Sign In to Follow Application
View All Documents & Correspondence

Preparation Of Novel 1 H Pyrazolo[4,3 D]Pyrimidines, Their Compositions, Synthesis And Methods Of Using Them For Treating Tuberculosis

Abstract: The present invention provides novel heterocyclic compounds of Formula (I): their derivatives, analogs, tautomeric forms, stereoisomers, bioisosters, diastereomers, polymorphs, enantiomers, prodrugs and their pharmaceutically acceptable salts for the treatment of tuberculosis. Also disclosed is the process for preparing compounds of Formula (I), and intermediates useful for preparing compounds of Formula (I).

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
31 May 2019
Publication Number
49/2020
Publication Type
INA
Invention Field
CHEMICAL
Status
Email
hyderabad@knspartners.com
Parent Application
Patent Number
Legal Status
Grant Date
2023-09-12
Renewal Date

Applicants

Dr.Reddy’s Institute of Life Sciences
Prof.C.R.Rao Road University of Hyderabad campus, Gachibowli Hyderabad 500046
Jamia Hamdard University
Mehrauli-Badarpur Road Near Batra Hospital, Hamdard Nagar New Delhi

Inventors

1. Manojit Pal
Plot 17, Flat 203, Maruti Majestics Srirangapuram Colony, Miyapur, Hyderabad 500049 Telengana
2. Parimal Misra
H No 55, Vertex Privilege, Prashant Nagar Nizampet Road, Kukatpally, Hyderabad 500072
3. Aparna Srikantam
Plot No: 78/A Balaji Enclave, Kalyanpuri, Uppal Hyderabad 500039
4. Farhan Jalees Ahmad
D-60, Abul Fazal Enclave Okhla New Delhi 110025
5. Seyed Ehtesham Hasnain
102 Villa Greens, Gandipet, Hyderabad, 500075

Claims

1. A compound of Formula (I) Formula (I) or an analogue, derivative, tautomer, prodrug, stereoisomer, enantiomer, diastereomer, polymorph, pharmaceutically acceptable salts, pharmaceutically acceptable hydrates, pharmaceutically acceptable solvates and bioisosteres or a combination thereof, wherein: R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl; Ar is an optionally substituted mono, bi or tri cyclic group, preferably an aryl or heteroaryl group selected from the group consisting of phenyl, naphthyl, indole, benzoxazole and benzotriazole; and Het is an optionally substituted heterocyclyl or heteroaryl group connected by a C-C bond.

2. The compound of formula (I) as claimed in claim 1 wherein the Ar is phenyl substituted with halo group selected from a group consisting of chloro and bromo.

3. The compound of formula (I) as claimed in claim 1 wherein the R is alkyl selected from a group consisting of methyl, ethyl and propyl.

4. The compound of formula (I) as claimed in claim 1 wherein the Het is indole bi substituted with halo and alkyl groups; or indole substituted with bromo or chloro group; or indole bi substituted with bromo and methyl or ethyl groups; or indole bi substituted with chloro and methyl or ethyl groups.

5. The compound of formula (I) as claimed in claim 1 wherein the Het is selected from wherein, R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl; X is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo; and and Yis hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo.

6. A compound of Formula (I) wherein the said compounds are 5-(4-chlorophenyl)-7-(1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-1-methyl-7-(1-methyl-1H-indol-3-yl)-3-propyl-1H-pyrazolo[4,3 d]pyrimidine; 5-(4-chlorophenyl)-7-(1-ethyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-bromo-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-bromo-1-methyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-bromo-1-ethyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-7-(5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 4-chlorophenyl)-7-(5-methoxy-1-methyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-7-(1-ethyl-5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; or 7-(1-allyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine.

7. A process of preparing the compound of formula I comprising the steps of

8. A formulation of the compound of claim 1 or 6, wherein the said formulation comprises 0.2 to 0.9% of the compound, 10 to 30% of S mix consisting tween 80: PEG 400 at a ratio of 1:1 and 70 to 90% normal saline.

9. A compound as claimed in claim 1 or 6 for the treatment of mycobacterial infections.

10. A compound as claimed in claim 1 or 6 for the treatment of tuberculosis. , Description:PREPARATION OF NOVEL 1H-PYRAZOLO[4,3-D]PYRIMIDINES, THEIR COMPOSITIONS, SYNTHESIS AND METHODS OF USING THEM FOR TREATING TUBERCULOSIS RELATED APPLICATION This application is being filed as a Complete Application with the Indian Patent Office. FIELD OF THE INVENTION The present invention is related to heterocyclic compounds of Formula (I): their derivatives, analogs, tautomeric forms, stereoisomers, bioisosters, diastereomers, polymorphs, enantiomers, prodrugs and their pharmaceutically acceptable salts for the treatment of tuberculosis. Also disclosed is the process for preparing compounds of Formula (I), and intermediates useful for preparing compounds of Formula (I). BACKGROUND OF THE INVENTION The international microbiological community continues to express serious concern that the evolution of antibiotic resistance could result in strains against which currently available antibacterial agents will be ineffective. In general, bacterial pathogens may be classified as either Grain-positive or Gram-negative pathogens. Antibiotic compounds with effective activity against both Gram-positive and Gram-negative pathogens are generally regarded as having a broad spectrum of activity. Tuberculosis is a chronic, infectious disease that is generally caused by infection with Mycobacterium tuberculosis. Although the infection may be asymptomatic for a considerable period of time, the disease is most commonly manifested as an acute inflammation of the lungs, resulting in fever and a nonproductive cough. If left untreated, serious complications and death typically result. Mycobacterium tuberculosis is the bacterial agent responsible for human pulmonary tuberculosis. Mycobacterial dormancy results in a disease stage termed latent tuberculosis. An individual with latent tuberculosis may later develop a case of reactivated tuberculosis, and in fact, a majority of the tuberculosis cases reported is the result of reactivation of a latent mycobacterial infection and not an initial infection. Reactivation of the Mycobacterium tuberculosis bacilli usually occurs in the apex of the lung where large numbers of tubercle bacilli cause necrosis of the small bronchi of the lung. The characteristic bloodstained sputum of tuberculosis results from the erosion of small blood vessels during this necrotic process. Much research has been done in this area to develop efficient drugs for the treatment of tuberculosis. But most of them are failure due to some or the other reason or the invented drugs/vaccines need more efficacy than they are. Hence there is undue need to develop new drugs in the treatment of tuberculosis. The present inventors have invented novel heterocyclic compounds which are found to be active in the treatment of tuberculosis. SUMMARY OF THE INVENTION The novel heterocyclic compounds of the present invention are represented by the general Formula (I) Formula (I) their analogues, derivatives, tautomers, prodrugs, stereoisomers, enantiomers, diastereomers, polymorphs, pharmaceutically acceptable salts, pharmaceutically acceptable hydrates, pharmaceutically acceptable solvates and bioisosteres, wherein R is independently selected from hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl, optionally substituted heteroaryl; Ar is an optionally substituted mono, bi or tri cyclic group preferably an aryl or heteroaryl group such as phenyl, naphthyl, indole, benzoxazole, benzotriazole and the likes thereof; Het represents an optionally substituted heterocyclyl or heteroaryl group connected through a C-C bond. In one aspect, Ar is substituted with phenyl or halo group; In yet another aspect, Ar is phenyl substituted with halo group selected from a group consisting of chloro and bromo; The invention also provides that R represents optionally substituted alkyl; In yet another aspect, R is selected from a group consisting of methyl, ethyl and propyl; Furthermore, Het is optionally a substituted heterocyclyl or heteroarylgroup; In another aspect, Het is optionally a substituted indole group connected to the pyrimidine moiety through a C-C bond; In yet another aspect, Het is indole bi substituted with halo and alkyl groups, or indole substituted with bromo or chloro group, or indole bi substituted with bromo and methyl or ethyl groups, or indole bi substituted with chloro and methyl or ethyl groups. In yet another embodiment, Het is selected from wherein, R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl; X is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo; and and Y is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo. The invention also provides a formulation of the compounds of Formula I, comprising 0.2 to 0.9% of the compound, 10 to 30% of S mix consisting tween 80: PEG 400 at a ratio of 1:1 and 70 to 90% normal saline. BRIEF DESCRIPTION OF DRAWINGS Figure 1. Dose Response curve for7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine provided in Example 8(g). Figure 2. Direct control (1.5x108 CFU/mL) -4.2 days. Figure 3. Proportion Control (1.5x106 CFU/mL): 3.6 days. Figure 4. Example 8(g)sample: 10µM -12.2days. Figure 5. Example 8(g)sample: 30µM-no growth in proportional to control. Figure 6. Isoniazid- no growth in proportional to control. Figure 7. Particle size data of M8. Figure 8. Particle size data of M9. Figure 9. Particle size data of M10. Figure 10. Particle size data of M14. Figure 11. Particle size data of M15. Figure 12. Particle size data of M16. Figure 13. Particle size data of M17. Figure 14. DSC Curve of Example 8(g). Figure 15. Comparative Data: Oral PK Study of formulated sample of Example 8(g) at 10mg/kg and 30mg/kg respectively. DETAIL DESCRIPTION OF THE INVENTION Definitions: "Halogen" refers to Fluorine, Chlorine, Bromine or Iodine. The term "lower alkyl" refers to a straight or branched chain saturated aliphatic hydrocarbon that may be substituted or unsubstituted. Examples of "alkyl" include but are not limited to methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, n-pentyl, isobutyl and the likes thereof. The term "lower Alkoxy" refers to a group –ORbwhereinRb is hydrogen or alkyl as herein defined. Representative examples include but are not limited to methoxy, ethoxy and the likes thereof. The term "Aryl" refers to optionally substituted unsaturated or partially saturated aromatic ring system having five to ten carbon atoms whichare monocyclic, bicyclic or polycyclic and may optionally be replaced by one or more heteroatoms selected from N, O and S. Exemplary aryl groups include phenyl, naphthyl, indanyl, biphenyl and the likes thereof. The term "cycloalkyl" used herein, either alone or in combination with other radicals, denotes mono, bicyclic or polycyclic saturated, partially saturated hydrocarbon ring system of about 3 to 12 carbon atoms which may be substituted or unsubstituted. Exemplary "cycloalkyl" groups include but are not limited to cyclopopyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl, perhydronapthyl, adamantyl, noradamantylandspirobicyclic groups such as spiro (4,4)non-2-yl. The term "Heteroaryl"refers to monocyclic aromatic ring systems or fused bicyclic aromatic ring systems comprising two or more aromatic rings, preferably two to three ring systems. These heteroaryl rings contain one or more nitrogen, sulfur and/or oxygen atoms where N-oxides sulfur oxides and dioxides are permissible heteroatom substitutions. The termincludes ring(s) optionally substituted with halogens, nitro, amino, alkoxy, alkyl sulfonyl amino, alkylcarbonylamino, carboxy, alkyl carbonoyl, hydroxy, and alkyl. Examples of heteroaryl groups include furan, thiophene, pyrrole, imidazole, pyrazole, triazole, tetrazole, thiazole, oxazole, isoxazole, oxadiazole, thiadiazole, isothiazole, pyridine, pyridazine, pyrazine, pyrimidine, quinoline, isoquinoline, benzofuran, benzothiophene, indole, indazole, chromanyl, isochromanyl and the likes thereof. The term "Heterocyclyl" refers to a stable 3 to 15 membered ring that is either saturated or has one or more degrees of unsaturation or unsaturated. These heterocyclic rings contain one or more heteroatoms selected from the group consisting of nitrogen sulfur and/or oxygen atoms where N-oxides, sulfur oxides and dioxides are permissible heteroatom substitutions. Such a ring is optionally fused to one or more of another heterocyclic ring(s), aryl ring(s) or cycloalkyl ring(s). Examples of such groups are selected from the group consisting ofazetidinyl, acridinyl, pyrazolyl, imidazolyl, triazolyl, pyrrolyl, thiophenyl, thiazolyl, oxazolyl, isoxazolyl, furanyl, pyrazinyl, tetrahydroisoquinolinyl, piperidinyl, piperazinyl, morpholinyl, thiomorphonilyl, pyridazinyl, indolyl, isoindolyl, quinolinyl, chromanyl and the likes thereof. "Heterocyclylalkyl" refers to a heterocyclic ring radical defined above, directly bonded to an alkyl group. The heterocyclylalkyl radical is attached to the main structure at carbon atom in the alkyl group that results in the creation of a stable structure. Unless otherwise specified, the term "substituted" as used herein refers to mono, bi, tri or tetra substitution with any one or combination of the following substituents: hydroxy, halogen, carboxyl, cyano, nitro, oxo (=O), thio (=S), substituted or unsubstituted alkyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted amino, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclylalkyl ring, substituted or unsubstituted heteroarylalkyl, substituted or unsubstituted heterocyclic ring, substituted or unsubstiuted guanidine, - COOR2, -C(O)R2, -C(S)R2, -C(O)NR2R3, - C(O)ONR3R4, -NR2CONR3R4, - N(R2)SOR3, -N(R2)SO2R3, -(=N-N(R2)R3), - NR2C(O)OR3, -NR2R3, -NR2C(O)R3, - NR2C(S)R3, -NR2C(S)NR3R4, -SONR2R3, - SO2NR2R3, -OR2, -OR2C(O)NR3R4, - OR2C(O)OR3, -OC(O)R2, -OC(O)NR2R3, - R2NR3C(O)R4, -R2OR3, -R2C(O)OR3, - R2C(O)NR3R4, -R2C(O)R3, -R2OC(O)R2, -SR2, - SOR2, -SO2R2, and -ONO2, wherein R2, R3 and R4 are independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted amino, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted heterocyclylalkyl ring, substituted or unsubstituted heteroarylalkyl, or substituted or unsubstituted heterocyclic ring. Alternately R3 and R4 together along with the nitrogen they are attached with, form a 4 to 8 membered ring which can be substituted or unsubstituted. According to one embodiment, the substituents in the aforementioned "substituted" groups cannot be further substituted. For example, when the substituent on "substituted alkyl" is "substituted aryl" the substituent on "substituted aryl" cannot be "substituted alkenyl" "Stereoisomers" refer to certain compounds described herein containing one or more chiral centres or may otherwise be capable of existing as multiple stereoisomers. Scope of the present invention includes pure stereoisomers as well as mixtures of stereoisomers such as purified enantiomers/diastereomers or enantiomerically/diastereomerically enriched mixtures. "Bioisosteres" refers to compounds or groups that possess near molecular shapes and volumes, approximately the same distribution of electrons and which exhibit similar physical properties such as hydrophobicity. Bioisostereic compounds affect the same biochemically associated systems as agonist or antagonists and thereby produce biological properties that are related to each other. "Pharmaceutically acceptable salts" forming part of this invention include salts derived from inorganic bases such as Li, Na, K, Ca, Mg, Fe, Cu, Zn, Al, Mn; salts of organic bases such as N,N'-diacetylethylenediamine, 2- dimethylaminoethanol, isopropylamine, morpholine, piperazine, piperidine, procaine, diethylamine, triethylamine, trimethylamine, tripropylamine, tromethamine, choline hydroxide, dicyclohexylamine, metformin, benzylamine, phenylethylamine, dialkylamine, trialkylamine, thiamine, aminopyrimidine, aminopyridine, purine, pyrimidine, spermidine, and the like; chiral bases like alkylphenylamine, glycinol, phenyl glycinol and the like, salts of natural amino acids such as glycine, alanine, valine, leucine, isoleucine, lysine, arginine, serine, threonine, phenylalanine; unnatural amino acids such as D-isomers or substituted amino acids; salts of acidic amino acids such as aspartic acid, glutamic acid; guanidine, substituted guanidine wherein the substituents are selected from nitro, amino, alkyl, alkenyl, alkynyl, ammonium or substituted ammonium salts. Salts may include acid addition salts where appropriate which are sulphates, nitrates, phosphates, perchlorates, borates, hydrohalides, acetates, tartrates, maleates, citrates, succinates, methanesulfonates, benzoates, salicylates, hydroxynaphthoates, benzenesulfonates, ascorbates and the liks thereof. "Pharmaceutically acceptable solvates" may be hydrates or comprising other solvents of crystallization such as alcohols. "Compounds of the invention" or "present invention" refers to the compounds of the present invention represented by general Formula (I) as here in defined, their derivatives, their analogs, their tautomeric forms, their stereoisomers, their bioisosters, their diastereomers, their polymorphs, their enantiomers, their appropriate N-oxides, their pharmaceutically acceptable salts, their pharmaceutically acceptable hydrates, their pharmaceutically acceptable solvates and pharmaceutically acceptable compositions containing them. The compounds of the present invention will be useful as antibacterial agents particularly in the treatment of tuberculosis. The stereoisomers of the compounds forming part of this invention may be prepared by using reactants in their single enantiomeric form in the process wherever possible or by conducting the reaction in the presence of reagents or catalysts in their single enantiomer form or by resolving the mixture of stereoisomers by conventional methods. Some of the preferred methods include use of microbial resolution, resolving the diastereomeric salts formed with chiral acids such as mandelic acid, camphorsulfonic acid, tartaric acid, lactic acid, and the like wherever applicable or chiral bases such as brucine, cinchona alkaloids and their derivatives and the like. Different polymorphs of a compound of general Formula (I) of present invention may be prepared by crystallization of the compound of Formula (I) under different conditions. For example making use of commonly used solvents or their mixtures for recrystallization, crystallization at different temperature ranges, different cooling techniques like very fast to very slow cooling during crystallization procedure, by exposing to room temp, by heating or melting the compound followed by gradual cooling and the like. The presence of polymorphs may be determined by one or more methods like solid probe NMR spectroscopy, DSC, TGA, Powder X- Ray diffraction and IR. The present invention also provides pharmaceutical compositions containing the compounds of invention as defined above, theirderivatives, analogs, tautomeric forms, stereoisomers, bioisosters, polymorphs,enantiomers, diastereomers, their pharmaceutically acceptable salts or solvates in combination with suitable pharmaceutically acceptable carriers, and/or diluents. The pharmaceutical compositions according to the present invention are useful antibacterial agents. The pharmaceutical composition may be tablets, capsules, powders, syrups, solutions, suspensions, sprays and the likes thereof and may contain flavorants, sweeteners etc., in a suitable solid or liquid carriers or diluents or in a suitable sterile media to form injectable solutions or suspensions. It is understood that in any of the above schemes, any reactive group in the substrate molecule may be protected according to any conventional procedure known in the prior art. Suitable protecting groups comprise N-Boc, N-Cbz, N-Fmoc, alkyl, benzophenoneimine for protection of amino group, acetal protection for aldehyde, ketal protection for ketone. The invention also encompasses prodrugs of compounds of the invention, which on administration undergo chemical conversion by metabolic processes before becoming active pharmacological substances. In general, such prodrugs will be functional derivatives of compounds of invention, which are readily convertible in vivo into compounds of the invention. The invention also encompasses the active metabolites of the compounds of the present invention of general Formula (I). PRODRUGS In another aspect of this invention, alternatively, the compounds can be formulated and administered in a prodrug form, hi general, prodrugs comprise functional derivatives of the claimed compounds which are capable of being enzymatically activated or converted into the more active parent form. Thus, in the treatment methods of the present invention, the term "administering" encompasses the treatment of the various disorders described with the compound specifically disclosed or with a compound which may not be specifically disclosed, but which converts to the specified compound in vivo after administration to the patient. Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in Wihnan, 14 Biochem. Soc. Trans. 375-82 (1986); Stella et al., Prodrugs: A Chemical Approach to Targeted Drug Delivery in Directed Drug Delivery 247-67 (1985). The present invention relates to novel heterocycliccompounds of Formula (I), their analogues, derivatives, tautomers, prodrugs, stereoisomers, enantiomers, diastereomers, polymorphs, pharmaceutically acceptable salts, pharmaceutically acceptable hydrates, pharmaceutically acceptable solvates and bioisosteres: Formula (I), wherein R is independently selected from hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl, optionally substituted heteroaryl; Ar is an optionally substituted mono, bi or tri cyclic group preferably an aryl or heteroaryl group such as phenyl, naphthyl, indole, benzoxazole, benzotriazole and the like; Het represents an optionally substituted heterocyclyl or heteroaryl group connected through a C-C bond. In one embodiment, Ar is substituted with phenyl or halo group; In yet another embodiment, Ar is phenyl substituted with halo group selected from a group consisting of chloro and bromo; In yet another embodiment, R represents optionally substituted alkyl; In yet another embodiment, R is selected from a group consisting of methyl, ethyl and propyl; In yet another embodiment, Het is optionally a substituted heterocyclylor heteroarylgroup; In yet another embodiment, Het is optionally a substituted indole group connected to the pyrimidine moiety through a C-C bond; In a further embodiment, Het is indole bi substituted with halo and alkyl groups, orindole substituted with bromo or chloro group, or indole bi substituted with bromo and methyl or ethyl groups, or indole bi substituted with chloro and methyl or ethyl groups. In yet another embodiment, Het is selected from wherein, R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl; X is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo; and and Y is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo. In yet another embodiment, the present invention provides the following compounds: 5-(4-chlorophenyl)-7-(1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-1-methyl-7-(1-methyl-1H-indol-3-yl)-3-propyl-1H-pyrazolo[4,3 d]pyrimidine; 5-(4-chlorophenyl)-7-(1-ethyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-bromo-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-bromo-1-methyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-bromo-1-ethyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-7-(5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine,4-chlorophenyl)-7-(5-methoxy-1-methyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; 5-(4-chlorophenyl)-7-(1-ethyl-5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;and 7-(1-allyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine. In yet another embodiment, the present invention relates to a process for the preparation of the compound of Formula (I) as shown below: Synthetic scheme for the preparation of 2-(hetero)aryl-pyrazole pyrimidines (5) The compounds of the present invention are prepared by reacting compound of Formula a (prepared as shown in Example 1 step iii of WO2006058201 which is herein incorporated by reference) with phosphorous chloride in the absence or presence of a suitable solvent selected from benzene, toluene, xylene, THF, 1,4-dioxane, diethyl ether, diphenyl ether, dichloromethane, chloroform, 1,2-dichloroethane and the likes thereof to give compound of formula b which is then reacted with suitable ‘Het’ compound in presence of aluminium chloride and suitable solvent selected fromnitrobenzene, THF, 1,4-dioxane, diethyl ether, diphenyl ether, dichloromethane, chloroform, 1,2-dichloroethane orthe likes thereof to given compound of Formula (I). USES The compounds of the invention are useful for the treatment of infections in subjects, mammals in particular, including humans. In one embodiment, the compounds may be used for the treatment of infections of soft tissues, blood, skin, mouth, lungs, respiratory tract, urinary tract and reproductive tract. In another embodiment, the compounds of the invention are useful for the treatment of infections caused by microorganisms, such as but not limited to bacterial infection, especially Mycobacterium complex, more specifically Mycobacterium tuberculosis that causes tuberculosis. ROUTE OF ADMINISTRATION The compounds of the present invention are delivered to the subjects by forms suitable for each administration route. For example, the compounds are administered as tablets, capsules, injection, drops, inhaler, ointment, foams suppository. In a preferred embodiment, the route of administration is oral, parenteral or topical. Topical or transdermal administration include powders, sprays, ointments, pastes creams, lotions, gels, solutions, patches and inhalants. DOSAGE FORMS The composition of the present invention is presented in unit dosage form generally in an amount that produces a therapeutic effect in the subject. The compounds of the present invention are administered at a daily dose that is the lowest dose effective to produce a therapeutic effect. Generally, the dosage will effect from about 0.0001 to about 100 mg per kg body weight per day. Preferably, the dosage will range from about 0.001 to 75 mg per kg body weight per day and more preferably, the dosage will range from about 0.1 to about 50 mg per kg body weight per day. Each unit dose may be, for example, 5, 10, 25, 50, 100, 125, 150, 200 or 250 mg of the compound of the invention. As per the requirement of the subject, the effective daily dose of the compound is administered as two, three, four or more sub-doses administered separately at appropriate intervals throughout the day, optionally in unit dosage forms. FORMULATION The antibacterial compositions of the present invention may be administered by any method known in the art. Some examples of suitable modes of administration include oral, intravenous, intramuscular topical or any other parenteral mode of administration. In certain embodiments, the present invention is directed to a method of formulating compounds of the present invention in a pharmaceutically acceptable carrier or excipient and may be administered in a wide variety of different dosage forms e.g. tablets, capsules, sprays, creams, lotions, ointments, aqueous suspensions syrups, and the like. Such carriers may include one or more of solid diluents or fillers, sterile aqueous media, and various nontoxic organic solvents, etc. For oral administration, tablets may contain various excipients such as one or more of microcrystalline cellulose, sodium citrate, calcium carbonate and the like, along with various disintegrants such as starch and certain complex silicates, together with granulation binders like polyvinylpyrrolidone, sucrose and the like. Solid compositions of a similar type may also be employed as fillers in gelatin capsules. The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluents or solvent e.g. as solution in 1, 3 butane diol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally employed including synthetic mono or diglycerides. In addition, fatty acids such as oleic acid find in the preparation of injectables. These aqueous solutions may be suitable for intravenous injection purposes. The oily solutions may be suitable for intra articular, intramuscular, and/or subcutaneous injection purposes. In another embodiment, the compounds of the present invention may be administered topically that include transdermal, buccal, or sublingual application. For topical applications, therapeutic compounds may be suitably admixed in a pharmacologically inert topical carrier such as a gel, an ointment, a lotion, and/or a cream. Such topical carriers may include water, glycerol, alcohol, propylene glycol, fatty alcohols, triglycerides, fatty acid esters, and/or mineral oils. The timing of the administration of the pharmaceutical composition may also be regulated. For example the compounds may be administered intermittently or by controlled release. The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be noted that many variations and modifications may be made while remaining within the scope of the invention. Likewise, the Exmaples provided herein are for illustrative purposes and should not be construed as limiting the invention in anyway. Examples Example 1. Pharmacological assay Cloning of Mycobacterium tuberculosis Chorismate Mutase (MTCM):RV1885C, encoding Mtb Chorismate Mutase (CM), was PCR amplified as known in the art from Mtb genomic DNA using the primers: (Fwd:5’TGGATCCTTGCTTACCCGTCCACGTGAGATATA3’ and Rev:5’ AATAAGCTTGGCCGGTAGGGCCTGGCAA 3’). The amplification conditions were as follows: 94°C for 5 min for initial denaturation of DNA followed by 10 cycles of amplification, with each cycle consisting of denaturation at 94°C for 30 sec and annealing at 50°C for 30 sec and polymerization at 72°C for 60 sec followed by 30cyclesof amplification, with each cycle consisting of denaturation at 94°C for 30 sec and annealing at 60°C for 30 sec and polymerization at 72°C for 60 sec. The polymerization was continued at the end for 10 min at 72°C. The amplified DNA was cloned into pET15b between the sites Nde1 and Xho1 and the recombinant DNA was isolated from E. coli DH5a [Journal of bacteriology, 188:8638, 2006]. The PET15b recombinant was transformed in BL21*DE3 for the production of MTCM. The E. coli BL21*DE3 harboring the recombinant plasmid was grown in LB medium supplemented with ampicillin (100µg/ml) at 37°C to an A260of ~0.6. MTCM was induced with 30µM IPTG at and kept for incubation at 25°C overnight as detailed in the above reference. Example 2. Purification of MTCM: Purification of MTCM was carried out according standard procedures [Journal of bacteriology, 188:8638, 2006]. The culture was scaled up to 1 liter and the cells were harvested by centrifugation at 4000rpm at 4°C, 15min.The pellet was resuspended in 10ml of 20% sucrose and 30mM TRIS-HCl pH8.0 and 1M EDTA was added to a final concentration of 1mM. The suspension was mixed on a rotary shaker at 150rpm for 10 min at 25°C and centrifuged at 13000rpm for 15 min at 4°C.The cell pellet was suspended in 4ml of ice cold 5mM MgSO4 and kept on rotary shaker at 150rpm for 10 min at 25°C.The cell suspension was centrifuged at 13000rpm for 15 min at 4°C .The supernatant containing the periplasmic proteins was collected and buffered with 1M TRIS pH8.0 to a final concentration of 30mM [Journal of bacteriology, 188:8638, 2006]. The periplasmic fluid was concentrated to ~1ml and injected into Mono Q 5/50 GL prepacked anionic exchanger FPLC Column. The column was equilibrated with 30mM TRIS pH 8.0 and 5mM DTT and the protein was eluted with 30mM TRIS pH 8.0, 5mM DTT and 250mM NaCl. The purified CM was quantified using Bradford, and the 100µl aliquots were preserved at -80°C. Example 3. Chorismate Mutase ASSAY: Activity of CM enzyme was based on direct observation of conversion of chorismate to prephenate at OD 274nm [Methods Enzymol. 142:440–450, 1987].The reaction volume of the assay was maintained as 100µl. 1mM of the substrate, Chorismic acid (SIGMA cat # 1701) was pre-incubated at 37°C for 5 min in the buffer (containing 50 mMTris-HCl (pH 7.5), 0.5 mM EDTA, 0.1 mg/ml bovine serum albumin, and 10 mM ß-Mercaptoethanol). The reaction was started by adding 180pmol of CM enzyme to the prewarmed Chorismic acid solution. Inhibitory screening of the compounds against CM activity was measured at 100nM to 50µM concentration of the effectors. The reaction was allowed to proceed at 37°C and was terminated after 5 min with 100µl of 1 N HCl. A blank with no enzyme for every reaction was kept as a control to account for the non enzymatic conversion of chorismate to prephenate. Compound Screening: Compounds of the invention as provided in Example 8(g),Example 8(h) and Example 8(i)were screened for inhibition against MTCMand the IC50 for the compound of Example 8(g)was found to be 7.7 ± 0.2 µM (n=4) (Figure 1). Table 1: Compounds showing inhibition against MTCM Compounds % Inhibition at 30µM 7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine, Example 8(g) 87.9 ± 0.5 7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine, Example 8(h) 50 ± 1.5 5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine, Example 8(i) 10 ± 2.0 Example 4. In vitro antimycobacterial activity Method used: Proportion control method of drug susceptibility testing

1. Preparation of bacterial suspension and controls: Pure, luxuriant, fresh culture of lab control,M. tuberculosis H37 Rv on Lowenstein Jensen slant was selected for the experiment. A loopfull of growth representative of as many colonies as possible was suspended in 1ml of sterile distilled water. A uniform suspension of bacterial cells was made by sufficient and gentle vortexing. Direct control (DC) and Proportion control (PC): Bacterial suspension matched for turbidity to the 0.5 Mc Farlandstandards was considered as the direct growth control and direct control diluted to 1/100 times with sterile distilled water is considered as proportion control.

2. Preparation of bacteriological medium: Medium used: BacT/ALERT®MP (Biomerieux, Inc. Durham, NC, USA), a ready to use mycobacterial liquid culture medium (10 mL standard volume) Other reagents: Reconstitution fluid MB/BacT®, (Biomerieux, Inc. Durham, NC, USA) a) Drug free controls: MP bottle with reconstitution fluid b) Drug medium: MP bottles with reconstitution fluid and one of the given FCs (10&30 uM) of the Example8(g)

3. Inoculation:Inoculation of drug free medium ? Inoculation of DC: 0.5ml of DC is inoculated into MP bottle. Inoculation of PC: 0.5ml of PC was inoculated into MP bottles in duplicate. Inoculation of drug containing medium: ? Drug containing MP bottles in duplicates for each of the FCs (10 and 30µM) of the Example 8(g) were inoculated with 0.5 ml of PC.

4. Incubation: Drug free and drug containing BacT/ALERT®MP (Biomerieux, Inc. Durham, NC, USA), bottles after being inoculated with the proportion control were loaded in to MB/BacT® (Biomerieux, Inc. Durham, NC, USA) automated incubator cum reader system for continuous and automated incubation.

5. Reading for mycobacterial positive/negative growth: MB/ BacT® system was automated to read the presence of mycobacterial growth once in every 15 minutes. Positive or negative culture bottles were determined by the decision making software contained in the MB/BacT® detection system. Reading for positive bottles was given along with the time of detection in days. All positive reading bottles were further tested by ZN smear microscopy and overnight culture on blood agar to rule out contamination.

6. Interpretation of antimycobacterial activity/drug susceptibility Susceptible: Drug containing bottle was not detected positive within 15 days, or had a positive time for detection that was greater than that of the proportion control. Standard upper limit for reading bottles was taken as 15days. Resistant: Drug containing bottle was detected positive with time of detection that was equal to or greater than that of the direct control but equal to or less than the proportion controls. Experiment was valid only if the growth in direct and proportion controls occurred within 15 days of incubation.

7. Positive control for antimycobacterial activity: Isoniazid with final concentrations of 0.2mg/mL (approx. 7.5 µM) following the same inoculation, incubation, reading and interpretation standards was used as a known drug control. Preliminary experiments – in vitro antimycobacterial activity of sample Explanation about the figures and growth curves: Figures2-6 are 'on-screen' growth curves as shown on the MB/BacT monitor. In the middle top of the curve: Unique barcode ID number of the bottle , along with the result of positive or negative is provided. With regard to the Growth curve, X axis denotes the number of days for detection of positive/negative and Y axis denotes the number of reflectance units (RLU) as measured by the detection system (cut off is 1800 RLU, anything above is considered positive and indicated in red color on the monitor). RLU is directly proportional and is an approximate indicative of the number of live Mycobacterial cells and their active multiplication. Growth curve of the drug containing bottles should be correlated with that of the proportion control. Results show that positive RLU of proportion control started on day 3.6 and reached within 4 days to and maintained at 4000 RLU. Growth curve with Example8(g) compound started on avg 12.4 at 10µM; Growth curve with 10µM drug concentration has reached up to 3500 RLU over a period of about 20days and has never reached the 4000RLU point as shown in the control. Observations: a) Growth in proportion control without the molecule: 3.6 days (Fig 3) b) Growth with molecule 10uM conc. Avg: 12.4 days (MP Bottle 12.2days) (Fig 4) and no growth at 30 µM (Fig. 5). c) Example 8(g) has inhibited the growth with 10µM four times longer. Considering the total drug testing period as 15days, 10µM has shown good inhibition of up to 12 days. Growth curve of proportion control and drugs are showing differences in terms of RLU and start points; clear indication of limited and delayed growth of M.tb cells may be due to the inhibitory activity of the Example 8(g). Isoniazide at con 0.25 mg/mL(approx.. 0.75 µM) and sample 8(g) at 30 µM did not show any growth. Example 5.The Pharmacokinetic properties of Example 8(g) The molecule was moderately stable (~ 35% after 30 min) in mice microsomal stability assay and was highly plasma protein bound (~98%) but stable upto25% even after two hours. The oral PK (30 mg/kg) in mice was also poor (~1µg/ml/hr) and oral bioavailability was only ~7.0%. But, the IV PK (10 mg/kg in DMSO) in mice was fair (AUC= 4.7µg/ml/hr) and T1/2 was ~8.25 hrs indicating the molecule stays in the circulation for a longer time. The approximate free drug concentration in mice blood plasma at 10 mg/kg given in IV route was ~0.4 µM (calculated considering 2 ml blood volume of a mouse, the Molecular weight of the molecule is 435.10 and ~98% plasma protein bound). Considering the fact that the molecule is moderately stable in mice plasma (~ 35% in 30 mins) and having large clearance volume (2100 ml/kg/hr), the free drug concentration should be >>~ 0.4 µM. This result leads to speculate that a considerable amount of molecule may be available inside the tissues which needs to be determined by tissue distribution experiment. Example 6. Formulation studies The following approaches were attempted to develop an appropriate formulation of Example 8(g). (i) Development of nanoemulsion using (a) Example 8(g), peppermint oil, Tween 80: PEG 400 (as surfactant : co-surfactant) and normal saline (0.9% w/v) (as an aqueous phase); and (b) Example 8(g), peppermint oil, Tween 20: PEG 200 (as surfactant : co-surfactant) and normal saline (0.9% w/v) (as an aqueous phase) (ii) Development of micelles using Example 8(g), PEG 400: Tween 80 (as surfactant: co-surfactant) and normal saline (0.9% w/v) (as an aqueous phase). The second approach was found to be promising and therefore was explored further. After assessing various compositions of micelles it was observed that the following composition, i.e. 0.2-0.9 % drug, 10-30% Smix containing tween 80: PEG 400 (1:1) and 70-90% normal saline was found to be ideal. More particularly, the following formulation, i.e. 0.3% drug, 20% S mix containing tween 80: PEG 400 (1:1) and 79.7% normal saline was preferred. The developed micelles were visually observed for clarity and the results are summarized in Table 3. The particle size was recorded using Malvern Zetaszier Nano ZS (Malvern instruments). Table 2: Composition of micelles Formulation code Drug (mg) S: Co-S (%) Water (%) M1 0.8 1:1 (10%) 90% M2 4 2:1 (10%) 90% M3 2 1:1 (20%) 80% M4 4.5 2:1 (10%) 90% M5 3 1:1 (10%) 90% M6 5.5 2:1 (10%) 90% M7 4 1:1 (10%) 90% M8 3 1:1 (20%) 80% M9 “ 1:1 (30%) 70% M10 “ 0:1 (15%) 85% M11 “ 0:1 (20%) 80% M12 “ 1:0 (15%) 85% M13 “ 1:0 (20%) 80% M14 “ 3:1 (20%) 80% M15 “ 2:1 (15%) 85% M16 “ 1:3 (20%) 80% M17 “ 1:2 (15%) 85% Table 3: Visual observation of micelles Formulation code Visual appearance M1 Clear M2 Clear M3 Clear M4 Turbid M5 Turbid M6 Turbid M7 Turbid M8 Clear M9 Clear M10 Transparent M11 Transparent M12 Drug precipitation M13 Drug precipitation M14 Transparent M15 Transparent M16 Transparent M17 Transparent The particle size data of the micelles is depicted in Figures 7-13 and DSC curve of Example 8(g) is shown in Figure 14: Example 7. PK studies of the formulated sample of Example 8(g) in mice: PK studies of the formulated Example 8(g) have been performed in mice at both 10mg/kg and 30mg/kg. The formulated Example 8(g) shows ~33µgms/ml and ~66µgms/ml of the blood plasma level at 10mg/kg and 30mg/kg dose (Figure 15) respectively in mice which was ~33 fold and ~66 fold higher compared to oral PK done at 30mg/kg in mice(~1µg/ml) and also many fold higher than the IV PK done at 10mg/kg in mice (~4.7 µg/ml). The IC50of the molecule is ~7.7 µM and the blood level of the formulated compound is ~153 µM(Mol. wt. of Example 8(g)is 430) at 30mg/kg and ~75 µMat 10mg/kg respectively and the levels were much higher than the IC50 value. Example 8. General method of Synthesis of Compounds of the Invention Unless stated otherwise, reactions were performed under nitrogen atmosphere. Reactions were monitored by thin layer chromatography (TLC) on silica gel plates (60 F254), visualizing with ultraviolet light or iodine spray. Flash chromatography was performed on silica gel (100-200 mesh) using distilled hexene, ethyl acetate, dichloromethane. 1H NMR and 13C NMR spectra were recorded either in CDCl3,DMSO-d6orCF3CO2Hsolution by using 400 and 100 MHz spectrometers, respectively. Proton chemical shifts (d) are relative to tetramethylsilane (TMS, d = 0.00) as internal standard and expressed in ppm. Spin multiplicities are given as s (singlet), d (doublet), t (triplet) and m (multiplet) as well as b (broad). Coupling constants (J) are given in hertz. Infrared spectra were recorded on a FT- IR spectrometer. Melting points were determined using melting point apparatus and are uncorrected. MS spectra were obtained on a mass spectrometer. Mass spectra (MS) and high-resolution mass spectra (HRMS) were recorded using electron ionization (EI) mass spectrometry. Preparation of compound b:A mixture of compound of formula a(4 g, 13.24 mmol) and phosphorousoxychloride (40ml) was stirred at 100oC, for 12-14 h under anhydrous conditions. After completion of the reaction excess of phosphorousoxychloride was removed under vacuum. The residue was diluted with aq NaHCO3 solution to reach the pH=7-8. White solid separated was filtered, washed with water (2 30ml) and dried under vacuum to afford compound of formula b. Preparation of compound of Formula (I): A mixture of compound of formula b, an appropriate ‘Het’ group and AlCl3 (1.2 equiv) in dichloroethane (5 mL) was stirred at 80 ºC for 7-12 h under a nitrogen atmosphere. After completion of the reaction, the mixture was poured into ice-cold water (15 mL), stirred for 10 min and then extracted with ethylacetate (3 x 20 mL). The organic layers were collected, combined, washed with cold water (2 x 20 mL), dried over anhydrous Na2SO4 and concentrated under vacuum. The residue obtained was purified by column chromatography using ethylacetate/hexene to afford the compound of formula (I). Following are the synthesis of specific compounds of the invention a) Preparation of 5-(4-chlorophenyl)-7-(1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with indole following the procedure given above in the preparation of compound of Formula (I). Yield: 75%; White solid; mp 110-112 ºC; 1H NMR (400 MHz, DMSO-d6) d 11.96 (bs, 1H), 8.50 (d, J = 8.8 Hz, 2H), 8.19-8.15 (m, 2H), 7. 61-7.56 (m, 3H), 7.29-7.21 (m, 2H), 4.03 (s, 3H), 3.02 (t, J = 7.4 Hz, 2H), 1.98-1.88 (m, 2H), 1.02 (t, J = 7.6 Hz, 3H) 13C NMR (100 MHz, DMSO-d6) d 148.3, 145.0, 144.5, 137.2 (2C), 136.6, 134.5, 130.4, 129.2 (2C), 128.7 (2C), 126.4, 122.6 (2C), 120.9, 120.5, 112.2, 111.2, 38.2, 27.3, 21.6, 14.0;HPLC: 91.74%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 10/95, 12/95, 15/90, 18/90; flowrate: 1.0 mL/min;UV 210 nm, retention time 5.67 min; IR (KBr) vmax3277, 2957, 1918, 1538, 1437 cm-1Mass (ESI method): 402.2 (M+1, 100%);. HRMS (ESI) calcd for C23H21N5Cl(M+H)+ 402.1485, found 402.1497. b) Preparation of 5-(4-chlorophenyl)-1-methyl-7-(1-methyl-1H-indol-3-yl)-3-propyl-1H-pyrazolo[4,3 d]pyrimidine The above compound was prepared by reacting compound of formula b(wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-methyl-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 75%; White solid; mp180-181 ºC; 1H NMR (400 MHz, CDCl3) d 8.57 (d, J = 8.4 Hz, 2H), 8.03 (d, J = 7.6 Hz, 1H), 7.59 (s, 1H), 7.46-7.43 (m, 3H), 7.38 (t, J = 7.4 Hz, 1H) 7.31-7.28 (m, 1H), 3.96 (s, 6H), 3.14-3.10 (m, 2H), 2.04-1.97 (m, 2H), 1.10 (t, J = 7.4 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 147.2, 147.0, 145.5, 137.3, 137.2, 135.5, 131.3, 129.8, 129.4 (2C), 128.5 (2C), 127.2, 123.1, 121.4, 121.0, 112.1, 109.8, 38.9, 33.4, 27.9, 22.1, 14.1; HPLC: 98.59%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min; UV 265 nm, retention time 5.74 min; IR (KBr) vmax2954, 1916, 1539, 1232 cm-1; HRMS (ESI) calcd for C24H23N5Cl(M+H)+ 416.1642, found 416.1653. c) Preparation of 5-(4-chlorophenyl)-7-(1-ethyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-ethyl-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 75%; White solid; mp 160-162 ºC; 1H NMR (400 MHz, CDCl3) d 8.55 (d, J = 8.8 Hz, 2H), 8.06 (d, J = 8.4 Hz, 1H), 7.65 (s, 1H), 7.49-7.44 (m,3H), 7.36-7.28 (m, 2H), 4.33 (q, J = 7.2 Hz, 2H), 3.96 (s, 3H), 3.12 (t, J = 7.4 Hz, 2H), 2.04-1.95 (m, 2H), 1.60 (t,J= 8.0 Hz, 3H), 1.10 (t, J = 7.2 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 151.1, 142.3, 141.9, 140.4, 132.1, 131.2, 130.3, 124.7, 124.6 (2C), 124.3, 123.4, 123.3, 122.3, 117.9, 116.2, 116.0, 107.0, 104.8, 36.4, 33.8, 22.8, 17.0, 10.3, 9.0;HPLC: 99.29%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 265 nm, retention time 6.41 min; IR(KBr) vmax2978, 2871, 1912, 1543, 1214 cm-1;HRMS (ESI) calcd for C25H25N5Cl (M+H)+ 430.1798, found 430.1815. d) Preparation of 7-(5-bromo-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b(wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-bromo-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 73%; White solid; mp 196-198 ºC; 1H NMR (400 MHz, CDCl3) d 8.72 (bs, 1H), 8.54 (m, 2H), 8.21 (d, J = 1.2 Hz, 1H),7.69 (d, J = 2.8 Hz, 1H), 7.48-7.38 (m, 4H), 3.95 (s, 3H),3.12 (t,J= 7.6 Hz,2H), 2.04-1.95 (m, 2H), 1.10 (t, J = 7.2 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 147.1, 146.5, 145.7, 137.0, 135.7, 134.8, 129.5, 129.3 (2C), 128.6 (2C), 128.3, 127.8, 126.5, 123.5, 114.9, 113.1, 112.5, 38.9, 27.9, 22.0, 14.1; HPLC: 92.55%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 10/95, 12/95, 15/90, 18/90; flowrate: 1.0 mL/min;UV 210 nm, retention time 8.50 min; IR (KBr)vmax3419, 3155, 2955, 1897, 1543 cm-1; HRMS (ESI) calcd for C23H20N5ClBr(M+H)+ 480.0591, found 480.0591. e) Preparation of 7-(5-bromo-1-methyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-bromo-1-methyl-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 72%; White solid; mp 237-238 ºC; 1H NMR (400 MHz, DMSO-d6) d 8.48 (d, J = 8.4 Hz, 2H,), 8.33 (s, 1H), 8.27 (s, 1H), 7.65-7.48 (m, 3H), 7.47-7.46 (m, 1H), 4.06 (s, 3H), 3.97 (s, 3H), 3.04-3.01 (m, 2H), 1.93-1.88 (m, 2H), 1.02 (t, J = 7.4 Hz, 3H), ; 13C NMR (100 MHz, TFA-d) d 152.5, 151.7, 144.9, 141.3, 139.7, 137.2, 135.1, 129.7, 129.5, 128.7, 128.4, 127.9, 127.5, 123.8, 118.8, 118.2, 115.5, 112.7, 112.3, 38.7, 33.0, 26.4, 21.7, 11.8;HPLC: 99.91%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min; UV 265 nm, retention time 7.95 min; IR (KBr) vmax3133, 2970, 1929, 1582, 1433 cm-1;HRMS (ESI) calcd for C24H22N5ClBr (M+H)+ 494.0747, found 494.0763. f) Preparation of 7-(5-bromo-1-ethyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-ethyl-5-bromo-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 75%; White solid; mp 212-213 ºC; 1H NMR (400 MHz, TFA-d) d 8.54 (s, 1H), 8.38 (s, 1H), 8.28-8.26 (m, 2H), 7.74-7.71 (m, 3H), 7.60-7.58 (m, 1H), 4.54 (q, J= 4.0, 2H), 4.40 (s, 3H), 3.28 (t, J = 7.2 Hz, 2H), 2.02 (q, J = 7.2 Hz, 2H), 1.73 (t, J = 7.2 Hz, 3H), 1.17 (t, J = 6.8 Hz, 3H); 13C NMR (100 MHz, TFA-d) d 152.6, 151.9, 144.9, 141.4, 138.3, 136.3, 134.9, 129.7, 129.6, 128.6, 128.5, 128.0, 127.8, 124.0, 118.4, 118.2, 115.6, 112.8, 112.5, 42.7, 38.7, 26.5, 21.7, 13.2, 11.8; HPLC: 99.86%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05% Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 230 nm, retention time 8.80 min; IR (KBr) vmax2956, 2870, 1737, 1582, 1219 cm-1HRMS (ESI) calcd for C25H24N5ClBr(M+H)+ 508.0904, found 508.0910. g) Preparation of 7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-chloro-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 76%; White solid; mp 230-232 ºC; 1H NMR (400 MHz, CDCl3) d 8.79 (bs, 1H), 8.54 (d, J = 9.2 Hz, 2H), 8.04 (d, J = 2.0 Hz, 1H), 7. 68 (d, J = 3.2 Hz,1H), 7.47-7.40 (m, 3H), 7.31-7.25 (m, 1H), 3.94 (s, 3H), 3.12 (t, J = 7.6 Hz, 2H), 2.04-1.97 (m, 2H), 1.10 (t, J = 7.4 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 147.1, 146.5, 145.7, 136.9, 135.7, 134.5 (2C), 129.3 (2C), 128.6 (2C), 127.9, 127.6, 127.5, 124.0, 120.3, 113.2, 112.6, 38.9, 29.6, 22.1, 14.1; HPLC: 96.30%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 265 nm, retention time 6.15 min; IR (KBr) vmax3206, 3170, 2957, 1541, 1109cm-1HRMS (ESI) calcd for C23H20N5Cl2(M+H)+ 436.1109, found 436.1096. h) Preparation of 7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-chloro-6-fluoro-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 80%; White solid; mp 231-232 ºC;1H NMR (400 MHz, CDCl3) d 8.80 (bs, 1H), 8.52 (d, J = 8.4 Hz, 2H), 7.85 (d, J = 9.6 Hz, 1H), 7.70 (d, J = 2.4 Hz, 1H), 7.53 (d, J = 5.6 Hz, 1H) 7.45 (d,J= 8.4 Hz, 2H), 3.97 (s, 3H) 3.12 (t, J = 7.6 Hz, 2H), 2.02-1.96 (m, 2H), 1.08(t, J = 7.2 Hz, 3H).13C NMR (100 MHz, CDCl3) d 156.2, 155.4, 153.0, 147.2, 146.2, 145.9, 136.9, 135.8, 132.4 (2C), 129.3 (2C), 128.6 (2C), 128.5, 125.6, 112.8, 107.3, 107.1, 38.96, 27.8, 22.0, 14.1; HPLC: 99.83%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min; UV 265 nm, retention time 6.0 min; IR (KBr) vmax3169, 2953, 2869, 1728, 1462 cm-1; HRMS (ESI) calcd for C23H19N5Cl2F (M+H)+ 454.1002, found 454.0999. i) 5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b(wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5,6-difluoro-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 78%; Brown solid; mp 233-234 ºC; 1H NMR (400 MHz, CDCl3) d 8.69 (bs, 1H), 8.52 (m, 2H), 7.91-7.86 (m, 1H), 7.69 (s, 1H), 7.47 (d, J = 8.8 Hz, 2H) 7.32-7.27 (m, 1H), 3.99 (s, 3H) 3.12 (t, J = 7.6 Hz, 2H), 2.04-1.94 (m, 2H), 1.09 (t, J = 7.4 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 155.4, 153.0, 147.2, 146.3, 145,9, 136.9 (2C), 135.7, 129.3 (2C), 128.6 (2C), 127.8, 125.6, 108.0, 107.8, 99.7, 99.5, 38.9, 27.8, 22.1, 14.1; HPLC: 98.59%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 265 nm, retention time 5.22 min; IR (KBr) vmax3131, 2959, 1920, 1584, 1175 cm-1 HRMS (ESI) calcd for C23H19N5ClF2(M+H)+ 438.1297, found 438.1297. j) 5-(4-chlorophenyl)-7-(5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-methoxy-indole following the procedure given above in the preparation of compound of Formula (I). Yield:66%;white solid; mp: 183-185°C;Rf=0.6 (20%EtOAc/n-hexane);1H NMR (400 MHz, CDCl3) d : 8.60 (dd, J = 8.61, 6.23 Hz, 3H), 7.65 (dd, J = 10.33, 2.52 Hz, 2H), 7.45 (d, J = 8.66 Hz, 2H), 7.43-7.33 (m, 1H), 7.01 (dd, J = 8.85, 2.44 Hz, 1H), 4.01 (s, 3H), 3.85 (s, 3H), 3.26-2.96 (t, J=8Hz, 2H), 2.00 (dt, J = 14.75, 7.18 Hz, 2H), 1.10 (t, J = 7.36 Hz, 3H); 13CNMR(100MHz,CDCl3)d: 156.1, 155.6, 147.4, 147.0, 145.6, 135.6, 131.2, 129.6(2C), 129.3, 128.5 (2C), 127.4, 127.2, 114.3, 113.3, 112.4 (2C), 102.2, 55.7, 39.0, 27.9, 22.1, 14.1; MS(ESmass): 431.2; HPLC:97.66%,Column:X-Bridge C-18 150 * 4.6 mm, 5µm,mobile phase A:0.1% formic acid in water, mobile Phase B: CH3CN,(T/%B):0/10,3/20, 10/95, 20/95, 22/20, 25/20; flow rate:1.0 mL/min;Diluent:water: ACN(80:20); UV 254.5 nm, retention time 13.6min. k) 4-chlorophenyl)-7-(5-methoxy-1-methyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-methoxy-1-methyl-indole following the procedure given above in the preparation of compound of Formula (I). Yield:71%;white solid; mp:152-154 °C;Rf= 0.5.1 (20%EtOAc/n-hexane);1H NMR (400 MHz, CDCl3) d:8.40 (d, J = 8.68 Hz, 2H), 7.45 (d, J = 2.38 Hz, 1H), 7.37 (s, 1H), 7.27 (d, J = 8.65 Hz, 2H), 7.17 (d, J = 8.89 Hz, 1H), 6.86 (dd, J = 8.93, 2.43 Hz, 1H), 3.85 (s, 3H), 3.76 (s, 3H), 3.68 (s, 3H), 2.90 (t, J=8Hz, 2H), 1.96-1.70 (m, 2H), 1.070-065(t, J = 7.36 Hz, 3H); 13CNMR(100MHz,CDCl3)dppm:156.0, 155.5, 147.0, 135.5, 132.5(2C), 131.8, 129.3(2C), 128.5(2C), 127.7(2C), 113.8, 111.5, 110.7, 109.9(2C), 102.4, 55.7, 39.0, 33.6, 27.9, 22.1, 14.1; MS(ES mass): 445.2;HPLC:95.63%,Column:X-Terra RP18 250* 4.6mm, 5µm,mobile phase A:0.1%TFA in water,mobilePhaseB:CH3CN,(T/%B):0/20, 5/20, 15/95, 23/95, 25/20, 30/20; flow rate:1.0 mL/min; Diluent: water: ACN(80:20);UV 254.5 nm,retention time 19.7min. l) 5-(4-chlorophenyl)-7-(1-ethyl-5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-ethyl-5-methoxy-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 79%;white solid;mp:147-149 °C; Rf= 0.7 (20%EtOAc/n-hexane); 1H NMR (400 MHz, CDCl3) d: 8.57 (t, J = 14.15 Hz, 2H), 7.79-7.59 (m, 2H), 7.47 (dd, J = 19.17, 8.69 Hz, 2H), 7.37 (d, J = 8.93 Hz, 1H), 7.03 (dd, J = 8.93, 2.46 Hz, 1H), 4.49-4.21 (m, 2H), 4.04 (s, 3H), 3.93-3.81 (m, 3H), 3.26-3.07 (t, J=8Hz, 2H), 2.09-1.90 (m, 2H), 1.58 (t, J = 7.29 Hz, 3H), 1.18-0.96 (t, J = 7.36 Hz,, 3H);13C NMR (100 MHz, CDCl3) d: 156.1, 155.5, 147.5, 147.1, 145.6, 137.3, 135.5, 131.6, 130.1, 129.5, 129.3, 128.5, 127.8, 113.7, 111.5, 110.7, 102.5, 55.7, 41.7, 39.0, 31.4, 30.1, 27.9, 22.1, 15.5, 14.2; MS (ES mass);460.0; HPLC:99.55 %, Column:X-Terra RP18 250* 4.6mm, 5µm, mobile phase A:0.1%TFA in water,mobilePhaseB:CH3CN,(T/%B): 0/20, 5/20, 15/95, 23/95, 25/20, 30/20;flow rate:1.0 mL/min; Diluent: water: ACN (80:20); UV 254.5nm, retention time 16.52min. m) 7-(1-allyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine. The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-allyl-indole following the procedure given above in the preparation of compound of Formula (I). Yield: 71%; white solid;mp: 137-139°C; Rf= 0.6; (20%EtOAc/n-hexane); 1H NMR (400 MHz, CDCl3) d: 8.55 (dd, J = 11.59, 8.76 Hz, 2H), 8.09 (d, J = 7.85 Hz, 1H), 7.78 (s, 1H), 7.50-7.43 (m, 3H), 7.36 (m, 2H), 6.23-5.96 (m, 1H), 5.31 (dd, J = 29.80, 13.69 Hz, 2H), 4.89 (d, J = 5.55 Hz, 2H), 4.00 (s, 3H), 3.20 (t, J = 7.62 Hz, 2H), 2.00 (m, 2H), 1.10 (t, J = 7.36 Hz, 3H); 13C NMR (100 MHz, CDCl3) d:156.1, 147.3, 147.0, 145.5, 137.2, 136.7(2C) , 135.5, 132.5, 130.4, 129.7, 129.4, 128.5, 127.4, 123.2, 121.5, 121.2 (2C), 118.5, 112.4, 110.2, 49.2, 38.9, 27.9, 22.1, 14.2; MS (ES mass): 441.9; HPLC:99.47 %, Column: X-Terra RP18 250* 4.6mm, 5µm, mobile phase A:0.1%TFA in water, mobile Phase B: CH3CN, (T/%B): 0/20, 5/20, 15/95, 23/95, 25/20, 30/20; flow rate:1.0 mL /min; Diluent : water: ACN (80:20); UV 254.5nm, retention time 17.05min.

Specification

Claims:CLAIMS
We Claim:
1. A compound of Formula (I)

Formula (I)
or an analogue, derivative, tautomer, prodrug, stereoisomer, enantiomer, diastereomer, polymorph, pharmaceutically acceptable salts, pharmaceutically acceptable hydrates, pharmaceutically acceptable solvates and bioisosteres or a combination thereof, wherein:
R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl;
Ar is an optionally substituted mono, bi or tri cyclic group, preferably an aryl or heteroaryl group selected from the group consisting of phenyl, naphthyl, indole, benzoxazole and benzotriazole; and
Het is an optionally substituted heterocyclyl or heteroaryl group connected by a C-C bond.
2. The compound of formula (I) as claimed in claim 1 wherein the Ar is phenyl substituted with halo group selected from a group consisting of chloro and bromo.
3. The compound of formula (I) as claimed in claim 1 wherein the R is alkyl selected from a group consisting of methyl, ethyl and propyl.
4. The compound of formula (I) as claimed in claim 1 wherein the Het is indole bi substituted with halo and alkyl groups; or indole substituted with bromo or chloro group; or indole bi substituted with bromo and methyl or ethyl groups; or indole bi substituted with chloro and methyl or ethyl groups.

5. The compound of formula (I) as claimed in claim 1 wherein the Het is selected from
wherein,
R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl;
X is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo; and
and Yis hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo.
6. A compound of Formula (I) wherein the said compounds are
5-(4-chlorophenyl)-7-(1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-1-methyl-7-(1-methyl-1H-indol-3-yl)-3-propyl-1H-pyrazolo[4,3 d]pyrimidine;
5-(4-chlorophenyl)-7-(1-ethyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-bromo-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-bromo-1-methyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-bromo-1-ethyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-7-(5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
4-chlorophenyl)-7-(5-methoxy-1-methyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-7-(1-ethyl-5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine; or
7-(1-allyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine.

7. A process of preparing the compound of formula I comprising the steps of

8. A formulation of the compound of claim 1 or 6, wherein the said formulation comprises 0.2 to 0.9% of the compound, 10 to 30% of S mix consisting tween 80:
PEG 400 at a ratio of 1:1 and 70 to 90% normal saline.
9. A compound as claimed in claim 1 or 6 for the treatment of mycobacterial infections.
10. A compound as claimed in claim 1 or 6 for the treatment of tuberculosis.
, Description:PREPARATION OF NOVEL 1H-PYRAZOLO[4,3-D]PYRIMIDINES, THEIR COMPOSITIONS, SYNTHESIS AND METHODS OF USING THEM FOR TREATING TUBERCULOSIS
RELATED APPLICATION
This application is being filed as a Complete Application with the Indian Patent Office.

FIELD OF THE INVENTION
The present invention is related to heterocyclic compounds of Formula (I): their derivatives, analogs, tautomeric forms, stereoisomers, bioisosters, diastereomers, polymorphs, enantiomers, prodrugs and their pharmaceutically acceptable salts for the treatment of tuberculosis. Also disclosed is the process for preparing compounds of Formula (I), and intermediates useful for preparing compounds of Formula (I).

BACKGROUND OF THE INVENTION
The international microbiological community continues to express serious concern that the evolution of antibiotic resistance could result in strains against which currently available antibacterial agents will be ineffective. In general, bacterial pathogens may be classified as either Grain-positive or Gram-negative pathogens. Antibiotic compounds with effective activity against both Gram-positive and Gram-negative pathogens are generally regarded as having a broad spectrum of activity.

Tuberculosis is a chronic, infectious disease that is generally caused by infection with Mycobacterium tuberculosis. Although the infection may be asymptomatic for a considerable period of time, the disease is most commonly manifested as an acute inflammation of the lungs, resulting in fever and a nonproductive cough. If left untreated, serious complications and death typically result.

Mycobacterium tuberculosis is the bacterial agent responsible for human pulmonary tuberculosis. Mycobacterial dormancy results in a disease stage termed latent tuberculosis. An individual with latent tuberculosis may later develop a case of reactivated tuberculosis, and in fact, a majority of the tuberculosis cases reported is the result of reactivation of a latent mycobacterial infection and not an initial infection. Reactivation of the Mycobacterium tuberculosis bacilli usually occurs in the apex of the lung where large numbers of tubercle bacilli cause necrosis of the small bronchi of the lung. The characteristic bloodstained sputum of tuberculosis results from the erosion of small blood vessels during this necrotic process.

Much research has been done in this area to develop efficient drugs for the treatment of tuberculosis. But most of them are failure due to some or the other reason or the invented drugs/vaccines need more efficacy than they are. Hence there is undue need to develop new drugs in the treatment of tuberculosis. The present inventors have invented novel heterocyclic compounds which are found to be active in the treatment of tuberculosis.

SUMMARY OF THE INVENTION
The novel heterocyclic compounds of the present invention are represented by the general Formula (I)


Formula (I)
their analogues, derivatives, tautomers, prodrugs, stereoisomers, enantiomers, diastereomers, polymorphs, pharmaceutically acceptable salts, pharmaceutically acceptable hydrates, pharmaceutically acceptable solvates and bioisosteres, wherein
R is independently selected from hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl, optionally substituted heteroaryl;
Ar is an optionally substituted mono, bi or tri cyclic group preferably an aryl or heteroaryl group such as phenyl, naphthyl, indole, benzoxazole, benzotriazole and the likes thereof;
Het represents an optionally substituted heterocyclyl or heteroaryl group connected through a C-C bond.
In one aspect, Ar is substituted with phenyl or halo group;
In yet another aspect, Ar is phenyl substituted with halo group selected from a group consisting of chloro and bromo;
The invention also provides that R represents optionally substituted alkyl;
In yet another aspect, R is selected from a group consisting of methyl, ethyl and propyl;
Furthermore, Het is optionally a substituted heterocyclyl or heteroarylgroup;
In another aspect, Het is optionally a substituted indole group connected to the pyrimidine moiety through a C-C bond;
In yet another aspect, Het is indole bi substituted with halo and alkyl groups,
or indole substituted with bromo or chloro group, or indole bi substituted with bromo and methyl or ethyl groups, or indole bi substituted with chloro and methyl or ethyl groups.
In yet another embodiment, Het is selected from

wherein, R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl;
X is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo; and
and Y is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo.
The invention also provides a formulation of the compounds of Formula I, comprising 0.2 to 0.9% of the compound, 10 to 30% of S mix consisting tween 80: PEG 400 at a ratio of 1:1 and 70 to 90% normal saline.

BRIEF DESCRIPTION OF DRAWINGS
Figure 1. Dose Response curve for7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine provided in Example 8(g).
Figure 2. Direct control (1.5x108 CFU/mL) -4.2 days.
Figure 3. Proportion Control (1.5x106 CFU/mL): 3.6 days.
Figure 4. Example 8(g)sample: 10µM -12.2days.
Figure 5. Example 8(g)sample: 30µM-no growth in proportional to control.
Figure 6. Isoniazid- no growth in proportional to control.
Figure 7. Particle size data of M8.
Figure 8. Particle size data of M9.
Figure 9. Particle size data of M10.
Figure 10. Particle size data of M14.
Figure 11. Particle size data of M15.
Figure 12. Particle size data of M16.
Figure 13. Particle size data of M17.
Figure 14. DSC Curve of Example 8(g).
Figure 15. Comparative Data: Oral PK Study of formulated sample of Example 8(g) at 10mg/kg and 30mg/kg respectively.

DETAIL DESCRIPTION OF THE INVENTION
Definitions:
"Halogen" refers to Fluorine, Chlorine, Bromine or Iodine.
The term "lower alkyl" refers to a straight or branched chain saturated aliphatic hydrocarbon that may be substituted or unsubstituted. Examples of "alkyl" include but are not limited to methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, n-pentyl, isobutyl and the likes thereof.
The term "lower Alkoxy" refers to a group –ORbwhereinRb is hydrogen or alkyl as herein defined. Representative examples include but are not limited to methoxy, ethoxy and the likes thereof.
The term "Aryl" refers to optionally substituted unsaturated or partially saturated aromatic ring system having five to ten carbon atoms whichare monocyclic, bicyclic or polycyclic and may optionally be replaced by one or more heteroatoms selected from N, O and S. Exemplary aryl groups include phenyl, naphthyl, indanyl, biphenyl and the likes thereof.
The term "cycloalkyl" used herein, either alone or in combination with other radicals, denotes mono, bicyclic or polycyclic saturated, partially saturated hydrocarbon ring system of about 3 to 12 carbon atoms which may be substituted or unsubstituted. Exemplary "cycloalkyl" groups include but are not limited to cyclopopyl, cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl, perhydronapthyl, adamantyl, noradamantylandspirobicyclic groups such as spiro (4,4)non-2-yl.
The term "Heteroaryl"refers to monocyclic aromatic ring systems or fused bicyclic aromatic ring systems comprising two or more aromatic rings, preferably two to three ring systems. These heteroaryl rings contain one or more nitrogen, sulfur and/or oxygen atoms where N-oxides sulfur oxides and dioxides are permissible heteroatom substitutions. The termincludes ring(s) optionally substituted with halogens, nitro, amino, alkoxy, alkyl sulfonyl amino, alkylcarbonylamino, carboxy, alkyl carbonoyl, hydroxy, and alkyl. Examples of heteroaryl groups include furan, thiophene, pyrrole, imidazole, pyrazole, triazole, tetrazole, thiazole, oxazole, isoxazole, oxadiazole, thiadiazole, isothiazole, pyridine, pyridazine, pyrazine, pyrimidine, quinoline, isoquinoline, benzofuran, benzothiophene, indole, indazole, chromanyl, isochromanyl and the likes thereof.
The term "Heterocyclyl" refers to a stable 3 to 15 membered ring that is either saturated or has one or more degrees of unsaturation or unsaturated. These heterocyclic rings contain one or more heteroatoms selected from the group consisting of nitrogen sulfur and/or oxygen atoms where N-oxides, sulfur oxides and dioxides are permissible heteroatom substitutions. Such a ring is optionally fused to one or more of another heterocyclic ring(s), aryl ring(s) or cycloalkyl ring(s). Examples of such groups are selected from the group consisting ofazetidinyl, acridinyl, pyrazolyl, imidazolyl, triazolyl, pyrrolyl, thiophenyl, thiazolyl, oxazolyl, isoxazolyl, furanyl, pyrazinyl, tetrahydroisoquinolinyl, piperidinyl, piperazinyl, morpholinyl, thiomorphonilyl, pyridazinyl, indolyl, isoindolyl, quinolinyl, chromanyl and the likes thereof. "Heterocyclylalkyl" refers to a heterocyclic ring radical defined above, directly bonded to an alkyl group. The heterocyclylalkyl radical is attached to the main structure at carbon atom in the alkyl group that results in the creation of a stable structure.
Unless otherwise specified, the term "substituted" as used herein refers to mono, bi, tri or tetra substitution with any one or combination of the following substituents: hydroxy, halogen, carboxyl, cyano, nitro, oxo (=O), thio (=S), substituted or unsubstituted alkyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted amino, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclylalkyl ring, substituted or unsubstituted heteroarylalkyl, substituted or unsubstituted heterocyclic ring, substituted or unsubstiuted guanidine, - COOR2, -C(O)R2, -C(S)R2, -C(O)NR2R3, - C(O)ONR3R4, -NR2CONR3R4, - N(R2)SOR3, -N(R2)SO2R3, -(=N-N(R2)R3), - NR2C(O)OR3, -NR2R3, -NR2C(O)R3, - NR2C(S)R3, -NR2C(S)NR3R4, -SONR2R3, - SO2NR2R3, -OR2, -OR2C(O)NR3R4, - OR2C(O)OR3, -OC(O)R2, -OC(O)NR2R3, - R2NR3C(O)R4, -R2OR3, -R2C(O)OR3, - R2C(O)NR3R4, -R2C(O)R3, -R2OC(O)R2, -SR2, - SOR2, -SO2R2, and -ONO2, wherein R2, R3 and R4 are independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted alkoxy, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aryl, substituted or unsubstituted arylalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkenyl, substituted or unsubstituted amino, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted heterocyclylalkyl ring, substituted or unsubstituted heteroarylalkyl, or substituted or unsubstituted heterocyclic ring. Alternately R3 and R4 together along with the nitrogen they are attached with, form a 4 to 8 membered ring which can be substituted or unsubstituted. According to one embodiment, the substituents in the aforementioned "substituted" groups cannot be further substituted. For example, when the substituent on "substituted alkyl" is "substituted aryl" the substituent on "substituted aryl" cannot be "substituted alkenyl"
"Stereoisomers" refer to certain compounds described herein containing one or more chiral centres or may otherwise be capable of existing as multiple stereoisomers. Scope of the present invention includes pure stereoisomers as well as mixtures of stereoisomers such as purified enantiomers/diastereomers or enantiomerically/diastereomerically enriched mixtures.
"Bioisosteres" refers to compounds or groups that possess near molecular shapes and volumes, approximately the same distribution of electrons and which exhibit similar physical properties such as hydrophobicity. Bioisostereic compounds affect the same biochemically associated systems as agonist or antagonists and thereby produce biological properties that are related to each other.
"Pharmaceutically acceptable salts" forming part of this invention include salts derived from inorganic bases such as Li, Na, K, Ca, Mg, Fe, Cu, Zn, Al, Mn; salts of organic bases such as N,N'-diacetylethylenediamine, 2- dimethylaminoethanol, isopropylamine, morpholine, piperazine, piperidine, procaine, diethylamine, triethylamine, trimethylamine, tripropylamine, tromethamine, choline hydroxide, dicyclohexylamine, metformin, benzylamine, phenylethylamine, dialkylamine, trialkylamine, thiamine, aminopyrimidine, aminopyridine, purine, pyrimidine, spermidine, and the like; chiral bases like alkylphenylamine, glycinol, phenyl glycinol and the like, salts of natural amino acids such as glycine, alanine, valine, leucine, isoleucine, lysine, arginine, serine, threonine, phenylalanine; unnatural amino acids such as D-isomers or substituted amino acids; salts of acidic amino acids such as aspartic acid, glutamic acid; guanidine, substituted guanidine wherein the substituents are selected from nitro, amino, alkyl, alkenyl, alkynyl, ammonium or substituted ammonium salts. Salts may include acid addition salts where appropriate which are sulphates, nitrates, phosphates, perchlorates, borates, hydrohalides, acetates, tartrates, maleates, citrates, succinates, methanesulfonates, benzoates, salicylates, hydroxynaphthoates, benzenesulfonates, ascorbates and the liks thereof.
"Pharmaceutically acceptable solvates" may be hydrates or comprising other solvents of crystallization such as alcohols.
"Compounds of the invention" or "present invention" refers to the compounds of the present invention represented by general Formula (I) as here in defined, their derivatives, their analogs, their tautomeric forms, their stereoisomers, their bioisosters, their diastereomers, their polymorphs, their enantiomers, their appropriate N-oxides, their pharmaceutically acceptable salts, their pharmaceutically acceptable hydrates, their pharmaceutically acceptable solvates and pharmaceutically acceptable compositions containing them. The compounds of the present invention will be useful as antibacterial agents particularly in the treatment of tuberculosis.
The stereoisomers of the compounds forming part of this invention may be prepared by using reactants in their single enantiomeric form in the process wherever possible or by conducting the reaction in the presence of reagents or catalysts in their single enantiomer form or by resolving the mixture of stereoisomers by conventional methods. Some of the preferred methods include use of microbial resolution, resolving the diastereomeric salts formed with chiral acids such as mandelic acid, camphorsulfonic acid, tartaric acid, lactic acid, and the like wherever applicable or chiral bases such as brucine, cinchona alkaloids and their derivatives and the like. Different polymorphs of a compound of general Formula (I) of present invention may be prepared by crystallization of the compound of Formula (I) under different conditions. For example making use of commonly used solvents or their mixtures for recrystallization, crystallization at different temperature ranges, different cooling techniques like very fast to very slow cooling during crystallization procedure, by exposing to room temp, by heating or melting the compound followed by gradual cooling and the like. The presence of polymorphs may be determined by one or more methods like solid probe NMR spectroscopy, DSC, TGA, Powder X- Ray diffraction and IR.
The present invention also provides pharmaceutical compositions containing the compounds of invention as defined above, theirderivatives, analogs, tautomeric forms, stereoisomers, bioisosters, polymorphs,enantiomers, diastereomers, their pharmaceutically acceptable salts or solvates in combination with suitable pharmaceutically acceptable carriers, and/or diluents.
The pharmaceutical compositions according to the present invention are useful antibacterial agents. The pharmaceutical composition may be tablets, capsules, powders, syrups, solutions, suspensions, sprays and the likes thereof and may contain flavorants, sweeteners etc., in a suitable solid or liquid carriers or diluents or in a suitable sterile media to form injectable solutions or suspensions. It is understood that in any of the above schemes, any reactive group in the substrate molecule may be protected according to any conventional procedure known in the prior art. Suitable protecting groups comprise N-Boc, N-Cbz, N-Fmoc, alkyl, benzophenoneimine for protection of amino group, acetal protection for aldehyde, ketal protection for ketone. The invention also encompasses prodrugs of compounds of the invention, which on administration undergo chemical conversion by metabolic processes before becoming active pharmacological substances. In general, such prodrugs will be functional derivatives of compounds of invention, which are readily convertible in vivo into compounds of the invention. The invention also encompasses the active metabolites of the compounds of the present invention of general Formula (I).
PRODRUGS
In another aspect of this invention, alternatively, the compounds can be formulated and administered in a prodrug form, hi general, prodrugs comprise functional derivatives of the claimed compounds which are capable of being enzymatically activated or converted into the more active parent form. Thus, in the treatment methods of the present invention, the term "administering" encompasses the treatment of the various disorders described with the compound specifically disclosed or with a compound which may not be specifically disclosed, but which converts to the specified compound in vivo after administration to the patient. Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in Wihnan, 14 Biochem. Soc. Trans. 375-82 (1986); Stella et al., Prodrugs: A Chemical Approach to Targeted Drug Delivery in Directed Drug Delivery 247-67 (1985).
The present invention relates to novel heterocycliccompounds of Formula (I), their analogues, derivatives, tautomers, prodrugs, stereoisomers, enantiomers, diastereomers, polymorphs, pharmaceutically acceptable salts, pharmaceutically acceptable hydrates, pharmaceutically acceptable solvates and bioisosteres:


Formula (I), wherein
R is independently selected from hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl, optionally substituted heteroaryl;
Ar is an optionally substituted mono, bi or tri cyclic group preferably an aryl or heteroaryl group such as phenyl, naphthyl, indole, benzoxazole, benzotriazole and the like;
Het represents an optionally substituted heterocyclyl or heteroaryl group connected through a C-C bond.

In one embodiment, Ar is substituted with phenyl or halo group;
In yet another embodiment, Ar is phenyl substituted with halo group selected from a group consisting of chloro and bromo;
In yet another embodiment, R represents optionally substituted alkyl;
In yet another embodiment, R is selected from a group consisting of methyl, ethyl and propyl;
In yet another embodiment, Het is optionally a substituted heterocyclylor heteroarylgroup;
In yet another embodiment, Het is optionally a substituted indole group connected to the pyrimidine moiety through a C-C bond;
In a further embodiment, Het is indole bi substituted with halo and alkyl groups,
orindole substituted with bromo or chloro group, or indole bi substituted with bromo and methyl or ethyl groups, or indole bi substituted with chloro and methyl or ethyl groups.
In yet another embodiment, Het is selected from

wherein, R is independently selected from the group consisting of hydrogen, halogen, hydroxyl, optionally substituted lower alkyl, optionally substituted lower alkoxy, optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocyclyl and optionally substituted heteroaryl;
X is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo; and
and Y is hydrogen or a halo group selected from fluoro, chloro, bromo, and iodo.
In yet another embodiment, the present invention provides the following compounds:
5-(4-chlorophenyl)-7-(1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-1-methyl-7-(1-methyl-1H-indol-3-yl)-3-propyl-1H-pyrazolo[4,3 d]pyrimidine;
5-(4-chlorophenyl)-7-(1-ethyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-bromo-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-bromo-1-methyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-bromo-1-ethyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-7-(5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine,4-chlorophenyl)-7-(5-methoxy-1-methyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;
5-(4-chlorophenyl)-7-(1-ethyl-5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine;and 7-(1-allyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine.

In yet another embodiment, the present invention relates to a process for the preparation of the compound of Formula (I) as shown below:
Synthetic scheme for the preparation of 2-(hetero)aryl-pyrazole pyrimidines (5)

The compounds of the present invention are prepared by reacting compound of Formula a (prepared as shown in Example 1 step iii of WO2006058201 which is herein incorporated by reference) with phosphorous chloride in the absence or presence of a suitable solvent selected from benzene, toluene, xylene, THF, 1,4-dioxane, diethyl ether, diphenyl ether, dichloromethane, chloroform, 1,2-dichloroethane and the likes thereof to give compound of formula b which is then reacted with suitable ‘Het’ compound in presence of aluminium chloride and suitable solvent selected fromnitrobenzene, THF, 1,4-dioxane, diethyl ether, diphenyl ether, dichloromethane, chloroform, 1,2-dichloroethane orthe likes thereof to given compound of Formula (I).

USES
The compounds of the invention are useful for the treatment of infections in subjects, mammals in particular, including humans. In one embodiment, the compounds may be used for the treatment of infections of soft tissues, blood, skin, mouth, lungs, respiratory tract, urinary tract and reproductive tract.
In another embodiment, the compounds of the invention are useful for the treatment of infections caused by microorganisms, such as but not limited to bacterial infection, especially Mycobacterium complex, more specifically Mycobacterium tuberculosis that causes tuberculosis.

ROUTE OF ADMINISTRATION
The compounds of the present invention are delivered to the subjects by forms suitable for each administration route. For example, the compounds are administered as tablets, capsules, injection, drops, inhaler, ointment, foams suppository. In a preferred embodiment, the route of administration is oral, parenteral or topical. Topical or transdermal administration include powders, sprays, ointments, pastes creams, lotions, gels, solutions, patches and inhalants.

DOSAGE FORMS
The composition of the present invention is presented in unit dosage form generally in an amount that produces a therapeutic effect in the subject.
The compounds of the present invention are administered at a daily dose that is the lowest dose effective to produce a therapeutic effect. Generally, the dosage will effect from about 0.0001 to about 100 mg per kg body weight per day. Preferably, the dosage will range from about 0.001 to 75 mg per kg body weight per day and more preferably, the dosage will range from about 0.1 to about 50 mg per kg body weight per day. Each unit dose may be, for example, 5, 10, 25, 50, 100, 125, 150, 200 or 250 mg of the compound of the invention. As per the requirement of the subject, the effective daily dose of the compound is administered as two, three, four or more sub-doses administered separately at appropriate intervals throughout the day, optionally in unit dosage forms.

FORMULATION
The antibacterial compositions of the present invention may be administered by any method known in the art. Some examples of suitable modes of administration include oral, intravenous, intramuscular topical or any other parenteral mode of administration.
In certain embodiments, the present invention is directed to a method of formulating compounds of the present invention in a pharmaceutically acceptable carrier or excipient and may be administered in a wide variety of different dosage forms e.g. tablets, capsules, sprays, creams, lotions, ointments, aqueous suspensions syrups, and the like. Such carriers may include one or more of solid diluents or fillers, sterile aqueous media, and various nontoxic organic solvents, etc.
For oral administration, tablets may contain various excipients such as one or more of microcrystalline cellulose, sodium citrate, calcium carbonate and the like, along with various disintegrants such as starch and certain complex silicates, together with granulation binders like polyvinylpyrrolidone, sucrose and the like. Solid compositions of a similar type may also be employed as fillers in gelatin capsules.
The pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents which have been mentioned above. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluents or solvent e.g. as solution in 1, 3 butane diol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally employed including synthetic mono or diglycerides. In addition, fatty acids such as oleic acid find in the preparation of injectables. These aqueous solutions may be suitable for intravenous injection purposes. The oily solutions may be suitable for intra articular, intramuscular, and/or subcutaneous injection purposes.

In another embodiment, the compounds of the present invention may be administered topically that include transdermal, buccal, or sublingual application. For topical applications, therapeutic compounds may be suitably admixed in a pharmacologically inert topical carrier such as a gel, an ointment, a lotion, and/or a cream. Such topical carriers may include water, glycerol, alcohol, propylene glycol, fatty alcohols, triglycerides, fatty acid esters, and/or mineral oils.
The timing of the administration of the pharmaceutical composition may also be regulated. For example the compounds may be administered intermittently or by controlled release.
The invention has been described with reference to various specific and preferred embodiments and techniques. However, it should be noted that many variations and modifications may be made while remaining within the scope of the invention. Likewise, the Exmaples provided herein are for illustrative purposes and should not be construed as limiting the invention in anyway.

Examples
Example 1. Pharmacological assay
Cloning of Mycobacterium tuberculosis Chorismate Mutase (MTCM):RV1885C, encoding Mtb Chorismate Mutase (CM), was PCR amplified as known in the art from Mtb genomic DNA using the primers: (Fwd:5’TGGATCCTTGCTTACCCGTCCACGTGAGATATA3’ and
Rev:5’ AATAAGCTTGGCCGGTAGGGCCTGGCAA 3’). The amplification conditions were as follows: 94°C for 5 min for initial denaturation of DNA followed by 10 cycles of amplification, with each cycle consisting of denaturation at 94°C for 30 sec and annealing at 50°C for 30 sec and polymerization at 72°C for 60 sec followed by 30cyclesof amplification, with each cycle consisting of denaturation at 94°C for 30 sec and annealing at 60°C for 30 sec and polymerization at 72°C for 60 sec. The polymerization was continued at the end for 10 min at 72°C. The amplified DNA was cloned into pET15b between the sites Nde1 and Xho1 and the recombinant DNA was isolated from E. coli DH5a [Journal of bacteriology, 188:8638, 2006].
The PET15b recombinant was transformed in BL21*DE3 for the production of MTCM. The E. coli BL21*DE3 harboring the recombinant plasmid was grown in LB medium supplemented with ampicillin (100µg/ml) at 37°C to an A260of ~0.6. MTCM was induced with 30µM IPTG at and kept for incubation at 25°C overnight as detailed in the above reference.

Example 2. Purification of MTCM: Purification of MTCM was carried out according standard procedures [Journal of bacteriology, 188:8638, 2006]. The culture was scaled up to 1 liter and the cells were harvested by centrifugation at 4000rpm at 4°C, 15min.The pellet was resuspended in 10ml of 20% sucrose and 30mM TRIS-HCl pH8.0 and 1M EDTA was added to a final concentration of 1mM. The suspension was mixed on a rotary shaker at 150rpm for 10 min at 25°C and centrifuged at 13000rpm for 15 min at 4°C.The cell pellet was suspended in 4ml of ice cold 5mM MgSO4 and kept on rotary shaker at 150rpm for 10 min at 25°C.The cell suspension was centrifuged at 13000rpm for 15 min at 4°C .The supernatant containing the periplasmic proteins was collected and buffered with 1M TRIS pH8.0 to a final concentration of 30mM [Journal of bacteriology, 188:8638, 2006].
The periplasmic fluid was concentrated to ~1ml and injected into Mono Q 5/50 GL prepacked anionic exchanger FPLC Column. The column was equilibrated with 30mM TRIS pH 8.0 and 5mM DTT and the protein was eluted with 30mM TRIS pH 8.0, 5mM DTT and 250mM NaCl. The purified CM was quantified using Bradford, and the 100µl aliquots were preserved at -80°C.

Example 3. Chorismate Mutase ASSAY: Activity of CM enzyme was based on direct observation of conversion of chorismate to prephenate at OD 274nm [Methods Enzymol. 142:440–450, 1987].The reaction volume of the assay was maintained as 100µl. 1mM of the substrate, Chorismic acid (SIGMA cat # 1701) was pre-incubated at 37°C for 5 min in the buffer (containing 50 mMTris-HCl (pH 7.5), 0.5 mM EDTA, 0.1 mg/ml bovine serum albumin, and 10 mM ß-Mercaptoethanol). The reaction was started by adding 180pmol of CM enzyme to the prewarmed Chorismic acid solution. Inhibitory screening of the compounds against CM activity was measured at 100nM to 50µM concentration of the effectors. The reaction was allowed to proceed at 37°C and was terminated after 5 min with 100µl of 1 N HCl. A blank with no enzyme for every reaction was kept as a control to account for the non enzymatic conversion of chorismate to prephenate.
Compound Screening:
Compounds of the invention as provided in Example 8(g),Example 8(h) and Example 8(i)were screened for inhibition against MTCMand the IC50 for the compound of Example 8(g)was found to be 7.7 ± 0.2 µM (n=4) (Figure 1).
Table 1: Compounds showing inhibition against MTCM

Compounds % Inhibition at 30µM
7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine, Example 8(g) 87.9 ± 0.5
7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine, Example 8(h) 50 ± 1.5
5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine, Example 8(i) 10 ± 2.0

Example 4. In vitro antimycobacterial activity
Method used: Proportion control method of drug susceptibility testing
1. Preparation of bacterial suspension and controls: Pure, luxuriant, fresh culture of lab control,M. tuberculosis H37 Rv on Lowenstein Jensen slant was selected for the experiment. A loopfull of growth representative of as many colonies as possible was suspended in 1ml of sterile distilled water. A uniform suspension of bacterial cells was made by sufficient and gentle vortexing.
Direct control (DC) and Proportion control (PC):
Bacterial suspension matched for turbidity to the 0.5 Mc Farlandstandards was considered as the direct growth control and direct control diluted to 1/100 times with sterile distilled water is considered as proportion control.
2. Preparation of bacteriological medium: Medium used: BacT/ALERT®MP (Biomerieux, Inc. Durham, NC, USA), a ready to use mycobacterial liquid culture medium (10 mL standard volume)
Other reagents: Reconstitution fluid MB/BacT®, (Biomerieux, Inc. Durham, NC, USA)
a) Drug free controls: MP bottle with reconstitution fluid
b) Drug medium: MP bottles with reconstitution fluid and one of the given FCs (10&30 uM) of the Example8(g)
3. Inoculation:Inoculation of drug free medium
? Inoculation of DC: 0.5ml of DC is inoculated into MP bottle.
Inoculation of PC: 0.5ml of PC was inoculated into MP bottles in duplicate.
Inoculation of drug containing medium:
? Drug containing MP bottles in duplicates for each of the FCs (10 and 30µM) of the Example 8(g) were inoculated with 0.5 ml of PC.
4. Incubation: Drug free and drug containing BacT/ALERT®MP (Biomerieux, Inc. Durham, NC, USA), bottles after being inoculated with the proportion control were loaded in to MB/BacT® (Biomerieux, Inc. Durham, NC, USA) automated incubator cum reader system for continuous and automated incubation.
5. Reading for mycobacterial positive/negative growth: MB/ BacT® system was automated to read the presence of mycobacterial growth once in every 15 minutes. Positive or negative culture bottles were determined by the decision making software contained in the MB/BacT® detection system. Reading for positive bottles was given along with the time of detection in days. All positive reading bottles were further tested by ZN smear microscopy and overnight culture on blood agar to rule out contamination.
6. Interpretation of antimycobacterial activity/drug susceptibility
Susceptible: Drug containing bottle was not detected positive within 15 days, or had a positive time for detection that was greater than that of the proportion control. Standard upper limit for reading bottles was taken as 15days.
Resistant: Drug containing bottle was detected positive with time of detection that was equal to or greater than that of the direct control but equal to or less than the proportion controls. Experiment was valid only if the growth in direct and proportion controls occurred within 15 days of incubation.
7. Positive control for antimycobacterial activity: Isoniazid with final concentrations of 0.2mg/mL (approx. 7.5 µM) following the same inoculation, incubation, reading and interpretation standards was used as a known drug control.
Preliminary experiments – in vitro antimycobacterial activity of sample
Explanation about the figures and growth curves: Figures2-6 are 'on-screen' growth curves as shown on the MB/BacT monitor. In the middle top of the curve: Unique barcode ID number of the bottle , along with the result of positive or negative is provided. With regard to the Growth curve, X axis denotes the number of days for detection of positive/negative and Y axis denotes the number of reflectance units (RLU) as measured by the detection system (cut off is 1800 RLU, anything above is considered positive and indicated in red color on the monitor). RLU is directly proportional and is an approximate indicative of the number of live Mycobacterial cells and their active multiplication. Growth curve of the drug containing bottles should be correlated with that of the proportion control.
Results show that positive RLU of proportion control started on day 3.6 and reached within 4 days to and maintained at 4000 RLU. Growth curve with Example8(g) compound started on avg 12.4 at 10µM; Growth curve with 10µM drug concentration has reached up to 3500 RLU over a period of about 20days and has never reached the 4000RLU point as shown in the control.

Observations:
a) Growth in proportion control without the molecule: 3.6 days (Fig 3)
b) Growth with molecule 10uM conc. Avg: 12.4 days (MP Bottle 12.2days) (Fig 4) and no growth at 30 µM (Fig. 5).
c) Example 8(g) has inhibited the growth with 10µM four times longer. Considering the total drug testing period as 15days, 10µM has shown good inhibition of up to 12 days. Growth curve of proportion control and drugs are showing differences in terms of RLU and start points; clear indication of limited and delayed growth of M.tb cells may be due to the inhibitory activity of the Example 8(g). Isoniazide at con 0.25 mg/mL(approx.. 0.75 µM) and sample 8(g) at 30 µM did not show any growth.

Example 5.The Pharmacokinetic properties of Example 8(g)
The molecule was moderately stable (~ 35% after 30 min) in mice microsomal stability assay and was highly plasma protein bound (~98%) but stable upto25% even after two hours. The oral PK (30 mg/kg) in mice was also poor (~1µg/ml/hr) and oral bioavailability was only ~7.0%. But, the IV PK (10 mg/kg in DMSO) in mice was fair (AUC= 4.7µg/ml/hr) and T1/2 was ~8.25 hrs indicating the molecule stays in the circulation for a longer time. The approximate free drug concentration in mice blood plasma at 10 mg/kg given in IV route was ~0.4 µM (calculated considering 2 ml blood volume of a mouse, the Molecular weight of the molecule is 435.10 and ~98% plasma protein bound). Considering the fact that the molecule is moderately stable in mice plasma (~ 35% in 30 mins) and having large clearance volume (2100 ml/kg/hr), the free drug concentration should be >>~ 0.4 µM. This result leads to speculate that a considerable amount of molecule may be available inside the tissues which needs to be determined by tissue distribution experiment.
Example 6. Formulation studies
The following approaches were attempted to develop an appropriate formulation of Example 8(g).
(i) Development of nanoemulsion using (a) Example 8(g), peppermint oil, Tween 80: PEG 400 (as surfactant : co-surfactant) and normal saline (0.9% w/v) (as an aqueous phase); and (b) Example 8(g), peppermint oil, Tween 20: PEG 200 (as surfactant : co-surfactant) and normal saline (0.9% w/v) (as an aqueous phase)
(ii) Development of micelles using Example 8(g), PEG 400: Tween 80 (as surfactant: co-surfactant) and normal saline (0.9% w/v) (as an aqueous phase).
The second approach was found to be promising and therefore was explored further. After assessing various compositions of micelles it was observed that the following composition, i.e. 0.2-0.9 % drug, 10-30% Smix containing tween 80: PEG 400 (1:1) and 70-90% normal saline was found to be ideal. More particularly, the following formulation, i.e. 0.3% drug, 20% S mix containing tween 80: PEG 400 (1:1) and 79.7% normal saline was preferred. The developed micelles were visually observed for clarity and the results are summarized in Table 3. The particle size was recorded using Malvern Zetaszier Nano ZS (Malvern instruments).

Table 2: Composition of micelles

Formulation code Drug (mg) S: Co-S (%) Water (%)
M1 0.8 1:1 (10%) 90%
M2 4 2:1 (10%) 90%
M3 2 1:1 (20%) 80%
M4 4.5 2:1 (10%) 90%
M5 3 1:1 (10%) 90%
M6 5.5 2:1 (10%) 90%
M7 4 1:1 (10%) 90%
M8 3 1:1 (20%) 80%
M9 “ 1:1 (30%) 70%
M10 “ 0:1 (15%) 85%
M11 “ 0:1 (20%) 80%
M12 “ 1:0 (15%) 85%
M13 “ 1:0 (20%) 80%
M14 “ 3:1 (20%) 80%
M15 “ 2:1 (15%) 85%
M16 “ 1:3 (20%) 80%
M17 “ 1:2 (15%) 85%
Table 3: Visual observation of micelles

Formulation code Visual appearance
M1 Clear
M2 Clear
M3 Clear
M4 Turbid
M5 Turbid
M6 Turbid
M7 Turbid
M8 Clear
M9 Clear
M10 Transparent
M11 Transparent
M12 Drug precipitation
M13 Drug precipitation
M14 Transparent
M15 Transparent
M16 Transparent
M17 Transparent

The particle size data of the micelles is depicted in Figures 7-13 and DSC curve of Example 8(g) is shown in Figure 14:

Example 7. PK studies of the formulated sample of Example 8(g) in mice:
PK studies of the formulated Example 8(g) have been performed in mice at both 10mg/kg and 30mg/kg.
The formulated Example 8(g) shows ~33µgms/ml and ~66µgms/ml of the blood plasma level at 10mg/kg and 30mg/kg dose (Figure 15) respectively in mice which was ~33 fold and ~66 fold higher compared to oral PK done at 30mg/kg in mice(~1µg/ml) and also many fold higher than the IV PK done at 10mg/kg in mice (~4.7 µg/ml). The IC50of the molecule is ~7.7 µM and the blood level of the formulated compound is ~153 µM(Mol. wt. of Example 8(g)is 430) at 30mg/kg and ~75 µMat 10mg/kg respectively and the levels were much higher than the IC50 value.

Example 8. General method of Synthesis of Compounds of the Invention

Unless stated otherwise, reactions were performed under nitrogen atmosphere. Reactions were monitored by thin layer chromatography (TLC) on silica gel plates (60 F254), visualizing with ultraviolet light or iodine spray. Flash chromatography was performed on silica gel (100-200 mesh) using distilled hexene, ethyl acetate, dichloromethane. 1H NMR and 13C NMR spectra were recorded either in CDCl3,DMSO-d6orCF3CO2Hsolution by using 400 and 100 MHz spectrometers, respectively. Proton chemical shifts (d) are relative to tetramethylsilane (TMS, d = 0.00) as internal standard and expressed in ppm. Spin multiplicities are given as s (singlet), d (doublet), t (triplet) and m (multiplet) as well as b (broad). Coupling constants (J) are given in hertz. Infrared spectra were recorded on a FT- IR spectrometer. Melting points were determined using melting point apparatus and are uncorrected. MS spectra were obtained on a mass spectrometer. Mass spectra (MS) and high-resolution mass spectra (HRMS) were recorded using electron ionization (EI) mass spectrometry.

Preparation of compound b:A mixture of compound of formula a(4 g, 13.24 mmol) and phosphorousoxychloride (40ml) was stirred at 100oC, for 12-14 h under anhydrous conditions. After completion of the reaction excess of phosphorousoxychloride was removed under vacuum. The residue was diluted with aq NaHCO3 solution to reach the pH=7-8. White solid separated was filtered, washed with water (2 30ml) and dried under vacuum to afford compound of formula b.

Preparation of compound of Formula (I): A mixture of compound of formula b, an appropriate ‘Het’ group and AlCl3 (1.2 equiv) in dichloroethane (5 mL) was stirred at 80 ºC for 7-12 h under a nitrogen atmosphere. After completion of the reaction, the mixture was poured into ice-cold water (15 mL), stirred for 10 min and then extracted with ethylacetate (3 x 20 mL). The organic layers were collected, combined, washed with cold water (2 x 20 mL), dried over anhydrous Na2SO4 and concentrated under vacuum. The residue obtained was purified by column chromatography using ethylacetate/hexene to afford the compound of formula (I).
Following are the synthesis of specific compounds of the invention

a) Preparation of 5-(4-chlorophenyl)-7-(1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 75%; White solid; mp 110-112 ºC; 1H NMR (400 MHz, DMSO-d6) d 11.96 (bs, 1H), 8.50 (d, J = 8.8 Hz, 2H), 8.19-8.15 (m, 2H), 7. 61-7.56 (m, 3H), 7.29-7.21 (m, 2H), 4.03 (s, 3H), 3.02 (t, J = 7.4 Hz, 2H), 1.98-1.88 (m, 2H), 1.02 (t, J = 7.6 Hz, 3H) 13C NMR (100 MHz, DMSO-d6) d 148.3, 145.0, 144.5, 137.2 (2C), 136.6, 134.5, 130.4, 129.2 (2C), 128.7 (2C), 126.4, 122.6 (2C), 120.9, 120.5, 112.2, 111.2, 38.2, 27.3, 21.6, 14.0;HPLC: 91.74%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 10/95, 12/95, 15/90, 18/90; flowrate: 1.0 mL/min;UV 210 nm, retention time 5.67 min; IR (KBr) vmax3277, 2957, 1918, 1538, 1437 cm-1Mass (ESI method): 402.2 (M+1, 100%);. HRMS (ESI) calcd for C23H21N5Cl(M+H)+ 402.1485, found 402.1497.

b) Preparation of 5-(4-chlorophenyl)-1-methyl-7-(1-methyl-1H-indol-3-yl)-3-propyl-1H-pyrazolo[4,3 d]pyrimidine
The above compound was prepared by reacting compound of formula b(wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-methyl-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 75%; White solid; mp180-181 ºC; 1H NMR (400 MHz, CDCl3) d 8.57 (d, J = 8.4 Hz, 2H), 8.03 (d, J = 7.6 Hz, 1H), 7.59 (s, 1H), 7.46-7.43 (m, 3H), 7.38 (t, J = 7.4 Hz, 1H) 7.31-7.28 (m, 1H), 3.96 (s, 6H), 3.14-3.10 (m, 2H), 2.04-1.97 (m, 2H), 1.10 (t, J = 7.4 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 147.2, 147.0, 145.5, 137.3, 137.2, 135.5, 131.3, 129.8, 129.4 (2C), 128.5 (2C), 127.2, 123.1, 121.4, 121.0, 112.1, 109.8, 38.9, 33.4, 27.9, 22.1, 14.1; HPLC: 98.59%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min; UV 265 nm, retention time 5.74 min; IR (KBr) vmax2954, 1916, 1539, 1232 cm-1; HRMS (ESI) calcd for C24H23N5Cl(M+H)+ 416.1642, found 416.1653.

c) Preparation of 5-(4-chlorophenyl)-7-(1-ethyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-ethyl-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 75%; White solid; mp 160-162 ºC; 1H NMR (400 MHz, CDCl3) d 8.55 (d, J = 8.8 Hz, 2H), 8.06 (d, J = 8.4 Hz, 1H), 7.65 (s, 1H), 7.49-7.44 (m,3H), 7.36-7.28 (m, 2H), 4.33 (q, J = 7.2 Hz, 2H), 3.96 (s, 3H), 3.12 (t, J = 7.4 Hz, 2H), 2.04-1.95 (m, 2H), 1.60 (t,J= 8.0 Hz, 3H), 1.10 (t, J = 7.2 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 151.1, 142.3, 141.9, 140.4, 132.1, 131.2, 130.3, 124.7, 124.6 (2C), 124.3, 123.4, 123.3, 122.3, 117.9, 116.2, 116.0, 107.0, 104.8, 36.4, 33.8, 22.8, 17.0, 10.3, 9.0;HPLC: 99.29%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 265 nm, retention time 6.41 min; IR(KBr) vmax2978, 2871, 1912, 1543, 1214 cm-1;HRMS (ESI) calcd for C25H25N5Cl (M+H)+ 430.1798, found 430.1815.

d) Preparation of 7-(5-bromo-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b(wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-bromo-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 73%; White solid; mp 196-198 ºC; 1H NMR (400 MHz, CDCl3) d 8.72 (bs, 1H), 8.54 (m, 2H), 8.21 (d, J = 1.2 Hz, 1H),7.69 (d, J = 2.8 Hz, 1H), 7.48-7.38 (m, 4H), 3.95 (s, 3H),3.12 (t,J= 7.6 Hz,2H), 2.04-1.95 (m, 2H), 1.10 (t, J = 7.2 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 147.1, 146.5, 145.7, 137.0, 135.7, 134.8, 129.5, 129.3 (2C), 128.6 (2C), 128.3, 127.8, 126.5, 123.5, 114.9, 113.1, 112.5, 38.9, 27.9, 22.0, 14.1; HPLC: 92.55%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 10/95, 12/95, 15/90, 18/90; flowrate: 1.0 mL/min;UV 210 nm, retention time 8.50 min; IR (KBr)vmax3419, 3155, 2955, 1897, 1543 cm-1; HRMS (ESI) calcd for C23H20N5ClBr(M+H)+ 480.0591, found 480.0591.

e) Preparation of 7-(5-bromo-1-methyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-bromo-1-methyl-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 72%; White solid; mp 237-238 ºC; 1H NMR (400 MHz, DMSO-d6) d 8.48 (d, J = 8.4 Hz, 2H,), 8.33 (s, 1H), 8.27 (s, 1H), 7.65-7.48 (m, 3H), 7.47-7.46 (m, 1H), 4.06 (s, 3H), 3.97 (s, 3H), 3.04-3.01 (m, 2H), 1.93-1.88 (m, 2H), 1.02 (t, J = 7.4 Hz, 3H), ; 13C NMR (100 MHz, TFA-d) d 152.5, 151.7, 144.9, 141.3, 139.7, 137.2, 135.1, 129.7, 129.5, 128.7, 128.4, 127.9, 127.5, 123.8, 118.8, 118.2, 115.5, 112.7, 112.3, 38.7, 33.0, 26.4, 21.7, 11.8;HPLC: 99.91%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min; UV 265 nm, retention time 7.95 min; IR (KBr) vmax3133, 2970, 1929, 1582, 1433 cm-1;HRMS (ESI) calcd for C24H22N5ClBr (M+H)+ 494.0747, found 494.0763.

f) Preparation of 7-(5-bromo-1-ethyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-ethyl-5-bromo-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 75%; White solid; mp 212-213 ºC; 1H NMR (400 MHz, TFA-d) d 8.54 (s, 1H), 8.38 (s, 1H), 8.28-8.26 (m, 2H), 7.74-7.71 (m, 3H), 7.60-7.58 (m, 1H), 4.54 (q, J= 4.0, 2H), 4.40 (s, 3H), 3.28 (t, J = 7.2 Hz, 2H), 2.02 (q, J = 7.2 Hz, 2H), 1.73 (t, J = 7.2 Hz, 3H), 1.17 (t, J = 6.8 Hz, 3H); 13C NMR (100 MHz, TFA-d) d 152.6, 151.9, 144.9, 141.4, 138.3, 136.3, 134.9, 129.7, 129.6, 128.6, 128.5, 128.0, 127.8, 124.0, 118.4, 118.2, 115.6, 112.8, 112.5, 42.7, 38.7, 26.5, 21.7, 13.2, 11.8; HPLC: 99.86%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05% Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 230 nm, retention time 8.80 min; IR (KBr) vmax2956, 2870, 1737, 1582, 1219 cm-1HRMS (ESI) calcd for C25H24N5ClBr(M+H)+ 508.0904, found 508.0910.

g) Preparation of 7-(5-chloro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-chloro-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 76%; White solid; mp 230-232 ºC; 1H NMR (400 MHz, CDCl3) d 8.79 (bs, 1H), 8.54 (d, J = 9.2 Hz, 2H), 8.04 (d, J = 2.0 Hz, 1H), 7. 68 (d, J = 3.2 Hz,1H), 7.47-7.40 (m, 3H), 7.31-7.25 (m, 1H), 3.94 (s, 3H), 3.12 (t, J = 7.6 Hz, 2H), 2.04-1.97 (m, 2H), 1.10 (t, J = 7.4 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 147.1, 146.5, 145.7, 136.9, 135.7, 134.5 (2C), 129.3 (2C), 128.6 (2C), 127.9, 127.6, 127.5, 124.0, 120.3, 113.2, 112.6, 38.9, 29.6, 22.1, 14.1; HPLC: 96.30%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 265 nm, retention time 6.15 min; IR (KBr) vmax3206, 3170, 2957, 1541, 1109cm-1HRMS (ESI) calcd for C23H20N5Cl2(M+H)+ 436.1109, found 436.1096.

h) Preparation of 7-(5-chloro-6-fluoro-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-chloro-6-fluoro-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 80%; White solid; mp 231-232 ºC;1H NMR (400 MHz, CDCl3) d 8.80 (bs, 1H), 8.52 (d, J = 8.4 Hz, 2H), 7.85 (d, J = 9.6 Hz, 1H), 7.70 (d, J = 2.4 Hz, 1H), 7.53 (d, J = 5.6 Hz, 1H) 7.45 (d,J= 8.4 Hz, 2H), 3.97 (s, 3H) 3.12 (t, J = 7.6 Hz, 2H), 2.02-1.96 (m, 2H), 1.08(t, J = 7.2 Hz, 3H).13C NMR (100 MHz, CDCl3) d 156.2, 155.4, 153.0, 147.2, 146.2, 145.9, 136.9, 135.8, 132.4 (2C), 129.3 (2C), 128.6 (2C), 128.5, 125.6, 112.8, 107.3, 107.1, 38.96, 27.8, 22.0, 14.1; HPLC: 99.83%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min; UV 265 nm, retention time 6.0 min; IR (KBr) vmax3169, 2953, 2869, 1728, 1462 cm-1; HRMS (ESI) calcd for C23H19N5Cl2F (M+H)+ 454.1002, found 454.0999.

i) 5-(4-chlorophenyl)-7-(5,6-difluoro-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b(wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5,6-difluoro-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 78%; Brown solid; mp 233-234 ºC; 1H NMR (400 MHz, CDCl3) d 8.69 (bs, 1H), 8.52 (m, 2H), 7.91-7.86 (m, 1H), 7.69 (s, 1H), 7.47 (d, J = 8.8 Hz, 2H) 7.32-7.27 (m, 1H), 3.99 (s, 3H) 3.12 (t, J = 7.6 Hz, 2H), 2.04-1.94 (m, 2H), 1.09 (t, J = 7.4 Hz, 3H). 13C NMR (100 MHz, CDCl3) d 156.2, 155.4, 153.0, 147.2, 146.3, 145,9, 136.9 (2C), 135.7, 129.3 (2C), 128.6 (2C), 127.8, 125.6, 108.0, 107.8, 99.7, 99.5, 38.9, 27.8, 22.1, 14.1; HPLC: 98.59%, column: X Bridge C-18 150*4.6 mm 5µ, mobile phase A: 0.05 % Formic Acid in water mobile phase B: CH3CN, gradient (T/%B): 0/90, 2/90, 8/98, 10/98, 12/90, 15/90; flowrate: 1.0 mL/min;UV 265 nm, retention time 5.22 min; IR (KBr) vmax3131, 2959, 1920, 1584, 1175 cm-1 HRMS (ESI) calcd for C23H19N5ClF2(M+H)+ 438.1297, found 438.1297.

j) 5-(4-chlorophenyl)-7-(5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-methoxy-indole following the procedure given above in the preparation of compound of Formula (I).
Yield:66%;white solid; mp: 183-185°C;Rf=0.6 (20%EtOAc/n-hexane);1H NMR (400 MHz, CDCl3) d : 8.60 (dd, J = 8.61, 6.23 Hz, 3H), 7.65 (dd, J = 10.33, 2.52 Hz, 2H), 7.45 (d, J = 8.66 Hz, 2H), 7.43-7.33 (m, 1H), 7.01 (dd, J = 8.85, 2.44 Hz, 1H), 4.01 (s, 3H), 3.85 (s, 3H), 3.26-2.96 (t, J=8Hz, 2H), 2.00 (dt, J = 14.75, 7.18 Hz, 2H), 1.10 (t, J = 7.36 Hz, 3H); 13CNMR(100MHz,CDCl3)d: 156.1, 155.6, 147.4, 147.0, 145.6, 135.6, 131.2, 129.6(2C), 129.3, 128.5 (2C), 127.4, 127.2, 114.3, 113.3, 112.4 (2C), 102.2, 55.7, 39.0, 27.9, 22.1, 14.1; MS(ESmass): 431.2; HPLC:97.66%,Column:X-Bridge C-18 150 * 4.6 mm, 5µm,mobile phase A:0.1% formic acid in water, mobile Phase B: CH3CN,(T/%B):0/10,3/20, 10/95, 20/95, 22/20, 25/20; flow rate:1.0 mL/min;Diluent:water: ACN(80:20); UV 254.5 nm, retention time 13.6min.
k) 4-chlorophenyl)-7-(5-methoxy-1-methyl-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 5-methoxy-1-methyl-indole following the procedure given above in the preparation of compound of Formula (I).
Yield:71%;white solid; mp:152-154 °C;Rf= 0.5.1 (20%EtOAc/n-hexane);1H NMR (400 MHz, CDCl3) d:8.40 (d, J = 8.68 Hz, 2H), 7.45 (d, J = 2.38 Hz, 1H), 7.37 (s, 1H), 7.27 (d, J = 8.65 Hz, 2H), 7.17 (d, J = 8.89 Hz, 1H), 6.86 (dd, J = 8.93, 2.43 Hz, 1H), 3.85 (s, 3H), 3.76 (s, 3H), 3.68 (s, 3H), 2.90 (t, J=8Hz, 2H), 1.96-1.70 (m, 2H), 1.070-065(t, J = 7.36 Hz, 3H); 13CNMR(100MHz,CDCl3)dppm:156.0, 155.5, 147.0, 135.5, 132.5(2C), 131.8, 129.3(2C), 128.5(2C), 127.7(2C), 113.8, 111.5, 110.7, 109.9(2C), 102.4, 55.7, 39.0, 33.6, 27.9, 22.1, 14.1; MS(ES mass): 445.2;HPLC:95.63%,Column:X-Terra RP18 250* 4.6mm, 5µm,mobile phase A:0.1%TFA in water,mobilePhaseB:CH3CN,(T/%B):0/20, 5/20, 15/95, 23/95, 25/20, 30/20; flow rate:1.0 mL/min; Diluent: water: ACN(80:20);UV 254.5 nm,retention time 19.7min.
l) 5-(4-chlorophenyl)-7-(1-ethyl-5-methoxy-1H-indol-3-yl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-ethyl-5-methoxy-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 79%;white solid;mp:147-149 °C; Rf= 0.7 (20%EtOAc/n-hexane); 1H NMR (400 MHz, CDCl3) d: 8.57 (t, J = 14.15 Hz, 2H), 7.79-7.59 (m, 2H), 7.47 (dd, J = 19.17, 8.69 Hz, 2H), 7.37 (d, J = 8.93 Hz, 1H), 7.03 (dd, J = 8.93, 2.46 Hz, 1H), 4.49-4.21 (m, 2H), 4.04 (s, 3H), 3.93-3.81 (m, 3H), 3.26-3.07 (t, J=8Hz, 2H), 2.09-1.90 (m, 2H), 1.58 (t, J = 7.29 Hz, 3H), 1.18-0.96 (t, J = 7.36 Hz,, 3H);13C NMR (100 MHz, CDCl3) d: 156.1, 155.5, 147.5, 147.1, 145.6, 137.3, 135.5, 131.6, 130.1, 129.5, 129.3, 128.5, 127.8, 113.7, 111.5, 110.7, 102.5, 55.7, 41.7, 39.0, 31.4, 30.1, 27.9, 22.1, 15.5, 14.2; MS (ES mass);460.0; HPLC:99.55 %, Column:X-Terra RP18 250* 4.6mm, 5µm, mobile phase A:0.1%TFA in water,mobilePhaseB:CH3CN,(T/%B): 0/20, 5/20, 15/95, 23/95, 25/20, 30/20;flow rate:1.0 mL/min; Diluent: water: ACN (80:20); UV 254.5nm, retention time 16.52min.
m) 7-(1-allyl-1H-indol-3-yl)-5-(4-chlorophenyl)-1-methyl-3-propyl-1H-pyrazolo[4,3-d]pyrimidine.
The above compound was prepared by reacting compound of formula b (wherein one of the R group is propyl and the other R group is methyl and Ar is chloro substituted aryl group) with 1-allyl-indole following the procedure given above in the preparation of compound of Formula (I).
Yield: 71%; white solid;mp: 137-139°C; Rf= 0.6; (20%EtOAc/n-hexane); 1H NMR (400 MHz, CDCl3) d: 8.55 (dd, J = 11.59, 8.76 Hz, 2H), 8.09 (d, J = 7.85 Hz, 1H), 7.78 (s, 1H), 7.50-7.43 (m, 3H), 7.36 (m, 2H), 6.23-5.96 (m, 1H), 5.31 (dd, J = 29.80, 13.69 Hz, 2H), 4.89 (d, J = 5.55 Hz, 2H), 4.00 (s, 3H), 3.20 (t, J = 7.62 Hz, 2H), 2.00 (m, 2H), 1.10 (t, J = 7.36 Hz, 3H); 13C NMR (100 MHz, CDCl3) d:156.1, 147.3, 147.0, 145.5, 137.2, 136.7(2C) , 135.5, 132.5, 130.4, 129.7, 129.4, 128.5, 127.4, 123.2, 121.5, 121.2 (2C), 118.5, 112.4, 110.2, 49.2, 38.9, 27.9, 22.1, 14.2; MS (ES mass): 441.9; HPLC:99.47 %, Column: X-Terra RP18 250* 4.6mm, 5µm, mobile phase A:0.1%TFA in water, mobile Phase B: CH3CN, (T/%B): 0/20, 5/20, 15/95, 23/95, 25/20, 30/20; flow rate:1.0 mL /min; Diluent : water: ACN (80:20); UV 254.5nm, retention time 17.05min.

Documents

Application Documents

# Name Date
1 201941021932-STATEMENT OF UNDERTAKING (FORM 3) [31-05-2019(online)].pdf 2019-05-31
2 201941021932-FORM 1 [31-05-2019(online)].pdf 2019-05-31
3 201941021932-DRAWINGS [31-05-2019(online)].pdf 2019-05-31
4 201941021932-DECLARATION OF INVENTORSHIP (FORM 5) [31-05-2019(online)].pdf 2019-05-31
5 201941021932-COMPLETE SPECIFICATION [31-05-2019(online)].pdf 2019-05-31
6 201941021932-FORM-26 [08-06-2019(online)].pdf 2019-06-08
7 Correspondence by Agent_Form-1, Form-3, Form-5, Power of Attorney_10-06-2019.pdf 2019-06-10
8 201941021932-REQUEST FOR CERTIFIED COPY [03-09-2019(online)].pdf 2019-09-03
9 201941021932-FORM 18 [28-12-2020(online)].pdf 2020-12-28
10 201941021932-POA [09-04-2021(online)].pdf 2021-04-09
11 201941021932-FORM 13 [09-04-2021(online)].pdf 2021-04-09
12 201941021932-FORM 3 [17-08-2021(online)].pdf 2021-08-17
13 201941021932-FER_SER_REPLY [18-08-2021(online)].pdf 2021-08-18
14 201941021932-DRAWING [18-08-2021(online)].pdf 2021-08-18
15 201941021932-CLAIMS [18-08-2021(online)].pdf 2021-08-18
16 201941021932-FER.pdf 2021-10-17
17 201941021932-US(14)-HearingNotice-(HearingDate-16-05-2023).pdf 2023-03-21
18 201941021932-Correspondence to notify the Controller [15-05-2023(online)].pdf 2023-05-15
19 201941021932-PETITION UNDER RULE 138 [30-05-2023(online)].pdf 2023-05-30
20 201941021932-PETITION UNDER RULE 137 [15-06-2023(online)].pdf 2023-06-15
21 201941021932-PETITION UNDER RULE 137 [15-06-2023(online)]-1.pdf 2023-06-15
22 201941021932-FORM-26 [15-06-2023(online)].pdf 2023-06-15
23 201941021932-Written submissions and relevant documents [16-06-2023(online)].pdf 2023-06-16
24 201941021932-PatentCertificate12-09-2023.pdf 2023-09-12
25 201941021932-IntimationOfGrant12-09-2023.pdf 2023-09-12

Search Strategy

1 searchstrategyE_18-02-2021.pdf
2 DocumentuploadedE_18-02-2021.pdf

ERegister / Renewals

3rd: 06 Nov 2023

From 31/05/2021 - To 31/05/2022

4th: 06 Nov 2023

From 31/05/2022 - To 31/05/2023

5th: 06 Nov 2023

From 31/05/2023 - To 31/05/2024

6th: 29 May 2024

From 31/05/2024 - To 31/05/2025

7th: 06 May 2025

From 31/05/2025 - To 31/05/2026