Abstract: The present disclosure provides a method for obtaining osteoblast cell-mixture which can be used for transplantation of osteoblast cells in a subject. The present disclosure further discloses a method for delivering osteoblast cells into a subject. The method for obtaining osteoblast cell-mixture as disclosed herein is devoid of any additives like calcium chloride and aprotinin. The method for delivering osteoblast cells as disclosed herein provides bone regeneration in the subject.
1. A method for preparing an osteoblast cell-mixture, said method comprising: a) obtaining thrombin; b) contacting thrombin with a first nutrient medium, to obtain a first mixture; c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; d) obtaining fibrinogen; e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture.
2. A method of delivering osteoblast cells into a subject, said method comprising: a) obtaining thrombin; b) contacting thrombin with a first nutrient medium, to obtain a first mixture; c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; d) obtaining fibrinogen; e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and g) delivering the osteoblast cell-mixture to a site in a subject.
3. A method of delivering osteoblast cells into a subject, said method comprising: a) obtaining thrombin; b) contacting thrombin with a first nutrient medium, to obtain a first mixture; c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; d) obtaining fibrinogen; e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; g) incising lateral side of an affected area in a subject to create an incision; h) drilling holes through the incision to gain access to a defect area; i) adjusting position of the subject in gravity-dependent position; j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and k) applying standard medical procedures for suturing, to deliver osteoblast cell-mixture into the subject.
4. The method as claimed in any one of the claims 1 to 3, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample.
5. The method as claimed in claim 4, wherein the mesenchymal stem cell suspension is cultured in presence of a nutrient medium comprising a platelet lysate to obtain the osteoblast cell suspension.
6. The method as claimed in claim 5, wherein the platelet lysate comprises a lysate obtained from a mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma.
7. The method as claimed in claim 6, wherein the mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma comprises 0.3×109 to 1×109 platelets/ml.
8. The method as claimed in any one of the claims 1 to 3, wherein the first mixture comprises 100-600 IU/ml thrombin.
9. The method as claimed in any one of the claims 1 to 3, wherein the third mixture comprises 20-100 mg/ml of fibrinogen.
10. The method as claimed in any one of the claims 1 to 3, wherein the first nutrient medium of step (b) or the second nutrient medium of step (e) comprises at least one medium selected from a group consisting of DMEM, αMEM, IMDM, and combinations thereof.
11. The method as claimed in claim 1, wherein the osteoblast cell-mixture is used in transplantation of osteoblast cells into a subject.
12. The method as claimed in any one of the claims 1 to 3, wherein the osteoblast cell suspension comprises osteoblast cells in a range of 12X106 cells to 60X106 cells.
13. The method as claimed in claim 2, wherein the mixing of the second mixture and the third mixture, and the delivering of the osteoblast cell-mixture is done by a dual syringe device.
14. The method as claimed in claim 3, wherein the injecting of the osteoblast cell-mixture is done by a dual syringe device.
15. The method as claimed in any one of the claims 1 to 3, wherein the second mixture and the third mixture is mixed in a ratio having a range of 1:0.5 to 1:2.
16. The method as claimed in any one of the claims 2 or 3, wherein the method achieves bone regeneration.
17. The method as claimed in any one of the claims 1 to 3, wherein fibrinogen is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
18. The method as claimed in any one of the claims 1 to 3, wherein thrombin is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
19. The method as claimed in any one of the claims 1 or 2, wherein the osteoblast cell-mixture forms a gel network in a time in a range of 3-6 minutes.
20. The method as claimed in claim 3, wherein the gel network is formed in a time in a range of 3-6 minutes.
21. The method as claimed in claim 3, wherein in the defect area, curettage is done to remove necrosed bone, and a saline wash is given through the holes.
22. The method as claimed in any one of the claims 1 to 3, wherein the osteoblast cell-mixture comprises autologous osteoblast cells.
23. The method as claimed in any one of the claims 2 or 3, wherein the method is used to treat conditions selected from a group consisting of non-union fracture, fibrous dysplasia, avascular necrosis, oral and maxillofacial fractures, and sinus lift.
FORM 2
THE PATENTS ACT, 1970 (39 of 1970) & THE PATENTS RULES, 2003
COMPLETE SPECIFICATION
(See section 10, rule 13)
1. Title of the invention: OSTEOBLAST CELL-MIXTURE, AND IMPLEMENTATIONS
THEREOF
2. Applicant(s)
NAME NATIONALITY ADDRESS
REGROW BIOSCIENCES Indian 2-ABC, ACME Plaza, Andheri-Kurla
PRIVATE LIMITED Road, Andheri (E), Mumbai
Maharashtra - 400 059, India
3. Preamble to the description
COMPLETE SPECIFICATION
The following specification particularly describes the invention and the manner in which it
is to be performed.
FIELD OF INVENTION
[001] The present disclosure broadly relates to the field of therapeutic composition, and in particular discloses a composition comprising osteoblast cells and method of administering the same.
BACKGROUND OF INVENTION
[002] Bones are an integral part of the musculoskeletal system. While it is the largest connective tissue, its main functions include support, strength, movement and protection. Bone formation and maintenance is a very specialized process, continuously happening in any healthy individual. Bone tissue is made up of at least three types of cells and extracellular matrix (ECM). The maturity and hardness of bone are dependent on composition of the cells and ECM.
[003] The ongoing process of maintenance of bone is called remodelling, during which, the new bone-forming progenitor cells i.e., osteoblasts are recruited, which eventually mature into osteocytes. Osteocytes have a specified lifespan, after which they are resorbed by another special type of cells called osteoclasts. During homeostasis, healthy bone tissue is continuously formed and resorbed with normal structure and function.
[004] The ECM is composed of collagen and minerals like calcium and phosphate. Tensile strength, and compressive strength of a bone is dependent on the type of collagen, and the minerals’ proportion. Bone “Modelling” and “Remodelling”
[005] The initial process of bone formation can be considered as bone “Modelling”, during which deposition of mineralized tissue takes place as a well-orchestrated process. The process begins during intrauterine fetal development and continues till adulthood. Endochondral bone formation as well as membranous bone formation are responsible for formation of bones and joints of the musculoskeletal system. Bone “Remodelling” also initiates during fetal stage and is a series of highly regulated processes that are dependent on the interaction between mesenchymal osteoblastic lineage and hematopoietic osteoclastic lineage. The “Activation” stage is marked by
recruitment of osteoclast cells that initiate “Resorption” of the mineralized mature bone. This scoops out the trabecular surface in an irregular manner and bone is removed. The next stage is “Reversal”, during which a natural debridement takes place to clean up the area, making it ready for new bone formation. It is at this stage that the final “Formation” is set in with the progenitor mesenchymal stem cells getting committed and differentiated to form osteoblasts that line up the surface or fill up the scoops created in earlier stages of “Bone Remodelling”. In fact, this stage continues till the scooped surface is filled with newly formed osteoblast population. These osteoblasts either get transformed into osteocytes and become a part of the metabolic function of the bone; or undergo apoptosis.
[006] Bones are metabolically active and undergo remodelling continuously, which is necessary for maintaining the structural integrity of the skeleton as well as the calcium-phosphate balance in the body. Homeostasis of bone remodelling and healthy bones are indicators of each other. Diseases of bones
[007] Bones are supposed to be strong and supportive as well as protective. Any condition that would lead to bones becoming weak, fragile, or brittle, would be considered as or would result in diseased conditions of the bones. Mineral imbalance, metabolic and hormonal disturbance, cellular insufficiency and/or simple trauma are known reasons for diseased condition of bones. While some conditions are genetic, many are due to medications, nutritional deficits etc. Inflammatory disorders as well as malignancies involving bones are also known. Overall, there could be structural deformities (e.g., short limbs or scoliosis); nutritional deficits (e.g., rickets, Paget’s disease); compromised bone density (e.g., osteoporosis); brittle bones (e.g., osteopetrosis); infection (e.g., osteomyelitis); inflammatory diseases of bones and joints (e.g., rheumatoid arthritis); degenerative conditions (e.g., osteoarthritis); vascular deficits (e.g., osteonecrosis of hip) and drug-induced abnormalities (e.g., osteonecrosis of jaw).
[008] The composition of minerals, collagen (overall ECM), and homeostasis of remodelling are the determinants of health of a bone. Thus, any derailed metabolic process that would result in abnormal mineral composition of bone would be
responsible for diseased condition. In the same manner, derailed bone remodelling, as a result of, for example, inadequate recruitment of osteoblasts and/or increased or uncontrolled activity of osteoclasts, would result in a diseased condition. Traumatic insults like fractures; especially when they do not heal in stipulated time frame can be considered diseased conditions. Cysts and benign tumors, and fibrous dysplasia like conditions that occupy and damage bone from within are another type of bone disease conditions. Age-related degenerative changes that progressively damage the collagen, and hence cartilage lead to osteoarthritis; while rheumatoid arthritis is a typical autoimmune disease. Few of the bone diseases requiring attention are listed below:
Avascular Necrosis (AVN)
[009] AVN is a progressive condition, characterized by death and loss of bone mass; most often affecting the head of the femur in the hip joint. Various conditions are responsible for the avascular condition in this region; ultimately resulting in diminished blood flow and hence, insufficient supply of bone-making osteoblasts with simultaneous increase in bone resorption by osteoclast population in the affected hip joint. AVN, mostly affects younger population (between 30-40 years of age); and males almost 4 times than females. While steroid intake and alcohol consumption are known risk or precipitating factors, AVN is equally idiopathic. The duration of progression is variable, and needs immediate attention as it is highly debilitating, painful condition with severe impact on patient’s mobility. [0010] A typical limp while walking, besides pain during change in posture are typical symptoms of AVN. The staging and grading (generally Ficat-Arlet and Steinberg), progressively from I to IV, denote the area/volume affected, crescent formation and collapse. Unattended AVN would lead to involvement of overlaying articular cartilage damage, and thus, irreversible arthritis. A routine X-ray followed by MRI and/or CT scan are recommended for confirmation of diagnosis. [0011] As far as treatment modality is concerned, pain management is considered in initial stages, provided the condition is diagnosed so early. During stage II and III, core decompression is considered as the standard care, with much varied success rate. In an in-patient OT setting, under anesthesia, a tunnel is drilled to access the
internal necrotized area, allowing the pressure to be released. It is expected to initiate revascularization. AVN, once attains stage IV with collapse of the femoral head and arthritic condition of hip joint, total hip replacement is inevitable. [0012] It is important to understand the cellular basis of the pathology of AVN. When core decompression cannot assure revascularization; and etiological reasons (steroid use and alcohol abuse) are in fact responsible of bone cells necrosis; it is logical and imperative that the dead cell component is replaced by live, healthy bone-making cells, enough to replace the dead cell portion as well as regenerate new, health bone. The implanted cells should also be able to bring back the pace of homeostasis of bone remodelling.
[0013] Since most of the patients are diagnosed during stage II/III, conservative treatment that will assure disease progression arrest is the need of the hour. Non-union fractures
[0014] The understanding of the complexity of fracture healing, involvement of molecular biology and genetic factors, and the “diamond-concept” has evolved in the recent past. The aim of treating a non-union fracture is to restore structural integrity without formation of a scar; and is achieved through intrinsic recruitment and coordinated spatial and temporal action of several different cell types, proteins, various growth factors and endothelial factors. Mechanical support is essential all throughout this process.
[0015] Any fracture that does not join or heal by the end of 9 months, despite standard of care, are considered non-union. About 5-10% of total fractures turn into non-union, with prevalence in smokers and, alcohol and drug abusers. The primary cause of delayed fracture union or non-union is the presence of gap resulting either from bone lost during trauma, excessive bone excision during corrective surgery or less than rigid internal fixation. This gap is associated with normal osteoclastic bone resorptive activity, resulting in further or continuous loss of bone. This is important, as the osteoclastic activity is more than 50 times aggressive than the osteoblast activity after a fracture. Thus, a very minor gap in bones, becomes clinically quite significant, by the time non-union is confirmed.
[0016] The management and care of non-union fractures has shifted to tertiary care with additional expertise. Methods that combine neo-osteogenesis and neo-vascularization to restore tissue deficits by using biomaterial scaffolds, regenerative techniques and/or growth factors have been tried.
[0017] As mentioned above, when the osteoclastic activity is much more pronounced in a non-union; and that not enough osteoblasts are being recruited, instead of generalized biological approaches, supply of specific osteoblast cells would be logical. Bone cysts/Fibrous Dysplasia
[0018] Either of these conditions are relatively rare; but affect younger population; and pose risk of malignancy. Both conditions are very painful, debilitating. Most often, young adolescents from age 13 to about 19 complain of these conditions; and can be diagnosed by X-ray, CT scan and MRI. Conservative attempts with surgery to excise the cyst or bone mass affected with Fibrous Dysplasia must be supported with auto-bone grafts. The outcome is not very promising, with very high recurrence rate.
[0019] Considering the cell-based pathology, both conditions are marked by imbalance of bone remodelling arising due to pronounced activity of osteoclast type as compared to effective recruitment of bone-forming osteoblast cells. [0020] Requirement of revision or repeat corrective surgical procedures is the major limitation of current treatment options for these two conditions. Bone loss and osteonecrosis in oral and maxillofacial (OMF) conditions [0021] Edentulous bone loss requires bone augmentation as a prerequisite before dental implantation. Osteonecrosis of jaw arising due to use of bisphosphonates is established. Various OMF conditions that result in pneumatization of sinuses will require sinus lift as the basic procedure before dental implantation. Thus, overall, about 50% of dental implantation procedures are preceded by bone/alveolar ridge augmentation and sinus lift.
[0022] Treatment options have been ample, from bone grafts to synthetic hydroxyapatite; again, with variable success. Various biological options like platelet-rich-fraction have also been tried and used.
[0023] Bone repair options in OMF conditions should essentially provide height, width and length enough for implant fixation; it should give mechanical support, be long-lasting and, maintain facial aesthetics. If bisphosphonate use is inevitable, osteonecrosis will continue to happen; and should be considered. [0024] Since all such options available are only able to provide moderate success, along with need for revisions and repeat procedures, the problem still persists. Biological/regenerative medicine options
[0025] The concept of regenerative medicine encompasses various stem cells derived from various sources, biological scaffolds (membranes etc.), Platelet-Rich Plasma, Platelet-Rich Fraction and the like. While most of them can be available at the bedside, collectively called as Bone-Marrow-Aspirate-Concentrate (BMAC), their clinical use is not approved for any of the conditions. BMAC basically is a source of heterogenous population of progenitor cells and its composition (types of cells, their cell counts etc.) but it cannot be ascertained before each application. In absence of this, most of the positive effects are restricted to the paracrine activity, that which is has the limitation of being time-bound. Thus, repair of the lost bone, resumption of bone-remodelling, structural integrity and biomechanics of the affected joint or part of body cannot be achieved.
[0026] US5824084A discloses a method providing a bone marrow aspirate suspension and passing the bone marrow aspirate suspension through a porous, biocompatible, implantable substrate to provide a composite bone graft having an enriched population of connective tissue progenitor cells.
[0027] US20180195043 discloses a method for generating an osteoblast that is applicable to repair of a bone defect due to various tumors, injuries, surgeries, etc., and due to treatment for bone resorption typified by a periodontal disease, bone fracture, osteoporosis, etc., and that has a low risk of carcinogenesis. Provided as a means for achieving this object is a method for generating an osteoblast from a somatic cell of a mammal, the method comprising introducing Oct9 gene or an expression product thereof into the somatic cell.
[0028] All the above-mentioned conditions are characterized by deficiency or imbalance of vasculature and blood supply, accumulation of unwanted debris and
lack of recruitment of committed and differentiated progenitor cells. Obviously, it is logical that the treatment modality should revolve around and aim at correcting these faults and bring about repair and restoration of function. Therefore, there still persists a problem in the field to which effective solution in terms of an effective composition comprising osteoblast and an associated transplantation technique is lacking.
SUMMARY OF THE INVENTION
[0029] In an aspect of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture. [0030] In an aspect of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture at a site in a subject.
[0031] In an aspect of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject into a
gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the osteoblast cell-mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cell-mixture into the subject.
[0032] These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.
BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS
[0033] The following drawings form a part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.
[0034] Figure 1 depicts clotted bone marrow biopsy, in accordance with an embodiment of the present disclosure.
[0035] Figure 2 depicts pipetting of bone marrow biopsy, in accordance with an embodiment of the present disclosure.
[0036] Figure 3 depicts a sample filtered with 100µM cell strainer, in accordance with an embodiment of the present disclosure.
[0037] Figure 4 depicts bone marrow derived stem cells (BM-MSCs) before staining, in accordance with an embodiment of the present disclosure.
[0038] Figure 5 depicts Crystal violet staining showing stained BM-MSCs colonies in Petri plates, in accordance with an embodiment of the present disclosure. [0039] Figure 6A and 6B depict bone marrow-derived mesenchymal stem cells (BM-MSCs) derived colony forming units-F (CFU-F) colonies from clotted bone marrow (BM) sample at 100X magnification, in accordance with an embodiment of the present disclosure.
[0040] Figure 7 depicts immunophenotypic results using Flow cytometry for BM-MSCs at 14 ± 3 days of culture showing CD90 and CD105 positive expression and CD34 negative expression (Representation of Sample No. 05), in accordance with an embodiment of the present disclosure. P1 depicts forward scattering v/s side scattering data, P2 depicts results for CD90, P3 depicts results for CD105, and P4 depicts results for CD34.
[0041] Figure 8 depicts immunophenotypic results using Flow cytometry for BM-MSCs at 14 ± 3 days of culture showing CD73 positive expression and HLA-DR negative expression (representation of Sample No. 05), in accordance with an embodiment of the present disclosure. P1 depicts forward scattering v/s side scattering data, P2 depicts results for FITC, P3 depicts results for CD73, and P4 depicts results for HLA-DR.
[0042] Figure 9 depicts fold expression for Oct-4, Nanong, Sox-2, i-cam, leptin and Ephrin genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages in sample 1, in accordance with an embodiment of the present disclosure. [0043] Figure 10 depicts fold expression for Oct-4, Nanong, Sox-2, i-cam, leptin and Ephrin genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages in sample 2, in accordance with an embodiment of the present disclosure. [0044] Figure 11 depicts fold expression for Oct-4, Nanong, Sox-2, i-cam, leptin and Ephrin genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages in sample 3, in accordance with an embodiment of the present disclosure. [0045] Figure 12 depicts fold expression for ALP, Collagen 1, runx-2, Osterix, MEPE and EphrinB genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages in sample 1, in accordance with an embodiment of the present disclosure. [0046] Figure 13 depicts fold expression for ALP, Collagen 1, runx-2, Osterix, MEPE and EphrinB genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages in sample 2, in accordance with an embodiment of the present disclosure. [0047] Figure 14 depicts fold expression for ALP, Collagen 1, runx-2, Osterix, MEPE and EphrinB genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages in sample 3, in accordance with an embodiment of the present disclosure.
[0048] Figure 15 depicts a flowchart for the process of isolating fibrinogen, in
accordance with an embodiment of the present disclosure.
[0049] Figure 16 depicts cord blood and maternal blood plasma as starting material
for preparation of fibrinogen and thrombin, in accordance with an embodiment of the
present disclosure.
[0050] Figure 17 depicts saturated ammonium sulphate prepared in sterile distilled
water, in accordance with an embodiment of the present disclosure.
[0051] Figure 18 depicts addition of protein precipitation solution to mixed cord blood
plasma and maternal blood plasma, in accordance with an embodiment of the present
disclosure.
[0052] Figure 19 depicts precipitation of proteins for 5-20 minutes, in accordance with
an embodiment of the present disclosure.
[0053] Figure 20 depicts centrifugation of precipitated proteins at 3000- 5000 rpm for
5-10 minutes, in accordance with an embodiment of the present disclosure.
[0054] Figure 21 depicts the discarded supernatant, in accordance with an
embodiment of the present disclosure.
[0055] Figure 22 depicts the protein pellet, in accordance with an embodiment of the
present disclosure.
[0056] Figure 23 depicts protein pellet dissolved in Dulbecco's phosphate-buffered
saline (DPBS)/ water for injection (WFI)/saline, in accordance with an embodiment
of the present disclosure.
[0057] Figure 24 depicts centrifugation at 1200-2500rpm for 5-10 minutes, in
accordance with an embodiment of the present disclosure.
[0058] Figure 25 depicts supernatant of dissolved proteins (containing fibrinogen)
collected in separate tube, in accordance with an embodiment of the present
disclosure.
[0059] Figure 26 depicts thrombin isolated using a process, in accordance with an
embodiment of the present disclosure.
DETAILED DESCRIPTION OF THE INVENTION
[0060] Those skilled in the art will be aware that the present disclosure is subject to
variations and modifications other than those specifically described. It is to be
understood that the present disclosure includes all such variations and modifications.
The disclosure also includes all such steps, features, compositions, and compounds
referred to or indicated in this specification, individually or collectively, and any and
all combinations of any or more of such steps or features.
Definitions
[0061] For convenience, before further description of the present disclosure, certain
terms employed in the specification, and examples are delineated here. These
definitions should be read in the light of the remainder of the disclosure and
understood as by a person of skill in the art. The terms used herein have the meanings
recognized and known to those of skill in the art, however, for convenience and
completeness, particular terms and their meanings are set forth below.
[0062] The articles “a”, “an” and “the” are used to refer to one or to more than one
(i.e., to at least one) of the grammatical object of the article.
[0063] The terms “comprise” and “comprising” are used in the inclusive, open sense,
meaning that additional elements may be included. It is not intended to be construed
as “consists of only”.
[0064] Throughout this specification, unless the context requires otherwise the word
“comprise”, and variations such as “comprises” and “comprising”, will be
understood to imply the inclusion of a stated element or step or group of element or
steps but not the exclusion of any other element or step or group of element or steps.
[0065] The term “including” is used to mean “including but not limited to”.
“Including” and “including but not limited to” are used interchangeably.
[0066] For the purposes of the present document, the term “umbilical cord blood”
(UCB) as used herein means the blood that remains in the placenta and in the
attached umbilical cord after childbirth. Cord blood is collected because it contains
stem cells, which can be used to treat hematopoietic and genetic disorders. Generally,
a lot of this rich biological resource is discarded. The definition is not meant to be
restricted to one species of subject, it generally covers vertebrates. The subject which
has been considered in the present disclosure is human. Specifically, umbilical cord
blood is collected from umbilical vein of a newly born baby/infant.
[0067] The term “maternal blood” as used herein means the blood collected from a
mother pre- and post- delivery. The maternal blood (MB) collection may take place
at a time immediately before/after cord blood collection, at the time of admission for
delivery (after initiation of labour) or before transfusion/infusion of any intravenous
fluid (colloids/crystalloids/blood products). The definition is not meant to be
restricted to one species of subject, it generally covers vertebrates. The subject which
has been considered in the present disclosure is human. Specifically, maternal blood
refers to blood from mother after delivery of baby, but within 7 days from the
delivery.
[0068] The term “platelet lysate” (PL) as used herein means cell lysates produced
from regular platelet transfusion units by lysis.
[0069] The term “platelet” as used herein refers to cells which are small a-nucleated
structures of hematopoietic origin which contribute to homeostasis and wound
healing by secreting growth factors and cytokines. They are produced by the
fragmentation of megakaryocytes and released into the bloodstream, where they
circulate for 7–10 days before being replaced.
[0070] The term “umbilical cord blood” (UCB) as used herein means the blood that
remains in the placenta and in the attached umbilical cord after childbirth. Cord
blood is collected because it contains stem cells, which can be used to treat
hematopoietic and genetic disorders. Generally, a lot of this rich biological resource
is discarded. The definition is not meant to be restricted to one species of subject, it
generally covers vertebrates. The subject which has been considered in the present
disclosure is human.
[0071] The term “bone regeneration” refers to the generation of bone tissue that is
required to correct the defective condition. The time may vary depending upon the
extent of damage to the bone. Bone regeneration may start around 5 weeks but will
depend on case to case basis, for instance it and may vary from 5-6 weeks to 3-4
months.
[0072] The term “dual-syringe device” or “dual-syringe applicator” refers to any device which allows application of ingredients from physically separable vials into a site. The site in this context refers to an area in a subject that is used for surgical intervention. “Affected area” refers to the area which is affected by a disorder, “Defect area” refers to an area which has the defect and is used as a target in case of surgical intervention. Affected area is used to approach the defect area in a subject. The term “curettage” refers to a medical procedure in which tissue is scrapped or scooped using a curette. The term “necrosed bone” refers to bone tissue which has been affected by necrosis, one of the causes being interruption of blood supply. [0073] The term “osteoblast cell suspension” is contemplated to comprise osteoblast cells. The osteoblast cell suspension is used to prepare “osteoblast cell-mixture”. [0074] The term “autologous osteoblast cells” refers to osteoblast cells that has been obtained by differentiating autologous mesenchymal cells.
[0075] The term “gravity dependent” refers to a position in which force of gravity can be used to facilitate a step required during any kind of treatment. [0076] The term “standard medical procedures” refers to well-known procedures that are followed during the treatment process.
[0077] The term “C-Arm” refers to a medical imaging device that is based on X-ray technology and can be used flexibly. The term “C-Arm guidance” refers to a step which has been performed under the guidance of C-Arm device. [0078] The term “necrotic area” refers to an area affected by necrosis. [0079] Abbreviations as used herein include, α-MEM – α Minimum Essential Medium, DMEM – Dulbecco’s Modified Eagle Medium, IMDM - Iscove's Modified Dulbecco's Medium, EMEM - Eagle’s Minimum Essential Medium, FGF -Fibroblast Growth Factor, TGF - Tranforming Growth Factor, IGF - Insulin-like growth factor 1, VEGF - Vascular endothelial growth factor, PDGF - Platelet-derived growth factor, BMP-2 – Bone Morphogenic Protein-2, CD90 - Cluster of Differentiation 90, CD73 - Cluster of Differentiation 73, CD105 - Cluster of Differentiation 105, CD34 - Cluster of Differentiation 34, HLA-DR - Human Leukocyte Antigen – DR isotype, umbilical cord blood (UCB), maternal blood (MB), platelet-rich plasma (PRP), platelet lysate (PL), mesenchymal stem cells
(MSCs), OCT-4 - octamer-binding transcription factor 4, Sox-2 – Sex determining region Y box 2, ALP – Alkaline phosphatase, bone alkaline phosphatase [0080] Ratios, concentrations, amounts, and other numerical data may be presented herein in a range format. It is to be understood that such range format is used merely for convenience and brevity and should be interpreted flexibly to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited.
[0081] The goal of treatment in the conditions mentioned in the background section, especially, AVN, should be to achieve the following steps:
[0082] 1) Revascularization - The step of core decompression is known to re-initiate required blood-flow through new blood vessel networks. Core decompression is performed to improve the repair in the ischemic osteonecrotic segment particularly at earlier stages of necrosis before mechanical failure of the femoral head has occurred. New vessels and bone cells arrive in the dead bone along the decompression tunnel. In an adult, hematopoietic red marrow is normally absent in the femoral head, but red marrow containing stem cells persist in the proximal shaft of the femur. These cells elicit formation of new blood vessels by the presence of endothelial cell progenitors or hemangioblasts in this cell fraction. Endothelial progenitors actively engage in vasculogenesis in tissue devoid of vessels, and in neoangiogenesis from the pre-existing capillaries. Besides the generation of new capillaries, the growing endothelia enhance mobilization and growth of mesenchymal progenitors through angiopoietin1-Tie2 pathway, which generate pericytes and vascular mural cells required for new vessel growth and stabilization. However, this fraction of cells is insufficient to ensure complete repair in most cases. Hence, treatment modalities should be to stimulate and guide bone remodeling to creeping substitution to preserve the integrity of the femoral head. The present disclosure provides a solution to preserve the integrity of femoral head. [0083] 2) Curettage - This is the most essential step during which, the present disclosure targets complete debridement of the necrotized bone. This ensures two
things. One, least chance of blood clot formation and hence, of compromised new
bone quality. Second, enough space for the cell-gel mixture implant.
[0084] The second step of curettage is performed to debride the necrotic tissue to
create space for the replacement of dead bone tissue with bone marrow mesenchymal
stem cell-derived osteoblasts. The process involves complete removal of the necrotic
tissue, where the diseased area is thoroughly curetted by debriding the head and
sclerotic bone. The process of curettage of the necrotic bone is necessary to counter
the faulty process of cell repair that is marked by new bone formation over the dead
bone trabeculae.
[0085] 3) Implant of committed, differentiated osteoblasts: it ensures effective
formation of new bone that would be like native bone but devoid of additional cells
which serve as are contaminating with respect to the purpose of invention.
[0086] The third step involves delivery of in vitro bone marrow mesenchymal stem
cell-derived osteoblasts in a fibrin gel system. For the repair and replacement of
injured tissue with biological substitutes, the following factors need to be considered.
Firstly, appropriate cells must be present to give rise to structural tissue. Secondly,
appropriate growth factors and stimuli must exist for the cells to proceed down the
proper lineage. Finally, a scaffolding matrix must act as a building block for cellular
attachment, differentiation and maturation into the desired tissue.
[0087] This unmet medical need gave way to the present disclosure which discloses
a method to prepare adult, autologous, live, transplantation-ready cultured osteoblast
cells mixed with appropriate gel mixture. The salient features of the present
disclosure are: (i) Autologous cells - ensures safety with near-minimum chances of
GvHD (Graft vs host disease); and (ii) Live-cultured cells - assures cell count, with
characterization. Thus, no ambiguity in cell type and cell count since, osteoblast cells
can differentiate only into osteocytes.
[0088] The present disclosure makes use of fibrin and thrombin system to arrive at
a composition which can be delivered to a subject.
[0089] Fibrin glue- structure, composition and properties
[0090] The Fibrin is a natural biopolymer formed in the last step of the clotting
cascade by the action of thrombin on fibrinogen. Fibrinogen is a large, complex,
fibrous glycoprotein essential to many biological processes such as hemostasis, wound healing, inflammation, angiogenesis, and so on. It is composed of two sets of three polypeptide chains (Aα, Bβ, and y), including the fibrinopeptides A and B, which are joined together by 29 disulfide bonds within the E domain. The a and γ chains are linked to the same chains of the opposite subunit by one and two interchain disulfide bond(s), respectively. The two β chains are not directly linked to each other: the β chain of one subunit is linked to the a chain of the other subunit via a disulfide bond, while an additional disulfide bond connects the second β chain to the y chain of the opposite subunit. The rod-shaped fibrinogen protein is ~45-nm long containing two identical outer D domains each connected to the central E domain, which contains the two pairs of fibrinopeptides, by a coiled-coil segment. [0091] In the last step of the coagulation cascade, thrombin cleaves off two sets of peptides, fibrinopeptides A and B, from the amino terminal ends of the Aa and Bβ chains which exposes knobs that can interact with holes that are always exposed at the ends of the molecule. Hence, each E-site interacts with a complementary binding site located on the D domain of adjacent molecules. Such “E:D” associations result in the spontaneous formation of half-staggered, double-stranded protofibrils. These protofibrils then aggregate and branch, yielding a three-dimensional (3D) clot network, as shown in Figure 1. Such structures are inherently weak, but the covalent cross-linking of fibrin by factor XIIIa leads to the formation of a stable structure. [0092] The fibrin structure or the matrix not only acts as a barrier preventing blood loss but also provides a scaffolding needed to support tissue healing and remodeling. Also, fibrin specifically binds numerous proteins and growth factors resident in normal tissue in response to tissue healing and remodeling. Thus, the complex mixture of proteins and growth factors enable fibrin glue to play an active role in tissue formation, suturing and remodeling through a specific receptor-mediated interaction within specific cell types.
[0093] Thus, such fibrin matrix is provided naturally by the body after injury, but also can be engineered as a tissue substitute as described herein to speed healing. The fibrin matrix consists of naturally occurring biomaterials composed of cross-linked fibrin network and has a broad use in biomedical applications. For example,
it is used to control surgical bleeding, speed wound healing, seal off hollow body organs or cover holes made by standard sutures, and provide slow-release delivery of medications like antibiotics to tissues exposed. Such a fibrin matrix is useful in repairing injuries to the body and is useful in sites of ischemia. In biomedical research, fibrin matrices have been used to repair neurons, heart valves and the surface of the eye. Fibrin matrices have also been used in the urinary tract, liver, lung, spleen, kidney, and hear. In the present invention, fibrin matrices and the formulation comprising of fibrin glue along with the cells are used in suturing and remodeling bone tissue at any defect site of the bone anatomy. [0094] In accordance with the present disclosure, fibrin thus possesses remarkable advantages, which makes it an ideal candidate for bone tissue engineering applications. It is nature’s nano-scaffold following tissue injury to initiate hemostasis and provide a temporary structure that facilitates cellular activities and also deposition of a new extracellular matrix (ECM). Fibrin gel precursors, fibrinogen and thrombin, are derived from a patient’s own blood, which enables the fabrication of completely autologous and inexpensive scaffolds. Moreover, owing to its multiple interaction sites for cells and other proteins, fibrin acts as a bioactive matrix and is suitable for cell and biomolecule delivery systems. In addition, the structural properties of fibrin substrates can be easily controlled by changes in fibrinogen and/or thrombin concentrations in the precursor solutions. Furthermore, fibrin is injected in a liquid form and it solidifies thereafter in situ; thus, filing bone gaps with any shape or geometry.
Biological relevance of Fibrin to the terminally differentiated osteoblast and in turn bone remodeling in vivo:
[0095] Fibrin is the result of coagulation process of fibrinogen and thrombin. Fibrinogen is a glycoprotein that is converted enzymatically by thrombin to fibrin. Thrombin is a highly specific serine protease which is the principal enzyme of hemostasis that catalyzes the conversion of fibrinogen to fibrin. Fibrinogen's product, fibrin, binds and reduces the activity of thrombin. Fibrinogen contains fibrinopeptides regions in the center flanked with γC nodules that cover ‘knobs’
which are complementary to ‘holes’ exposed at the ends of the protein. In the presence of thrombin, the fibrinopeptides are removed and knob-hole interactions give rise to fibrin monomers. The monomeric fibrin self-assembles spontaneously to yield fibrin oligomers that lengthen to make two-stranded protofibrils. Protofibrils are the important intermediate product of fibrin polymerization. Protofibrils aggregate both laterally and longitudinally to form fibers that branch to yield a three-dimensional filamented, gelled network that constitute the matrix of the fibrin. [0096] The microarchitecture of fibrin facilitates transport of gases, nutrients, peptides and macromolecules needed for cellular activities and tissue development. The specific ratio of the fibrinogen complex and thrombin concentrations are optimized for osteoblast proliferation and growth within the bone cavity. The fibrin concentration also upregulates the collagen production and thereby promotes osteogenic properties within the bone cavity. The specific pore size also promotes enough oxygenation and nutrition to the cells which is important for proliferation of the osteoblasts to aid in vivo bone formation. The use of fibrin positively affects the osteogenic differentiation and angiogenic activity of the seeded cells by sustaining the expression of osteocalcin (OC) and VEGF, respectively. There is acceleration of revascularization and stimulation of the growth of both fibroblasts and osteoblasts observed with the use of fibrin glue.
[0097] Formation of a fibrin network is a transition from sol-gel upon formation of a three-dimensional filamentous network. Cell suspension with thrombin and fibrinogen is mixed at the time of surgery to allow formation of fibrin clot with in vitro cultured osteoblasts entrapped to hold them at the site of implantation. The gel is injected and solidifies in situ in 8 minutes thereby filling the bone gaps with any shape or geometry and molds within the defect region. It is advantageous as leakage of supraphysiological doses to adjacent sites can pose huge problems such as heterotopic ossification from osteoinductive factors. The bioadhesive property of fibrin helps in containing the osteoblasts in a precise manner and adherence to bone defect site. Its hemostatic properties help to reduce blood loss, adheres to the surrounding tissue and secures the graft in place. This results in decreased hematoma formation and decreased graft motion, both of which enhance graft survival. The
properties of fibrin glue such as malleability, deformability, elasticity and tensile strength render it an effective tissue surface adherent.
[0098] Fibrin glue containing osteoblasts acts as a three-dimensional biological vehicle and bioactive matrix owing to its multiple interaction sites for cells and other proteins. It is non-toxic and non-immunogenic, mechanically compatible with the biological environment and, undergoes biodegradation at the appropriate time. The nano-sized and well-defined microstructure facilitates cellular activities for bone formation, vascularization and deposition of a new extracellular matrix. Fibrin has an influence on extracellular matrix formation, retention and accumulation of collagen and increase in osteoblast proliferation and helps in the fixation of osteochondral fragments due to its osteoinductive and osteoconductive properties. The biological mesh supports osteoblast growth and movement while promoting angiogenesis which is necessary for new bone formation.
[0099] Angiogenesis is a complex process resulting in the development of new capillaries from pre-existing vessels. Angiogenesis requires a coordinated interaction of the hemostatic and inflammatory systems and is regulated by cytokines and growth factors that act locally to regulate cellular proliferation and tissue repair. Decompression of the bone defect site leads to revascularization that restores perfusion to the dead bone region that has become ischemic. Fibrin plays an active role through specific receptor-mediated interactions with cells of the blood and vessel wall. These result in fibrin-specific responses including adhesion and spreading, proliferation, protein synthesis, and secretion. Growth factors which are part of the components of blood interact with fibrinogen for formation of vascular structures in a fibrinogen rich environment.
[00100] Fibrin specifically binds numerous proteins and growth factors resident in normal tissue including ECM proteins such as fibronectin and vitronectin, many growth factors including FGF, VEGF, insulin-like growth factor-1, and enzymes like plasminogen as well as tissue plasminogen activator (tPA). This complex mixture of proteins binds to the fibrin matrix, enabling it to play an active role in wound healing as well as osteogenic signaling through specific receptor-mediated interactions with cells. Various hemostatic factors like Prothrombin-derived fragments, Fibrinogen E
fragment, Plasminogen fragment/Angiostatin possess anti-angiogenic activity. The degradation of fibrin is influenced by plasminogen activation, which leads to the generation of serine protease plasmin and subsequent fibrinolysis. Plasminogen is converted to plasmin on the fibrin surface and fibrin is degraded by plasmin. Plasmin degradation of cross-linked fibrin forms a heterogeneous group of degradation products. The fibrin matrix component initially serves as a biochemical anti-angiogenic barrier and hence post-hemostatic angiogenesis follows fibrinolysis-mediated angiogenic inhibition.
[00101] When the clot is no longer needed, fibrinolysis is activated to efficiently dissolve clots and avoid thrombosis. Hence, fibrin has a dual role during fibrinolysis, functioning as both a cofactor and a substrate for the fibrinolytic enzyme plasmin. There are several factors affecting the effectiveness of fibrinolysis in vivo, including the fibrin network structure, the clot hemodynamic environment, the kinetic properties of the fibrinolytic enzymes, and the balance of their formation and inactivation.
[00102] The sustained release of osteoblasts held within the fibrin gel leads to production of the organic bone and aids its mineralization. Due to revascularization and interaction with the viable bone surface, these cells then receive proliferation and osteoinductive signals for bone formation. Osteoblasts express a range of genetic markers: they secrete collagen I-which makes up over 90% of bone matrix protein-essential for later mineralization of hydroxyapatite. Bone formation by osteoblasts is controlled both locally and systemically during bone modeling. The collagen excreted forms osteoids, the osteoblasts cause calcium salts and phosphorous to precipitate from the blood and bond with the newly formed osteoid to mineralize the bone tissue. Mineralization is achieved by the local release of phosphate, which is generated by phosphatases present in osteoblast-derived, membrane bound matrix vesicles within the osteoid. With abundant calcium in the extracellular fluid, this results in nucleation and growth of crystals of hydroxyapatite. The proportion of organic matrix to mineral in cortical bone (approximately 60% mineral, 20% organic material, 20% water) is crucial to ensure the correct balance between stiffness and flexibility of the skeleton.
[00103] Osteoblasts also produce alkaline phosphatase which is an enzyme that is involved in the mineralization of bone. It is an early marker of osteoblast differentiation and its increased expression is associated with the progressive differentiation of osteoblasts. Injecting cultured osteoblasts have only two specific transcripts, one encoding Cbfa1 and other encoding osteocalcin, an inhibitor of osteoclast function that is only expressed when these cells are completely differentiated. Cbfa1 has all the properties of a differentiation factor for the osteoblast lineage. Cbfa1 plays an important role in osteogenesis. Binding sites for Cbfa1 are also present in the regulatory sequences of most genes that are required for the synthesis of extracellular matrix. Osteoblasts injected are already immature bone tissue that leads to mature bone formation at the decompression site. The volume of bone matrix made by one osteoblast is approximately 5000 µm3. The injection of the cultured osteoblasts prevents of the loss of structural integrity of the subchondral trabeculae thus aids in restoration of the bone mass. [00104] In earlier attempts, with different types of cells, loss of cell suspension during or soon after implant has been a major limitation. Hence, the present disclosure discloses a unique cell-delivery system that makes use of physiological property of thrombin- fibrin network. When the patient-specific cell suspension gets mixed with this special delivery system, soon after implantation (within 3-6 minutes), it would transform into a well-set gel, occupying the space where it is implanted. The implanted osteoblast cells are enough to execute the expected repair through integration with native bone, reestablishment of bone remodeling, resuming joint biomechanics and activity, movement and strength that is continuous and on¬going. In AVN patients, use of this cultured osteoblast cells will arrest or even reverse the condition and essentially avoid or delay requirement of total arthroplasty. In non-union fractures, it will supply required cells for new bone formation that will balance out the pronounced bone resorption and loss; and allow bone union without scar formation. Use of terminally-differentiated osteoblast cells will minimize chances of malignancy in bone cysts, as it will completely wipe-off the cyst. Similar effect is expected in fibrous dysplasia. The requirement of spatial bone augmentation
can also be taken care of in OMF conditions and dental implants not requiring any kind of revision can be assured.
[00105] One of the biggest cell therapy areas in tissue engineering is defined by either (1) in vivo, that is, by stimulating the body's own regeneration response with the appropriate biomaterial, or by (2) ex vivo, that is, cells can be expanded in culture, attached to a scaffold and then re-implanted into the host. Depending on the source, cells may be heterologous (different species), allogeneic (same species, different individual) or autologous (same individual). Autologous cells are preferred as they will not evoke an immunologic response and thus, the deleterious side effects of immunosuppressive agents can be avoided. In addition, the potential risks of pathogen transfer are also eliminated. When engineering bone tissue substitutes, mechanical stability, osteo-conductivity, osteo-inductivity, osteo-genicity and ease of handling must be well balanced in order to properly meet any clinical needs. [00106] Typically, bone tissue engineering requires not only living cells but also the use of scaffolds, which serve as a three-dimensional environment for the cells. Scaffolds for engineering bone should be: (i) biocompatible (non-immunogenic and non-toxic); (ii) absorbable (with rates of resorption commensurate with those of bone formation); (iii) preferably radiolucent (to allow the new bone to be distinguished radiographically from the implant); (iv) osteoconductive; (v) easy to manufacture and sterilize; and (vi) easy to handle in the operating theater, preferably without preparatory procedures (in order to limit the risk of infection). Three-dimensional scaffolds for bone tissue regeneration require an internal microarchitecture, specifically highly porous interconnected structures and a large surface-to-volume ratio, to promote cell in-growth and cell distribution throughout the matrix. Pore sizes, Particle size, shape and surface roughness affect cellular adhesion, proliferation and phenotype. Specifically, cells are sensitive and responsive to the chemistry, topography and surface energy of the material substrates with which they interact. In this respect, the type, amount and conformation of specific proteins that adsorb onto material surfaces, subsequently modulate cell functions. [00107] Therefore, the present disclosure has been made in view of the above aspect, and it is an object of the present disclosure to provide a semi-solid osteoblast
composition containing fibrin glue comprising fibrinogen and thrombin for bone formation and a method for preparing the same. The present disclosure aims for having no clinical graft rejection via injection of an osteoblasts with fibrinogen and thrombin mixture into a defect site where bone formation is sought, and capable of achieving effective and rapid bone formation via injection of a composition which was shaped to a certain extent, in order to ease problems associated with bone tissue formation.
[00108] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference.
[00109] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture. [00110] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample.
[00111] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample, and wherein the platelet lysate comprises a lysate obtained from a mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma, and the mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma comprises 0.3×109 to 1×109 platelets/ml.
[00112] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the first mixture comprises 100-600 IU/ml thrombin.
[00113] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the third mixture comprises 20-100 mg/ml of fibrinogen.
[00114] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the first nutrient medium of step (b) or the second nutrient medium of step (e) comprises at least one medium selected from a group consisting of DMEM, αMEM, IMDM, and combinations thereof.
[00115] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the osteoblast cell-mixture is used in transplantation of osteoblast cell suspension into a subject.
[00116] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the osteoblast cell suspension comprises osteoblast cells in a range of 12X106 cells to 60X106 cells.
[00117] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first
mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the second mixture and the third mixture is mixed in a ratio in a range of 1:0.5 to 1:2. In another embodiment of the present disclosure, the second mixture and the third mixture is mixed in a ratio of 1:1.
[00118] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein fibrinogen is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
[00119] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein thrombin is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
[00120] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step
(c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the osteoblast cell-mixture forms a gel network in a time in a range of 3-6 minutes. In another embodiment of the present disclosure, the osteoblast cell-mixture forms a gel network in a time in a range of 4-5 minutes.
[00121] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the osteoblast cell-mixture comprises autologous osteoblast cells. [00122] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the method is used to correct conditions selected from a group consisting of non¬union fracture, fibrous dysplasia, avascular necrosis, oral and maxillofacial fractures, and sinus lift.
[00123] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the first mixture comprises 100-600 IU/ml thrombin, and the third mixture comprises 20-100 mg/ml of fibrinogen, and the second mixture and the third mixture are mixed
in a ratio of 1:1, and thrombin and fibrinogen are independently obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma, and the osteoblast cell-mixture forms a gel network in a time in a range of 3-6 minutes, and the mixing of the second mixture and the third mixture is done by a dual syringe device.
[00124] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein thrombin is obtained by a method comprising: (i) mixing umbilical cord blood plasma with maternal blood plasma to obtain mixture A; (ii) contacting saturated ammonium sulphate/ ethanol to the mixture A in a ratio selected from a group consisting of 1:1, 2:1 and 3:1, wherein the ratio is between cord blood in mixture A and the saturated ammonium sulphate/ethanol, and allowed to precipitate plasma proteins for 5-20 minutes to obtain a mixture B; (iii) centrifuging the mixture B at 3000–5000 rpm for 5-10 minutes to separate protein precipitate in form of a pellet from a supernatant; (iv) discarding the supernatant and adding 4-5ml of a solution A to the pellet to obtain a pellet solution; (v) centrifuging the pellet solution, and collecting supernatant; (vi) lyophilizing the supernatant under vacuum conditions to obtain a lyophilized protein powder; (vii) dissolving the lyophilized protein powder in a solution B to obtain a protein solution; (viii) extracting prothrombin by ion exchange chromatography using diethyl aminoethyl (DEAE-IEC) followed by heparin affinity chromatography (A second DEAE – IEC step), followed by immobilized metal affinity chromatography (IMAC), and collecting prothrombin; (ix) activating prothrombin obtain crude thrombin and purifying crude thrombin by hydrophobic interaction chromatography (HIC), to obtain purified thrombin; (x) concentrating the purified thrombin, to obtain thrombin, wherein the solution A and
solution B is independently selected from a group consisting of water, saline, and Dulbecco’s phosphate buffer saline.
[00125] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein fibrinogen is obtained by a method comprising: (i) mixing umbilical cord blood plasma with maternal blood plasma to obtain mixture A; (ii) contacting saturated ammonium sulphate/ ethanol to the mixture A in a ratio selected from a group consisting of 1:1, 2:1 and 3:1, wherein the ratio is between cord blood in mixture A and the saturated ammonium sulphate/ethanol, and allowed to precipitate plasma proteins for 5-20 minutes to obtain a mixture B; (iii) centrifuging the mixture B at 3000–5000 rpm for 5-10 minutes to separate a pellet from a supernatant; (iv) lyophilizing the supernatant under vacuum conditions resulting in a lyophilized protein powder, wherein the lyophilized protein powder comprises fibrinogen wherein the solution A is selected from a group consisting of water, saline, and Dulbecco’s phosphate buffer saline.
[00126] In an embodiment of the present disclosure, there is provided a method for preparing an osteoblast cell-mixture, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture, wherein the osteoblast cell suspension is obtained using a process comprising: (i) seeding in a culture flask, a mesenchymal stem cell suspension in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium, to obtain culture flask-adhered mesenchymal stem cells; (ii) culturing the adhered mesenchymal stem cells
in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium; (iii) supplementing the nutrient medium of step (ii) with differentiation factors and growth factors to obtain a differentiation medium; (iv) complementing the differentiation nutrient medium of step (iii) with fresh differentiation nutrient medium comprising 10% to 20% of a platelet lysate, differentiation factors and growth factors to obtain a population of pre-osteoblast cells; (v) sub-culturing the population of pre-osteoblast cells of step (iv) for a time in a range of 12 to 15 days to obtain a P1 pre-osteoblast cells; (vi) expanding the P1 pre-osteoblast cells in a P1 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P1 expansion nutrient medium for a time in a range of 12 to 15 days to obtain expanded P1 pre-osteoblast cells, and sub-culturing the expanded P1 pre-osteoblast cells, to obtain a P2 osteoblast cells; and (vii) expanding the P2 osteoblast cells in a P2 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P2 expansion nutrient medium to obtain osteoblast cell suspension, and wherein the mesenchymal stem cell suspension is prepared using a process comprising: (1) obtaining a bone marrow sample, wherein the bone marrow sample comprises clotted bone marrow; (2) chopping the clotted bone marrow into pieces of at least 2 mm3 to obtain chopped clotted bone marrow; (3) contacting the chopped clotted bone marrow to at least one or combinations of enzymes in presence of a buffer to obtain a clotted bone marrow reaction solution; (4) incubating the clotted bone marrow reaction solution at a temperature in a range of 35°C to 39°C for a time of at least 20 minutes at a speed in a range of 100 rpm to 200 rpm to obtain incubated clotted bone marrow reaction solution; (5) contacting the incubated clotted bone marrow reaction solution of step (4) to a growth medium to obtain a suspension, wherein the growth medium is selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; (6) mixing the suspension for a plurality of repeats; (7) filtering the suspension of step (6) with a cell strainer with a pore size in a range of 50μm - 100μm to obtain a filtrate; (8) centrifuging the filtrate at 1300 rpm to 1800 rpm for a time in a range of 10 minutes to 15 minutes to obtain a cell pellet; and (9) dissolving the cell pellet with a nutrient medium to obtain a mesenchymal stem cell suspension, wherein the nutrient medium comprises 10% to 20% of a
platelet lysate, and a medium selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof, and a plurality of factors selected from a group consisting of L-Glutamine, FGF, TGF, and wherein the at least one enzyme is selected from a group consisting of urokinase, collagenase, hyaluronidase, and combinations thereof.
[00127] In an embodiment of the present disclosure, there is provided a method for preparing mesenchymal stem cells suspension from a clotted bone marrow, said method comprising: (1) obtaining a bone marrow sample, wherein the bone marrow sample comprises clotted bone marrow; (2) chopping the clotted bone marrow into pieces of at least 2 mm3 to obtain chopped clotted bone marrow; (3) contacting the chopped clotted bone marrow to at least one or combinations of enzymes in presence of a buffer to obtain a clotted bone marrow reaction solution; (4) incubating the clotted bone marrow reaction solution at a temperature in a range of 35°C to 39°C for a time of at least 20 minutes at a speed in a range of 100 rpm to 200 rpm to obtain incubated clotted bone marrow reaction solution; (5) contacting the incubated clotted bone marrow reaction solution of step (4) to a growth medium to obtain a suspension, wherein the growth medium is selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; (6) mixing the suspension for a plurality of repeats; (7) filtering the suspension of step (6) with a cell strainer with a pore size in a range of 50μm - 100μm to obtain a filtrate; (8) centrifuging the filtrate at 1300 rpm to 1800 rpm for a time in a range of 10 minutes to 15 minutes to obtain a cell pellet; and (9) dissolving the cell pellet with a nutrient medium to obtain a mesenchymal stem cell suspension, wherein the nutrient medium comprises 10% to 20% of a platelet lysate, and a medium selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof, and a plurality of factors selected from a group consisting of L-Glutamine, FGF, TGF, and wherein the at least one enzyme is selected from a group consisting of urokinase, collagenase, hyaluronidase, and combinations thereof, and wherein urokinase is present in a range of 10,000 units to 30,000 units, collagenase type I - II is present in a range of 200 units to 500 units, and hyaluronidase type I-IV is present in a range of 200 units to 1000 units.
[00128] In an embodiment of the present disclosure, there is provided a method for preparing mesenchymal stem cells suspension from a clotted bone marrow, said method comprising: (1) obtaining a bone marrow sample, wherein the bone marrow sample comprises clotted bone marrow; (2) chopping the clotted bone marrow into pieces of at least 2 mm3 to obtain chopped clotted bone marrow; (3) contacting the chopped clotted bone marrow to at least one or combinations of enzymes in presence of a buffer to obtain a clotted bone marrow reaction solution; (4) incubating the clotted bone marrow reaction solution at a temperature in a range of 35°C to 39°C for a time of at least 20 minutes at a speed in a range of 100 rpm to 200 rpm to obtain incubated clotted bone marrow reaction solution; (5) contacting the incubated clotted bone marrow reaction solution of step (4) to a growth medium to obtain a suspension, wherein the growth medium is selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; (6) mixing the suspension for a plurality of repeats; (7) filtering the suspension of step (6) with a cell strainer with a pore size in a range of 50μm - 100μm to obtain a filtrate; (8) centrifuging the filtrate at 1300 rpm to 1800 rpm for a time in a range of 10 minutes to 15 minutes to obtain a cell pellet; and (9) dissolving the cell pellet with a nutrient medium to obtain a mesenchymal stem cell suspension, wherein the nutrient medium comprises 10% to 20% of a platelet lysate, and a medium selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof, and a plurality of factors selected from a group consisting of L-Glutamine, FGF, TGF, and wherein the mesenchymal stem cells are culture flask-adherent, nucleated, and stain with crystal violet stain, and the mesenchymal stem cells test positive in flow cytometry cell surface marker analysis for CD90, CD73 and CD 105, and negative for CD34 and HLA-DR.
[00129] In an embodiment of the present disclosure, there is provided a method for preparing mesenchymal stem cells suspension from a clotted bone marrow, said method comprising: (1) obtaining a bone marrow sample, wherein the bone marrow sample comprises clotted bone marrow; (2) chopping the clotted bone marrow into pieces of at least 2 mm3 to obtain chopped clotted bone marrow; (3) contacting the chopped clotted bone marrow to at least one or combinations of enzymes in presence
of a buffer to obtain a clotted bone marrow reaction solution; (4) incubating the clotted bone marrow reaction solution at a temperature in a range of 35°C to 39°C for a time of at least 20 minutes at a speed in a range of 100 rpm to 200 rpm to obtain incubated clotted bone marrow reaction solution; (5) contacting the incubated clotted bone marrow reaction solution of step (4) to a growth medium to obtain a suspension, wherein the growth medium is selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; (6) mixing the suspension for a plurality of repeats; (7) filtering the suspension of step (6) with a cell strainer with a pore size in a range of 50μm - 100μm to obtain a filtrate; (8) centrifuging the filtrate at 1300 rpm to 1800 rpm for a time in a range of 10 minutes to 15 minutes to obtain a cell pellet; and (9) dissolving the cell pellet with a nutrient medium to obtain a mesenchymal stem cell suspension, wherein the nutrient medium comprises 10% to 20% of a platelet lysate, and a medium selected from a group consisting of a-MEM, DMEM, IMDM, F12, EMEM and combinations thereof, and a plurality of factors selected from a group consisting of L-Glutamine, FGF, TGF, and wherein the platelet lysate comprises a lysate obtained from a mixture of an umbilical cord blood (UCB) derived platelet-rich plasma and a maternal blood (MB) derived platelet-rich plasma, and the mixture of an umbilical cord blood (UCB) derived platelet-rich plasma and a maternal blood (MB) derived platelet-rich plasma comprises 0.3×109 to 1×109 platelets/ml.
[00130] In an embodiment of the present disclosure, there is provided a method for preparing osteoblast cell suspension from mesenchymal stem cell suspension, said method comprising: (i) seeding in a culture flask, a mesenchymal stem cell suspension in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium, to obtain culture flask-adhered mesenchymal stem cells; (ii) culturing the adhered mesenchymal stem cells in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium; (iii) supplementing the nutrient medium of step (ii) with differentiation factors and growth factors to obtain a differentiation medium; (iv) complementing the differentiation nutrient medium of step (iii) with fresh differentiation nutrient medium comprising 10% to 20% of a platelet lysate, differentiation factors and growth factors to obtain a population of
pre-osteoblast cells; (v) sub-culturing the population of pre-osteoblast cells of step (iv) for a time in a range of 12 to 15 days to obtain a P1 pre-osteoblast cells; (vi) expanding the P1 pre-osteoblast cells in a P1 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P1 expansion nutrient medium for a time in a range of 12 to 15 days to obtain expanded P1 pre-osteoblast cells, and sub-culturing the expanded P1 pre-osteoblast cells, to obtain a P2 osteoblast cells; and (vii) expanding the P2 osteoblast cells in a P2 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P2 expansion nutrient medium to obtain osteoblast cell suspension, wherein the mesenchymal stem cell suspension is prepared using a method as described herein, and wherein nutrient medium for culturing the adhered mesenchymal stem cells comprises a medium selected from a group consisting of α-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; and a plurality of factors selected from a group consisting of L-glutamine, FGF, TGF, and wherein the differentiation medium comprises a medium selected from a group consisting of α-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; and a plurality of factors selected from a group consisting of L-glutamine, FGF, TGF, IGF, L-thyroxine, calcitrol, stanozolol, dexamethasone, and wherein the P1 expansion medium comprises a medium selected from a group consisting of α-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; and a plurality of factors selected from a group consisting of L-glutamine, F12, genistein, FGF, TGF, IGF, and wherein the P2 expansion medium comprises a medium selected from a group consisting of α-MEM, DMEM, IMDM, F12, EMEM and combinations thereof; and a plurality of factors selected from a group consisting of L-glutamine, F12, genistein, FGF, TGF, IGF.
[00131] In an embodiment of the present disclosure, there is provided a method for preparing osteoblast cell suspension from mesenchymal stem cell suspension, said method comprising: (i) seeding in a culture flask, a mesenchymal stem cell suspension in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium, to obtain culture flask-adhered mesenchymal stem cells; (ii) culturing the adhered mesenchymal stem cells in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium; (iii) supplementing the nutrient
medium of step (ii) with differentiation factors and growth factors to obtain a differentiation medium; (iv) complementing the differentiation nutrient medium of step (iii) with fresh differentiation nutrient medium comprising 10% to 20% of a platelet lysate, differentiation factors and growth factors to obtain a population of pre-osteoblast cells; (v) sub-culturing the population of pre-osteoblast cells of step (iv) for a time in a range of 12 to 15 days to obtain a P1 pre-osteoblast cells; (vi) expanding the P1 pre-osteoblast cells in a P1 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P1 expansion nutrient medium for a time in a range of 12 to 15 days to obtain expanded P1 pre-osteoblast cells, and sub-culturing the expanded P1 pre-osteoblast cells, to obtain a P2 osteoblast cells; and (vii) expanding the P2 osteoblast cells in a P2 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P2 expansion nutrient medium to obtain osteoblast cell suspension, wherein the mesenchymal stem cell suspension is prepared using a method as described herein, and wherein the mesenchymal stem cells are culture flask-adherent, nucleated, and stain with crystal violet stain, and wherein the mesenchymal stem cells test positive in flow cytometry cell surface marker analysis for CD90, CD73 and CD105, and negative for CD34 and HLA-DR, and wherein the mesenchymal stem cells test positive for OCT-4, Nanog, and Sox-2 markers in RT-PCR analysis, and wherein the P1 pre-osteoblast cells test positive in flow cytometry cell surface marker analysis for bone ALP, and wherein the P1 pre-osteoblast cells test positive for ALP, collagen-1, osterix, and runx2 and negative for ephrinB4 markers in RT-PCR analysis, and wherein the P1 pre-osteoblast cells test positive for bone ALP by histochemical analysis, and wherein the P2 osteoblast cells test positive in flow cytometry cell surface marker analysis for ALP, and the P2 osteoblast cells test positive for alizarin red staining, and wherein the P2 osteoblast cells test positive for bone ALP, collagen-1, osterix, runx2 and ephrinB4 markers in RT-PCR analysis, and wherein the osteoblast cells are in a range of 12X106 cells to 60x106 cells.
[00132] In an embodiment of the present disclosure, there is provided a method for preparing osteoblast cell suspension from mesenchymal stem cell suspension, said method comprising: (i) seeding in a culture flask, a mesenchymal stem cell
suspension in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium, to obtain culture flask-adhered mesenchymal stem cells; (ii) culturing the adhered mesenchymal stem cells in a nutrient medium comprising 10% to 20% of a platelet lysate in the nutrient medium; (iii) supplementing the nutrient medium of step (ii) with differentiation factors and growth factors to obtain a differentiation medium; (iv) complementing the differentiation nutrient medium of step (iii) with fresh differentiation nutrient medium comprising 10% to 20% of a platelet lysate, differentiation factors and growth factors to obtain a population of pre-osteoblast cells; (v) sub-culturing the population of pre-osteoblast cells of step (iv) for a time in a range of 12 to 15 days to obtain a P1 pre-osteoblast cells; (vi) expanding the P1 pre-osteoblast cells in a P1 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P1 expansion nutrient medium for a time in a range of 12 to 15 days to obtain expanded P1 pre-osteoblast cells, and sub-culturing the expanded P1 pre-osteoblast cells, to obtain a P2 osteoblast cells; and (vii) expanding the P2 osteoblast cells in a P2 expansion nutrient medium comprising 10% to 20% of a platelet lysate in the P2 expansion nutrient medium to obtain osteoblast cell suspension, wherein the platelet lysate comprises a lysate obtained from a mixture of an umbilical cord blood (UCB) derived platelet-rich plasma and a maternal blood (MB) derived platelet-rich plasma, and wherein the mixture of an umbilical cord blood (UCB) derived platelet-rich plasma and a maternal blood (MB) derived platelet-rich plasma comprises 0.3×109 to 1×109 platelets/ml. In another embodiment of the present disclosure, the mixture of an umbilical cord blood (UCB) derived platelet-rich plasma and a maternal blood (MB) derived platelet-rich plasma comprises 0.3×109 to 0.7×109 platelets/ml. In yet another embodiment of the present disclosure, the mixture of an umbilical cord blood (UCB) derived platelet-rich plasma and a maternal blood (MB) derived platelet-rich plasma comprises 0.3×109 to 0.5×109 platelets/ml.
[00133] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain
a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject.
[00134] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample. [00135] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample, and wherein the mesenchymal stem cell suspension is cultured in presence of a nutrient medium comprising a platelet lysate to obtain the osteoblast cell suspension, and the platelet lysate comprises a lysate obtained from a mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma, and the mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma comprises 0.3×109 to 1×109 platelets/ml.
[00136] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the first mixture comprises 100-600 IU/ml thrombin. In another embodiment of the present disclosure, the first mixture comprises 200-550 IU/ml thrombin [00137] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the third mixture comprises 20-100 mg/ml of fibrinogen. In another embodiment of the present disclosure, the third mixture comprises 25-70 mg/ml of fibrinogen [00138] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the first nutrient medium of step (b) or the second nutrient medium of step (e) comprises at least one medium selected from a group consisting of DMEM, αMEM, IMDM, and combinations thereof.
[00139] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the osteoblast cell suspension comprises osteoblast cells in a range of 12X106 cells to 60X106 cells. In another embodiment of the present disclosure, the osteoblast cell suspension comprises osteoblast cells in a range of 24X106 cells to 55X106 cells. In yet another embodiment, the osteoblast cell suspension comprises osteoblast cells in a range of 40X106 cells to 55X106 cells.
[00140] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the mixing of the second mixture and the third mixture, and the delivering of the osteoblast cell suspension is done by a dual syringe device.
[00141] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the second
mixture and the third mixture is mixed in a ratio having a range of 1:0.5 to 1:2. In another embodiment of the present disclosure, the second mixture and the third mixture is mixed in a ratio having a range of 1:0.8 to 1:1.5. In yet another embodiment of the present disclosure, the second mixture and the third mixture is mixed in a ratio of 1:1.
[00142] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the method achieves in-vivo bone regeneration.
[00143] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein fibrinogen is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
[00144] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g)
delivering the osteoblast cell-mixture to a site in a subject, wherein thrombin is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
[00145] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the osteoblast cell-mixture forms a gel network in a time in a range of 3-6 minutes. [00146] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the osteoblast cell-mixture comprises autologous osteoblast cells.
[00147] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein the method is used to correct conditions selected from a group consisting of non-union fracture, fibrous dysplasia, avascular necrosis, oral and maxillofacial fractures, and sinus lift.
[00148] In an embodiment of the present disclosure, there is provided a
method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein thrombin is obtained by a method comprising: (i) mixing umbilical cord blood plasma with maternal blood plasma to obtain mixture A; (ii) contacting saturated ammonium sulphate/ ethanol to the mixture A in a ratio selected from a group consisting of 1:1, 2:1 and 3:1, wherein the ratio is between cord blood in mixture A and the saturated ammonium sulphate/ethanol, and allowed to precipitate plasma proteins for 5-20 minutes to obtain a mixture B; (iii) centrifuging the mixture B at 3000–5000 rpm for 5-10 minutes to separate protein precipitate in form of a pellet from a supernatant; (iv) discarding the supernatant and adding 4-5ml of a solution A to the pellet to obtain a pellet solution; (v) centrifuging the pellet solution, and collecting supernatant; (vi) lyophilizing the supernatant under vacuum conditions to obtain a lyophilized protein powder; (vii) dissolving the lyophilized protein powder in a solution B to obtain a protein solution; (viii) extracting prothrombin by ion exchange chromatography using diethyl aminoethyl (DEAE-IEC) followed by heparin affinity chromatography (A second DEAE – IEC step), followed by immobilized metal affinity chromatography (IMAC), and collecting prothrombin; (ix) activating prothrombin obtain crude thrombin and purifying crude thrombin by hydrophobic interaction chromatography (HIC), to obtain purified thrombin; (x) concentrating the purified thrombin, to obtain thrombin, wherein the solution A and solution B is independently selected from a group consisting of water, saline, and Dulbecco’s phosphate buffer saline.
[00149] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first
mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and (g) delivering the osteoblast cell-mixture to a site in a subject, wherein fibrinogen is obtained by a method comprising: (i) mixing umbilical cord blood plasma with maternal blood plasma to obtain mixture A; (ii) contacting saturated ammonium sulphate/ ethanol to the mixture A in a ratio selected from a group consisting of 1:1, 2:1 and 3:1, wherein the ratio is between cord blood in mixture A and the saturated ammonium sulphate/ethanol, and allowed to precipitate plasma proteins for 5-20 minutes to obtain a mixture B; (iii) centrifuging the mixture B at 3000–5000 rpm for 5-10 minutes to separate a pellet from a supernatant; (iv) lyophilizing the supernatant under vacuum conditions resulting in a lyophilized protein powder, wherein the lyophilized protein powder comprises fibrinogen wherein the solution A is selected from a group consisting of water, saline, and Dulbecco’s phosphate buffer saline. [00150] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject.
[00151] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first
mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) performing curettage to clean necrosed bone present in the defect area; (j) washing the holes by a saline solution; (k) adjusting position of the subject in a gravity-dependent position; (l) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (m) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject.
[00152] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample.
[00153] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second
nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample, and wherein the mesenchymal stem cell suspension is cultured in presence of a nutrient medium comprising a platelet lysate to obtain the osteoblast cell suspension, and the platelet lysate comprises a lysate obtained from a mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma, and mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma comprises 0.3×109 to 1×109 platelets/ml.
[00154] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the first mixture comprises 100-600 IU/ml thrombin. In another embodiment of the present disclosure, the first mixture comprises 200-600 IU/ml
thrombin. In yet another embodiment, the first mixture comprises 300-550 IU/ml thrombin
[00155] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the third mixture comprises 20-100 mg/ml of fibrinogen. In another embodiment, the third mixture comprises 50-100 mg/ml of fibrinogen. [00156] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the first nutrient medium of step (b) or the second nutrient medium of step (e) comprises at least one medium selected from a group consisting of DMEM, αMEM, IMDM, and combinations thereof.
[00157] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the osteoblast cell suspension comprises osteoblast cells in a range of 12X106 cells to 60X106 cells. In another embodiment of the present disclosure, the osteoblast cell suspension comprises osteoblast cells in a range of 24X106 cells to 55X106 cells. In yet another embodiment, the osteoblast cell suspension comprises osteoblast cells in a range of 40X106 cells to 52X106 cells.
[00158] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the injecting of the osteoblast cell-mixture is done by a dual syringe device.
[00159] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the second mixture and the third mixture is mixed in a ratio having a range of 1:0.5 to 1:2. In another embodiment of the present disclosure, the second mixture and the third mixture is mixed in a ratio of 1:1.
[00160] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the method achieves in-vivo bone regeneration. [00161] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first
mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein fibrinogen is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
[00162] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein thrombin is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
[00163] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c)
with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the osteoblast cell-mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cell-mixture into the subject, wherein the gel network is formed in a time in a range of 3-6 minutes.
[00164] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the osteoblast cell-mixture comprises autologous osteoblast cells. In another embodiment of the present disclosure, the osteoblast cell-mixture comprises allogenic osteoblast cells.
[00165] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes
through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein the method is used to correct conditions selected from a group consisting of non-union fracture, fibrous dysplasia, avascular necrosis, oral and maxillofacial fractures, and sinus lift.
[00166] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein drilling holes is through a 7/9 mm sized reamer made by standard core decompression method to approach a necrotic area, and the necrotic area is debrided with the help of long surgical scoops to gain access to a defect area, and wherein in the defect area, long spinal needle is inserted in core decompression tunnel and tip is placed at the defect area region under C-Arm guidance. [00167] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising
lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein thrombin is obtained by a method comprising: (i) mixing umbilical cord blood plasma with maternal blood plasma to obtain mixture A; (ii) contacting saturated ammonium sulphate/ ethanol to the mixture A in a ratio selected from a group consisting of 1:1, 2:1 and 3:1, wherein the ratio is between cord blood in mixture A and the saturated ammonium sulphate/ethanol, and allowed to precipitate plasma proteins for 5-20 minutes to obtain a mixture B; (iii) centrifuging the mixture B at 3000–5000 rpm for 5-10 minutes to separate protein precipitate in form of a pellet from a supernatant; (iv) discarding the supernatant and adding 4-5ml of a solution A to the pellet to obtain a pellet solution; (v) centrifuging the pellet solution, and collecting supernatant; (vi) lyophilizing the supernatant under vacuum conditions to obtain a lyophilized protein powder; (vii) dissolving the lyophilized protein powder in a solution B to obtain a protein solution; (viii) extracting prothrombin by ion exchange chromatography using diethyl aminoethyl (DEAE-IEC) followed by heparin affinity chromatography (A second DEAE – IEC step), followed by immobilized metal affinity chromatography (IMAC), and collecting prothrombin; (ix) activating prothrombin obtain crude thrombin and purifying crude thrombin by hydrophobic interaction chromatography (HIC), to obtain purified thrombin; (x) concentrating the purified thrombin, to obtain thrombin, wherein the solution A and solution B is independently selected from a group consisting of water, saline, and Dulbecco’s phosphate buffer saline.
[00168] In an embodiment of the present disclosure, there is provided a method of delivering osteoblast cells into a subject, said method comprising: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; (f) mixing the second mixture of step (c)
with the third mixture of step (e), to obtain an osteoblast cell-mixture; (g) incising lateral side of an affected area in a subject to create an incision; (h) drilling holes through the incision to gain access to a defect area; (i) adjusting position of the subject in gravity-dependent position; (j) injecting the osteoblast cell-mixture of step (f) into the defect area and allowing the cell mixture to form a gel network; and (k) applying standard medical procedures for suturing, to deliver osteoblast cells into the subject, wherein fibrinogen is obtained by a method comprising: (i) mixing umbilical cord blood plasma with maternal blood plasma to obtain mixture A; (ii) contacting saturated ammonium sulphate/ ethanol to the mixture A in a ratio selected from a group consisting of 1:1, 2:1 and 3:1, wherein the ratio is between cord blood in mixture A and the saturated ammonium sulphate/ethanol, and allowed to precipitate plasma proteins for 5-20 minutes to obtain a mixture B; (iii) centrifuging the mixture B at 3000–5000 rpm for 5-10 minutes to separate a pellet from a supernatant; (iv) lyophilizing the supernatant under vacuum conditions resulting in a lyophilized protein powder, wherein the lyophilized protein powder comprises fibrinogen wherein the solution A is selected from a group consisting of water, saline, and Dulbecco’s phosphate buffer saline.
[00169] Although the subject matter has been described in considerable detail with reference to certain examples and implementations thereof, other implementations are possible.
EXAMPLES
[00170] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood
that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may apply.
[00171] The examples as described herein clearly illustrates the process followed for arriving at the present disclosure. The experimental efforts have been bought out in the present example section.
Example 1
Preparation of osteoblast cells from mesenchymal stem cells: Covering the process of obtaining MSC from clotted bone marrow and culturing the MSC to obtain osteoblast cells
[00172] Isolating MSC from clotted bone marrow sample: The bone marrow biopsy was collected in a transport vial containing transport medium (90% α-MEM+10% platelet lysate (PL)). The clotted bone marrow sample (Figure 1 and Figure 2) was not suitable for isolation of osteoprogenitor cells /MSCs and might result in discard of the bone marrow sample. To overcome this problem, clotted bone marrow sample was placed on 100μm cell strainer (Figure 3) on top of a sterile 50 ml centrifuge tube. Bone marrow was transferred and aspirated from the transport kit onto the cell strainer. Clotted bone marrow collected on cell strainer taken into an empty cell culture Petri dish using sterile forceps. Clot was chopped into small pieces of approximately 2-3 mm3 using a sterile scalpel and sterile needle. Small pieces of the clot transferred into a 50 ml centrifuge tube using the sterile forceps. [00173] To these small chopped pieces of bone clots, 10 ml of freshly prepared enzymes (Urokinase mixed with enzymes including but not limiting to collagenase enzymes (either Type I or Type II) and Hyaluronidase suspended in Hank's balanced salt solution (1X-HBSS)) was added to the clot pieces and incubated for 20- 30 min at 37°C in a shaking incubator at 150 rpm. Further, 10 ml of growth medium in the clotted biopsy-enzyme solution was added and vigorous mixing of the suspension was done using 25 ml sterile pipette. The above vigorous mixing procedure was repeated for 3-4 times. Growth medium containing bone marrow sample was filtered with 50- 100 µM cell strainer followed by centrifugation at 1300-1800 rpm for 10-15 min. After centrifugation supernatant was discarded and cell pellet dissolved with growth medium (DMEM with 10% PL/FBS). Different tests viz., cell count, cell
viability (Table-01) and other QC tests viz., sterility and mycoplasma were performed. 1ml of each nucleated cells of bone marrow cell suspension were seeded in four 35 mm Petri plates for confirmation of CFU test and cell characterization through flow cytometry. Remaining cell suspension was seeded in T75 tissue culture grade cell culture flasks for further culture, differentiation into osteoblasts and their expansion with different combination of medium viz., DMEM, F12, RPMI and α-MEM along with 10% umbilical cord blood derived Platelet lysate with maternal platelet lysate – PL with growth factor FGF. Ten different clotted bone marrow samples were used to isolate MSCs, the isolated MSCs were further differentiated to osteoblast cells. Table 1 provides MSC characterization data for samples 1-10. The sample numbers refer to the respective sample as per the context (MSCs at isolation stage, or osteoblast at differentiation/expansion stage).
[00174] Data with respect to cell count, viability, and sterility for ten samples which were isolated from clotted bone marrow have been described in Table 1.
S. No Sample ID Cell count at isolation stage Cell
viability at
isolation
stage Sterility Mycoplasma
1 Sample-01 5.1X106 98.2 No growth Negative
2 Sample-02 4.4 X106 97.5 No growth Negative
3 Sample-03 3.6 X106 96.4 No growth Negative
4 Sample-04 4.8 X106 95.7 No growth Negative
5 Sample-05 5.6 X106 90.8 No growth Negative
6 Sample-06 5.2 X106 89.6 No growth Negative
7 Sample-07 5.9 X106 93.8 No growth Negative
8 Sample-08 6.4 X106 97.5 No growth Negative
9 Sample-09 4.9 X106 92.2 No growth Negative
10 Sample-10 5.3 X106 90.8 No growth Negative
11 Sample-11 6.2 X106 91.6 No growth Negative
12 Sample-12 6.4 X106 94.5 No growth Negative
13 Sample-13 3.9 X106 90.8 No growth Negative
14 Sample-14 4.6 X106 89.9 No growth Negative
15 Sample-15 4.1 X106 96.6 No growth Negative
[00175] The data provided in Table 1 confirms the isolation of MSC from bone
marrow with good recovery.
Characterization of MSC by Flow cytometry and MSC-CFU assay
[00176] The cells were seeded for MSC-CFU assay and flow cytometry for initial
cell characterization in four 90 mm cell culture Petri plates, are used. Bone marrow
samples (2ml each) were seeded in 90 mm Petri plate cultured with Alpha MEM and
10% PL or FBS, 2mM L-Glutamine and 1X pen-strep antibiotics (growth medium)
along with growth factor such as 1-10 ng/ml FGF. These Petri plates were further
incubated in CO2 incubator with 5% CO2 at 370C temperature conditions.
[00177] Medium changes (α-MEM and 10% PL or FBS) were given at subsequence
intervals of 2-4 days up to 12-14 days in order to replenish the media which gets
depleted during cell growth and multiplication; which otherwise causes depletion of
media or acidic nature to the media leading to improper growth. Therefore, media is
changed at regular intervals.
MSC-CFU assay:
Identification of MSCs using CFU-F assay:
[00178] CFU-F assay was used to enumerate or identify the number of MSCs
within a given heterogeneous population of cells isolated from bone marrow. It was
carried out by using freshly isolated primary cells from bone marrow.
Use of Crystal Violet Staining for CFU-F Assay:
Preparation of Early Passage MSCs for the CFU-F assay:
[00179] Harvested bone marrow derived primary cells were seeded in 90 mm Petri
plate with growth medium as described above. Medium Changes were given at
alternate day. Cells were incubated in CO2 incubator at 370C at 5% under humidified
conditions. On day 14 ± 3, cultured cells were taken out from incubator and observed
under microscope for growth of the cells. After confirmation of growth, the cells
were analyzed for crystal violet staining.
Procedure for Staining the CFU-F:
[00180] After 14 ± 3 days of culture, petri plates were removed from the CO2
incubator, cell culture medium was pipetted out and cells were washed with buffer
for three times. Cells were stained with 0.5% of Crystal violet solution freshly
prepared in methanol and incubated at room temperature for 30 minutes. Stain was
discarded and then plate washed with buffer followed by air drying.
Counting Colonies:
[00181] Stained cells were observed under inverted microscope. Inverted 90 mm
dish and score bottom of dish into four equal quadrants. 90 mm dish was placed,
inverted onto the stage of a dissection microscope. Colonies were enumerated of
each plate. By definition, a colony was having a minimum of 50 cells to be
enumerated. After counting the colonies photographs of the same were taken under
100x magnification.
Results: MSC CFU- F Assay:
[00182] Table 2 depicts the results of Crystal violet in the stained plate containing
BM-MSCs colonies at 14 + 3 days of culture. Figure 4 depicts the BM-MSCs before
straining. Figure 5 depicts the Crystal violet staining showing stained BM-MSCs
colonies in petri plates. Figure 6 depicts the BM-MSC derived CFU-F colonies from
clotted bone marrow at 100X magnification after staining. Therefore, Table 2 along
with the Figures 3-6, suggest the staining of the cells, thereby signifying the isolation of MSC.
Table 2:
Sr. No Sample ID Result Remark No. of colonies obtained
1 Sample BM-MSC 01 Positive Stained MSC in colonies were observed 25
2 Sample BM-MSC 02 Positive Stained MSC in colonies were observed 35
3 Sample BM-MSC 03 Positive Stained MSC in colonies were observed 45
4 Sample BM-MSC 04 Positive Stained MSC in colonies were observed 27
5 Sample BM-MSC 05 Positive Stained MSC in colonies were observed 24
Characterization of BM-MSCs using Flow Cytometry:
[00183] Around 1 million of cultured cell suspension was taken for cell characterization through flow cytometry. They were tested for CD90, CD73, and CD105 as a positive markers and CD 3 and HLA-DR as negative markers for expression on surface of BM-MSCs. Marker characterization:
[00184] Cultured BMSCs (after 14 ± 3 days) were harvested by the process of trypsinization. Immunophenotypic characterization was performed by Fluorescence-Activated Cell Sorter (FACS) on a BD (Becton, Dickinson) FACS CANTO-2. Fluorescence excitation was carried out by using an argon-ion and a red LASER of 488nm and 632nm respectively. The fluorescence emission was collected by using corresponding detectors. Approximately 1×106 cells were stained with predefined
antibody cocktails I i.e., CD 90, CD 73, CD 105, HLA-DR and CD 34. The stained cells were incubated in the dark for 20min at room temperature, washed with FACS flow buffer (BD Biosciences) and resuspended in FACS flow buffer and then analyzed on a BD FACS canto-2. Data acquisition and analysis were accomplished by using BD FACS Diva software (BD Biosciences).
[00185] Table 3 depicts the cell surface marker expression for BM-MSCs. Figure 7 depicts the FACS data for cell surface expression of different markers. Immunophenotypic results using Flow cytometry for bone marrow derived MSCs at 14 ± 3 days of culture showed CD90 and CD105 positive expression and CD34 negative expression (Representation of Sample No. 05) (Figure 7).
Sr. No. Sample ID Cell Surface Expression (%)
CD73 CD90 CD105 HLA-DR CD34
1 Sample BM-MSC01 99.8 99.9 100 0.1 3.6
2 Sample BM-MSC 02 100 99.9 100 0.1 3.5
3 Sample BM-MSC 03 99.9 100 100 0.0 4.8
4 Sample BM-MSC 04 99.8 100 100 0.2 3.2
5 Sample BM-MSC 05 94.2 94.9 92.3 1.0 1.8
Differentiation of BM-derived MSC into osteoblast cells:
[00186] After 2-5 days of seeding of bone marrow nucleated cells, non-adhered cells are washed out during the process of medium change. To the adhered cells, bone differentiation medium with combinations of 60% α-MEM, 30% IMDM and L-glutamine (2mM) with 10% umbilical cord blood derived platelet lysate with maternal blood platelet lysate – PL or FBS are used. Differentiation factors such as dexamethasone, β-glycerophosphate and L- ascorbic acid are added to the medium. Growth factors such as FGF, TGF, IGF were added to the differentiated medium. 10 ml of each freshly prepared medium are added to the culture flasks and flasks are further incubated in CO2 incubator under humidified conditions (>80% humidity) with 5% CO2 at 370C temperature conditions. The adhered cells at this stage, which is prior to expansion process have been termed as P0 (passage stage 0). Expansion and comparison with FBS or PL: Expansion:
[00187] After initiation of differentiation of MSCs into osteoblasts, media changes (EMEM + F12 + FBS/PL) were given at subsequent intervals (every three days) to achieve >70% confluency stage, the cells at this stage has been termed as P1 (first passage stage) which took around 12-15 days. Cell were washed thrice with the 1X DPBS followed by treating with 0.25% trypsin and incubated the cells at 370C for 5 mins, followed by neutralizing the incubated cells with the complete media (EMEM + F12 + FBS/PL). Cells were collected in growth media (EMEM + F12 + FBS/PL) and centrifuged at 1300 -1800 rpm for 5-10mins. Cell count, cell viability (Table 4), sterility and mycoplasma (Table 5) were done subsequently. Cell characterization with the help of flow cytometry and RT-PCR studies are performed. For the cell characterization by flow cytometry alkaline phosphatase (ALP+) and for RT-PCR ALP, collagen-1, osterix and Runx markers are tested and rest of the cells were cryopreserved.
Culturing of bone cells using FBS and umbilical cord blood derived platelet lysate (PL) with maternal blood platelet lysate:
[00188] In this study effect of platelet lysate on cell growth when added to medium and the same were compared with cell culture medium supplemented with FBS. Total Cell suspension was divided in two parts and these two parts cultured
separately. One part contains a combination of DMEM, F12, RPMI and α-MEM with 10% umbilical cord blood derived platelet lysate with maternal blood platelet lysate and another containing cell suspension cultured in combination of DMEM, F12, RPMI and α-MEM with 10% FBS. In both the cases cells were seeded with seeding density of 3000 to 5000 cells/cm2 in T-150 cell culture flasks. Medium changes were given at subsequent intervals of 2-4 days to achieve >70% at second passage stage for around 12-15 days, cells at this stage have been termed as P2 (second passage stage). Cells were washed with the 1X DPBS followed by treating the rewashed cells with 0.25% trypsin and incubated the cells at 370C for 5 mins followed by neutralizing the incubated cells with the complete media. Cells were collected with growth media and centrifuged at 1300 -1800 rpm for 5-10mins.
S. No Sample ID Cell count at P(1) stage-PL Cell count at P(1) stage-FBS Cell
viability
(%) at P(1)
stage-PL Cell
viability
(%) at P(1)
stage-FBS ALP
marker
expression
(%)-PL ALP marker
expression
(%)-FBS
1 Sample-01 14.28 14.34 97.95 98.52 90 94.9
2 Sample-02 17.79 16.45 96.15 98.02 96 96.4
3 Sample-03 17.73 13.08 95.97 96.55 92.2 87.3
4 Sample-04 19.71 15.69 96.73 97.98 91 99.1
5 Sample-05 16.23 12.28 96.09 95.89 90.5 93
6 Sample-06 17.5 12.66 97.36 97.7 97.6 96.6
7 Sample-07 17.76 19.18 98.59 98.3 90.1 93.1
8 Sample-08 18.9 16.16 97.4 97.79 95.1 97.4
9 Sample-09 18.83 8.6 96.73 96.56 94.4 96.8
10 Sample-10 15.21 15.3 95.28 97.89 93.7 97.9
11 Sample-11 17.36 21.06 96.2 98.61 92 93.9
12 Sample-12 16.43 5.71 94.04 96.59 90.9 89.2
13 Sample-13 15.6 15.78 93.87 98.06 92.8 81.1
14 Sample-14 15.7 16.03 95.08 97.42 90.4 94.1
15 Sample-15 14.39 17.68 96.65 98.52 93.4 91.6
Table 5:
S. No Sample ID Sterility Mycoplasma
1 Sample-01 No growth Negative
2 Sample-02 No growth Negative
3 Sample-03 No growth Negative
4 Sample-04 No growth Negative
5 Sample-05 No growth Negative
6 Sample-06 No growth Negative
7 Sample-07 No growth Negative
8 Sample-08 No growth Negative
9 Sample-09 No growth Negative
10 Sample-10 No growth Negative
11 Sample-11 No growth Negative
12 Sample-12 No growth Negative
13 Sample-13 No growth Negative
14 Sample-14 No growth Negative
15 Sample-15 No growth Negative
Gene expression studies:
[00189] Total RNA was isolated from the cultured Mesenchymal stem cells and differentiated to osteoblasts cells by total RNA extraction method. Extracted RNA was quantified and using reverse transcriptase technique RNA was transcribed in the presence of oligo-dT primers for complementary DNA (cDNA) synthesis. The expression of different genes was assessed by using SYBR-Green RT-PCR master mix. Real-time PCR Master Mix containing, syber green probes, specific primers,
and cDNA were mixed, and real-time RT-PCR was performed using a Rotar gene Q Real-Time RT-PCR. The primers used are shown in below table. Gene expressions was normalized to the reference gene GAPDH and calculated as the relative as the relative expression compared to control cells. Comparative analysis of the 12 different gene expression was done in cultured MSCs, differentiated pre-osteoblasts and mature osteoblasts with fold of gene expressions. Table 6 depicts the primer sequences for the genes which were analyzed.
Name of the Genes species Primer sequence*
Forward (5’ → 3’) Reverse (5’ → 3’)
OCT-4 Human GTTGATCCTCGGACCTGGCTA (SEQ ID NO: 1) GGTTGCCTCTCACTCGGTTCT (SEQ ID NO: 2)
Nanog Human GTCTTCTGCTGAGATGCCTCACA (SEQ ID NO: 3) CTTCTGCGTCACACCATTGCTAT (SEQ ID NO: 4)
Sox2 Human GCCGAGTGGAAACTTTTGTCG (SEQ ID NO: 5) GCAGCGTGTACTTATCCTTCTT (SEQ ID NO: 6)
ALP Human ACC ATT CCC ACG TCT TCA CAT TT (SEQ ID NO: 7) AGA CAT TCT CTC GTT CAC CGC C (SEQ ID NO: 8)
Collagen-1 Human GGACACAATGGATTGCAAGGCCGC (SEQ ID NO: 9) TAACCACTGCTCCACTCTGGATGG (SEQ ID NO: 10)
RunX2 Human AGA TGA TGA CAC TGC CAC CTC TG (SEQ ID NO: 11) GGG ATG AAA TGC TTG GGA ACT (SEQ ID NO: 12)
Osterix Human TAG TGG TTT GGG GTT TGT TTT ACC GC (SEQ ID NO: 13) AAC CAA CTC ACT CTT ATT CCC TAA GT (SEQ ID NO: 14)
ICAM-1 Human GGCCGGCCAGCTTATACAC (SEQ ID NO: 15) TAGACACTTGAGCTCGGGCA (SEQ ID NO: 16)
Leptin receptor Human AGGAAGCCCGAAGTTGTGTT (SEQ ID NO: 17) TCTGGTCCCGTCAATCTGA (SEQ ID NO: 18)
Ephrin B2 Human GCATCTGTCTGCTTGGTCTTTATCAA C (SEQ ID NO: 19) ATGGCTGTGAGAAGGGACTCC (SEQ ID NO: 20)
Ephrin B4 Human GAAGAAGGAGAGC TGTGTGGCAATC (SEQ ID NO: 21) GATGACTGTGAACTGTCCGTCGTT (SEQ ID NO: 22)
MEPE Human CGAGTTTTCTGTGTGGGACTACTC (SEQ ID NO: 23) CTTAGTTTTCTCAGTCTGTGGTTGAAA T (SEQ ID NO: 24)
*Oligonucleotide sequences of sense (S) and antisense (A) primers used in the real-time PCR of target and housekeeping gene.
[00190] Table 7 depicts List of RT-PCR markers used at P1 and P2 stages.
Table 7: MSC
+++ +++ +++
-
-
-
--+ +
-
Markers
Pre-osteoblast Osteoblast Osteocyte Bone
lining
cells(BLC) Osteoclast
OCT-4
- - - - -
Nanog
- - - - -
Sox2
- - - - -
ALP
+ +++ -
Collagen-1
++ +++ -
RunX2
++ +++ -
Ephrin B4
- +++ - - -
Osterix
++ +++ - - -
MEPE
- - + - -
ICAM-1
- - - + -
Leptin receptor
- - - + -
Ephrin B2
- - -- +
[00191] Table 8 depicts the difference in fold expression for different RT-PCR markers.
Table 8:
Genes Sample-01-Fold of expression Sample-02- Fold of expression Sample-03- Fold of expression
MSC (P0)
1 1 1 1 1
1 1 1 1 1 1 1 Pre-osteoblast (P1) Mature
osteoblast
(P2) MSC (P0)
1 1 1 1 1
1 1 1 1 1 1 1 Pre-osteoblast (P1) Mature
osteoblast
(P2) MSC (P0)
1 1 1 1 1
1 1 1 1 1 1 1 Pre-osteoblast (P1) Mature
osteoblast
(P2)
Oct-4
0.49 0.45
0.16 0.4
1.4 1.31
Nanog
1.15 0.98
1.18 0.74
1.18 1.31
sox2
1.18 0.8
1.26 1.45
1.49 0.89
ALP
4 9
1 2
4.8 6.7
Collagen-1
8 11
1 2
5.2 8.7
runx2
4 9.5
2 4
4.7 5.9
OSTERIX
8 13.5
2 4
3.7 4.5
ICAM -I
0 0
0 0
0.2 1
leptin
2 1.4
0.5 1
2.2 0.1
ephrinB4
1.8 2.8
3.2 4.6
7.5 10.6
MEPE
2 2
2 2
6.8 5.9
Ephrin-b2
0.4 0.3
0 1.3
0.3 0.8
[00192] The Figures 9, 10, and 11 depicts RT-PCR result for Oct-4, Nanong, Sox-2, i-cam, leptin and Ephrin genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages for the samples 1, 2, and 3 respectively.
[00193] The Figures 12, 13, and 14 depicts RT PCR result for ALP, Collagen 1, runx-2, Osterix, MEPE and EphrinB genes in MSCs, Pre-osteoblast and Osteoblasts cells at different stages for the samples 1, 2, and 3 respectively. Overall analysis of RT-PCR expression studies: Analyzing Figures 9 to 14, and Tables 7 and 8.
Oct4 Expression: At P0 stage shows higher expression compare to P1(pre-osteoblast) and P2 (mature osteoblast) stage.
Nanog Expression: P0 stage shows expression and P1 stage little more expression than P0 but P2 stage shows lower expression than P0 stage.
SOX2 Expression: P0 stage shows expression and P1 stage little more expression than P0 but P2 stage shows lower expression than P0 stage.
ALP Expression: Compared to P0 stage, P1 and P2 stage shows higher expression
Collagen-1 expression: Compared to P0 stage, P1 and P2 stage shows higher
expression.
RunX2 expression: Compared to P0 stage, P1 and P2 stage shows higher expression
Osterix Expression: Compared to P0 stage, P1 and P2 stage shows higher expression
ICAM1 expression: P0 stage shows expression and very less expression can be
observed at P1 & P2 stage.
Leptin expression: P0 shows some expression, and P1 stage little more expression
than P0 but at P2 stage it showed lower than P0 stage.
Ephrin B4 expression: Compared to P0 stage, P1 and P2 stage showed higher
expression.
MEPE Expression: Compared to P0 stage, P1 and P2 stage showed higher expression
Ephrin b2 expression: At P0 stage shows certain expression and very less expression
is observed at P1 and P2 stage.
[00194] The temporal expression of Oct-4, Nanog, SOX2, ALP, Collagen-1,
RUNX2, OSTERIX, ICAM-I, Leptin, Ephrin B4, MEPE and Ephrin-B2 to evaluate
osteoblastic phenotypic properties were studied. The gene expression results were
similar with in vivo bone remodeling system. In general, the expression levels of
collagen type I, RUNX2, OSTERIX and ALP were upregulated in the cell cultures
in the differentiated and expansion medium of the invention. The expressions of
alkaline phosphatase, RUNX2 and Osterix genes on the culture plates showed
increasing levels with increasing culturing phase/time. The expression of Oct-4,
Nanog, SOX2 seen in cultured MSCs were further downregulated in the
differentiated osteoblasts cultures of the optimized medium. The expression of
ICAM-I and Leptin were also downregulated. ICAM-I and Leptin markers of Bone
lining cells are predominantly expressed in the fully formed bone cells in in vivo
bone union. Thus, downregulation of these gene expression is a confirmatory result
of obtaining adult, live, mature osteoblasts in the culture medium.
[00195] Therefore, from the present Example, it can be established that the
osteoblast cells obtained from MSC as per the process as disclosed herein, leads to
transplantation-ready osteoblast cells which are well differentiated. The gene
expression results further establish that the osteoblast cells so obtained mimic the in-vivo bone remodeling system, therefore, providing ex-vivo cultured osteoblast cells having the potential to perform much like in-vivo cultured cells.
Example 2
Preparation of osteoblast cell-mixture
Method of preparation of fibrinogen and thrombin from discarded umbilical cord
blood and maternal blood plasma
Isolation of HSC’s from Cord blood sample:
1. Umbilical Cord blood sample was collected at hospital and shipped to the
processing facility of cord blood banking in controlled temperature at 18°C– 28°C.
2. The isolation of hematopoietic stem cells from cord blood was carried out within
72 hours from collection of cord blood.
3. Processing of umbilical cord blood sample was carried out under aseptic conditions in Biosafety cabinet.
4. Addition of sedimentation reagent into cord blood collection bag was done aseptically and then placed the collection bag on rocker for 5 minutes for proper mixing.
5. The cord blood collection bag was subjected for double sedimentation for 30-50 minutes under undisturbed conditions.
6. Leukocyte rich plasma was collected twice in processing bag after both
sedimentations.
7. The cord blood bag containing leukocyte rich plasma was centrifuged at 1500-2100 rpm for 10-20 minutes.
8. After completion of centrifugation, the cord blood bag was placed on the Auto volume expresser in biosafety cabinet and the excess cord blood plasma was collected in a separate bag.
9. This excess cord blood plasma was used for preparation of fibrinogen and thrombin. Excess cord blood plasma was stored at 2- 8°C till processing.
10. Maternal whole blood sample of same cord blood sample was tested for
Infectious diseases such as HIV, HCV, HBsAg and Syphilis Antibodies. Once
confirmation of testing is received as negative for Infectious diseases then process the cord blood plasma for preparation of fibrinogen.
11. After testing for Infectious diseases, maternal blood plasma was mixed with cord blood plasma and used for preparation of fibrinogen.
Fibrinogen Isolation Procedure: (depicted in Figure 15)
1. Additional cord blood plasma was mixed with maternal blood plasma after processing of cord blood sample is collected (Figure 16).
2. Saturated Ammonium Sulphate / Ethanol was added to the cord blood plasma in ratio of 1:1, 2:1 or 3:1 (Cord blood plasma: Ammonium sulphate/Ethanol) (Figure 17 and 18) and allowed to precipitate the plasma proteins for 5-20 minutes (Figure 19).
3. This mixture was centrifuged at 3000 – 5000 rpm for 5 minutes (Figure 20) to settle down the protein precipitate in the form of pellet.
4. The supernatant was discarded (Figure 21 and 22) and around 4ml of water for injection / Saline/ Dulbecco’s phosphate buffer saline was added to the pellet. Mixed well to dissolve the pellet properly (Figure 23).
5. This mixture is centrifuged, and the supernatant was collected in separate tube (Figure 24). This supernatant was used to prepare powdered form of fibrinogen.
6. Collected supernatant was allowed to lyophilize under vacuum conditions (Figure 25) using vacuum lyophilizer and resultant lyophilized protein powder tested for total fibrinogen, total protein and Immunoglobulin’s, if any.
7. 40-50 mg of lyophilized protein powder rich in fibrinogen was used in delivery system for osteoblast cell implantation.
Thrombin isolation procedure:
1. Additional Cord Blood plasma was mixed with maternal blood plasma after processing of cord blood sample is collected.
2. Saturated Ammonium Sulphate/ Ethanol was added to the cord blood plasma in ratio of 1:1, 2:1 or 3:1 (Cord blood plasma: Ammonium sulphate/Ethanol) and allowed to precipitate the plasma proteins for 5-20 minutes.
3. This mixture was centrifuged at 3000 – 5000 rpm for 5 minutes and allowed to settle down the protein precipitate in the form of pellet.
4. The supernatant was discarded and around 4ml of water for injection / Saline/ Dulbecco’s phosphate buffer saline was added to the pellet. Mixed well to dissolve the pellet properly.
5. This mixture was centrifuged, and the supernatant was collected in a separate tube. This supernatant was used to prepare powdered form of thrombin.
6. Collected supernatant was allowed to lyophilize under vacuum conditions using vacuum lyophiliser and lyophilized protein powder was tested for total thrombin and total protein.
7. Protein dissolved in Water for Injection (WFI)/saline/Dulbecco’s phosphate buffer saline was used for the process of thrombin extraction.
8. Prothrombin was extracted by Ion exchange chromatography using Diethyl Aminoethyl (DEAE-IEC) followed by heparin Affinity Chromatography (A second DEAE – IEC step) followed by Immobilized Metal Affinity Chromatography (IMAC).
9. Collected Prothrombin was then activated to thrombin and purified by Hydrophobic Interaction Chromatography (HIC) and concentrated by Ultrafiltration.
10. This isolated thrombin (Figure 26) is tested for total protein content and concentration of thrombin per microliter (µl).
11. 500 IU of isolated thrombin was mixed with cell and later on cord blood and maternal blood derived protein rich in fibrinogen and used for osteoblasts cell mixture delivery system.
Method for preparing osteoblast cell-mixture using fibrinogen and thrombin [00196] For preparing the osteoblast cell-mixture, fibrinogen and thrombin used were obtained by the process as described herein.
[00197] The process for preparing the osteoblast cell-mixture comprises: (a) obtaining thrombin; (b) contacting thrombin with a first nutrient medium, to obtain a first mixture; (c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture; (d) obtaining fibrinogen; (e) contacting fibrinogen with a
second nutrient medium, to obtain a third mixture; and (f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture. [00198] The specific process followed was as follows: (i) 1 ml of nutrient media was mixed with fibrin, and the contents were aspirated into syringe A; (ii) 1 ml of nutrient media was mixed with thrombin; (iii) 0.4 ml of osteoblast cell suspension (as described in Example 1) was mixed with 0.4 ml of thrombin (having nutrient media), and aspirated into syringe B; (iv) syringe A and B were fixed using Y- shaped dual syringe applicator and mixed, to obtain an osteoblast cell-mixture. The osteoblast cell-mixture comprises not less than 48 million osteoblast cells. In order to obtain a mixture as homogenous as possible and thus a homogenous final product, a stream of syringe A and B was simultaneously mixed.
[00199] One of the significant advantage of the process of preparing the cell mixture and transplanting the same in a subject is that it does not use additives like aprotinin and calcium chloride during the entire process.
[00200] The osteoblast cell-mixture thus obtained forms a gel in a time span of 3-6 minutes. The final volume of the cell suspension obtained by such mixture of fibrin glue along with the cultured adult live osteoblasts was 24 million in 1 ml of said composition. 1 ml of the fibrin glue amounted to two vials each of 12 million cells giving a total of 24 million cells. Further depending on the intensity of the defect site, more of the cells are supplemented. Thus, a total of 48 million cells are provided which constitutes to 12 million cells of each vial, 2 vials of fibrin powder reconstituted with the nutrient media, 2 vials of thrombin and 2 empty vials to prepare the said composition. Thus, the procedure involves a few thousand of the patients’ mesenchymal stem cells' (MSC) are harvested from the bone marrow. Mesenchymal Stem cells are specialized cells present in the bone marrow of adults which have a capacity to replace a terminally differentiated cell derived from the mesenchyme with an identical cell type, herein the osteoblasts. The stem cells are harvested, cultured, multiplied and finally differentiated into adult live cultured osteoblast. These osteoblasts at the time of implantation have a number around 48 million cells. The dead bone is curetted out and is replaced with adult live cultured osteoblast cell suspension.
[00201] The present disclosure thus emphasizes a formulation wherein 4 ml of bone marrow aspirated from the iliac crest gives an average of 6.5-7.2 x 106 nucleated cells. Differentiation of mesenchymal stem cells in vitro and giving rise to a range of osteoblast count of 50-70 x 106 osteoblasts. The number of osteoblasts formed in 1 cm3 of bone is 4.07 x 105 cells (Vashishth D, et al., “The Anatomical Record: An Official Publication of the American Association of Anatomists.” 2002 Aug; 267(4):292-5). The lowest number of osteoblasts that has been implanted is 12 x 106 cells which gives rise to 30 cm3 (3.10 cm x 3.10 cm x 3.10 cm) of bone matrix. The highest number of osteoblasts that has been implanted is 48 x 106 cells which gives rise to 117 cm3 (4.89 cm x 4.89 cm x 4.89 cm) of bone. Hence, by implantation of autologous adult live cultured osteoblasts the present disclosure has been demonstrated to have achieved new bone formation from 30 cm3 to 117 cm3. The osteoblast cell-mixture as disclosed herein has been shown to have been used for transplanting osteoblast cells in a subject in need.
Example 3
Treatment of Avascular necrosis (AV) using the osteoblast cell-mixture as
described herein
[00202] AVN, regardless of the etiology, is characterized by diminished supply of
progenitor osteoblasts, simultaneously pronounced activity of osteoclasts with
resultant imbalance in bone remodeling. Osteoclasts play a role of scavenger in
healthy bone; but in AVN, even immature osteocytes are resorbed due to enhanced
activity of osteoclasts. This leads to greatly compromised bone quality, as bone
generation is insufficient. The bone death and necrosis continue and disease
condition progresses. Thus, cell-based treatment for AVN should aim to bring back
the balance in remodeling by making available specifically osteoblasts that will
overcome their short supply due to prevailing ischemic environment. These
osteoblasts will regenerate fresh bone, like native bone.
[00203] As per the present Example, one of the treatment methodologies to treat AV
using the osteoblast cell-mixture (obtained by method as disclosed in Example 2)
comprising osteoblast cells (obtained by method as disclosed in Example 1) comprises:
1. An incision was made on lateral side of the affected area.
2. Using a 7/9 mm sized reamer, single or multiple drill holes were made by standard core decompression method to approach the necrotic area
3. The necrotic bone was gently debrided with the help of long surgical scoops.
4. The table was tilted to bring the hip joint into gravity dependent position.
5. Long spinal needle was inserted in core decompression tunnel and tip was placed at defect area region under C-Arm guidance.
6. The osteoblast cell-mixture was injected at the defect site.
7. Waited for 8-10 minutes.
8. The site was closed with standard medical procedure of suturing. Case study for treatment of AV
[00204] Primary Objective: To assess the safety of the Autologous Adult Live
Cultured Osteoblasts implantation in avascular necrosis of hip joint(s).
[00205] Secondary Objective: To evaluate the efficacy of Autologous Adult Live
Cultured Osteoblasts implantation in avascular necrosis of hip joint(s).
[00206] Number of patients: 14 patients were enrolled in the study. 14 patients
completed the study.
[00207] Product detail: Osteoblast cell prepared as per the present disclosure
(Autologous Adult Live Cultured Osteoblasts vial (0.4 mL))
[00208] Appearance: Colourless transparent vial product, which contains mixed
precipitated pale-white-coloured autologous adult live cultured osteoblasts and red
coloured fluid. This fluid becomes turbid when shaken.
[00209] Study Duration:
Total duration of participation for each subject in the study was approximately 28
weeks from the day of participation.
Total enrolment duration: Approximately 16 weeks
Total study duration: Approximately 44 weeks
Criteria for evaluation:
[00210] The safety endpoint: Incidence of adverse events (AEs) related to therapy
[00211] The efficacy endpoints are:
Change in Oxford Hip Score at visit 7 from baseline visit.
Change in Harris Hip Score at visit 7 from baseline visit.
Pain relief as per Visual Analogue Score (VAS) at visit 7 from baseline visit.
Change in MRI (Not less than 1.5 T MRI) at visit 7 from baseline visit
Change in X-ray at visit 7 from baseline visit.
Change in CT Scan at visit 7 from baseline visit.
Efficacy Evaluation:
Change in Oxford Hip Score at visit 7 from baseline visit
Table 9:
Site ID Patient ID Total
Oxford Hip Score at Baseline Total
Oxford Hip Score at Visit 07 Difference Percentage
Changes
(%) Condition (Effect)
O1 1 25 45 20 80.00 Positive
O1 2 36 45 9 25.00 Positive
O1 3 44 48 4 9.09 Positive
O1 5 22 31 9 40.91 Positive
O1 6 34 46 12 35.29 Positive
O2 1 22 44 22 100.00 Positive
O2 2 30 46 16 53.33 Positive
O3 2 29 39 10 34.48 Positive
O3 3 34 34 0 0.00 Neutral
O3 5 22 48 26 118.18 Positive
O4 1 36 41 5 13.89 Positive
O4 2 37 43 6 16.22 Positive
O4 4 29 43 14 48.28 Positive
O4 5 28 35 7 25.00 Positive
Total Mean 30.57 42.00 11.43 42.83
Standard Deviation 6.61 5.35 7.42
[00212] Conclusion: Overall change in Oxford Hip Score between baseline and visit 7 was noted as 42.83%, so it was concluded that there is highly statistically significant mean difference between baseline and visit 7 (Table 9).
Change in Harris Hip Score at visit 7 from baseline visit
Table 10:
Site ID Patient ID Total
Harris Hip
Score at
Baseline Total
Harris Hip
Score Visit
07 Difference Percentage Changes (%) Condition (Effect)
O1 1 52 93 41 78.85 Positive
O1 2 66 95 29 43.94 Positive
O1 3 82 100 18 21.95 Positive
O1 5 63 89 26 41.27 Positive
O1 6 60 94 34 56.67 Positive
O2 1 83 96 13 15.66 Positive
O2 2 77 86 9 11.69 Positive
O3 2 51 74 23 45.10 Positive
O3 3 64 64 0 0.00 Neutral
O3 5 58 100 42 72.41 Positive
O4 1 89 93 4 4.49 Positive
O4 2 75 93 18 24.00 Positive
O4 4 62 89 27 43.55 Positive
O4 5 55 87 32 58.18 Positive
Total Mean 66.93 89.50 22.57 36.98
Standard Deviation 12.20 9.84 12.95
Conclusion: Overall change in Harris Hip Score between baseline and visit 7 was noted as 36.98%, so it was concluded that there is highly statistically significant mean difference between baseline and visit 7 (Table 10).
Pain relief as per Visual Analogue Score (VAS) at visit 7 from baseline visit.
Table 11:
Site ID Patient ID Total Visual
Analogue
Score at
Baseline Total
Visual
Analogue
Score at
Visit 07 Difference Percentage
Changes
(%) Condition (Effect)
O1 1 40 10 -30 -75.00 Positive
O1 2 15 10 -5 -33.33 Positive
O1 3 20 0 -20 -100.00 Positive
O1 5 30 80 50 166.67 Negative
O1 6 40 30 -10 -25.00 Positive
O2 1 80 30 -50 -62.50 Positive
O2 2 80 20 -60 -75.00 Positive
O3 2 30 20 -10 -33.33 Positive
O3 3 40 40 0 0.00 Neutral
O3 5 40 0 -40 -100.00 Positive
O4 1 40 5 -35 -87.50 Positive
O4 2 50 10 -40 -80.00 Positive
O4 4 60 10 -50 -83.33 Positive
O4 5 70 15 -55 -78.57 Positive
Total Mean 45.36 20.00 -25.36 -47.64
Standard Deviation 20.42 20.85 29.19
Conclusion: Overall change in VAS Score between baseline and visit 7 was noted as -47.64%, so it was concluded that there is highly statistically significant mean difference between baseline and visit 7 (Table 11).
[00213] In CT-scan/MRI/X-ray studies at visit 7 (24 weeks post implant) compared to baseline recording suggest, there was marginal decrease in necrotic tissue at the affected area of AVN in seven (07) of the 14 randomized patients. Remaining patients had preservation of architecture of affected part without any worsening of the joint treated with osteoblast cells of the present disclosure. The possible reason for only marginal improvement is due to the complex nature and long process involved in osteogenesis.
Safety Evaluation: During the study period, out of 14 patients, total 04 adverse events were reported in three (03) different patients. Among the reported AEs, two events (i.e., fever and swelling on foot) were of grade 02 (moderate) and one AE (asymptomatic urinary tract infection) was of mild severity. All these AEs which were not related and were resolved on symptomatic treatment to the implantation. One patient reported serious adverse event of grade 03 (Severe). Patient with SAE had sub trochanteric fracture of right proximal femur because of accidental fall which was not considered to be related with the implantation. This patient was operated in next follow up and necessary post-operative care was provided to the patient. Conclusion: Based on the safety and efficacy results derived at 24 weeks post osteoblasts implantation in 14 patients, it is concluded that osteoblasts is safe and effective treatment option for Avascular Necrosis (AVN) patients in improving quality of life and management of pain.
Example 4
Treatment of non-union fractures using the osteoblast cell-mixture
[00214] A non-union is a fracture in bone that has not healed even at 9 months post routine treatment. The loose ends of the non-union will have compromised blood supply and it is documented that the bone resorption in this area is about 50 times higher as compared to that in healthy bone. This clearly means that osteoblast activity required for bone regeneration is greatly compromised. Thus, in many non-union,
the initial gap at the fracture site widens. If locally osteoblasts are supplied, they can reverse the imbalance in bone remodeling, support new bone formation and heal the fracture.
[00215] The surgical method of use of osteoblast cell-mixture as disclosed in the present disclosure for treatment of a non-union in any bone will vary depending on the bone and the success of any previous surgery.
[00216] Osteoblast cells can be implanted during a corrective surgery in an old non-union, where previous surgery has failed (e.g., wrong plating or nailing or screwing) or any additional plating etc. is required to be done, the non-union site is cut open using a scalpel/knife. The musculature is set apart while bleeding is kept under control. The correction procedure is performed. The gap in the exposed non-union is implanted with semi-solid osteoblasts suspension following osteoblasts preparation method. The incision is serially sutured and closed inside-out. During a process of corrective cosmetic/ plastic surgery many times, a non-union that is operated upon frequently, requires cosmetic correction. During such skin grafting procedures, the incision made can be used to access the non-union region of the concerned bone. The gap in the exposed non-union is implanted with semi-solid osteoblasts suspension following its preparation method. The topical cosmetic surgery is done alongside the implantation. As an isolated minimally invasive procedure in absence of any other complication or abnormality, and when there is no other revision or corrective surgery, the non-union can be located using an X-ray as a reference. Osteoblast cell-mixture prepared following standard protocol, can be injected through intradermal route.
Example 5
Treatment of oral and maxillofacial abnormalities using osteoblast cell-mixture as disclosed in the present disclosure
[00217] Bone is a dynamic tissue, and if it not put to use it starts regressing. Edentulous bone loss is an example, and about 50% of dental implantation processes require bone augmentation as a prerequisite. Like any other condition, in OMF conditions also, the bone remodeling is compromised with bone resorption
pronounced as compared to simultaneous bone regeneration. Here, at cellular level, recruitment of osteoblasts and their further differentiation into osteocytes to form firm bone is imbalanced, resulting in relatively enhanced osteoclast activity that results in bone loss. Thus, supplementing the affected OMF region with cultured osteoblasts would be expected to give promising results.
[00218] Many conditions with loss of teeth end up with bone loss to the extent that dental implant placing is not possible without attaining enough height, length and width of alveolar bone.
[00219] Mandibular bone augmentation - The affected length of the mandible was accessed by placing cheek protractor. The supportive use of bone graft and/or membrane and/or scaffold and/or titanium mesh is dependent on the height and width of mandible to be achieved. Surgical scalpel was used to make the first incision and to cut the flap. This will split open the mandibular ridge to make space for implant. By using appropriate drills, implant guide was placed.
[00220] The slit edges were used for placing the scaffold and membrane or titanium mesh and bone graft. Titanium mesh was fixed with screws, depending on the area covered. Underneath the mesh, the bone graft material soaked in semi-solid osteoblasts suspension (cell mixture) was fill-packed. The rest of the osteoblasts suspension was instilled over the bone graft material and ensured that it sets perfect. [00221] Primary suturing was followed by secondary suturing to close the incision. [00222] Once it was ensured that enough height and width of bone is achieved, the mesh was removed, and dental implants can be placed as appropriate.
Example 6
Treatment of bone cyst using the osteoblast cell-mixture as disclosed in the
present disclosure
[00223] Bone cysts are common in young adolescents, and most often are idiopathic,
although, the possible malignant expression cannot be negated. Surgical excision is
mandatory as is the replacement of lost bone. Other conventional methods like bone
grafting, either vascular or avascular, doesn’t lead to complete integration of the
grafted bone with the native bone. It also leaves gaps as hard grafted bone doesn’t
occupy the space available, and this leads to compromised strength and movement of the bone. As the bone is lost, replacing it with osteogenic cell population allowing bone regeneration with native bone morphology and other qualities will help regain bone function completely.
Advantages of the present disclosure:
[00224] The osteoblast cell-mixture as disclosed in the present disclosure shall be of significant advantage in terms of the encouraging clinical study that has been described in the present disclosure. The osteoblast cell-mixture ensures uniform coverage over the damaged site and has a gelling time of 3-6 minutes that ensures minimal unwanted spread of the osteoblast cell-mixture. Further, the method as disclosed in the present disclosure for preparing the osteoblast cell-mixture is fairly simple and avoids the usage of additives like aprotinin and calcium chloride which are generally used in preparing such cell mixtures. By avoiding the usage of additives, the process as disclosed in the present disclosure provides economic significance over the traditional processes and also minimizes the usage of additives in the composition that needs to be transplanted in a subject. The state-of-the-art technique exploits usage of certain additives to achieve the desired result, but the present disclosure provides a solution by avoiding the additives. Also, the timeline of recovery of a subject undergoing treatment using a process as disclosed herein comprising the osteoblast cell-mixture as disclosed herein has been found to be encouraging.
[00225] By exploiting the process of transplantation as disclosed herein, complete bone regeneration is achieved in a subject, also, it provides a platform for transplanting autogenic osteoblast cells.
I/We Claim:
1. A method for preparing an osteoblast cell-mixture, said method comprising:
a) obtaining thrombin;
b) contacting thrombin with a first nutrient medium, to obtain a first mixture;
c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture;
d) obtaining fibrinogen;
e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture; and
f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture.
2. A method of delivering osteoblast cells into a subject, said method
comprising:
a) obtaining thrombin;
b) contacting thrombin with a first nutrient medium, to obtain a first mixture;
c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture;
d) obtaining fibrinogen;
e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture;
f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture; and
g) delivering the osteoblast cell-mixture to a site in a subject.
3. A method of delivering osteoblast cells into a subject, said method
comprising:
a) obtaining thrombin;
b) contacting thrombin with a first nutrient medium, to obtain a first mixture;
c) combining the first mixture with an osteoblast cell suspension, to obtain a second mixture;
d) obtaining fibrinogen;
e) contacting fibrinogen with a second nutrient medium, to obtain a third mixture;
f) mixing the second mixture of step (c) with the third mixture of step (e), to obtain an osteoblast cell-mixture;
g) incising lateral side of an affected area in a subject to create an incision;
h) drilling holes through the incision to gain access to a defect area;
i) adjusting position of the subject in gravity-dependent position;
j) injecting the osteoblast cell-mixture of step (f) into the defect area and
allowing the cell mixture to form a gel network; and k) applying standard medical procedures for suturing, to deliver
osteoblast cell-mixture into the subject.
4. The method as claimed in any one of the claims 1 to 3, wherein the osteoblast cell suspension is prepared from a mesenchymal stem cell suspension, and said mesenchymal stem cell suspension is obtained from a clotted bone marrow sample.
5. The method as claimed in claim 4, wherein the mesenchymal stem cell suspension is cultured in presence of a nutrient medium comprising a platelet lysate to obtain the osteoblast cell suspension.
6. The method as claimed in claim 5, wherein the platelet lysate comprises a lysate obtained from a mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma.
7. The method as claimed in claim 6, wherein the mixture of an umbilical cord blood (UCB) derived platelet rich plasma and a maternal blood (MB) derived platelet rich plasma comprises 0.3×109 to 1×109 platelets/ml.
8. The method as claimed in any one of the claims 1 to 3, wherein the first mixture comprises 100-600 IU/ml thrombin.
9. The method as claimed in any one of the claims 1 to 3, wherein the third mixture comprises 20-100 mg/ml of fibrinogen.
10. The method as claimed in any one of the claims 1 to 3, wherein the first nutrient medium of step (b) or the second nutrient medium of step (e) comprises at least one medium selected from a group consisting of DMEM, αMEM, IMDM, and combinations thereof.
11. The method as claimed in claim 1, wherein the osteoblast cell-mixture is
used in transplantation of osteoblast cells into a subject.
12. The method as claimed in any one of the claims 1 to 3, wherein the osteoblast cell suspension comprises osteoblast cells in a range of 12X106 cells to 60X106 cells.
13. The method as claimed in claim 2, wherein the mixing of the second mixture and the third mixture, and the delivering of the osteoblast cell-mixture is done by a dual syringe device.
14. The method as claimed in claim 3, wherein the injecting of the osteoblast cell-mixture is done by a dual syringe device.
15. The method as claimed in any one of the claims 1 to 3, wherein the second mixture and the third mixture is mixed in a ratio having a range of 1:0.5 to 1:2.
16. The method as claimed in any one of the claims 2 or 3, wherein the method achieves bone regeneration.
17. The method as claimed in any one of the claims 1 to 3, wherein fibrinogen is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
18. The method as claimed in any one of the claims 1 to 3, wherein thrombin is obtained from a mixture of umbilical cord blood (UCB) plasma and maternal blood (MB) plasma.
19. The method as claimed in any one of the claims 1 or 2, wherein the osteoblast cell-mixture forms a gel network in a time in a range of 3-6 minutes.
20. The method as claimed in claim 3, wherein the gel network is formed in a time in a range of 3-6 minutes.
21. The method as claimed in claim 3, wherein in the defect area, curettage is done to remove necrosed bone, and a saline wash is given through the holes.
22. The method as claimed in any one of the claims 1 to 3, wherein the osteoblast cell-mixture comprises autologous osteoblast cells.
23. The method as claimed in any one of the claims 2 or 3, wherein the method is used to treat conditions selected from a group consisting of non-union fracture, fibrous dysplasia, avascular necrosis, oral and maxillofacial fractures, and sinus lift.
| # | Name | Date |
|---|---|---|
| 1 | 201921005149-STATEMENT OF UNDERTAKING (FORM 3) [08-02-2019(online)].pdf | 2019-02-08 |
| 2 | 201921005149-SEQUENCE LISTING(PDF) [08-02-2019(online)].pdf | 2019-02-08 |
| 3 | 201921005149-SEQUENCE LISTING [08-02-2019(online)].txt | 2019-02-08 |
| 4 | 201921005149-FORM 1 [08-02-2019(online)].pdf | 2019-02-08 |
| 5 | 201921005149-DRAWINGS [08-02-2019(online)].pdf | 2019-02-08 |
| 6 | 201921005149-DECLARATION OF INVENTORSHIP (FORM 5) [08-02-2019(online)].pdf | 2019-02-08 |
| 7 | 201921005149-COMPLETE SPECIFICATION [08-02-2019(online)].pdf | 2019-02-08 |
| 8 | 201921005149-Proof of Right (MANDATORY) [26-02-2019(online)].pdf | 2019-02-26 |
| 9 | 201921005149-FORM-26 [26-04-2019(online)].pdf | 2019-04-26 |
| 10 | Abstract1.jpg | 2019-05-06 |
| 11 | 201921005149-ORIGINAL UR 6(1A) FORM 26-020519.pdf | 2019-10-17 |
| 12 | 201921005149- ORIGINAL UR 6(1A) FORM 1-050319.pdf | 2019-12-27 |
| 13 | 201921005149-Request Letter-Correspondence [24-02-2020(online)].pdf | 2020-02-24 |
| 14 | 201921005149-Form 1 (Submitted on date of filing) [24-02-2020(online)].pdf | 2020-02-24 |
| 15 | 201921005149-CERTIFIED COPIES TRANSMISSION TO IB [24-02-2020(online)].pdf | 2020-02-24 |
| 16 | 201921005149-FORM 3 [22-07-2020(online)].pdf | 2020-07-22 |
| 17 | 201921005149-FORM 18A [28-07-2021(online)].pdf | 2021-07-28 |
| 18 | 201921005149-FER.pdf | 2021-10-19 |
| 19 | 201921005149-FORM 3 [27-01-2022(online)].pdf | 2022-01-27 |
| 20 | 201921005149-FER_SER_REPLY [27-01-2022(online)].pdf | 2022-01-27 |
| 21 | 201921005149-CLAIMS [27-01-2022(online)].pdf | 2022-01-27 |
| 22 | 201921005149-US(14)-HearingNotice-(HearingDate-27-05-2022).pdf | 2022-04-27 |
| 23 | 201921005149-Correspondence to notify the Controller [23-05-2022(online)].pdf | 2022-05-23 |
| 24 | 201921005149-FORM FOR SMALL ENTITY [31-05-2022(online)].pdf | 2022-05-31 |
| 25 | 201921005149-Written submissions and relevant documents [10-06-2022(online)].pdf | 2022-06-10 |
| 26 | 201921005149-Response to office action [20-12-2022(online)].pdf | 2022-12-20 |
| 27 | 201921005149-PatentCertificate21-12-2022.pdf | 2022-12-21 |
| 28 | 201921005149-IntimationOfGrant21-12-2022.pdf | 2022-12-21 |
| 1 | ISAIN2020000302_PCT_in2020_050122_17-06-202015-11-17E_30-07-2021.pdf |
| 2 | ISAIN2020000302_2020-06-1617-00-26_17-06-202015-10-26E_30-07-2021.pdf |