Sign In to Follow Application
View All Documents & Correspondence

Oligonucleotides For Detection And Serotyping Of Foot And Mouth Disease Virus

Abstract: The present invention relates to detection and serotyping of foot and mouth disease virus (FMDV) using a novel set of oligonucleotides as diagnostic tools. The oligonucleotides of the present invention have nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18. The present invention provides a kit for the detection of the FMDV and serotyping of FMDV. The present invention also provides a method of detecting and serotyping FMDV in a sample using the novel oligonucleotides.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
15 March 2012
Publication Number
38/2013
Publication Type
INA
Invention Field
MICRO BIOLOGY
Status
Email
Parent Application
Patent Number
Legal Status
Grant Date
2019-09-13
Renewal Date

Applicants

INDIAN IMMUNOLOGICALS LIMITED
RAKSHAPURAM, GACHIBOWLI, HYDERABAD 500 032

Inventors

1. MUTHUKRISHNAN, MADHANMOHAN
INDIAN IMMUNOLOGICALS LIMITED, RAKSHAPURAM, GACHIBOWLI, HYDERABAD 500 032
2. SINGANALLUR BALASUBRAMANIAN, NAGENDRAKUMAR
INDIAN IMMUNOLOGICALS LIMITED, RAKSHAPURAM, GACHIBOWLI, HYDERABAD 500 032
3. CHANDRAN, DEV
INDIAN IMMUNOLOGICALS LIMITED, RAKSHAPURAM, GACHIBOWLI, HYDERABAD 500 032
4. VILLUPPANOOR ALWAR, SRINIVASAN
INDIAN IMMUNOLOGICALS LIMITED, RAKSHAPURAM, GACHIBOWLI, HYDERABAD 500 032

Claims

1. A set of oligonucleotides for detection and serotyping of FMDV in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14.

2. The set of oligonucleotides as claimed in claim 1, wherein the set of oligonucleotides further comprises SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18.

3. The set of oligonucleotides as claimed in claim 1, wherein the FMDV serotype is selected from a group consisting of A, O, C, Asia 1, South African Territories (SAT) 1, SAT 2, SAT 3 and combination thereof.

4. A kit for detection and serotyping of FMDV, wherein said kit comprises the set of oligonucleotides as claimed in claim 1, dNTP mixture, reaction buffer, and polymerase enzyme.

5. A process for detection and serotyping of FMDV in a sample, wherein the process comprises a) subjecting the sample to a nucleic acid amplification reaction at a temperature ranging from 60°C to 65°C for a time ranging from 30 minutes to 60 minutes followed by inactivation at a temperature ranging from 80°C to 95°C for a time ranging from 2 to 5 minutes using a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, and b) detecting the presence or absence of amplified product by real time-monitoring or end-point visualization.

6. A process for detection and serotyping of FMDV in a sample, wherein the process comprises a) subjecting the sample to a nucleic acid amplification reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, and b) detecting the presence or absence of amplified product by post amplification analysis.

Specification

FIELD OF INVENTION

The present invention relates to the field of viral diagnostics, in particular, the detection and serotyping of Foot-and-Mouth Disease virus (FMDV) in a sample using the set of oligonucleotides as disclosed in the present invention and nucleic acid amplification techniques. The present invention also provides a process for detection and serotyping of the FMDV in samples.

BACKGROUND OF THE INVENTION
Foot-and-Mouth disease (FMD) is a highly contagious and economically devastating viral disease of cloven hoofed animals. The causative agent is Foot and Mouth disease virus (FMDV), a member of the genus Aphthovirus, family Picornaviridae (Belsham, G. J. 1993. Distinctive features of foot-and-mouth disease virus, a member of the Picornavirus family; aspects of virus protein synthesis, protein processing and structure. Prog. Biophysics and Mol Biol. 60, 241-260.) Infection with FMDV is a significant constraint to international trade in animals and animal by-products (Kitching, R. P., Hutber, A.M., Thrusfield, M.V., 2005. A review of foot-and-mouth disease with special consideration for the clinical and epidemiological factors relevant to predictive modeling of the disease. Vet. J. 169, 197-209). The disease is endemic in India with FMD outbreaks recorded throughout the year. Of the seven FMDV serotypes, O, A, C, SAT1, SAT2, SAT3 and Asia 1, only the serotypes FMDV Type O, A and Asia 1 are prevalent in India.

The FMDV genome is a single-stranded, positive-sense RNA of approximately 8 kb linked at its 5' end to a viral coded protein, VPg, and polyadenylated at the 3' terminus. Translation of the single open reading frame produces a polyprotein that is processed proteolytically to the mature viral proteins. The primary cleavage products are L, Pl-2A, P2 and P3. The PI-2A precursor yields the structural proteins. PI is the capsid protein precursor of the FMDV. FMDV has an icosahedral symmetry with a viral capsid that is non-enveloped and composed of 60 copies of each of the four structural proteins, VP1, VP2, VP3 and VP4 (Sobrino F, Saiz M, Jimenez-Clavero MA, Nunez JI, Rosas MF, Baranowski E, Ley V. Foot-and-mouth disease virus: a long known virus, but a current threat. Vet Res. 2001 Jan-Feb; 32(1): 1-30.). Three of these proteins, VP1, VP2 and VP3, contribute to the formation of five known antigenic sites of type 01 FMDV (Kitson JD, McCahon D, Belsham GJ. Sequence analysis of monoclonal antibody resistant mutants of type O foot and mouth disease virus: evidence for the involvement of the three surface exposed capsid proteins in four antigenic sites. Virology. 1990 Nov; 179(l):26-34).

FMDV affect a huge range of species with a high rate of infectivity making FMD one of the most feared diseases. Laboratory diagnosis of the FMDV usually employ techniques of virus isolation in cell culture, detection of FMDV peptides, detection of FMDV generated antibodies and detection of FMDV genetic material like ELISA (Reid, S., Ferris, N.P., Hutchings, G.H., Zhang, Z., Belsham, G.J., Alexandersen, S., 2001. Diagnosis of foot-and-Mouth disease by real-time fluorogenic PCR assay. Vet. Rec. 149, 621-623), polymerase chain reaction (PCR) assays, reverse transcriptase PCR (Reid, S.M., Hutchings, G.H., Ferris, N.P., Clercq, K.D., 1999. Diagnosis of foot-and-mouth disease by RT-PCR: evaluation of primers for serotypic characterisation of viral RNA in clinical samples. J. Virol. Methods 83, 113-123.), and real-time RT-PCR assays. The recent development of portable equipment for PCR has made molecular diagnosis of FMD possible directly in the field and animal pens (Callahan JD, Brown F, Osorio FA, Sur JH, Kramer E, Long GW, Lubroth J, Ellis SJ, Shoulars KS, Gaffney KL, Rock DL, Nelson WM. Use of a portable real-time reverse transcriptase-polymerase chain reaction assay for rapid detection of foot-and-mouth disease virus. J Am Vet Med Assoc. 2002; 220(11): 1636-42). However, this approach relies on precision thermocycling, fragile instrumentation, is prohibitively expensive, and requires decontamination when transferred from one site to another.

In laboratories in India, routine typing methods often do not result in identification of virus serotype from all the field samples and nearly 50% of the samples tested are declared as 'no virus detected' (NVD) or 'no genome detected'.^Submission of scanty samples, poor storage conditions, time lapse between collection and despatch and transportation in ambient temperatures are the basic causes for declaring the samples as NVD or no genome detected. This leads to difficulties in confirmation of outbreaks and in reporting the prevalence of FMDV serotypes. Currently, the serotyping of FMDV is done by enzyme linked Immunomodulatory assays (ELISA) and conventional real-time polymerase chain reaction (RT-PCR) assays. These techniques usually take 3-4 hours and are performed solely under laboratory conditions.

US6048538 describes the use of novel peptides from the non-structural proteins of the FMDV and their use in the detection in animal body fluids of antibodies to FMDV. The detection method includes an enzyme linked immunosorbent assay (ELISA) and other wellrknown immunoassay formats.
US7790876 describes the methods and materials for the detection of FMDV. The methods may employ PCR amplification with appropriate primer pairs. The reagents to perform this method are supplied as a kit
and/or in tablet form.

US7794938 describes the use of PCR-based, multiplexed Luminex assays for the detection of seven agricultural pathogens including FMDV. The invention also describes the primers and probe sets for use in assay.

US20080280296 describes the use of a chromatographic strip test wherein the nucleic acid sequence of the non-structural proteins of the FMDV is set on a test strip and the nucleic acid sequence is amplified by reverse transcriptase PCR method.

US20110014639 describes a hybridoma cell line producing monoclonal antibody against FMDV, the monoclonal antibody therefrom, reagent and kit for ELISA, and immunoassay method.

Novel nucleic acid amplification techniques like isothermal amplification have been developed which prove to be superior to that of conventional PCR techniques since (i) expensive thermocyclers are not required as reactions can be performed at a constant temperature ranging from 60°C to 65°C (ii) the amplification specificity is extremely high because two or more primers recognize two or more distinct regions on the target DNA (iii) detection limit is equal to or higher than that of conventional PCR with shorter time for detection (iv) the reaction can be accelerated by using specially designed primers and (v) visualization of amplified end products may be done by the naked eye with an option for real-time monitoring of the amplification. Isothermal amplification may also accommodate RNA amplification by simply adding a reverse transcriptase to the reaction solution.

Although numerous diagnostic techniques have evolved for the detection of FMDV, there is a dire need for high fidelity diagnostic tests that are reliable, highly specific and sensitive, rapid and easy to use for the detection of FMDV and identification of its serotypes. Diagnostic tools which can be easily used for the serotyping of FMDV in a single reaction in fields or pens are highly desirable.

SUMMARY OF THE INVENTION
A set of oligonucleotides for detection and serotyping of FMDV in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14.

Another aspect of the present invention provides a kit for detection and serotyping of FMDV, wherein the kit comprises a set of oligonucleotides having sequences as set forth in SEQ ID NO: 1-18, dNTP mixture, reaction buffer, and polymerase enzyme.

Another aspect of the present invention provides a kit for detection and serotyping of FMDV, wherein the kit comprises a set of oligonucleotides having sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, dNTP mixture, reaction buffer, and polymerase enzyme.

Further aspect of the present invention provides a process for detection and serotyping of FMDV in a sample, wherein the process comprises subjecting the sample to a nucleic acid amplification reaction at a temperature ranging from 60°C to 65°C for a time ranging from 30 minutes to 60 minutes followed by inactivation at a temperature ranging from 80°C to 95°C for a time ranging from 5 minutes to 2 minutes, using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, and detecting the presence or absence of amplified product by real time-monitoring or end-point visualization.

Another aspect of the present invention provides a process for detection and serotyping of FMDV in a sample, wherein the sample is subjected to a nucleic acid amplification reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, and detecting the presence or absence of amplified product by post amplification analysis.

BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS

Figure 1 shows the genome of the Foot and Mouth Disease Virus (FMDV).

Figure 2 shows the Fluorescent dye-mediated (Calcein) monitoring/detection of FMDV serotype-specific RT-LAMP assay amplification. A: Visualization by inspection under normal light. The original orange colour of the calcein changed to yellow in the case of positive amplification (Tube 8), and remained the original orange colour for a negative control with no amplification (Tube 6 and 7). B: Visual observation of green fluorescence of calcein under UV light shows bright fluorescence in a positive reaction (Tube 8).

Figure 3A shows the isothermal amplification turbidity (RT-LAMP assay) of FMDV serotypes wherein the viral RNA template of FMDV isolates were from strains TNN 24/84 (Type O), HAH 14/00 (Type A) and WBN 117/85 (Type Asia 1).

Figure 3B shows the detection of FMDV by RT-LAMP assay in FMD-infected and healthy samples.

Figure 4 shows the specificity of primers having SEQ ID NO: 1-18 in a serotype-specific RT-LAMP assay. Lane M: lOObp DNA ladder, Lane 1: O TNN 24/84, Lane 2: A HAH 14/00, Lane 3: Asia 1 WBN 117/85, Lane 4: negative control.

A: FMDV Type O specific RT-LAMP assay; B: FMDV Type A specific RT-LAMP assay; C: FMDV Type Asia 1 specific RT-LAMP assay.

D: shows the electrophoresis and restriction analysis of FMDV serotype-specific RT-LAMP assay products on a 2% agarose gel. Lane M: 100-bp DNA ladder, Lane 1: Type RT-LAMP assay amplified product, Lane2: Alul digested Type O RT-LAMP assay amplified product (154 bp), Lane 3: Type O RT-LAMP assay negative product, Lane 4:

type A RT-LAMP assay amplified product, Lane 5: BstEII digested Type A RT-LAMP assay amplified product (128 bp), Lane 6: Type A RT-LAMP assay negative product, Lane 7: Type Asia 1 RT-LAMP assay amplified product, Lane 8: Alul digested Type Asia 1 RT-LAMP amplified assay product (169 bp), Lane 9: Type Asia 1

RT-LAMP assay negative product.
Figure 5 shows the sensitivity of the serotype-specific RT-LAMP assay for detection of FMDV Type O. TNN 24/84 virus was serially diluted starting from 102 to 10"6 TCID50. Lane M Marker, Lane 1: log2, Lane 2: log1, Lane 3: log0, Lane 4: log"1; Lane 5: log"2, Lane 6: log"3; Lane 7: log"4, Lane 8: log"5, Lane 9: log"6, Lane 10: log"7, Lane 11: log"8, Lane 12: log"9, Lane 13: log"10

Figure 6 shows the sensitivity of the serotype-specific RT-LAMP assay for detection of FMDV Type A. HAH 14/00 virus were serially diluted starting from 104 to 10"7 TCID50. Lane M Marker, Lane 1: log4, Lane 2: log3, Lane 3: log2, Lane 4: log1, Lane 5: log0, Lane 6: log"1; Lane 7: log"2, Lane 8: log"3; Lane 9: log"4, Lane 10: log"5, Lane 11: log"6, Lane 12: log"7, Lane 13: log"8, Lane 14: log"9.

Figure 7 shows the sensitivity of the serotype-specific RT-LAMP assay for detection of FMDV Type Asial. WBN 117/85 virus was serially diluted starting from 102 to 10"5 TCID50. Lane M Marker, Lane 1: log2, Lane 2: log1, Lane 3: log0, Lane 4: log"'; Lane 5: log"2, Lane 6: log"3; Lane 7: log"4, Lane 8: log"5, Lane 9: log"6, Lane 10: log"7, Lane 11: log"8, Lane 12: log"9, Lane 13: log"10
Figure 8A shows the detection and serotyping of BHK-21 adapted FMDV using RT-PCR, RT-LAMP and qRT-PCR assays.

Figure 8B shows the detection and serotyping of FMDV in clinical material using RT-PCR, RT-LAMP and qRT-PCR assays.

DETAILED DESCRIPTION OF THE INVENTION

Those skilled in the art will be aware that the invention described herein is subject to variations and modifications other than those specifically described. It is to be understood that the invention described herein includes all such variations and modifications. The invention also includes all such steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any two or more of said steps or features.

Definitions

For convenience, before further description of the present invention, certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.

The articles "a", "an" and "the" are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.

The terms "comprise" and "comprising" are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as "consists of only."

The terms "polynucleotide", "nucleotide", "DNA", "gene" and "nucleic acid" are used interchangeably.
The term "Oligonucleotide" refers to a short sequence of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA).

The terms "primer" and "oligonucleotide" used herein are used interchangeably.

In the present invention, the "target nucleic acid sequence" embraces not only a nucleic acid sequence to be amplified but also a sequence complementary thereto.

The term "cloven-hoofed" animal refers to domestic and wild animals, for example, but by no means limited to cattle, buffalo, sheep, goats, deer, and pigs.

The term 'test sample' or 'sample' refers to material obtained from a biological source, environmental source or a processed sample. The processed sample may include extraction of genetic material from the sample. The terms 'test sample' or 'sample' are used interchangeably.

The present invention provides oligonucleotides having nucleotide sequence as set forth in SEQ ID NO: 1 to SEQ ID NO: 18. The oligonucleotides as set forth in SEQ ID NO: 1 to SEQ ID NO: 18 of the present invention are useful in the detection and serotyping of FMDV in a sample. The oligonucleotides of the present invention can be used for the simultaneous detection and serotyping of FMDV in a single reaction mixture or in a one-step approach. Multiple FMDV serotypes can be identified in a single reaction and the oligonucleotides may also be used for the identification of FMDV in mixed infections. The FMDV serotypes identified by the oligonucleotides of the present invention relate to FMDV Type O, Type A and Type Asia 1.

The primers or oligonucleotides were designed from the PI region of FMDV genome for each serotype (Figure 1). The FMDV consists of structural (PI) and non structural protein (NSP). The L pro, IRES and NSP are more conserved region among all 7 FMDV serotypes. PI region is highly variable among 7 serotypes of FMDV and therefore is a valuable tool chosen by the present inventors for detection and serotyping of FMDV. The nucleotide sequence as set forth in SEQ ID NO: 19 to 21 shows three different PI region sequences representing Foot and mouth disease virus serotypes O, A and Asia 1.

The present inventors found unexpected and surprising results when the primers having nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, designed based on the PI region of the FMDV were used for the detection and serotyping of the FMDV. It was found that these primers or oligonucleotides are highly sensitive and serotype-specific. The primers show detection and serotyping sensitivity of virus titers of 10~3 to 10"5 TCID50 (Figures 5, 6 and 7). Further, the primers do not show any cross reactivity with other closely related family members of FMDV like Blue tongue virus (BTV), Peste Des Petits Ruminants virus (PPRV), Rabies virus (RV), Hepatitis A virus (Hep A), Chikungunya virus (CHIKV) and Japanese encephalitis virus (JEV). Details are provided in Example 3, Tables 6, 7 and 8. These high fidelity oligonucleotides or primers are useful for serotyping the FMDV rapidly and reliably in the field or point-of-care sites and in laboratory conditions. These primers are useful as rapid diagnostic tools for detection and serotyping FMDV in a sample in a single reaction. The oligonucleotides of the present invention also useful for detection and serotyping of FMDV in mixed infections.

One embodiment of the present invention provides a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 6 specific for detection and serotyping FMDV Type O.

Another embodiment of the present invention provides a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 7 to SEQ ID NO: 12 specific for detection and serotyping FMDV Type A.

Another embodiment of the present invention provides a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 13 to SEQ ID NO: 18 specific for detection and serotyping FMDV Type Asia 1.

The oligonucleotides of the present invention are used for the detection and serotyping of FMDV in samples from environmental, food or biological sources like blood plasma, peripheral blood monocytes, nasal secretions, saliva, milk, body fluids, vaginal secretions, oropharyngeal fluids, probang samples, tongue epithelium, foot epithelium and heart tissue. The samples may also constitute processed samples like those obtained 24 hour post infection, 40 hour post infection, post clarification, 24 hour post inactivation or 48 hours post inactivation.

The present invention provides a simple, rapid, cost-effective, one-step, quantitative process for the detection and serotyping of FMDV in a sample over the conventional methods prevalent in the art.
The oligonucleotides having sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18 are used in the nucleic acid amplification reaction for the detection and serotyping of FMDV, wherein the amplification reactions may be polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), real-time polymerase chain reaction, isothermal amplification and Loop-mediated Isothermal Amplification (LAMP).

In an advantageous embodiment, the isothermal amplification reaction as disclosed in the present invention comprises the real-time reverse transcriptase loop mediated amplification (RT-LAMP) assay. The time for detection and serotyping of FMDV is substantially reduced by the RT-LAMP assay compared to the RT-PCR and qRT-PCR assay methods. The time taken in an RT-LAMP assay ranges from 30-60 minutes while in the RT-PCR and qRT-PCR assay methods, the assay time ranges between 3-4 hours. The RT-LAMP assay developed in this invention allows rapid and accurate serotyping of FMDV. Due to its simple operation without the need for sophisticated equipments, this invention will be a valuable tool for the rapid detection and serotyping of FMDV at the point-of-care site like fields and pens.

The process of detection and serotyping of FMDV in a sample as disclosed in the present invention comprises performing an isothermal amplification reaction of the sample using the oligonucleotides as set forth in SEQ ID NO: 1 and SEQ ID NO: 18 sample and visualizing the results of amplification, wherein the presence or absence of FMDV and its serotypes is confirmed by electrophoresis, spectrophotometry, UV light or by visual observation.

The results of the isothermal amplification reaction may be visualized by naked eye or by a spectrophotometer. Naked eye detections are carried out by determining the turbidity changes or observing the colour changes in the reaction mixture after the completion of the amplification reaction. Spectrophotometric measurements include measuring the turbidity of the reaction mixture at 400 nm in a Turbidimeter or by monitoring the green fluorescence under ultraviolet light (Figure 2).

The specificity of the primer sets as disclosed in the present invention was confirmed by using viral RNA template from FMDV strains TNN 24/84, HAH 14/00 and WBN 117/85 and monitoring the time of positivity for each serotype (Figure 3A). The primer sets as set forth in SEQ ID NO: 1 to SEQ ID NO: 6 successfully amplified the 231 bp target sequence of type O (target genome position 66-297 of SEQ ID NO: 19), primer sets as set forth in SEQ ID NO: 7 to SEQ ID NO: 12 successfully amplified the 208 bp target sequence of type A (target genome position 1728-1936 of SEQ ID NO: 20), and primer sets as set forth in SEQ ID NO: 13 to SEQ ID NO: 18 successfully amplified the 186 bp target sequence of type Asia 1 (target genome position 287-483 of SEQ ID NO: 21) (Figure 4A,4B and 4C).

The oligonucleotides of the present invention can also be used for a pan-FMDV assay for the detection of all the FMDV types in the assay. Oligonucleotides having SEQ ID NO: 1 and 2 for the detection of FMDV Type O, oligonucleotides having SEQ ID NO: 7 and 8 for the detection of FMDV Type A and oligonucleotides having SEQ ID NO: 13 and 14 for the detection of FMDV Type Asial can be used simultaneously in a single reaction tube for a pan-FMDV detection assay.

The present invention provides a kit for detection and serotyping of Foot and Mouth Disease Virus (FMDV) serotype O, A and/or Asia 1 in a sample, wherein the kit comprises the set of oligonucleotides as set forth in SEQ ID NO: 1 to SEQ ID NO: 18 A kit comprising these oligonucleotides may also be used for the detection and characterization of the FMDV in the field or laboratory conditions.

One embodiment of the present invention provides a set of oligonucleotides for detection and serotyping FMDV in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14.
Another embodiment of the present invention provides a set of oligonucleotides for detection and serotyping FMDV in a sample having the nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, wherein the set of oligonucleotides further comprises SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID
NO: 18.

Another embodiment of the present invention provides a set of oligonucleotides for detection and serotyping FMDV in a sample having the nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, wherein the FMDV serotype is selected from a group consisting of Type A, Type O, Type C, Type Asia 1, Type South African Territories (SAT) 1, Type SAT 2, Type SAT 3 and a combination thereof.

Another embodiment of the present invention provides a set of oligonucleotides for detection and serotyping FMDV in a sample having the nucleotide sequence as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, wherein the SEQ ID NO: 1 to SEQ ID NO: 6 detects and serotypes FMDV Type O.

Another embodiment of the present invention provides a set of oligonucleotides for detection and serotyping FMDV in a sample having the nucleotide sequence as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, wherein the SEQ ID NO: 7 to SEQ ID NO: 12 detects and serotypes FMDV Type A.
Another embodiment of the present invention provides a set of oligonucleotides for detection and serotyping FMDV in a sample having the nucleotide sequence as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, wherein the SEQ ID NO: 13 to SEQ ID NO: 18 detects and serotypes FMDV Type Asia 1.

An embodiment of the present invention provides a kit for detection and serotyping FMDV, wherein said kit comprises the set of oligonucleotides for detection and serotyping FMDV in a sample having the nucleotide sequence as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, reaction buffer, dNTP mixture and polymerase enzyme.

An embodiment of the present invention provides a process for detection and serotyping FMDV in a sample, wherein the process comprises a) subjecting the sample to a nucleic acid amplification reaction using the set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, and b) detecting the presence or absence of amplified product.

Another embodiment of the present invention provides a process for detection and serotyping FMDV in a sample, wherein the process comprises a) subjecting the sample to a nucleic acid amplification reaction at a temperature ranging from 60°C to 65°C for a time ranging from 30 minutes to 60 minutes followed by inactivation at a temperature ranging from 80°C to 95°C for a time ranging from 2 to 5 minutes, using a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, and b) detecting the presence or absence of amplified product by real time-monitoring or end-point visualization.

Another embodiment of the present invention provides a process for detection and serotyping FMDV in a sample, wherein the process comprises a) subjecting the sample to a nucleic acid amplification reaction using the set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, and b) detecting the presence or absence of amplified product, wherein the nucleic acid amplification is selected from a group consisting of polymerase chain reaction (PCR), reverse transcriptase polymerase chain reaction (RT-PCR), real-time polymerase chain reaction, isothermal amplification and Loop-mediated Isothermal Amplification (LAMP).

Another embodiment of the present invention provides a process for detection and serotyping FMDV in a sample comprising a) subjecting the sample to a nucleic acid amplification reaction using a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, and b) detecting the presence or absence of amplified product, wherein the nucleic acid amplification is isothermal amplification by Loop-mediated Isothermal Amplification (LAMP) method.

An embodiment of the present invention provides a process for detection and serotyping of FMDV in a sample, wherein the process comprises a) subjecting the sample to a nucleic acid amplification reaction using a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, and b) detecting the presence or absence of amplified product by post amplification analysis.

EXAMPLES
The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure.

Example 1: Detection of FMDV and identification of FMDV serotypes in a sample Synthesis of the oligonucleotides designed to function as primers The primers were selected from PI region of FMDV genome of each serotype (Figure 1). To avoid primer dimmer formation, a set of five primer sets for each serotype was designed. Upon screening of the five primer sets, one primer set for each serotype in the PI region was found to be serotype specific. Primers having SEQ ID NO: 1-6 were serotype specific for FMDV Type O. Primers having SEQ ID NO: 7-12 were serotype specific for FMDV Type A. Primers having SEQ ID NO: 13-18 were serotype specific for FMDV Type Asial.

Preparation ofRNA sample
Total RNA was extracted from 460 ul of epithelial suspensions or from cell culture supernatants of a sample using RNeasy Mini-kit (a kit for RNA extraction, silica membrane type, QIAGEN Inc.) as per the manufacturer's instructions. The RNA from the samples may also be extracted using conventional methods. The isolated and purified RNA was prepared to a final concentration of O.lng/ml. This was used as sample in the detection and identification assays.

Isothermal amplification for detection and serotyping of FMDV
A reaction mixture of 25 ul volume comprising 5 pmol each of F3 and B3 primers (SEQ ID NO: 1 and SEQ ID NO: 2), 20 pmol each of LF and LB primers (SEQ ID NO: 5 and SEQ ID NO: 6), 40 pmol each of FIP and BIP primers (SEQ ID NO: 3 and SEQ ID NO: 4), 5 uJ of the sample RNA and the Loopamp RNA amplification kit (Eiken Chemical Co., Ltd. Tokyo, Japan, contains Buffer and Enzyme mix) was prepared for detection of FMDV Type O.

A reaction mixture of 25 uJ volume comprising 5 pmol each of F3 and B3 primers (SEQ ID NO: 7 and 8), 20 pmol each of LF and LB primers (SEQ ID NO: 11 and SEQ ID NO: 12), 40 pmol each of FIP and BIP primers (SEQ ID NO: 9 and SEQ ID NO: 10), 5 ul of the sample RNA and the Loopamp RNA amplification kit was prepared for detection of FMDV Type A.

A reaction mixture of 25 ul volume comprising 5 pmol each of F3 and B3 primers (SEQ ID NO: 13 and SEQ ID NO: 14), 20 pmol each of LF and LB primers (SEQ ID NO: 17 and SEQ ID NO: 18), 40 pmol each of FIP and BIP primers (SEQ ID NO: 15 and SEQ ID NO: 16), 5 ul of the sample RNA and the Loopamp RNA amplification kit was prepared for detection of FMDV Type Asia 1.

The analysis of each sample was performed in a set of three tubes, each of which had the primer mixture for a particular serotype, i.e FMDV Type A, FMDV Type O and FMDV Type Asia 1. The positive control was BHK-21 adapted FMDV and FMD infected tongue epithelium or foot epithelium samples. Negative control was tongue epithelium or foot epithelium of healthy animals. Positive and negative controls were included in each run and all precautions to prevent cross-contamination were observed.

Isothermal amplification assay of the reaction mixture was carried out in a LA-500 Loopamp Realtime Turbidimeter (Eiken Chemical Co Ltd, Japan). The run protocol for the real time Reverse transcription-Loop mediated isothermal amplification (RT-LAMP) assay was as follows:

Table 1: Run protocol for RT-LAMP assay

The isothermal amplification assay was initially optimized using viral RNA from FMDV strains TNN 24/84 (Type O), HAH 14/00 (Type A) and WBN 117/85 (Type Asia 1).

Time ofpositivitv (Tp) and visualization nf"result*
The real-time monitoring of the amplification of the sample template by the isothermal amplification assay was observed through spectrophotometric analysis by recording the optical density at 400 nm every 6 seconds with the help of the Loopamp Realtime Turbidimeter. The cut-off value for positivity by the real-time isothermal amplification assay was determined by taking into account positivity (Tp; in min), which was the time when the turbidity increases above the threshold value fixed at 0.1. This threshold value is two times more than the average turbidity of the negative controls of 20 replicates. There was no increase in the turbidity of positive samples after 55 minutes. Therefore, a sample with Tp value < 55min and turbidity threshold value of > 0.1 was considered as positive.

The times of positivity observed through real-time monitoring were 36.03 for FMDV Type O, 32.06 for FMDV Type A and 26.24 for FMDV Type Asia 1 (Figure 3).

Naked eye visualization of the amplification by RT-LAMP assay was carried out by inspecting the presence or absence of turbidity in the reaction tubes. Prior to visualization, reaction tubes were pulse centrifuged to deposit the magnesium pyrophosphate precipitate. Fluorescence detection of the reaction may also be done by the addition of lul of fluorescent detection reagent (FDR), calcein (Eiken Chemical Co., Ltd., Tokyo, Japan) to the initial reaction mixture. For a positive reaction, the orange colour of the FDR changes to yellow fluorescence that can be detected with the naked eye or to green fluorescence under UV irradiation. In a negative reaction, the orange colour of the unbound dye is retained as such. The colour change can be observed by the naked eye or with the aid of UV light at 302 nm, and the results are captured photographically (Figure 2).

Electrophoresis
Following incubation at 63°C for 60 min, 5 ul aliquot of the amplified products were electrophoresed on 2% molecular grade agarose gel (Invitrogen) prepared in lx Tris-borate-EDTA buffer and stained with 0.5 μ g/ml ethidium bromide. The amplified products were visualized using a transilluminator with UV light at 302 nm. The isothermal amplification assay successfully amplified the 231 bp target sequence of FMDV Type O (target genome position 66-297 of SEQ ID NO: 19), 208 bp target sequence of FMDV Type A (target genome position 1728-1936 of SEQ ID NO: 20) and 186 bp target sequence of FMDV Type Asia 1 (target genome position 287-483 of SEQ ID NO: 21) at 63°C in 60 min as revealed by agarose gel electrophoresis. The reaction products, observed as a ladder-like pattern on the gel, were due to the formation of stem-loop DNAs of varying stem length and cauliflower-like structure with multiple loops formed by sequentially inverted repeats of the target sequence (Figure 4A, 4B and 4C).

The specificity of the RT-LAMP assay amplified product was further validated by restriction digestion with Alu\ (New England Biolabs, USA) for serotype O and Asia 1, Bst E II (New England Biolabs, USA) for serotype A. Following overnight digestion at 37°C (Alu I) and 60°C (Bst E II), the digested products were analyzed 2% agarose gel electrophoresis as described above. In addition, the authenticities of the amplified products were also established by nucleotide sequencing of both digested and undigested products with two outer and two inner primers. Further cross-reaction studies within the three serotypes of FMDV were performed to ensure the specificity of each serotype-specific FMD RT-LAMP assay primer. This structure was confirmed by restriction analysis; products of predictable sizes comprising repeats of same 154 bp product for FMDV Type O, 128 bp product for FMDV Type A and 169 bp for FMDV Type Asia 1 were resolved on an agarose gel (Figure 4D).

Further confirmation of the structure of the amplified products was also carried out by sequencing. Reaction mixture containing 2 ul of template, 3uJ of 5x buffer, lul of primer (SEQ ID NO: 1 and SEQ ID NO:2 for FMDV Type O, SEQ ID NO: 7 and SEQ ID NO: 8 for FMDV Type A, and SEQ ID NO: 13 and SEQ ID NO: 14 for FMDV Type Asia 1) and reaction buffer containing dNTPs and ddNTPs finally made up to 20ul (AB1 Prism Dye termination Kit) is used for sequencing PCR. PCR amplification is done for 25 cycles using the following conditions 96°C for 10 sec, 55°C for 5 sec, 60°C for 4 min. The sequencing was done using ABI Prism sequencer with analyzer. It was observed that the sequence of the amplified products perfectly matched the target nucleotide sequence.

Example 2: Sensitivity of the oligonucleotides, SEQ ID NO: 1-18 in serotyping FMDV
Total RNA was isolated from each dilution. RT-LAMP, RT-PCR and qRT-PCR were performed. A reaction mixture of 25 (il volume comprising 5 pmol each of F3 and B3 primers, 20 pmol each of LF and LB primers, 40 pmol each of FIP and BIP primers, 5 uJ of the sample RNA and the Loopamp RNA amplification kit was prepared. Serial ten fold dilution of each virus serotype i.e. TNN 24/84 (103TCID50), HAH 40/00 (103TC1D50) and WBN 117/85 (103TCID50) were made.

For RT-PCR, a reaction mixture of 25 ul volume comprising 10 pmol each of 13 primers (SEQ ID NO: 22-34 as given in Table 2), 5x buffer 5 [i\, 5Q buffer 5 ul, DNT 0.5 ul, Enzyme mix 0.5 ul and RNase free water 4.5 μ l (One step RT-PCR kit, Qiagen, Germany) and 5 ul of the sample RNA was prepared for FMDV serotyping. The amplified products were visualized in 2% agarose gel. In a positive amplification 402 bp, 702 bp and 292 bp amplified products were obtained for FMDV Type O, Type A and Type Asia 1 respectively.

Table 2: RT-PCR for FMDV serotyping primer sequences
For qRT-PCR, the optimal volume of nucleic acid was 5 \il per reaction, which was added to 20ul of a qRT-PCR reaction mix containing 12.5 ul of 2X reaction mix, 0.5 ul of Superscript Hi/Platinum Taq enzyme mix (both supplied with the kit), 2 ul of each primer (10 pmol; Table 4), 1.5 ul of probe (5 pmol; Table 4) and 1.5 ul of nuclease-free water. Prior to amplification, the contents of each reaction were mixed by spinning the plate for 1 min at 300*g. The optimal thermal cycling conditions were: 60°C for 30 min, 95°C for 10 min followed by 50 cycles of 95°C for 15 s and 60°C for 1 min. The reaction was performed in an IQ®5 Multicolor Real-time PCR detection system (BioRad, USA). The results from all samples were analyzed using Bio-Rad IQ®5 optical system software and CT values were assigned to each reaction as described previously. Samples with a CT value of 35 or less were considered positive.



Detection limit of the RT-LAMP method using the specific primers (?>bg iu INU: l-18) for detection and identification of FMDV was done by serial dilution method. The results were compared with those of the one-step RT-PCR with serotype-specific primer pairs. The RT-LAMP assay demonstrated higher sensitivity than the conventional RT-PCR. The isothermal amplification assay was found to be 10 to 100000 fold (10000-Type O; 100000-Type A and 10-Type Asia 1) more sensitive than RT-PCR, with a detection of 10"3 to 10"5 TCID50 of virus (Figures 5, 6 and 7).

Table 5: Sensitivity of RT-LAMP assay for with serotype-specific primers

Example 3: Specificity of the oligonucleotides, SEQ ID NO: 1-18, in detection and serotyping of FMDV
Specificity of the oligonucleotides for the detection of FMDV

The specificity of primers having SEQ ID NO: 1-18 for the detection of FMDV was determined by checking the cross-reactivity of primers with other closely related family members of the FMDV.
Samples from Blue tongue virus (BTV), Peste Des Petites Ruminants virus (PPRV), Rabies virus (RV), Hepatitis A virus (Hep A), Chikungunya virus (CHIKV) and Japanese encephalitis virus (JEV) were assayed. RT-LAMP assay was carried out in a final reaction volume of 25 μ l using a Loopamp RNA amplification kit with 5 pmol (each) of the primers F3 and B3, 20 pmol (each) of the primers LF and LB, and 40 pmol (each) of the primers FIP and BIP. Five microliters of the extracted RNA was used as template per reaction. The analysis of each sample was performed in a set of three tubes, each of which had the primer mixture for a particular serotype. The run protocol was as given in Example 1.

The primer sets demonstrated a high degree of specificity for the detection of FMDV by amplifying FMDV Type O, Type A and Type Asia 1 but yielded negative results for all other viruses tested (Table 6, 7 and 8).

Table 6: Specificity of primer sets (SEQ ID NO: 1-6) for detection and serotyping of FMDV Type O in a RT-LAMP assay. (NVD- No virus detected; N- Negative)Kpprifirity of the oligonucleotides for the serotvvinx ofFMDV Cross-reaction studies within the three serotypes of FMDV were performed to ensure the specificity of the primers for each serotype. RNA templates from known standard FMDV serotypes were taken up for the study. The RNA template for serotype O was obtained from FMDV strain TNN 24/84 having a nucleotide sequence as shown in SEQ ID NO: 19. The RNA template for serotype A was obtained from FMDV strain HAH 14/00 having a nucleotide sequence as shown in SEQ ID NO: 20. The RNA template for serotype Asia 1 was obtained from FMDV strain WBN 117/85 having a nucleotide sequence as shown in SEQ ID NO: 21.

The reaction mixture containing the RNA templates from the known serotypes and primer sets other than that corresponding to the known serotype were subjected to isothermal amplification assay. There was no amplification observed in the reaction mixtures and all the three primer sets were highly specific for detection and identification of the three serotypes of FMDV: Type O, Type A and Type Asia 1 (Figure 4A-4C).

Example 4: Detection and Serotyping of FMDV field isolates and BHK-adapted FMDV isolates
Field samples were collected both from experimental infections in cattle and buffalo and or from outbreaks in the field. The samples were obtained in the form of tissue culture fluid (0=47; A=42 and Asia 1= 47) and clinical materials such as tongue epithelium/ foot epithelium (0=44; A=31 and Asia 1=10). RNA was extracted from the samples and each sample was subjected to a specific set of primers that detect the specific serotypes, O, A and Asial of FMDV.

Serotyping of FMDV in clinical samples and BHK-21 adapted FMDV was carried out using RT-LAMP assay, RT-PCR and qRT-PCR. BHK adapted virus isolates of titre value TCID50 5.0-6.0 was validated and the results were compared with RT-PCR and qRT-PCR assays.

Table 9: Comparative evaluation of RT-PCR, RT-LAMP and qRT-PCR assays for detection and serotyping of FMDV.

Among the BHK-adapted virus samples, RT-LAMP assay and qRT-PCR assay could detect 100% of FMDV Type O, 100% of FMDV Type A and 100% of FMDV Type Asia 1, whereas RT-PCR detected only 89.4% of FMDV Type O virus, 100% of FMDV Type A virus and 100% of FMDV Type Asia 1 virus in the samples. Similarly, in clinical samples, RT-LAMP assay and qRT-PCR assay could detect 100% of FMDV Type O, FMDV Type A and FMDV Type Asia 1, whereas RT-PCR detected only 70.5% of FMDV Type O, 58.1% of FMDV Type A and 40.0% of FMDV Type Asia 1 in the samples. The sensitivity of the oligonucleotides having SEQ ID NO: 1 to SEQ ID NO: 18 in the detection and identification of the FMDV serotypes were higher in the RT-LAMP assay and qRT-PCR than RT-PCR assay (Figure 8A and 8B).

Example 5: Detection of FMDV serotype by conventional PCR method

Reaction mixture of 25 ul volume comprising 5 ul of the sample RNA, 10 pmol each of primers having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, 5 ul of 5x buffer, 5 ul of 5Q buffer, 0.5 ul of dNTP, 0.5 ul of Enzyme mix and 4.5 ul of RNase free water (One step RT-PCR kit, Qiagen, Germany) was prepared. The reaction mixture was subjected to an optimal thermal cycling condition as given below in Table 10.

Post-amplification, the amplified products were visualized in 2% agarose gel. In a positive amplification, amplified products having a size of 231 bp, 208 bp and 186 bp were obtained for FMDV Type O, Type A and Type Asia 1, respectively.

SEQ ID NO: 1 shows the nucleotide sequence of F3 primer for the detection of FMDV type O
CATCCTCACCACCCGTAAC SEQ ID NO: 2 shows the nucleotide sequence of B3 primer for the detection of FMDV typeO GACACCTTTGTGGTCGGTC SEQ ID NO: 3 shows the nucleotide sequence of
FIP primer for the detection of FMDV type

GAAGTGTTCGGTCCGCTCACTTTTCCCAGTCAAGCGTTGGAG SEQ ID NO: 4 shows the nucleotide sequence of BIP primer for the detection of FMDV type O

CAGAGTTGTGCAGGCAGAACGGTTTTAACGTCCGAATGAGTCACTG
SEQ ID NO: 5 shows the nucleotide sequence of LF primer for the detection of FMDV type O

GGAGTCACATACGGGTACG
SEQ ID NO: 6 shows the nucleotide sequence of LB primer for the detection of FMDV type O

CACCTCTTCGACTGGGTC

SEQ ID NO: 7 shows the nucleotide sequence of F3 primer for the detection of FMDV type A

CTACACTGCGCCTAACCG

SEQ ID NO: 8 shows the nucleotide sequence of B3 primer for the detection of FMDV type A

TGGGGCAGTAGAGTTCGG

SEQ ID NO: 9 shows the nucleotide sequence of FIP primer for the detection of FMDV type A
TGCGACTGCCCCTAGGTCACTTTTTAACAGTGTACAACGGGACG SEQ ID NO: 10 shows the nucleotide sequence of BIP primer for the detection of FMDV type A
GCCCAACTTCCTGCCTCTTTCATTTTCTTCATGCGCACAAGAAGC SEQ ID NO: 11 shows the nucleotide sequence of LF primer for the detection of FMDV type A
CAAGTACTCCGCGGCCAGTG

SEQ ID NO: 12 shows the nucleotide sequence of LB primer for the detection of FMDV type A
GGTGCAATCAAGGCTGACG

SEQ ID NO: 13 shows the nucleotide sequence of F3 primer for the detection of FMDV type Asia 1 CCCCACTGAACACAAAGGC

SEQ ID NO: 14 shows the nucleotide sequence of B3 primer for the detection of FMDV type Asia 1
GTGGGGAAAGAGAGTCAGC

SEQ ID NO: 15 shows the nucleotide sequence of FIP primer for the detection of FMDV type Asia 1

AGTCACCTCTACGTCCCATCCATTTTGTGTACGGCAGTCTCATGG

SEQ ID NO: 16 shows the nucleotide sequence of BIP primer for the detection of FMDV type Asia 1
TTGGAAACCAATTCAACGGCGGTTTTGTCAAGGCTCTTCAGCTCTG

SEQ ID NO: 17 shows the nucleotide sequence of LF primer for the detection of FMDV type Asia 1
CTCGTACGCCTACATGAGGAA

SEQ ID NO: 18 shows the nucleotide sequence of LB primer for the detection of FMDV type Asia 1
GCCTCCTTGTCGCACTTGTG

SEQ ID NO: 19 shows the nucleotide sequence of the PI region of FMDV Type O
Strain TNN 24/84 (1980 nt).

AGCGGTCTTTTCGGCGCTCTTCTCGCCGACAAGAAGACAGAGGAGACCACT
CTCCTCGAAGACCGCATCCTCACCACCCGTAACGGCCACACCACGTCGACA
ACCCAGTCAAGCGTTGGAGTCACATACGGGTACGCAACAGCTGAAGATTTT
GTGAGCGGACCGAACACTTCCGGTCTCGAAACCAGAGTTGTGCAGGCAGA
ACGGTTTTTCAAAACCCACCTCTTCGACTGGGTCACCAGTGACTCATTCGGA
CGTTGCCACCTCCTGGAACTCCCGACCGACCACAAAGGTGTCTACGGCAGC
CTGACTGACTCGTATGCATATATGAGAAACGGCTGGGATGTCGAGGTCACC
GCGGTTGGCAACCAGTTCAACGGAGGGTGCCTTCTGGTCGCAATGGTACCA
GAGCTTTATTCTATCCAAAAGAGGGAACTGTACCAGCTCACACTTTTCCCTC
ACCAGTTCATCAACCCACGCACGAACATGACTGCGCACATCACAGTGCCCT
TTGTTGGCGTCAACCGCTACGACCAGTACAAGGTTCACAAGCCTTGGACCC
TTGTGGTTATGGTTGTAGCCCCTCTGACCGTCAACACTGAAGGTGCCCCTCA
GATCAAGGTGTATGCCAACATTGCCCCAACCAACGTGCACGTCGCGGGTGA
GTTTCCTTCCAAGGAGGGAATATTCCCCGTGGCCTGTAGCGACGGCTATGG
TGGCCTGGTGACCACGGACCCGAAGACGGCTGACCCCGTTTATGGGAAAGT
GTTCAACCCCCCCCGCAACCAGTTGCCGGGGCGTTTTACCAACCTCCTTGAT
GTGGCTGAGGCATGCCCGACGTTTCTGCGCTTCGAGGGTGGCGTACCGTAC
GTGACCACGAAAACGGACTCGGACAGGGTGCTTGCTCAGTTTGACATGTCT

TTGGCAGCAAAACAAATGTCGAACACTTTCCTGGCAGGTCTTGCCCAGTAC
TACACACAGTACAGCGGCACCATCAACCTGCACTTCATGTTCACAGGTCCC
ACCGACGCGAAGGCGCGTTACATGATTGCATATGCCCCTCCTGGCATGGAG
CCGCCTAAGACACCTGAGGCGGCTGCCCACTGCATACACGCTGAATGGGAC
ACAGGGTTGAACTCAAAATTCACATTTTCAATCCCGTACCTCTCGGCGGCTG
ACTACGCGTACACCGCGTCTGACACTGCCGAGACCACAAATGTACAGGGAT
GGGTTTGCTTGTTCCAAATAACACACGGGAAGGCTGACGGTGACGCACTGG
TCGTACTGGCTAGCGCCGGTAAGGACTTTGAGCTCCGCCTGCCTGTGGATG
CCCGCACGCAGACCACCTCTGCGGGCGAGTCAGCTGACCCCGTGACTGCCA
CCGTCGAGAACTACGGTGGAGAGACACAGGTCCAGAGGCGCCAACACACG
GACGTCTCGTTCATATTGGACAGGTTTGTGAAAGTGACACCGCAAGACCAA
ATTAATGTGTTGGACCTGATGCAAACCCCCGCTCACACACTCGTGGGAGCG
CTTCTCAGAACCGCCACTTACTACTTCGCCGACCTCGAAATTGCGGTAAAA
CACGAGGGAAACCTCACTTGGGGCCCGAACGGGGCGCCCGAAAAGGCGTT
GGACAACACCACCAACCCAACTGCTTACCACAAGGCACCACTCACCCGGCT
TGCACTGCCTTACACTGCGCCCCACCGTGTGTTGGCTACTGTTTACAACGGG
GCCAGTAGGTACGTACGAAACACGGTGGCCAATTTGAGAGGTGACCTTCAA
GTGTTGGCCCAGAAGGCGGCGAGAACACTGCCTACCTCCTTCAACTACGGT
GCCATCAAGGCCACTCGGGTGACTGAACTGCTTTACCGCATGAAGAGGGCT
GAAACATACTGCCCCCGGCCTCTTTTGGCCATCCACCCGAACGAGGCCAGA
CACAAACAGAAGATTGTGGCGCCTGCGAAACAACTCCTG

SEQ ID NO: 20 shows the nucleotide sequence of the PI region of FMDV Type A Strain HAH 14/00 (1988 nt) GTTTAGCAAACTGGCGAGCAGCGCGTTTAGCGGCCTGTTTGGCGCGCTGCT
GGCGGATAAAAAAACCGAAGAAACCACCCTGCTGGAAGATCGTATTCTGA
CCACCCGTAACGGCCATACCACCAGCACCACCCAGAGCAGCGTGGGCGTG
ACCTATGGCTATAGCACCGGCGAAGATCATGTGAGCGGCCCGAACACCAGC
GGCCTGGAAACCCGTGTGGTGCAGGCGGAACGTTTTTTTAAAAAACATCTG
TTTGATTGGACCACCGATAAAGCGTTTGGCCATCTGGAAAAACTGGAACTG
CCGACCGATCATAAAGGCGTGTATGGCCATCTGGTGGATAGCTTTGCGTAT
ATGCGTAACGGCTGGGATGTGGAAGTGAGCGCGGTGGGCAACCAGTTTAA

CGGCGGCTGCCTGCTGGTGGCGATGGTGCCGGAATGGAAAGAATTTACCAC
CCGTGAAAAATATCAGCTGACCCTGTTTCCGCATCAGTTTATTAACCCGCGT
ACCAACATGACCGCGCATATTACCGTGCCGTATCTGGGCGTGAACCGTTAT
GATCAGTATAAAAAACATAAACCGTGGACCCTGGTGGTGATGGTGGTGAGC
CCGCTGACCAACGCGGGCATTGGCGCGACCCAGATTAAAGTGTATGCGAAC
ATTGCGCCGACCTATGTGCATGTGGCGGGCGAACTGCCGAGCAAAGAAGG
CATTGTGCCGGTGGCGTGCGCGGATGGCTATGGCGGCCTGGTGACCACCGA
TCCGAAAACCGCGGATCCGGTGTATGGCATGGTGTATAACCCGCCGCGTAC
CAACTTTCCGGGCCGTTTTACCAACCTGCTGGATGTGGCGGAAGCGTGCCC
GACCTTTCTGTGCTTTGATAACGGCAAACCGTATGTGGAAACCCGTACCGA
TGAACAGCGTCTGCTGGCGAAATTTGATGTGAGCCTGGCGGCGAAACATAT
GAGCAACACCTATCTGAGCGGCATTGCGCAGTATTATGCGCAGTATAGCGG
CACCATTAACCTGCATTTTATGTTTACCGGCAGCACCGATAGCAAAGCGCG
TTATATGGTGGCGTATGTGCCGCCGGGCGTGGAAACCCCGCCGGATACCCC
GGAAAAAGCGGCGCATTGCATTCATGCGGAATGGGATACCGGCCTGAACA
GCAAATTTACCTTTAGCATTCCGTATGTGAGCGCGGCGGATTATGCGTATAC
CGCGAGCGATACCGCGGAAACCACCAACGTGCAGGGCTGGGTGTGCATTTA
TCAGATTACCCATGGCAAAGCGGAAAACGATACCCTGGTGGTGAGCGCGA
GCGCGGGCAAAGATTTTGAACTGCGTCTGCCGATTGATCCGCGTGCGCAGA
CCACTTCGGCGGGGGAGAGCGCTGAGCCCGTCACCACTACTGTTGAGGACT
ACGGCGGTGAGACACAAGTCCAGCGGCGTCACCACACTGACGTCAGCTTCA
TAATGGACAGATTTGTGAAGATTGGAACCACTAACCCCACACATGTCATTG
ACCTCATGCAAACCCACCACCACGGGCTGGTGGGTGCCCTGTTGCGTGCTG
CCACGTACTACTTCTCCGACTTGGAGATCGTGGTTCGTCACGCAGGCAACCT
GACATGGGCTCCCAATGGTGCTCCTGAGGCAGCCCTGTCCAACACAGGGAA
CCCTACCGCCTACAACAAGGCACCGTTCACGAGACTTGTGCTCCCCTACAC
TGCGCCTAACCGCTTGCTGGTAACAGTGTACAACGGGACGAACAAGTACTC
CGCGGCCAGTGGGCGCACACGGGGTGACCTAGGGGCAGTCGCAGCGCGAA
TCGCCGCCCAACTTCCTGCCTCTTTCAATTTTGGTGCAATCAAGGCTGACGC
CATCCACGAGCTTCTTGTGCGCATGAAGCGTGCCGAACTCTACTGCCCCAG
ACCACTGTTGGCGGTGGAGGTCTCGTCTCAAGACAGACACAAACAGAAGAT
CA

SEQ ID NO: 21 show the nucleotide sequence of the PI region of FMDV Type Asia 1 Strain WBN 117/85 (1990 nt).
CGCCTGGCTAGTTCTGCTTTCAGCGGACTGTTTGGCGCGCTTCTGGCTGACA
AGAAAACGGAAGAGACAACTTTGCTTGAAGACCGCATTCTCACCACCAGG
AACGGCCACACAACGTCGACGACACAGTCGAGCGTTGGCGTAACGTACGG
TTACGCTGTGGCTGAGGACGCGGTGTCAGGACCTAACACTTCAGGTCTTGA
GACCCGTGTTCAACAGGCAGAACGGTTCTTTAAAAAGCACTTGTTTGACTG
GACACCGAATTTGGCATTTGGACACTGTCACTACCTGGGACTCCCCACTGA
ACACAAAGGCGTGTACGGCAGTCTCATGGACTCGTACGCCTACATGAGGAA
TGGATGGGACGTAGAGGTGACTGCTGTTGGAAACCAATTCAACGGCGGTTG
CCTCCTTGTCGCACTTGTGCCAGAGCTGAAGAGCCTTGACACGCGGCAGAA
ATACCAGCTGACTCTCTTTCCCCACCAGTTCATCAACCCACGCACCAACATG
ACGGCCCACATTAACGTGCCGTTCGTGGGTGTCAACAGATACGACCAGTAC
GCGCTTCACAAACCGTGGACGCTCGTTGTGATGGTGGTGGCCCCACTCACC
GTCAAGACTGGTGGTTCTGAACAGATTAAGGTTTACATGAATGCAGCACCG
ACCTACGTGCACGTGGCGGGAGAGCTGCCCTCGAAAGAGGGAATAGTTCCC
GTTTCGTGCGCGGACGGTTATGGCAACATGGTGACAACGGACCCGAAGACT
GCCGACCCAGTTTACGGGAAAGTCTACAACCCCCCCAGGACAAACCTCCCT
GGGCGCTTCACAAACTTCCTTGACGTTGCGGAGGCATGTCCAACCTTCCTCC
GCTTCGGAGAAGTGCCATTTGTGAAGACGGTGAACTCTGGTGACCGCCTGC
TGGCCAAGTTCGATGTCTCGCTCGCTGCGGGGCACATGTCCAACACCTACTT
GGCTGGTCTGGCACAGTACTACACACAGTACAGTGGCACCATCAATGTCCA
CTTCATGTTCACCGGGCCCACAGACGCCAAAGCCCGCTACATGGTGGCCTA
CATCCCTCCCGGTATGACACCGCCCACAGACCCTGAGCGCGCCGCGCACTG
CATTCACTCTGAGTGGGACACTGGTCTTAACTCCAAGTTCACCTTTTCTATA
CCTTACCTCTCTGCTGCTGACTACGCCTACACTGCTTCTGACACGGCGGAGA
CCACAAGTGTGCAGGGATGGGTGTGCATCTACCAGATCACCCACGGCAAGG
CTGAAGGAGACGCACTGATCGTTTCTGTCAGCGCCGGCAAAGATTTTGAGT
TCCGCTTGCCCGTTGACGCGCGCCGGCAAACCACCACAACCGGCGAGTCAG
CGGACCCAGTGACAACCACGGTCGAGAACTACGGAGGAGAAACTCAGACG
GCCAGACGGCTTCACACTGACGTTGCCTTTGTTCTTGACAGGTTTGTGAAAC
TCACTACACCCAAGAGCACCCAGACCCTTGATTCATGCAGATCCCCTCACA

CACGTTGGTTGGAGCACTGCTTCGGTCTGCGACGTACTACTTCTCAGACCTA
GAGGTTGCGCTTGTCCACACAGGCCCGGTTACTGGGTGCCCAACGGCTCGC
CCAAGGATGCCCTAGACAACCAAACTAACCCAACTGCCTATCGGAAGCGGC
CCATCACCCGCTTGGCACTCCCCTACACCGCCCCCCACCGTGTGCTGGCAAC
AGTGTACAACGGGAAGACGACGTACGGGGAAACAACCTCACGGCGTGGTG
ATATGGCGGCCCTTGCACAAAGGCTGAGTGGGCGGCTGCCCACCTCCTTCA
ACTACGGCGCTGTAAAGGCTGAAACCATCACTGAGCTTTTGATCCGCATGA
AACGCGCGGAGACATACTGCCCCAGGCCTTTGCTAGCTCTTGACACTACTC
AGGACCGCCGTAAACAGGAGATCATTGCACCTGAGAAACAGGTACTG

I/We Claim:

1. A set of oligonucleotides for detection and serotyping of FMDV in a sample, wherein the nucleotide sequence of the oligonucleotides is as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14.

2. The set of oligonucleotides as claimed in claim 1, wherein the set of oligonucleotides further comprises SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18.

3. The set of oligonucleotides as claimed in claim 1, wherein the FMDV serotype is selected from a group consisting of A, O, C, Asia 1, South African Territories (SAT) 1, SAT 2, SAT 3 and combination thereof.

4. A kit for detection and serotyping of FMDV, wherein said kit comprises the set of oligonucleotides as claimed in claim 1, dNTP mixture, reaction buffer, and polymerase enzyme.

5. A process for detection and serotyping of FMDV in a sample, wherein the process comprises

a) subjecting the sample to a nucleic acid amplification reaction at a temperature ranging from 60°C to 65°C for a time ranging from 30 minutes to 60 minutes followed by inactivation at a temperature ranging from 80°C to 95°C for a time ranging from 2 to 5 minutes using a set of oligonucleotides having the nucleotide sequences as set forth in SEQ ID NO: 1 to SEQ ID NO: 18, and

b) detecting the presence or absence of amplified product by real time-monitoring or end-point visualization.

6. A process for detection and serotyping of FMDV in a sample, wherein the process
comprises

a) subjecting the sample to a nucleic acid amplification reaction using a set of oligonucleotides having nucleotide sequences as set forth in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13 and SEQ ID NO: 14, and b) detecting the presence or absence of amplified product by post amplification analysis.

Documents

Application Documents

# Name Date
1 963-CHE-2012 POWER OF ATTORNEY 15-03-2012.pdf 2012-03-15
2 963-CHE-2012 FORM-5 15-03-2012.pdf 2012-03-15
3 963-CHE-2012 FORM-3 15-03-2012.pdf 2012-03-15
4 963-CHE-2012 FORM-2 15-03-2012.pdf 2012-03-15
5 963-CHE-2012 FORM-1 15-03-2012.pdf 2012-03-15
6 963-CHE-2012 DRAWINGS 15-03-2012.pdf 2012-03-15
7 963-CHE-2012 DESCRIPTION (COMPLETE) 15-03-2012.pdf 2012-03-15
8 963-CHE-2012 CORRESPONDENCE OTHERS 15-03-2012.pdf 2012-03-15
9 963-CHE-2012 CLAIMS 15-03-2012.pdf 2012-03-15
10 963-CHE-2012 ABSTRACT 15-03-2012.pdf 2012-03-15
11 963-CHE-2012 CORRESPONDENCE OTHERS 27-04-2012.pdf 2012-04-27
12 963-CHE-2012 FORM-1 27-04-2012.pdf 2012-04-27
13 Form-18(Online).pdf 2013-11-25
14 963-CHE-2012-FER.pdf 2017-12-18
15 963-CHE-2012-FER_SER_REPLY [18-06-2018(online)].pdf 2018-06-18
16 963-CHE-2012-COMPLETE SPECIFICATION [18-06-2018(online)].pdf 2018-06-18
17 963-CHE-2012-HearingNoticeLetter20-08-2019.pdf 2019-08-20
18 963-CHE-2012-FORM-26 [20-08-2019(online)].pdf 2019-08-20
19 963-CHE-2012-ExtendedHearingNoticeLetter_20-08-2019.pdf 2019-08-20
20 963-CHE-2012-HearingNoticeLetter21-08-2019.pdf 2019-08-21
21 Correspondence by Agent_Power of Attorney_26-08-2019.pdf 2019-08-26
22 963-CHE-2012-HearingNoticeLetter26-08-2019.pdf 2019-08-26
23 963-CHE-2012-Written submissions and relevant documents (MANDATORY) [03-09-2019(online)].pdf 2019-09-03
24 963-CHE-2012 SEQUENCE LISTING.pdf 2019-09-09
25 Marked up Claims_Granted 320399_13-09-2019.pdf 2019-09-13
26 Drawings_Granted 320399_13-09-2019.pdf 2019-09-13
27 Description_Granted 320399_13-09-2019.pdf 2019-09-13
28 Claims_Granted 320399_13-09-2019.pdf 2019-09-13
29 Abstract_Granted 320399_13-09-2019.pdf 2019-09-13
30 963-CHE-2012-PatentCertificate13-09-2019.pdf 2019-09-13
31 963-CHE-2012-IntimationOfGrant13-09-2019.pdf 2019-09-13
32 963-CHE-2012-RELEVANT DOCUMENTS [13-03-2020(online)].pdf 2020-03-13
33 963-CHE-2012-RELEVANT DOCUMENTS [15-09-2021(online)].pdf 2021-09-15
34 963-CHE-2012-RELEVANT DOCUMENTS [28-09-2022(online)].pdf 2022-09-28
35 963-CHE-2012-RELEVANT DOCUMENTS [14-08-2023(online)].pdf 2023-08-14

Search Strategy

1 Lens_18-12-2017.pdf

ERegister / Renewals

3rd: 23 Sep 2019

From 15/03/2014 - To 15/03/2015

4th: 23 Sep 2019

From 15/03/2015 - To 15/03/2016

5th: 23 Sep 2019

From 15/03/2016 - To 15/03/2017

6th: 23 Sep 2019

From 15/03/2017 - To 15/03/2018

7th: 23 Sep 2019

From 15/03/2018 - To 15/03/2019

8th: 23 Sep 2019

From 15/03/2019 - To 15/03/2020

9th: 23 Sep 2019

From 15/03/2020 - To 15/03/2021

10th: 16 Feb 2021

From 15/03/2021 - To 15/03/2022

11th: 17 Feb 2022

From 15/03/2022 - To 15/03/2023

12th: 22 Feb 2023

From 15/03/2023 - To 15/03/2024

13th: 14 Feb 2024

From 15/03/2024 - To 15/03/2025

14th: 24 Feb 2025

From 15/03/2025 - To 15/03/2026