein each U can be independently substituted with T and vice versa.

[00182] In some embodiments, a HTT oligonucleotide is any of stereopure (chirally controlled) HTT oligonucleotide which has a base sequence comprising at least 15 contiguous bases of the base sequence of any of: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-

19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof, wherein each U can be independently substituted with T and vice versa.

[00183] In some embodiments, a HTT oligonucleotide is any of stereopure (chirally controlled) HTT oligonucleotide or HTT oligonucleotide which has a base sequence comprising at least 10 contiguous bases of the base sequence of any of: WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21404, WV-21405, WV-21406, WV-21409, WV-21410, WV-21412, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, or WV-9679, or a salt thereof, wherein each U can be independently substituted with T and vice versa.

[00184] In some embodiments, the present disclosure pertains to: A composition comprising a HTT oligonucleotide and a pharmaceutical carrier.

[00185] In some embodiments, the present disclosure pertains to: A method of use of a HTT oligonucleotide in treatment of and/or prevention of Huntington’s Disease.

[00186] In some embodiments, the present disclosure pertains to: A method of use of a HTT oligonucleotide a method of treating, preventing, delaying onset of, and/or decreasing the severity of at least one symptom of Huntington’s Disease.

[00187] In some embodiments, the present disclosure pertains to: A method of manufacture of a medicament comprising a HTT oligonucleotide.

[00188] In some embodiments, a HTT oligonucleotide is any individual HTT oligonucleotide or genus of HTT oligonucleotides described herein.

Base Sequences

[00189] In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, comprises a base sequence described herein or a portion (e.g., a span of 5-50, 5-40, 5-30, 5-20, or 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or at least 10, at least 15, contiguous nucleobases) thereof with 0-5 (e.g., 0, 1, 2, 3, 4 or 5) mismatches. In some embodiments, an oligonucleotide, e.g., an HTT oligonucleotide, comprises a base sequence described herein, or a portion thereof, wherein a portion is a span of at least 10 contiguous nucleobases, or a span of at least 15 contiguous nucleobases with 1-5 mismatches. In some embodiments, provided oligonucleotides comprise a base sequence described herein, or a portion thereof, wherein a portion is a span of at least 10 contiguous nucleobases, or a span of at least 10 contiguous nucleobases with 1-5 mismatches. In some embodiments, base sequences of oligonucleotides comprise or consists of 10-50 (e.g., about or at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45; in some embodiments, at least 15; in some embodiments, at least 16; in some embodiments, at least 17; in some embodiments, at least 18; in some embodiments, at least 19; in some embodiments, at least 20; in some embodiments, at least 21; in some embodiments, at least 22; in some embodiments, at least 23; in some embodiments, at least 24; in some embodiments, at least 25) contiguous bases of a base sequence that is identical to or complementary to a base sequence of an HTT gene or a transcript (e.g., mRNA) thereof.

[00190] Base sequences of provided oligonucleotides, as appreciated by those skilled in the art, typically have sufficient length and complementarity to their targets, e.g., RNA transcripts (e.g., pre-mRNA, mature mRNA, etc.) to mediate target-specific knockdown. In some embodiments, the base sequence of an HTT oligonucleotide has a sufficient length and identity to an HTT transcript target to mediate target-specific knockdown. In some embodiments, the HTT oligonucleotide is complementary to a portion of an HTT transcript (a HTT transcript target sequence). In some embodiments, the base sequence of an HTT oligonucleotide has 90% or more identity with the base sequence of an oligonucleotide disclosed in a Table. In some embodiments, the base sequence of an HTT oligonucleotide has 95% or more identity with the base sequence of an oligonucleotide disclosed in a Table. In some embodiments, the base sequence of an HTT oligonucleotide comprises a continuous span of 15 or more bases of an oligonucleotide disclosed in a Table, except that one or more bases within the span are abasic (e.g., a nucleobase is absent from a nucleotide). In some embodiments, the base sequence of an HTT oligonucleotide comprises a continuous span of 19 or more bases of an HTT oligonucleotide disclosed herein, except that one or more bases within the span are abasic (e.g., a nucleobase is absent from a nucleotide). In some embodiments, the base sequence of an HTT oligonucleotide comprises a continuous span of 19 or more bases of an oligonucleotide disclosed herein, except for a difference in the 1 or 2 bases at the 5’ end and/or 3’ end of the base sequences.

[00191] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of TCTCCATTCT ATCTTATGTT, wherein each T may be independently replaced with U.

[00192] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of

GTTGATCTGTAGTAGCAGCT or GTTGATCTGTAGCAGCAGCT, wherein each T may be independently replaced with U.

[00193] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of GTGCACACAG TAGATGAGGG, wherein each T may be independently replaced with U.

[00194] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of GTGCAACACA GTAGATGAGGG, wherein each T may be independently replaced with U.

[00195] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of GGCACAAGGG CACAGACTTC, wherein each T may be independently replaced with U.

[00196] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of GGCACAAAGG GCACAGACTTC, wherein each T may be independently replaced with U.

[00197] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-20, e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous bases of CAAGGGCACA GACTTC, wherein each T may be independently replaced with U.

CLAIMS

1. An oligonucleotide, wherein:

(a) the oligonucleotide targets SNP rs362273, and the base sequence of the oligonucleotide comprises at least 15 contiguous bases, including the SNP position, of the base sequence GTTGATCTGTAGCAGCAGCT, wherein each T can be independently replaced with U;

(b) the oligonucleotide targets SNP rs362272, and the base sequence of the oligonucleotide comprises at least 15 contiguous bases, including the SNP position, of the base sequence ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC, wherein each T can be independently replaced with U;

(c) the oligonucleotide targets SNP rs362273, and the base sequence of the oligonucleotide comprises at least 15 contiguous bases, including the SNP position, of the base sequence AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT, wherein each T can be independently replaced with U;

(d) the oligonucleotide targets SNP rs362307, and the base sequence of the oligonucleotide comprises at least 15 contiguous bases, including the SNP position, of the base sequence GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, or GGCACAAGGGCACAGACTT, wherein each T can be independently replaced with U;

(e) the oligonucleotide targets SNP rs362331, and the base sequence of the oligonucleotide comprises at least 15 contiguous bases, including the SNP position, of the base sequence GTGCACACAGTAGATGAGGG, wherein each T can be independently replaced with U; or (f) the oligonucleotide targets SNP rs363099, and the base sequence of the oligonucleotide comprises at least 15 contiguous bases, including the SNP position, of the base sequence AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, wherein each T can be independently replaced with U; and wherein the oligonucleotide comprises one or more chiral internucleotidic linkages.

2. The oligonucleotide of claim 1, wherein the base sequence of the oligonucleotide comprises or is:

(a) GTTGATCTGTAGCAGCAGCT, wherein each T can be independently replaced with U;

(b) ACATAGAGGACGCCGTGCAG, AGAGGACGCCGTGCAGGGCT, ATAGAGGACGCCGTGCAGGG, CACATAGAGGACGCCGTGCA, CATAGAGGACGCCGTGCAGG, GCACATAGAGGACGCCGTGC, or TAGAGGACGCCGTGCAGGGC, wherein each T can be independently replaced with U;

(c) AGCTGCTGCTACAGATCAAC, AGCTGCTGCTGCAGATCAAC, GGTTGATCTGTAGCAGCAGCT, GTTGATCTGTAGCAGCAGCT, or TTGATCTGTAGCAGCAGCT, wherein each T can be independently replaced with U;

(d) GGCACAAGGGCACAGAC, GGCACAAGGGCACAGACT, or GGCACAAGGGCACAGACTT, wherein each T can be independently replaced with U;

(e) GTGCACACAGTAGATGAGGG, wherein each T can be independently replaced with U; or

(f) AAGGCTGAGCGGAGAAACCC, AGGCTGAGCGGAGAAACCCT, CAAGGCTGAGCGGAGAAACC, CTGAGCGGAGAAACCCTCCA, GCTGAGCGGAGAAACCCTCC, GGCTGAGCGGAGAAACCCTC, or TGAGCGGAGAAACCCTCCAA, wherein each T can be independently replaced with U.

3. The oligonucleotide of claim 1 or 2, wherein each internucleotidic linkage of the oligonucleotide is independently a natural phosphate linkage, a phosphorothioate linkage, or a

linkage.

4. The oligonucleotide of claim 1 or 2, wherein the oligonucleotide comprises one or more natural phosphate linkages, one or more Sp phosphorothioate linkages, and one or more Rp n001 linkages.

5. The oligonucleotide of any one of claims 1-4, wherein the oligonucleotide comprises or consists of: a 5’-wing and a 3’-wing, each of which independently comprises one or more modified sugars, and a core between the 5’-wing and the 3’-wing.

6. The oligonucleotide of claim 5, wherein the oligonucleotide comprises a 5’-wing

comprising 5 consecutive 2’-OMe modified sugars and a 3’-wing comprising 5 consecutive 2’-OMe modified sugars.

7. The oligonucleotide of any one of claims 5-6, wherein the core comprises one or more unmodified natural DNA sugars.

8. An oligonucleotide, wherein the oligonucleotide is WV-21404, WV-21405, WV-21406, WV-21412, WV-12282, WV-12283, WV-12284, WV-19840, WV-21178, WV-21179, WV-21180, WV-21181, WV-21403, WV-21409, WV-21410, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, or WV-28168.

9. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is in the form of a pharmaceutically acceptable salt.

10. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is in a sodium salt form.

11. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is at least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% diastereomerically pure.

12. A chirally controlled oligonucleotide composition of an oligonucleotide of any one of claims 1-10.

13. The composition of claim 11, wherein at least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the oligonucleotides in the composition, or the oligonucleotides in the composition that share the same base sequence as the oligonucleotide, are each independently an oligonucleotide of any one of claims 1-10.

14. A pharmaceutical composition comprising a therapeutically effective amount of an oligonucleotide and a pharmaceutically acceptable inactive ingredient, wherein the oligonucleotide is an oligonucleotide of any one of claims 1-11.

15. The composition of claim 14, wherein at least about 10%, 20%, 30%, 40%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% of the oligonucleotides in the composition, or the oligonucleotides in the composition that share the same base sequence as the oligonucleotide, are each independently an oligonucleotide of any one of claims 1-10.

16. The composition of any one of claims 12-15, wherein the oligonucleotide is in the form of a pharmaceutically acceptable salt.

17. The composition of any one of claims 12-15, wherein the oligonucleotide is in a sodium salt form.

18. A composition comprising an oligonucleotide selected from WV-21404, WV-21405, WV-21406, WV-21412, WV-10786, WV-10787, WV-10790, WV-10791, WV-10806, WV-10810, WV-10811, WV-12282, WV-12283, WV-12284, WV-14914, WV-15078, WV-15080, WV-17782, WV-19824, WV-19825, WV-19840, WV-19841, WV-21178, WV-21179, WV-21180, WV-21181, WV-21267, WV-21271, WV-21274, WV-21403, WV-21409, WV-21410, WV-21447, WV-21448, WV-23689, WV-23690, WV-23691, WV-23692, WV-28152, WV-28153, WV-28154, WV-28155, WV-28156, WV-28157, WV-28158, WV-28159, WV-28160, WV-28161, WV-28162, WV-28163, WV-28164, WV-28165, WV-28166, WV-28167, WV-28168, and WV-9679.

19. The composition of claim 18, wherein the oligonucleotide is in the form of a pharmaceutically acceptable salt.

20. A method of treating, preventing, delaying onset of, and/or decreasing the severity of at least one symptom of Huntington’s Disease, wherein the method comprises administering to a subject suffering therefrom or susceptible thereto an effective amount of an oligonucleotide or composition of any one of the preceding claims.

21. The method of claim 20, wherein the subject has a HTT allele that comprises an expanded CAG repeat region and is fully complementary to the base sequence of the oligonucleotide.

22. An oligonucleotide, composition or method described in the present application.

Documents

Application Documents

# Name Date
1 202117039001-STATEMENT OF UNDERTAKING (FORM 3) [27-08-2021(online)].pdf 2021-08-27
2 202117039001-SEQUENCE LISTING(PDF) [27-08-2021(online)].pdf 2021-08-27
3 202117039001-SEQUENCE LISTING [27-08-2021(online)].txt 2021-08-27
4 202117039001-POWER OF AUTHORITY [27-08-2021(online)].pdf 2021-08-27
5 202117039001-NOTIFICATION OF INT. APPLN. NO. & FILING DATE (PCT-RO-105) [27-08-2021(online)].pdf 2021-08-27
6 202117039001-FORM 1 [27-08-2021(online)].pdf 2021-08-27
7 202117039001-DRAWINGS [27-08-2021(online)].pdf 2021-08-27
8 202117039001-DECLARATION OF INVENTORSHIP (FORM 5) [27-08-2021(online)].pdf 2021-08-27
9 202117039001-COMPLETE SPECIFICATION [27-08-2021(online)].pdf 2021-08-27
10 202117039001-FORM-26 [03-09-2021(online)].pdf 2021-09-03
11 202117039001-Proof of Right [12-10-2021(online)].pdf 2021-10-12
12 202117039001.pdf 2021-10-19
13 202117039001-FORM 3 [07-02-2022(online)].pdf 2022-02-07
14 202117039001-Proof of Right [18-02-2022(online)].pdf 2022-02-18
15 202117039001-FORM 3 [04-08-2022(online)].pdf 2022-08-04
16 202117039001-FORM 18 [27-01-2023(online)].pdf 2023-01-27
17 202117039001-FORM 3 [14-07-2023(online)].pdf 2023-07-14
18 202117039001-FORM 3 [02-01-2024(online)].pdf 2024-01-02