Technical Field
The present invention relates to a peptide having a
skin-whitening activity and a composition for skin
whitening containing the same as an active ingredient.
Background Art
Transforming growth factor beta 1 (TGF-β1) is a
factor that induces the development of tissues or the
maintenance of homeostasis through the control of growth,
differentiation, and apoptosis in various types of cells.
Transforming growth factor beta 1 has been known to
exhibit a melanogenesis inhibitory effect in melanocytes
(THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 272, No. 7,
Issue of February 14, pp. 3967-3972, 1997).
The transforming growth factor beta 1 is shown to
function to increase the degradation of tyrosinase,
which is an enzyme important for melanogenesis. In
addition, the transforming growth factor beta 1 often
inhibits melanogenesis by promoting the activity of
ERK1/2, which promotes the degradation of
microphthalmia-associated transcription factor (MITF),
which is a transcription factor that regulates the
expression of melanogenesis-involved enzymes, such as
tyrosinase, tyrosinase-associated gene-1, and
tyrosinase-associated gene-2.
The present inventors, through prior studies, have
developed a peptide based on a portion of the amino acid
sequence of the transforming growth factor beta 1, and
have verified the whitening effect of the peptide in
melanocytes. Thereafter, the present inventors have
researched structural improvement through binding with
various chemical compounds in order to maximize the
functions of the peptide, and have found a material of
3
the present invention having an improved whitening
effect compared with existing peptides through an effect
screening process.
Throughout the entire specification, many papers
and patent documents are referenced and their citations
are represented. The disclosures of the cited papers and
patent documents are entirely incorporated by reference
into the present specification, and the level of the
technical field within which the present invention falls
and the details of the present invention are thus
explained more clearly.
Detailed Description of the Invention
Technical Problem
The present inventors have endeavored to develop a
peptide having excellent skin-whitening activity. As a
result, the present inventors have established that a
peptide having the amino acid sequence of SEQ ID NO: 1
exhibits an excellent skin-whitening effect by
inhibiting melanogenesis, inhibiting the activity of
tyrosinase and inhibiting the expression of
melanogenesis-associated factors, and thus the present
inventors have completed the present invention.
Therefore, an aspect of the present invention is to
provide a peptide having skin-whitening activity, the
peptide having the amino acid sequence of SEQ ID NO: 1.
Another aspect of the present invention is to
provide a composition for skin whitening, the
composition containing the peptide.
Still another aspect of the present invention is to
provide a use of the peptide for skin whitening.
Still another aspect of the present invention is to
provide a method for skin whitening using the peptide.
Other purposes and advantages of the present
invention will become more obvious with the following
detailed description of the invention, claims and
drawings.
Technical Solution
The present inventors have endeavored to develop a
peptide having excellent skin-whitening activity. As a result, the present inventors have established that a
peptide having the amino acid sequence of SEQ ID NO: 1
exhibits an excellent skin-whitening effect by
inhibiting melanogenesis, inhibiting the activity of tyrosinase and inhibiting the expression of
melanogenesis-associated factors.
Hereinafter, the present invention will be
described in detail.
An aspect of the present invention is to provide a
peptide having skin-whitening activity, the peptide
having the amino acid sequence of SEQ ID NO: 1.
According to an embodiment of the present invention,
the peptide inhibits melanogenesis, inhibits the
activity and expression of tyrosinase, inhibits the
expression of MITF and PAR2, which are factors involved
in melanogenesis, inhibits the phosphorylation of CREB,
which is a signaling material involved in melanogenesis,
inhibits melanosome transfer involved in skin whitening,
and promotes melanosome degradation. In addition, the
peptide of the present invention inhibits hair growth.
These results indicate that the peptide of the present
invention has an excellent effect in skin whitening.
As used herein, the term “peptide” refers to a
linear molecule formed by allowing amino acid residues
to be joined to each other via peptide bonds. The
peptide of the present invention may be prepared by
chemical synthesis methods known in the art, especially,
solid-phase synthesis techniques (Merrifield, J. Amer.
Chem. Soc. 85:2149-54(1963); Stewart, et al., Solid
5
Phase Peptide Synthesis, 2nd. ed., Pierce Chem. Co.:
Rockford, 111(1984)) or liquid-phase synthesis
techniques (U.S. Patent No. 5,516,891).
The peptide of the present invention may select a
partial region of the amino acid sequence and induce a
modification at the N-terminal and/or C-terminal thereof
in order to increase the activity thereof.
For example, the C-terminal of the peptide may be
modified with a hydroxyl group (-OH), an amino group (-
NH2), an azide (-NHNH2) or the like, but is not limited
thereto.
In addition, a protective group selected from the
group consisting of an acetyl group, a fluorenyl methoxy
carbonyl group, a formyl group, a palmitoyl group, a
myristyl group, a stearyl group and polyethylene glycol
(PEG) may be bound to the N-terminal of the peptide.
Such a modification of the N-terminal and/or the Cterminal
increases the half-life of the peptide of the
present invention, leading to a high half-life for the
in vivo administration, thereby greatly improving the
stability of the peptide.
As used herein, the term “stability” refers to
storage stability (e.g., room-temperature storage
stability) as well as in vivo stability. The foregoing
protective group protects the peptide of the present
invention from attack by protein cleavage enzymes in
vivo.
An aspect of the present invention is directed to a
composition for skin whitening, the composition
containing a peptide having the amino acid sequence of
SEQ ID NO: 1 as an active ingredient.
Since the composition for skin whitening of the
present invention contains the peptide of the present
invention as an active ingredient, the description of
overlapping contents therebetween will be omitted to
6
avoid excessive complexity of the present specification.
The composition for skin whitening of the present
invention can be prepared as a cosmetic composition.
The cosmetic composition may be prepared in any
dosage form that is ordinarily prepared in the art. For
example, the cosmetic composition may be formulated as a
solution, suspension, emulsion, paste, gel, cream,
lotion, powder, soap, surfactant-containing cleanser,
oil, powder foundation, emulsion foundation, wax
foundation, spray, or the like, and more specifically,
in the dosage form of an emollient lotion, nourishing
lotion, nourishing cream, massage cream, essence, eye
cream, cleansing cream, cleansing foam, cleansing water,
pack, spray and/or powder, but is not limited thereto.
In cases where the dosage form of the cosmetic
composition is a paste, a cream or a gel, useful
examples of the carrier ingredient may be an animal oil,
a plant oil, wax, paraffin, starch, tracant, a cellulose
derivative, polyethylene glycol, silicone, bentonite,
silica, talc and/or zinc oxide.
In cases where the dosage form of the cosmetic
composition is a power or a spray, useful examples of
the carrier component may be lactose, talc, silica,
aluminum hydroxide, calcium silicate and/or polyamide
powder.
In cases where the dosage form of the cosmetic
composition is a spray, the spray may further contain a
propellant, such as chlorofluorohydrocarbon, propane,
butane and/or dimethyl ether.
In cases where the dosage form of the cosmetic
composition is a solution or an emulsion, useful
examples of the carrier ingredient may be a solvent, a
solubilizer, and/or an emulsifier, and for example,
water, ethanol, isopropanol, ethyl carbonate, ethyl
acetate, benzyl alcohol, benzyl benzoate, propylene
7
glycol, 1,3-butyl glycol oil, glycerol fatty ester,
polyethylene glycol and/or fatty acid esters of sorbitan
may be used, but are not limited thereto.
In cases where the dosage form of the cosmetic
composition is a suspension, useful examples of the
carrier ingredient may be a liquid diluent (such as
water, ethanol and/or propylene glycol), a suspending
agent (such as ethoxylated isostearyl alcohol,
polyoxyethylene sorbitol ester and/or polyoxyethylene
sorbitan ester), microcrystalline cellulose, aluminum
metahydroxide, bentonite, agar and/or tragacanth, but
are not limited thereto.
In cases where the dosage form of the cosmetic
composition is a surfactant-containing cleanser, useful
examples of the carrier ingredient may be aliphatic
alcohol sulfate, aliphatic alcohol ether sulfate,
sulfosuccinate monoester, isethionate, imidazolium
derivatives, methyl taurate, sarcosinate, fatty acid
amide ether sulfate, alkyl amido betaine, aliphatic
alcohol, fatty acid glyceride, fatty acid diethanolamide,
plant oil, lanoline derivatives and/or ethoxylated
glycerol fatty acid ester, but are not limited thereto.
The ingredients contained in the cosmetic
composition of the present invention may include, in
addition to the carrier ingredient and the peptide
having the amino acid sequence of SEQ ID NO: 1 as an
active ingredient, ingredients ordinarily used in
cosmetic compositions, for example, ordinary supplements,
such as an antioxidant, a purifier, a solubilizer,
vitamins, a pigment and/or a flavoring agent, but are
not limited thereto.
Advantageous Effects
The present invention is directed to a peptide
having skin-whitening activity and to a composition for
8
skin whitening containing the same as an active
ingredient, and the peptide inhibits melanogenesis,
inhibits the activity of tyrosinase, inhibits the
expression of melanogenesis-involved factors, and
inhibits melanosome transfer, thereby exhibiting an
excellent skin-whitening effect. In addition, the
peptide has excellent skin permeability due to the small
size thereof, and can be very favorably applied to
cosmetics due to the excellent activity and stability
thereof.
Brief Description of the Drawings
FIG. 1 is a graph showing results of evaluation of
the cytotoxicity of a peptide according to an embodiment
of the present invention.
FIG. 2a is a graph showing results of measurement
of melanin production when melanoma cell line (B16F10)
was treated with a peptide according to an embodiment of
the present invention.
FIG. 2b is an image showing results of measurement
of melanin production when melanoma cell line (B16F10)
was treated with a peptide according to an embodiment of
the present invention.
FIG. 3 provides images showing results of
observation of melanogenesis when melanoma cell line
(B16F10) was treated with a peptide according to an
embodiment of the present invention.
FIG. 4 is a graph showing results of measurement of
tyrosinase activity in cells when melanoma cell line
(B16F10) was treated with a peptide according to an
embodiment of the present invention.
FIG. 5 provides images showing results of
confirming the tyrosinase expression level in cells
using tyrosinase antibody when melanoma cell line
(B16F10) was treated with a peptide according to an
9
embodiment of the present invention.
FIG. 6 provides images showing PCR results of
confirming the gene expression change of melanogenesis
factors when melanoma cell line (B16F10) was treated
with a peptide according to an embodiment of the present
invention.
FIG. 7 provides images showing results of
confirming changes in the protein expression of
melanogenesis factors using antibodies specific to
proteins of the melanogenesis factors when melanoma cell
line (B16F10) was treated with a peptide according to an
embodiment of the present invention.
FIG. 8 provides images showing the results of
confirming the degree of phosphorylation of CREB, which
is a melanogenesis factor signaling material, when
melanoma cell line (B16F10) was treated with a peptide
according to an embodiment of the present invention.
FIG. 9 provides images showing PCR results of
confirming the change in the expression of a gene
involved in the activity and phagocytosis of
keratinocytes when human keratinocyte cell line (HaCat)
was treated with a peptide according to an embodiment of
the present invention.
FIG. 10 is a graph showing the results of
confirming the inhibition of melanosome transfer into
keratinocytes when human keratinocyte cell line (HaCat)
was treated with a peptide according to an embodiment of
the present invention.
FIG. 11 provides images showing the results of
confirming the inhibition of melanosome phagocytosis of
keratinocytes when human keratinocyte cell line (HaCat)
was treated with a peptide according to an embodiment of
the present invention.
FIG. 12 provides images showing the results of a
keratinocyte phagocytosis assay using fluorescent10
conjugated bioparticles in order to observe the
melanosome transfer inhibitory effect according to an
embodiment of the present invention.
FIG. 13 is a graph showing the results of
confirming the melanosome degradation ability in
keratinocytes when human keratinocyte cell line (HaCat)
was treated with a peptide according to an embodiment of
the present invention.
FIG. 14a provides an image showing results of
observation of the in vivo whitening effect when a
peptide according to an embodiment of the present
invention was liposomized and applied to the tail of
C57BL/6 mice.
FIG. 14b provides an image showing results
(comparative example) of observation of the in vivo
whitening effect when a peptide according to an
embodiment of the present invention was liposomized and
applied to the tail of C57BL/6 mice.
FIG. 14c provides an image showing results
(example) of observation of the in vivo whitening effect
when a peptide according to an embodiment of the present
invention was liposomized and applied to the tail of
C57BL/6 mice.
FIGS. 15a to 15f are images showing results of
observation of hair growth rates on day 0, 7, 10, 13, 15,
and 17 after a peptide according to an embodiment of the
present invention was liposomized and applied to the
dorsal skin of C57BL/6 mice, from which the hairs had
been removed.
Mode for Carrying Out the Invention
Hereinafter, the present invention will be
described in detail with reference to examples. These
examples are only for illustrating the present invention
more specifically, and it will be apparent to those
11
skilled in the art that the scope of the present
invention is not limited by these examples.
EXAMPLES
Synthesis Example 1: Peptide synthesis
Into a reaction container, 700 mg of chloro trityl
chloride resin (CTL resin, Nova Biochem Cat No. 01-64-
0021) was placed, and 10 ㎖ of methylene chloride (MC)
was added, followed by stirring for 3 minutes.
Thereafter, the solution was removed, 10 ㎖ of
dimethylform amide (DMF) was added, followed by stirring
for 3 minutes, and then the solvent was again removed.
Into a reactor, 10 ㎖ of a dichloromethane solution was
placed, and 200 mmole Fmoc-Asp(OtBu)-OH (Bachem, Swiss)
and 400 mmole diisopropyl ethylamine (DIEA) were added.
The mixture was thoroughly dissolved with stirring, and
the reaction was conducted with stirring for 1 hour.
After the reaction, the resulting material was washed,
and methanol and DIEA (2:1) were dissolved in
dichloromethane (DCM), followed by reaction for 10
minutes, and then the resulting material was washed with
excess DCM/DMF (1:1). After the solution was removed, 10
㎖ of dimethylform amide (DMF) was added, followed by
stirring for 3 minutes, and then the solvent was again
removed. Into a reaction container, 10 ㎖ of a
deprotection solution (20% piperidine/DMF) was placed,
followed by stirring at room temperature for 10 minutes,
and then the solution was removed. An equal amount of a
deprotection solution was added, and then the reaction
was again allowed to continue for 10 minutes, followed
by removal of the solution. The resulting material was
washed twice with DMF, once with MC, and once with DMF,
for 3 minutes each, thereby preparing Asp-CTL resin.
12
Into a new reactor, 10 ㎖ of a DMF solution was placed,
and 200 mmol Fmoc-Gly-OH (Bachem, Swiss), 200 mmol HoBt,
and 200 mmole Bop were added, and the mixture was
thoroughly dissolved with stirring. Into a reactor, 400
mmole DIEA was added in two portions, and then stirring
was conducted for at least 5 minutes until all solids
were dissolved. The dissolved amino acid mixed solution
was placed in the reactor containing the deprotected
resin, and the reaction was conducted with stirring at
room temperature for 1 hour. After the reaction liquid
was removed, stirring was conducted using a DMF solution
three times for 5 minutes each time, followed by removal
of the DMF solution. A small amount of the reaction
resin was taken to check the extent of the reaction
using the Kaiser test (Ninhydrin test). Using the
deprotection solution, the deprotection reaction was
conducted twice in the same manner as described above to
prepare Gly-Asp-CTL resin. After sufficient washing with
DMF and MC, the Kaiser test was again conducted, and
then the following amino acid attachment test was
conducted in the same manner as described above. Based
on the selected amino acid sequence, a chain reaction
was carried out in the order of Fmoc-Arg(Pbf)-OH, Fmoc-
Gly-OH, Fmoc-Gly-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Gln(Trt)-OH,
Fmoc-Thr(tBu)-OH, Fmoc-Asp(OtBu)-OH, Fmoc-Leu-OH, Fmoc-
Ser(tBu)-OH, Fmoc-Trp-OH, and Fmoc-Ile-OH. The Fmocprotective
group was reacted twice with a deprotection
solution for 10 minutes for each time, and then washed
thoroughly. Thereafter, the activated valproic acid was
bound, and then the prepared peptidyl resin was washed
three times with DMF, MC, and methanol for each time,
dried under slow-flowing nitrogen gas, and completely
dried by vacuum-drying under P2O5. Then, 30 ㎖ of a
missing solution (81.5% trifluoroacetic acid (TFA), 5%
13
distilled water, 5% thioanisole, 5% phenol, 2.5% EDT,
and 1% TIS) was added, and the reaction was allowed to
continue for 2 hours while the mixture was
intermittently stirred at room temperature. The resin
was obtained through filtration, and the resin was
washed with a small amount of a TFA solution, and then
mixed with the stock solution. The distillation was
conducted under reduced pressure to leave about half of
the total volume, and then 50 ㎖ of cold ether was added
to induce precipitation. Thereafter, the precipitate was
collected by centrifugation, followed by washing twice
with cold ether. The stock solution was removed, and the
precipitate was sufficiently dried under nitrogen, to
synthesize 0.8 g of Valprooyl-Ile-Trp-Ser-Leu-Asp-Thr-
Gln-Tyr-Gly-Gly-Arg-Gly-Asp-COOH, peptide 1 (SEQ ID No.
1) before purification (yield: 89.0%). The molecular
weight of the peptide was found to be 1593.7
(theoretical value: 1593.7) when measured using a
molecular weight meter.
[Table 1]
SEQ ID
NO
Amino acid sequence
(5’->3’)
Analytical value
(mass spectrometer)
Analytical
value
Theoretical
value
1 VC-IWSLDTQYGGRGD 1593.7 1593.7
Example 1: Cytotoxicity Test
After melanin-forming cells (B16F10 cell line)
dispensed in 48-well culture plates were incubated in a
37℃ incubator for 24 hours, the medium for each plate
was removed and replaced with serum-free medium, and
then the cells were treated with the peptide of the
present invention at different concentrations (1, 10, 50,
100, 150, 200 uM). After the cells were incubated for 72
hours, the MTT reagent was added, followed by reaction
14
for 4 hours. Then, the generated formazan was dissolved
in DMSO, and the absorbance was measured at 560 nm.
As a result of performing the MTT assay to examine
whether the cytotoxicity of the peptide having the amino
acid sequence of SEQ ID NO: 1 on melanocytes, it was
verified that no cytotoxicity was observed in the groups
treated with 1 uM to 200 uM (FIG. 1).
Example 2: Measurement of melanin production
After melanin-forming cells (B16F10 cell line)
dispensed in 6-well culture plates were incubated in a
37􀀀 incubator for 24 hours, the medium for each plate
was removed and then replaced with new medium (2% serum
medium). Then, the cells were treated with α-MSH (200
ng/ml), arbutin (200, 500 uM), or the peptide of the
present invention at different concentrations (50, 100,
200 uM). Thereafter, the cells were incubated for 72
hours, and then the culture medium was removed. The
cells were detached and then transferred into a 1.5 ㎖
tube, followed by centrifugation at 13,000 rpm for 3
minutes. The supernatant was removed, and cell pellets
were collected to observe melanin. Then, 150 ㎕ of 2 M
NaOH was added to the cell pellets to lyse intracellular
melanin at 60℃ for 30 minutes. Then, 100 ㎕ of the
supernatant obtained from the lysis was added into each
well of a 96-well plate, and the absorbance at 490 nm
was measured. The results are shown in FIGS. 2a and 2b.
As can be seen from FIGS. 2a and 2b, the
melanogenesis inhibitory effect of the peptide having
the amino acid sequence of SEQ ID NO: 1 in a dosedependent
manner was verified (**P≤ 0.01).
Example 3: Visual observation of melanin production
After melanin-forming cells (B16F10 cell line)
15
dispensed in 6-well culture plates were incubated in a
37􀀀 incubator for 24 hours, the medium for each plate
was removed and replaced with new medium (10% serum
medium). Then, the cells were treated with α-MSH (200
ng/ml), arbutin (500 uM), or the peptide of the present
invention at different concentrations (50, 100, 200 uM).
The cells were incubated for 72 hours, and then the
formed melanin was observed through an optical
microscope. The results are shown in FIG. 3.
As can be seen from FIG. 3, the melanogenesis
inhibitory effect of the peptide having the amino acid
sequence of SEQ ID NO: 1 in a dose-dependent manner was
verified through cell morphology.
Example 4: Measurement of intercellular tyrosinase
activity
Melanoma cells (B16F10) were incubated in 6-well
culture plates, and then the cells were treated with α-
MSH (200 ng/ml), the peptide at different concentrations
(50, 100, 200 uM), or arbutin (200, 500 uM) as a
positive control, followed by incubation for 72 hours.
The 6-well culture plates were loaded on ice and washed
with cool PBS, and then 300 ㎕ of 0.1 M sodium phosphate
buffer (pH 6.8 lysis buffer) containing 1% Triton X-100
was added. The cells were collected in a 1.5 mL tube,
and then cell membranes were disrupted by repeating
rapid-freezing at -270℃ and thawing, five times. Then,
the tube was centrifuged at 13,000 rpm for 20 minutes,
and then the supernatant was collected in another 1.5 mL
tube, and the protein content of the samples was
quantified. The samples were diluted to have the same
protein concentration and then dispensed in three wells
each in a 96-well culture plate, and then 20 ㎕ of 1 0 mM
16
L-dopa was added, followed by incubation at 37􀀀 for 1
hour. The absorbance was measured at 475 nm, and the
results are shown in FIG. 4.
As can be seen from FIG. 4, the tyrosinase activity
inhibitory effect of the peptide having the amino acid
sequence of SEQ ID NO: 1 in a dose-dependent manner was
verified (**P≤ 0.01).
Example 5: Measurement of tyrosinase expression
level
After melanin-forming cells (B16F10 cell line)
dispensed in 6-well culture plates were incubated in a
37􀀀 incubator for 24 hours, the medium for each plate
was removed and replaced with new medium (10% serum
medium). Then, the cells were treated with α-MSH (200
ng/ml) or the peptide of the present invention at
different concentrations (50, 100 uM). Then, the cells
were incubated for 48 hours, and the intracellular
expression protein was stained with tyrosinase antibody
(Santa Cruz biotechnology, USA) and FITC-conjugated
secondary IgG antibody (Santa Cruz biotechnology, USA).
The expression level thereof was visually observed
through a fluorescence microscope, and the results are
shown in FIG. 5.
As can be seen from FIG. 5, the tyrosinase
expression inhibitory effect of the peptide having the
amino acid sequence of SEQ ID NO: 1 in a dose-dependent
manner was verified.
Example 6: Observation of change in gene expression
of melanin-forming factors
After melanin-forming cells (B16F10 cell line) were
incubated in 6-well culture plates for 24 hours, the
cells were treated with α-MSH (200 ng/ml), arbutin (500
uM), or the present peptide at different concentrations
17
(100, 200 uM). After RNA was extracted from the cells
incubated for 24 hours, cDNA was prepared. Then, PCR was
conducted using the primers shown in Table 2 below,
which are specific to MITF and tyrosinase, respectively,
as melanogenesis-involved factors, and then the change
in the expression of each gene was observed. The results
are shown in FIG. 6.
[Table 2]
SEQ ID
NO
Name
Sequence listing (5’-
>3’)
Note
2 MITF_F CCAGCCTGGCGATCATGTCAT Annealing
3 MITF_R GGTCTGGACAGGAGTTGCTG temperature, 60􀀀
4 Tyrosinase_F GGCCAGCTTTCAGGCAGAGG Annealing
5 Tyrosinase_R TGGTGCTTCATGGGCAAAAT temperature, 60􀀀
As can be seen from FIG. 6, it was verified that
the peptide having the amino acid sequence of SEQ ID NO:
1 had strong effects of inhibiting MITF and tyrosinase
genes.
Example 7: Observation of change in protein
expression of melanin-forming factors
After melanin-forming cells (B16F10 cell line) were
incubated in 6-well culture plates for 24 hours, the
cells were treated with α-MSH (200 ng/ml) or the present
peptide at different concentrations (50, 100 uM). After
the cells were incubated for 72 hours, the cells were
lysed, and the expression of MITF (Santa Cruz
Biotechnology, USA) and tyrosinase (Santa Cruz
Biotechnology, USA), which are core factors involved in
melanogenesis, was observed using a western blot method
using specific antibodies. The results are shown in FIG.
7.
As can be seen from FIG. 7, the MITF and tyrosinase
protein expression inhibitory effects of the peptide
having the amino acid sequence of SEQ ID NO: 1 in a
dose-dependent manner was verified.
18
Example 8: Observation of melanogenesis signaling
material
After melanin-forming cells (B16F10 cell line) were
incubated in 6-well culture plates for 24 hours, the
cells were treated with α-MSH (200 ng/ml) or the present
peptide at different concentrations (50, 100 uM). After
the cells were incubated for 10 minutes, the cells were
lysed, and the degree of phosphorylation of CREB, which
is a signaling material involved in melanogenesis, was
observed using a western blot method using a specific
antibody (Santa Cruz Biotechnology, USA). The results
are shown in FIG. 8.
As can be seen from FIG. 8, the CREB
phosphorylation inhibitory effect of the peptide having
the amino acid sequence of SEQ ID NO: 1 was verified.
Through the above results, the peptide having the
amino acid sequence of SEQ ID NO: 1 inhibits the MC1R
signaling pathway activated by α-MSH, thereby exhibiting
a melanogenesis inhibitory effect.
Example 9: Observation of change in expression of
gene involved in activity and phagocytosis of
keratinocytes
After a human keratinocyte line (HaCaT) was
incubated in 6-well culture plates for 24 hours, the
cells were treated with trypsin (Trypsin 4 Unit, Soybean
trypsin inhibitor 10 Unit) as an activity-inducing
material and the present peptide at different
concentrations (100, 200 uM). After RNA was extracted
from the cells incubated for 16 hours, cDNA was prepared.
PCR was conducted using a primer pair (see table 3
below) specific to PAR2, which is one of surface
receptors of keratocytes activated by a trypsin action,
and then the change in the expression of each gene was
observed. The results are shown in FIG. 9.
19
[Table 3]
SEQ ID
NO
Name
Sequence listing (5’-
>3’)
Note
6 PAR2_F TGCTAGCAGCCTCTCTCTCC Annealing temperature,
7 PAR2_R CTTCAAGGGGAACCAGATGA 60􀀀
As can be seen from FIG. 9, the gene expression was
induced by the activation of PAR2 of keratocytes
resulting from the treatment with trypsin as serine
protease, and it was observed that the treatment with
the peptide having the amino acid sequence of SEQ ID NO:
1 reduced the expression of PAR2 gene in a dosedependent
manner.
Example 10: Verification of inhibition of
melanosome transfer into keratinocytes (using isolated
melanosomes)
After human keratinocyte line (HaCaT) was cultured
in 6-well culture plates for 24 hours, the melanosomes
isolated from mouse melanoma cell line (B16F10) were
pretreated for 3 hours in serum-free culture medium, and
then the cells were treated with the present peptide at
different concentrations (10, 50, 100, 200 uM) or
arbutin (200 uM) as a positive control, followed by
incubation for 48 hours. Then, the plates were washed
with PBS to remove un-transferred melanosomes, and 1 N
NaOH was added to pellets, which had been obtained
through cell collection and precipitation. Then, 1 M
NaOH was added to the pellets, and the pellets were
dissolved in an oven at 80􀀀, and then the OD value at
490 nm was measured. In order to observe the melanosome
transfer inhibitory effect of the peptide having the
amino acid sequence of SEQ ID NO: 1 according to the
concentration, a keratinocyte phagocytosis assay was
performed using the melanosomes isolated from melanoma.
The results are shown in FIG. 10.
As can be seen from FIG. 10, as a result of
examining the amount of melanosomes transferred into
20
keratinocytes through the measurement of absorbance, the
phagocytosis inhibitory effect of the peptide having the
amino acid sequence of SEQ ID NO: 1 in a dose-dependent
manner was verified.
Example 11: Verification of inhibition of
melanosome transfer into keratinocytes (using isolated
melanosomes)
After human keratinocyte line (HaCaT) was cultured
in 6-well culture plates for 24 hours, the melanosomes
isolated from mouse melanoma cell line (B16F10) were
pretreated for 3 hours in serum-free culture medium.
Then, the cells were treated with the present peptide at
different concentrations (10, 50, 100, 200 uM) or
arbutin (200 uM) as a positive control, followed by
incubation for 48 hours. Then, the plates were washed
with PBS to remove un-transferred melanosomes, and
subjected to Fontana-Masson staining to observe the
inhibition of the melanosome phagocytosis by
keratinocytes through a microscope. In order to observe
the melanosome transfer inhibitory effect of the peptide
having the amino acid sequence of SEQ ID NO: 1 according
to the concentration, a keratinocyte phagocytosis assay
was performed using melanosomes isolated from melanoma.
The results are shown in FIG. 11.
As can be seen from FIG. 11, as a result of
examining the amount of melanosomes transferred into
keratinocytes through optical microscope image analysis,
the phagocytosis inhibitory effect of the peptide having
the amino acid sequence of SEQ ID NO: 1 in a dosedependent
manner was verified.
Example 12: Verification of inhibition of
melanosome transfer into keratinocytes (using
bioparticles)
21
After human keratinocyte line (HaCaT) was cultured
in 24-well culture plates for 24 hours, the cells were
treated with the present peptide at different
concentrations (100, 200 uM) or arbutin (200 uM) as a
positive control in 0.5% FBS culture medium, followed by
incubation for 24 hours. Thereafter, the inhibition of
phagocytosis of the human keratinocyte line was observed
using the Vybrant Phagocytosis Assay Kit (V-6694). In
order to observe the melanosome transfer inhibitory
effect of the peptide having the amino acid sequence of
SEQ ID NO: 1 according to the concentration, a
keratinocyte phagocytosis assay was performed using
fluorescent-conjugated bioparticles. The results are
shown in FIG. 12.
As can be seen from FIG. 12, as a result of
examining the amount of bioparticles transferred into
keratinocytes through fluorescent microscopic image
analysis, the phagocytosis inhibitory effect of the
peptide having the amino acid sequence of SEQ ID NO: 1
in a dose-dependent manner was verified.
Example 13: Observation of melanosome degradation
ability in keratinocytes
After human keratinocyte line (HaCaT) was cultured
in 6-well culture plates for 24 hours, melanosomes
isolated from mouse melanoma cell line (B16F10) were
pretreated for 48 hours in serum-free culture medium.
The plates were washed with PBS to remove un-transferred
melanosomes, and then the cells were treated with the
peptide at different concentrations (100, 200 uM) or
arbutin (200 uM) as a positive control, and TGFβ-1,
followed by incubation for 48 hours. In order to measure
the degradation of melanosomes phagocytized into
keratinocytes, 1 M NaOH was added to pellets obtained by
keratinocyte collection and precipitation, and the
22
pellets were dissolved in an oven at 80􀀀, and then the
OD value at 490 nm was measured. The results are shown
in FIG. 13.
As can be seen from FIG. 13, as a result of
observing the effect of the peptide having the amino
acid sequence of SEQ ID NO: 1 to promote the degradation
of the melanosomes transferred into the keratinocytes,
the effect in a dose-dependent manner was verified.
Example 14: Observation of in vivo whitening effect
Liposomal peptide (5,000 ppm) or arbutin as a
positive control was applied to the tail of 8-week-old
C57BL/6 mice once a day, and the experiment was
conducted for about 8 weeks. After the completion of the
experiment, the mice were sacrificed to extract tail
skin tissues, which were then embedded in paraffin to
manufacture paraffin blocks. Then, the paraffin blocks
were made into paraffin sections and morphologically
observed through Fontana-Masson staining. The results
are shown in FIGS. 14a to 14c.
As can be seen from FIG. 14a, as a result of the 8-
week application experiment, it was observed that the
tail color in the group treated with the liposomes
including the peptide having the amino acid sequence of
SEQ ID NO: 1 was brighter than the tail color in the
control group.
In addition, as can be seen from results of
confirmation of melanin distribution through F&M
staining in FIGS. 14b and 14c, it can be verified that
the amount of melanin distributed in the basal layer of
the epidermis in the group treated with the peptide
having the amino acid sequence of SEQ ID NO: 1 was much
smaller than that in the control group.
Example 15: Observation of in vivo hair growth
23
inhibition
The hairs on the dorsal skin of 8-week-old C57BL/6
mice were removed through waxing, and the liposomal
peptides were applied thereto once a day for 17 days to
observe the hair growth rate. The results are shown in
FIG. 15.
As can be seen from FIG. 15, as a result of
applying the liposomes including the peptide having the
amino acid sequence of SEQ ID NO: 1 on the dorsal skin
of the mice, from which the hairs had been removed
through waxing or the like, for 17 days, the hair growth
rate was found to be distinctively slower compared with
the control group.
Although the present invention has been described
in detail with reference to the specific features, it
will be apparent to those skilled in the art that this
description is only for a preferred embodiment and does
not limit the scope of the present invention. Thus, the
substantial scope of the present invention will be
defined by the appended claims and equivalents thereof.

Claims
1. A peptide having skin-whitening activity,
the peptide having the amino acid sequence of SEQ ID NO:
1.
2. The peptide of claim 1, wherein the peptide
inhibits melanogenesis.
3. The peptide of claim 1, wherein the peptide
inhibits the activity of tyrosinase.
4. The peptide of claim 1, wherein the peptide
inhibits the expression of a melanogenesis-involved
factor.
5. The peptide of claim 4, wherein the
melanogenesis-involved factor is microphthalmiaassociated
transcription factor (MITF) or proteinaseactivated
receptor 2 (PAR2).
6. The peptide of claim 1, wherein the peptide
inhibits the phosphorylation of cAMP response elementbinding
protein (CREB) which is a signaling material
involved in melanogenesis.
7. The peptide of claim 1, wherein the peptide
inhibits melanosome transfer.
8. The peptide of claim 1, wherein the peptide
exhibits the ability to promote melanosome degradation.
9. The peptide of claim 1, wherein the peptide
inhibits hair growth.
10. A composition for skin whitening, the
composition containing the peptide of any one of claims 1 to 9 as an active ingredient.