Abstract: The present disclosure provides a method for the detection and quantification of Salmonella that cause typhoid fever in humans from blood samples. It discloses oligonucleotide probe of SEQ ID No. 1, along with primers of SEQ ID Nos. 2 and 3 for detecting typhoid causing Salmonella infections. It also provides a PCR reaction mixture for the detection of Salmonella that cause typhoid fever in humans from blood samples and a kit for detecting typhoid.
TECHNICAL FIELD
The present disclosure relates to identification and detection of Salmonella that causes typhoid fever in humans from blood samples by employing nucleic acid amplification assay. The present disclosure provides a PCR reaction mixture and also relates to a method of detecting and optionally quantifying Salmonella that causes typhoid fever in humans from blood samples along with a kit thereof
BACKGROUND
Salmonella that causes Typhoid is an obligate parasite that has no known natural reservoirs outside humans. This gram-negative enteric bacilli belonging to the family of Enterobacteriaceae is motile, facultative anaerobe that is susceptible to various antibiotics. The occurrence of typhoid is mainly attributed to the presence of unhygienic conditions owing to inadequate sewage disposal and unsafe drinking water. The infection mainly spreads by ingestion of infected food or water hence giving access to the intestinal system. The bacterium after entering the system multiplies and spreads into bloodstream thus giving rise to symptoms such as malaise, anorexia, headache, constipation or diarrhea, rose-colored spots on the chest area and enlarged spleen and liver. The estimates from WHO indicate annual incidence of typhoid cases being about 17 million worldwide.
The conventional diagnosis of typhoid is made by blood, stool, bone marrow cultures or by Widal test. These assays are either time consuming or not so specific towards identification of the said bacteria. In order to overcome these disadvantages PCR based assays for direct and specific identification of the bacteria from the biological samples are utilized. These assays have an advantage of determining exact load of the infectious agent and treatment pattern after diagnosis, hence serving physicians for proper selection of the treatment. Thus designing specific and sensitive primers and probes towards identification of the said bacteria plays a pivotal role in diagnosis and treatment of typhoid.
STATEMENT OF THE DISCLOSURE
Accordingly, the present disclosure relates to probe having nucleotide sequence set forth as SEQ ID No. 1, optionally conjugated with detectable labels; primer having nucleotide sequence set
I t
forth as SEQ ID Nos. 2 or 3; a PCR reaction mixture for detecting typhoid, said mixture comprising nucleic acid amplification reagents, probe having nucleotide sequence set forth as SEQ ID No. I and primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3; a method of detecting and optionally quantifying typhoid, said method comprising acts of - (a) obtaining a PCR reaction mixture comprising nucleic acid amplification reagents, probe having nucleotide sequence set forth as SEQ ID No. I and primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3 (b) introducing test sample to the PCR reaction mixture for PCR amplification to obtain copies of target sequence, followed by measuring fluorescence signal generated for detecting typhoid and (c) optionally, constructing a Standard Curve from the detected signal for quantifying typhoid; a kit for detecting typhoid, said kit comprising probe having nucleotide sequence set forth as SEQ ID No. 1, optionally labeled at 5' and 3' end, primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3 and amplification reagents, optionally along with instruction manual; and a method of assembling a kit for detecting typhoid, said method comprising step of combining probe having nucleotide sequence set forth as SEQ ID No. I, primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3, and amplification reagents, optionally along with instruction manual.
BRIEF DESCRIPTION OF THE ACCOMPANYING FIGURES
In order that the disclosure may be readily understood and put into practical effect, reference will now be made to exemplary embodiments as illustrated with reference to the accompanying figures. The figure together with a detailed description below, are incorporated in and form part of the specification, and serve to further illustrate the embodiments and explain various principles and advantages, in accordance with the present disclosure where:
Figure 1 shows amplification plot for Salmonella paratyphi by real time PCR. Figure 2 shows amplification plot^r Salmonella typhi by real time PCR. Figure 3 shows amplification plot^r Salmonella typhimurium by real time PCR. Figure 4 shows real time profile for log diluted Salmonella DNA. Figure 5 shows log dilution curve for Salmonella.
DETAILED DESCRIPTION
The present disclosure relates to a probe having nucleotide sequence set forth as SEQ ID No. 1,
optionally conjugated with detectable labels.
In an embodiment of the present disclosure, the probe is for detecting typhoid; and wherein the
detectable labels are flurophore at 5' end and quencher at 3' end.
In another embodiment of the present disclosure, the fluorophore is selected from group
comprising fluorescein, fluorescein derivatives consisting of 6-Carboxy Fluorescein [FAM],
VIC, JOE, 5-(2'-aminoethyl)aminonaphthalene-l-sulphonic acid, coumarin and coumarin
derivatives, lucifer yellow, texas red, tetramethylrhodamine,, tetrachloro-6-carboxyfluoroscein,
5-carboxyrhodamine and cyanine dyes, preferably 6-Carboxy Fluorescein [FAM]; and the
quencher is selected from group comprising tetra methyl rhodamine, 4'-(4-
dimethylaminophenylazo)benzoic acid, 4-dimethylaminophenylazophenyl-4'-maleimide, tetra
methyl rhodamine, carboxytetramethyl rhodamine and black hole quencher 1 [BHQ] dyes,
preferably black hole quencher 1 (BHQl).
The present disclosure relates to a primer having nucleotide sequence set forth as SEQ ID Nos. 2
or 3.
In an embodiment of the present disclosure, the primer having the SEQ ID No. 2 is sense primer
and the primer having the SEQ ID No. 3 is antisense primer; and the primers correspond to probe
having nucleotide sequence set forth as SEQ ID No. 1
The present disclosure relates to a PCR reaction mixture for detecting typhoid, said mixture
comprising nucleic acid amplification reagents, probe having nucleotide sequence set forth as
SEQ ID No. 1; and primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3.
In an embodiment of the present disclosure, the primer having the SEQ ID No. 2 is sense primer
and the primer having the SEQ ID No. 3 is antisense primer; and the probe is conjugated with
detectable labels having flurophore at 5' end and quencher at 3' end.
In another embodiment of the present disclosure, the primers correspond to probe having SEQ
ID No. 1.
In yet another embodiment of the present disclosure, the typhoid is detected from blood sample;
and the amplification reagents are selected from group comprising magnesium chloride, Taq
polymerase and buffer or any combination thereof.
The present disclosure relates to a method of detecting and optionally quantifying typhoid, said
method comprising acts of:
(a) obtaining a PCR reaction mixture comprising nucleic acid amplification reagents, probe having nucleotide sequence set forth as SEQ ID No.l and primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3;
(b) introducing test sample to the PCR reaction mixture for PCR amplification to obtain copies of target sequence, followed by measuring fluorescence signal generated for detecting typhoid; and
(c) optionally, constructing a Standard Curve from the detected signal for quantifying typhoid.
In an embodiment of the present disclosure, the primer having the SEQ ID No. 2 is sense primer
and the primer having the SEQ ID No. 3 is antisense primer.
In another embodiment of the present disclosure, the primers correspond to probe having SEQ
IDNo. 1.
In yet another embodiment of the present disclosure, the test sample is blood sample; and the
amplification reagents are selected from group comprising magnesium chloride, Taq polymerase
and buffer or any combination thereof.
In still another embodiment of the present disclosure, the probe is conjugated with detectable
labels having flurophore at 5' end and quencher at 3' end; and the fluorescence signal is
generated by the probes having flurophore at 5' end and quencher at 3' end.
In still another embodiment of the present disclosure, the fluorophore is selected from group
comprising fluorescein, fluorescein derivatives consisting of 6-Carboxy Fluorescein [FAM],
VIC, JOE, tetrachloro-6-carboxyfluoroscein and 5-(2'-aminoethyl)aminonaphthalene-l-
sulphonic acid; coumarin, coumarin derivatives, lucifer yellow, texas red, tetra methyl
rhodamine, 5-carboxyrhodamine and cyanine dyes, preferably 6-Carboxy Fluorescein [FAM];
and the quencher is selected from a group comprising tetra methyl rhodamine, 4'-(4-
dimethylaminophenylazo)benzoic acid, 4-dimethylaminophenylazophenyl-4'-maleimide, tetra
methyl rhodamine, carboxytetramethyl rhodamine and black hole quencher 1 [BHQ] dyes,
preferably black hole quencher 1 (BHQl).
The present disclosure relates to a kit for detecting typhoid, said kit comprising probe having
nucleotide sequence set forth as SEQ ID No. 1, optionally labeled at 5' and 3' end; primers
having nucleotide sequence set forth as SEQ ID Nos. 2 and 3; and amplification reagents,
optionally along with instruction manual.
In an embodiment of the present disclosure, the probe is conjugated with detectable labels having flurophore at 5' end and quencher at 3' end; and the amplification reagents are selected fi-om a group comprising magnesium chloride, Taq polymerase and buffer or any combination thereof. The present disclosure relates to a method of assembling a kit for detecting typhoid, said method comprising step of combining probe having nucleotide sequence set forth as SEQ ID No. 1; primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3; and amplification reagents, optionally along with instruction manual.
List of biological sequences of the disclosure
The "oligonucleotide" probe and the corresponding primers have sequence identification
numbers as shown in Table 1 below:
Table -1
SEQUENCE ID I NUCLEOTIDE SEQUENCE
NUMBER
SEQ ID No. 1 5'- FAM - ATTACGATACACAGGCAGCGATACA-BHQl- 3'
or
5'- Flurophore - ATTACGATACACAGGCAGCGATACA-Quencher- 3'
SEQ ID No. 2 5' - GCAGTCGTGGAGGGATTTAT- 3'
SEQ ID No. 3 5' - CAGTTCGGCACGGATTTGAC - 3'
In an embodiment of the present disclosure, the designed "Oligonucleotide" probe are used for the detection of typhoid causing Salmonella nucleic acids from an infected blood sample by employing Real time PCR. The mode of detection is by measuring increase in fluorescence during PCR.
In an embodiment of the present disclosure, the said "Oligonucleotide" of SEQ ID No. 1 has detectable label with fluorophore at 5' end and quencher at the 3' end. The fluorophore is selected from a group comprising fluorescein and fluorescein derivatives FAM, VIC, JOE, 5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid, coumarin and coumarin derivatives, lucifer
yellow, texas red, tetramethylrhodamine, 6-Carboxy Fluorescein, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine and cyanine dyes.
In an embodiment of the present disclosure, the said quencher is selected from a group comprising Tetra Methyl Rhodamine, 4'-(4-dimethylaminophenylazo) benzoic acid, 4-dimethylaminophenyl-4'-maleimide, tetramethyl rhodamine, carboxy tetramethyl rhodamine and BHQ dyes. The said fluorophore is preferably 6-Carboxy Fluorescein [FAM] and the quencher is Black hole quencher 1 [BHQl] when present at the 3' end.
The present disclosure is in relation to a method for detecting typhoid causing Salmonella infections, where in the said PCR mixture comprising of nucleic acid amplification reagents, "Oligonucleotide" probe designated as SEQ ID No. 1, along with its corresponding primers of SEQ ID Nos. 2 & 3 and a test sample is subjected for amplification using real-time PCR to obtain copies of the target sequence. The amplification is measured in terms of increase in fluorescence signal.
In an embodiment of the present disclosure, the "Oligonucleotide" probe has a size of 25 nucleotides and the primers having a size of 20 nucleotides respectively. The designed probe has a fluorophore at the 5'end and a quencher at the 3' end.
In an embodiment of the present disclosure, the said fluorophore is preferably 6-Carboxy fluorescein [FAM] and the quencher is Black hole quencher 1. The current disclosure is used for the detection of Salmonella that cause typhoid fever in humans from blood samples. The method used for detection is by monitoring the increase in fluorescence during the PCR.
According to the present disclosure the "Oligonucleotide" probe refers to a short sequence of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). The "Oligonucleotide" probes specifically hybridise to nucleic acids from typhoid causing Salmonella strains. The "Oligonucleotide" probe according to the present disclosure is generally of 25 nucleotides length. The said "Oligonucleotide" probe specifically hybridizes to typhoid causing Salmonella nucleic
acid sequence without exhibiting non-specific hybridization to Salmonella non-typhi nucleic acids.
In an embodiment of the present disclosure, the said "Oligonucleotide" probe employed here follows the principles of Taqman chemistry. TaqMan probes also called Double-Dye oligonucleotide or dual labeled probes, are the most widely used type of probes. They were developed by Roche [Basel, Switzerland] and ABI [Foster City, USA] from an assay that originally used a radiolabeled probe and consist of a single-stranded probe sequence that is complementary to one of the strands of the amplicon. The fluorophore when excited passes its energy, via FRET (Fluorescence resonance energy transfer), to the quencher. During real time PCR the probe binds to the amplicon during each annealing step of the PCR. When the Taq polymerase extends from the primer bound to the amplicon it displaces the 5' end of the probe, which is then degraded by the 5'-3' exonuclease activity of the Taq polymerase. Cleavage continues until the remaining probe melts off the amplicon. This process releases the fluorophore and quencher into solution, specially separating them compared to when they were held together by the probe. This leads to an irreversible increase in fluorescence from the fluorophore.
In an embodiment of the present disclosure, the said "Oligonucleotide" probe according to the present disclosure, therefore, is further provided in combination with their corresponding sense and antisense primers that can be used to specifically amplify and detect the nucleic acids of Salmonella that cause typhoid fever in humans from blood samples by real time PCR.
In an embodiment of the present disclosure, the technology of the instant Application is further elaborated with the help of following examples and figures. However, the example should not be construed to limit the scope of the disclosure.
EXAMPLE 1
DNA is isolated from the blood samples of 15 patients (4 samples ofS. Paratyphi and 6 samples ofS. typhi and 5 samples ofS. Typhimurium) with typhoid fever using QIA amp DNA blood kit. The DNA isolation process consisted of lysis, binding, washing and elution steps. Real time PCR reactions are carried out for all the samples using the oligonucleotide probe designated as SEQ
ID No. 1 along with its corresponding primers of SEQ ID Nos. 2 & 3 respectively. The composition of the real time PCR mix and PCR conditions is as given in Tables 2 & 3.
Table 2; Real time-PCR with Takara Premix
Real time PCR Master Mix Composition
Premix 5.0 fi 1
Forward Primer 0.2 ^1 (2picomoles)
Reverse Primer 0.2 ^1 (2picomoles)
Probe 0.2 fil (2picomoles)
Sample 2.0 }iPCR grade Water 2.4 |LI1
Total 10 ^1
Table 3: Real time-PCR cycle conditions
PCR Program
Stepl I 95"C for 60sec
Step 2 95"C for lOsec
Step 3 58"C for 34sec
Steps 2 and 3 repeats 45 times
Table 4: Showing Ct values by real time PCR
SI. no Sample Name Ct
1 S. Paratyphi 20.1771
^ S. Paratyphi 19.5164
1 S. Paratyphi 21.0534
~4 S. Paratyphi 21.3574
5 S. typhi 19.0802
~6 S. typhi 19.9695
1 S. typhi 20.0099
1 S. typhi 18.9876
~9 S. typhi 20.2862
To S. typhi 18.8562
11 S. Typhimurium 3g 94
12 S. Typhimurium 38 06
13 S. Typhimurium 37 11
14 S. Typhimurium 3116
15 S. Typhimurium 3724
The results obtained from the above Table 4, showed that the probe and the primers designated as SEQ ID No. 1 along with its corresponding primers of SEQ ID Nos. 2 & 3 could detect all the 15 samples comprising of 4 samples of S. Paratyphi, 6 samples of S. typhi and 5 samples of 5. Typhimurium which are the common strains to cause typhoid fever. This result shows the specificity of the designed probe and primers (Figs. 1,2 & 3).
EXAMPLE 2
The oligonucleotide probe designated as SEQ ID No. 1 is used for quantifying bacterial load in an infected sample. For quantifying the bacterial load an overnight culture of Salmonella is grown at 37°C, on a shaker for 12 hours. The culture is diluted with 0.9% saline to obtain an absorbance of 1 O.D. The 1 O.D culture is further serially diluted with saline and the CFU is calculated by doing a viable cell count by plate count method (approximately 1 O. D is equivalent to 3x10^ CFU/ml). About 100|il of each dilution is subjected to DNA isolation using a commercial kit. The bound DNA is eluted in 100 ^l of elution buffer. The isolated DNA is subjected to real time PCR using SEQ ID No. 1 along with its corresponding primers of SEQ ID
I
* *
Nos. 2 & 3. The volume of the DNA taken for PCR is 4 \il. Based on the dilution and the obtained Ct values a log dilution curve is generated (Figs. 4 & 5). The log 10 CFU/reaction along with the Ct value is given in Table 5. Based on the Ct values obtained from the log dilution curve one can calculate the bacterial load in an infected clinical sample. For instance in an unknown clinical sample if it gives a Ct of 20, it will have a bacterial load of 3.00 E+08 CFU/ml.
Table 5: log dilution curve values with respect to Ct
I \ LoglO CFU/ I
CFU/ml CFU/reaction reaction Ct
3.00E+09 1.20E+07 7J08 17.378
3.00E+08 1.20E+06 6^08 20.1704
3.00E+07 1.20E+05 5^08 23.1803
3.00E+06 1.20E+04 408 27.5816
3.00E+05 1.20E+03 3M 30.8042
3.00E+04 1.20E+02 2M 33.5095
3.00E+03 1.20E+01 LOS 37.5007
EXAMPLE 3
The sensitivity of the designed primers and probe s tested on a clinical sample panel of 25 blood samples characterized by Widal test. DNA is isolated from the blood samples using a QIA amp DNA blood kit. The DNA isolation process consisted of lysis, binding, washing and elution steps. Real time PCR reactions are carried out for all the samples using the oligonucleotide probe designated as SEQ ID No. 1 along with its corresponding primers of SEQ ID Nos. 2 & 3 respectively. The composition of the real time PCR mix and PCR conditions is as given in Tables 2&3.
Table 6: Real time PCR Ct values for clinical sample panel
Sample I Ct real time PCR i Widal (TO) titre
1 •
ID I SDI 34.43 +^
SD2 35.65 +^
SD3 38.17 ^
SD4 35.59 +^
SDI 32.62 +^
SD6 34.76 ^
SD7 34.99 ^^^e
SDI 33.36 +ve
SD'9 37.07 +^
SD 10 ^ve ^ve
SDll 33.67 ^
SD12 33.57 ^ve
SD13 3421 +ve
SD 14 33.38 ^ve
SD 15 35.82 '^
SD 16 33.75 +ve
SD 17 34.19 ^ve
SD 18 ^ve ^ve
SD 19 37.24 ^ve
SD20 36?71 ^ve
SD21 35^21 ^ve
SD22 35.00 ^ve
SD23 34.72 ^ve
SD24 I 33.98 \ '^
SD25 33.99 +^
Results obtained as given in Table 6 showed that Widal test could detect 11 samples as positive and 14 samples as negative. While the real time PCR could detect 23 samples as positive and 2 samples as negative.
From the above the following is concluded:
a) The Oligonucleotide of SEQ ID No.l, which is designed for the Plasmid maintenance protein gene of Salmonella that causes typhoid fever in humans showed good specificity and sensitivity (100%). All the 15 positive samples are detected by the respective primers and probe.
b) The oligonucleotide probe designated as SEQ ID No. 1 can also be used for quantifying bacterial load in an infected sample.
c) The oligonucleotide probe designated as SEQ ID No. 1 proved to be more sensitive than the Widal test.
We Claim:
1) Probe having nucleotide sequence set forth as SEQ ID No. 1, optionally conjugated with
detectable labels.
2) The probe as claimed in claim 1, wherein the probe is for detecting typhoid; and wherein the detectable labels are flurophore at 5' end and quencher at 3' end.
3) The probe as claimed in claim 2, wherein the fluorophore is selected from group comprising fluorescein, fluorescein derivatives consisting of 6-Carboxy Fluorescein [FAM], VIC, JOE, 5-(2'-aminoethyl)aminonaphthalene-l-sulphonic acid, coumarin and coumarin derivatives, lucifer yellow, texas red, tetramethylrhodamine,, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine and cyanine dyes, preferably 6-Carboxy Fluorescein [FAM]; and the quencher is selected from group comprising tetra methyl rhodamine, 4'-(4-dimethylaminophenylazo)benzoic acid, 4-dimethylaminophenylazophenyl-4'-maleimide, tetra methyl rhodamine, carboxytetramethyl rhodamine and black hole quencher 1 [BHQ] dyes, preferably black hole quencher 1 (BHQl).
4) Primer having nucleotide sequence set forth as SEQ ID Nos. 2 or 3.
5) The primer as claimed in claim 4, wherein the primer having the SEQ ID No. 2 is sense primer and the primer having the SEQ ID No. 3 is antisense primer; and the primers correspond to probe having nucleotide sequence set forth as SEQ ID No. 1
6) A PCR reaction mixture for detecting typhoid, said mixture comprising nucleic acid amplification reagents, probe having nucleotide sequence set forth as SEQ ID No. 1; and primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3.
7) The reaction mixture as claimed in claim 6, wherein the primer having the SEQ ID No. 2 is sense primer and the primer having the SEQ ID No. 3 is antisense primer; and the probe is conjugated with detectable labels having flurophore at 5' end and quencher at 3' end.
8) The reaction mixture as claimed in claim 6, wherein the primers correspond to probe having SEQ ID No. 1.
9) The reaction mixture as claimed in claim 6, wherein the typhoid is detected from blood sample; and the amplification reagents are selected from group comprising magnesium chloride, Taq polymerase and buffer or any combination thereof.
10) A method of detecting and optionally quantifying typhoid, said method comprising acts of:
<
(a) obtaining a PCR reaction mixture comprising nucleic acid amplification reagents, probe having nucleotide sequence set forth as SEQ ID No.l and primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3;
(b) introducing test sample to the PCR reaction mixture for PCR amplification to obtain copies of target sequence, followed by measuring fluorescence signal generated for detecting typhoid; and
(c) optionally, constructing a Standard Curve from the detected signal for quantifying typhoid.
11) The method as claimed in claim 10, wherein the primer having the SEQ ID No. 2 is sense primer and the primer having the SEQ ID No. 3 is antisense primer.
12) The method as claimed in claim 10, wherein the primers correspond to probe having SEQ ID No.l.
13) The method as claimed in claim 10, wherein the test sample is blood sample; and the amplification reagents are selected from group comprising magnesium chloride, Taq polymerase and buffer or any combination thereof.
14) The method as claimed in claim 10, wherein the probe is conjugated with detectable labels having flurophore at 5' end and quencher at 3' end; and the fluorescence signal is generated by the probes having flurophore at 5' end and quencher at 3' end.
15) The method as claimed in claim 14, wherein the fluorophore is selected from group comprising fluorescein, fluorescein derivatives consisting of 6-Carboxy Fluorescein [FAM], VIC, JOE, tetrachloro-6-carboxyfluoroscein and 5-(2'-aminoethyl)aminonaphthalene-l-sulphonic acid; coumarin, coumarin derivatives, lucifer yellow, texas red, tetra methyl rhodamine, 5-carboxyrhodamine and cyanine dyes, preferably 6-Carboxy Fluorescein [FAM]; and the quencher is selected from a group comprising tetra methyl rhodamine, 4'-(4-dimethylaminophenylazo)benzoic acid, 4-dimethylaminophenylazophenyl-4'-maleimide, tetra methyl rhodamine, carboxytetramethyl rhodamine and black hole quencher 1 [BHQ] dyes, preferably black hole quencher 1 (BHQl).
16) A kit for detecting typhoid, said kit comprising probe having nucleotide sequence set forth as SEQ ID No. 1, optionally labeled at 5' and 3' end; primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3; and amplification reagents, optionally along with instruction manual.
17) The kit as claimed in claim 16, wherein the probe is conjugated with detectable labels having flurophore at 5' end and quencher at 3' end; and the amplification reagents are selected from a group comprising magnesium chloride, Taq polymerase and buffer or any combination thereof
18) A method of assembling a kit for detecting typhoid, said method comprising step of combining probe having nucleotide sequence set forth as SEQ ID No. 1; primers having nucleotide sequence set forth as SEQ ID Nos. 2 and 3; and amplification reagents, optionally along with instruction manual.
| # | Name | Date |
|---|---|---|
| 1 | Form-5.pdf | 2011-09-02 |
| 2 | Form-3.pdf | 2011-09-02 |
| 3 | Form-1.pdf | 2011-09-02 |
| 4 | Drawings.pdf | 2011-09-02 |
| 5 | 122-CHE-2011 SEQUENCE LISTING 28-09-2011.pdf | 2011-09-28 |
| 6 | 122-CHE-2011 FORM-5 28-09-2011.pdf | 2011-09-28 |
| 7 | 122-CHE-2011 FORM-3 28-09-2011.pdf | 2011-09-28 |
| 8 | 122-CHE-2011 FORM-2 28-09-2011.pdf | 2011-09-28 |
| 9 | 122-CHE-2011 FORM-18 28-09-2011.pdf | 2011-09-28 |
| 10 | 122-CHE-2011 FORM-1 28-09-2011.pdf | 2011-09-28 |
| 11 | 122-CHE-2011 DRAWINGS 28-09-2011.pdf | 2011-09-28 |
| 12 | 122-CHE-2011 DESCRIPTION(COMPLETE) 28-09-2011.pdf | 2011-09-28 |
| 13 | 122-CHE-2011 CORRESPONDENCE OTHERS 28-09-2011.pdf | 2011-09-28 |
| 14 | 122-CHE-2011 CLAIMS 28-09-2011.pdf | 2011-09-28 |
| 15 | 122-CHE-2011 ABSTRACT 28-09-2011.pdf | 2011-09-28 |
| 16 | 122-CHE-2011 POWER OF ATTORNEY 12-12-2011.pdf | 2011-12-12 |
| 17 | 122-CHE-2011 FORM-1 12-12-2011.pdf | 2011-12-12 |
| 18 | 122-CHE-2011 CORRESPONDENCE OTHERS 12-12-2011.pdf | 2011-12-12 |
| 19 | 122-CHE-2011 FORM-3 06-02-2012.pdf | 2012-02-06 |
| 20 | 122-CHE-2011 CORRESPONDENCE OTHERS,, 06-02-2012.pdf | 2012-02-06 |
| 21 | 122-CHE-2011 FORM -3 31-10-2012.pdf | 2012-10-31 |
| 22 | 122-CHE-2011 CORRESPONDENCE OTHERS 31-10-2012.pdf | 2012-10-31 |
| 23 | 122-CHE-2011 FORM-18 16-06-2015.pdf | 2015-06-16 |
| 24 | 122-CHE-2011 CORRESPONDENCE OTHERS 16-06-2015.pdf | 2015-06-16 |
| 25 | 122-CHE-2011-FER.pdf | 2016-12-09 |
| 26 | Examination Report Reply Recieved [08-06-2017(online)].pdf | 2017-06-08 |
| 27 | Description(Complete) [08-06-2017(online)].pdf_244.pdf | 2017-06-08 |
| 28 | Description(Complete) [08-06-2017(online)].pdf | 2017-06-08 |
| 29 | Correspondence [08-06-2017(online)].pdf | 2017-06-08 |
| 30 | Claims [08-06-2017(online)].pdf | 2017-06-08 |
| 31 | 122-CHE-2011-HearingNoticeLetter.pdf | 2019-05-24 |
| 32 | 122-CHE-2011-FORM-26 [25-06-2019(online)].pdf | 2019-06-25 |
| 33 | 122-CHE-2011-ExtendedHearingNoticeLetter_26-06-2019.pdf | 2019-06-26 |
| 34 | 122-CHE-2011-Written submissions and relevant documents (MANDATORY) [10-07-2019(online)].pdf | 2019-07-10 |
| 35 | Marked Up Claims_Granted 316468_19-07-2019.pdf | 2019-07-19 |
| 36 | Drawings_Granted 316468_19-07-2019.pdf | 2019-07-19 |
| 37 | Description_Granted 316468_19-07-2019.pdf | 2019-07-19 |
| 38 | Claims_Granted 316468_19-07-2019.pdf | 2019-07-19 |
| 39 | Abstract_Granted 316468_19-07-2019.pdf | 2019-07-19 |
| 40 | 122-CHE-2011-PatentCertificate19-07-2019.pdf | 2019-07-19 |
| 41 | 122-CHE-2011-IntimationOfGrant19-07-2019.pdf | 2019-07-19 |
| 42 | 122-CHE-2011-RELEVANT DOCUMENTS [14-04-2020(online)].pdf | 2020-04-14 |
| 43 | 122-CHE-2011-RELEVANT DOCUMENTS [14-04-2020(online)]-1.pdf | 2020-04-14 |
| 44 | 122-CHE-2011-FORM 4 [15-04-2020(online)].pdf | 2020-04-15 |
| 45 | 122-CHE-2011-RELEVANT DOCUMENTS [28-10-2021(online)].pdf | 2021-10-28 |
| 46 | 122-CHE-2011-RELEVANT DOCUMENTS [28-10-2021(online)]-1.pdf | 2021-10-28 |
| 47 | 122-CHE-2011-RELEVANT DOCUMENTS [25-09-2022(online)].pdf | 2022-09-25 |
| 48 | 122-CHE-2011-RELEVANT DOCUMENTS [25-09-2022(online)]-1.pdf | 2022-09-25 |
| 49 | 122-CHE-2011-RELEVANT DOCUMENTS [17-08-2023(online)].pdf | 2023-08-17 |
| 50 | 122-CHE-2011-RELEVANT DOCUMENTS [17-08-2023(online)]-1.pdf | 2023-08-17 |
| 1 | Searchstrategy_09-12-2016.pdf |