Abstract: Abstract PROCESS FOR EXTRACELLULAR SECRETION OF BRAZZEIN The present invention discloses a process for the secretion of brazzein in improved yield.
DESC:TECHNICAL FIELD OF THE INVENTION:
The present invention relates to a process for the extracellular secretion of Brazzein from E.coli cells in enhanced yield and purity.
BACKGROUND OF THE INVENTION:
Brazzein is a high-potency thermostable sweet protein, originally isolated from the fruit of the West African climbing tree Pentadiplandra brazzeana Baillon. (Ming and Hellekant, FEBS Lett. 355: 106-108, 1994). Brazzein is 2,500 times sweeter than sucrose in comparison to 2% sucrose aqueous solution and 500 times in comparison to 10% sucrose. Due to its close taste profile with sucrose compared to other protein based natural sweetners such as thaumatin or monellin, its water solubility, stability at high temperatures and at low pH, brazzein may be conveniently used in baking formulations and by industrial food manufacturers. This stability of Brazzein coupled with its sweet taste profile makes this a suitable alternative to currently available low calorie high intensity sweeteners such as sucralose, Aspartame, and Stevia. As a dietary protein, it is safe for consumption by diabetics. When blended with other sweeteners such as aspartame and stevia, Brazzein reduces their aftertaste and complements their flavour.
However, isolation of Brazzein from it natural source is expensive, and hence is not commercially feasible. Moreover, Pentadiplandra brazzeana, known for producing Brazzein which is found in the extracellular space of the pulp surrounding the seeds is geographically located in the West African regions of Cameroon and Gabon, isolating brazzein on a commercial scale from other regions globally becomes impractical.
In view of the many difficulties resulting from the process of extraction of Brazzein from P. brazzeana, several synthetic approaches have been proposed in the art to devise a mechanism for the synthesis of Brazzein.
Structurally, Brazzein comprises 54 amino acid residues, corresponding to a molecular mass of 6.5 kDa, and has been classified based on variations at the N-terminal sequences. Type I Brazzein is an unstable form composed of 54 amino acids having glutamine as the first amino acid. This unstable form may be converted to Type II Brazzein form or the Major form, wherein glutamine at the N-terminal position is converted to pyroglutamate. In Type III Brazzein or Minor form, glutamine is absent at the first amino acid position, therefore spanning an amino acid sequence of 53 amino acids. (Assadi-Porter, et al., Arch. Biochem. Biophys. 376: 252-258, 2000).
Other than these naturally existing forms, researchers have developed variants and multi variants of brazzein having excellent physical stability at varying temperatures, and pH ranges and possessing an excellent taste profile by mutating wild-type Brazzein through substitution of amino acids at certain positions.
A disclosure in US Patent No. 8592181 relates to Brazzein variants and multi variants having higher sweetness and a method for preparing the said multi-variant. A corresponding research article (Kwang-Hoon Kong et al Bull. Korean Chem. Soc. 2010, Vol. 31, No. 12) by the same inventor of US’181 has, to improve production levels of the recombinant soluble brazzein, established a new strategy using the pelB leader sequence of pectate lyase B from Erwinia carotovora CE for Brazzein expression. The process for Brazzein expression disclosed therein only resulted in periplasmic localization of the protein. Post fermentation, downstream processing techniques involved subjecting the induced BL21 Star (DE3) cells to centrifugation and osmotic shock. Major disadvantages of periplasmic expression and osmotic treatment to isolate the protein are its low expression yields, several centrifugation steps and a large increase in buffer volumes during the osmotic treatment, making isolation processes tedious and results in yield loss.
Fariba Assadi-Porter et al., (Protein Expr Purif. 2008 Apr;58(2):263-8) have attempted at providing for efficient and rapid protein expression and purification of Brazzein in E. coli. However, the method described therein involves intracellular expression of the Brazzein protein fused to Small Ubiquitin-like Modifier protein (SUMO), followed by cleavage by SUMO protease. SUMO proteins are a family of small proteins which are covalently attached to and detached from other proteins in cells to modify their function. However, fusion of SUMO to the Brazzein protein does not modify the localization of Brazzein to the extracellular region, thereby resulting in usage of expensive and inconvenient downstream processes to isolate and purify the functional protein.
In a research article by Fariba Assadi-Porter et al.,(Arch Biochem Biophys.2000, 15;376(2):252-8) Brazzein in fusion with Staphylococcal nuclease protein with single engineered cyanogen bromide cleavage site between Brazzein and Staphylococcal nuclease has been expressed. This fusion protein is expressed in insoluble inclusion bodies in E.coli, thus requiring extensive refolding of the followed by cleavage with cyanogen bromide to isolate functional Brazzein.
The above disclosures, relate either to periplasmic or intracellular localization of Brazzein in E.coli, however no attempts have been made in prior art to obtain extracellular Brazzein secretion when expressed in E.coli in order to increase expression yield and make downstream processing convenient and economical during industrial scale Brazzein production.
Extracellular release of proteins lodged in the periplasmic space is usually achieved by several strategies like employing leaky strains for protein expression, cell membrane permeabilization, or co-expression of release proteins. However, applications of these techniques incur exorbitant costs.
In view of the shortcomings of the methods known in the art, the present inventors have with the object of minimizing disadvantages posed by low expression yields and downstream processing of Brazzein protein, provided a convenient process for extracellular secretion of Brazzein protein from E.coli cells in order to increase expression yields and ease downstream processing techniques.
SUMMARY OF THE INVENTION:
In a preferred aspect, the present invention provides a process for the extracellular secretion of recombinant Brazzein with improved yield comprising:
(a) ligating a plasmid with a nucleotide sequence encoding a signal leader sequence conjugated to Brazzein to obtain a recombinant DNA construct and inserting the said construct in BL21(DE3) E. coli cells by transformation;
(b) culturing the transformed cells of step (a) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 4 hrs to 72 hrs to obtain secretion of brazzein in the culture medium, and
(c) separating culture medium from cells after 4 to 72 hours post induction and purifying Brazzein from the clarified medium.
Accordingly, the nucleotide sequence to be ligated in the recombinant vector is such that it encodes a signal leader sequence fused to Brazzein. The signal leader sequence is selected from the group consisting of pelB, ompA, Bla, PhoA, PhoS, MalE, LivK, LivJ, MglB, AraF, AmpC, RbsB,MerP, CpdB, Lpp, LamB, OmpC, PhoE, OmpF, TolC, BtuB and LutA signal sequences.
In another aspect, the present invention provides a process for extracellular secretion of recombinant Brazzein comprising (a) inserting the pelB-Brazzein nucleotide sequence in a pET vector, wherein the said pelB-Brazzein sequence is amplified by employing primers selected from sequences represented by Seq Id No.3, Seq Id No.4,; (b) ligating pelB-Brazzein in a pET vector to obtain a recombinant construct and inserting the said construct into BL21(DE3) E. coli cells by transformation; (c) culturing the transformed cells of step (b) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose, (d) separating culture medium from cells after 4 to 72 hours post induction and purifying Brazzein from the clarified medium.
In yet another aspect, Brazzein expressed extracellularly in the culture medium is selected from the group consisting of the naturally existing wild-type functional type III Brazzein, a variant comprising a substitution at the 28th position of the type III brazzein from Aspartate to Alanine D28A or multi-variant of the type III.
In one aspect, the present invention provides a process for extracellular secretion of Brazzein in enhanced yield, wherein the yield of brazzein ranging between 0.5g/l to 5g/l. The present process is performed on a fermenter scale or at a laboratory stage in shaker flask system.
DETAILED DESCRIPTION OF DRAWINGS:
Figure 1 depicts a vector construct comprising a lac I Promoter, LacI gene, lac operator, T7 promoter, T7 terminator and pelB-Brazzein coding nucleotide sequence.
Figure 2 depicts PCR amplification of pelB-Brazzein recombinant construct wherein Lane 1 shows amplification product corresponding to pelB-Brazzein and Lane 2 shows 100 bp DNA ladder.
Figure 3 depicts IPTG induced whole cell expression of Brazzein, depicted by 6.5kiloDalton Brazzein protein. M represents Low weight molecular weight marker, Lane 1: un-induced whole cell extract, Lane 2: Whole cell extract 24 hours post-induction with 0.25 mM IPTG, Lane 3: Whole cell extract 48 hours post-induction with 0.25 mM IPTG. Lane 4: Whole cell extract 72 hours post-induction with 0.25 mM IPTG, Lane 5: Whole cell extract 24 hours post-induction with 0.50 mM IPTG, Lane 6: Whole cell extract 48 hours post-induction with 0.50 mM IPTG, Lane 7: Whole cell extract 72 hours post-induction with 0.50 mM IPTG.
Figure 4 depicts IPTG induced extracellular secretion of Brazzein in LB medium. M: Low weight molecular weight marker. Lane 1: Cell free supernatant of uninduced cells, Lane 2: Cell free supernatant after 24 hours induction with 0.25mM IPTG, Lane 3: Cell free supernatant after 48 hours induction with 0.25mM IPTG, Lane 4: Cell free supernatant after 72 hours induction with 0.25mM IPTG, Lane 5: Cell free supernatant after 24 hours induction with 0.50 mM IPTG, Lane 6: Cell free supernatant after 48 hours induction with 0.50 mM IPTG, and Lane 7: Cell free supernatant after 72 hours induction with 0.50 mM IPTG;
Figure 5 depicts Lactose induced extracellular secretion of Brazzein in LB medium, M represents the Low weight molecular weight marker, Lane 1: Cell free supernatant of uninduced cells, Lane 2: Cell free supernatant after 48 hours induction with 2.5 mM Lactose, Lane 3: Cell free supernatant after 72 hours of induction with 2.5 mM Lactose, Lane 4: Cell free supernatant after 48 hours induction with 5.0 mM Lactose, and Lane 5: Cell free supernatant after 72 hours induction with 5.0 mM Lactose;
Figure 6 depicts Lactose induced extra-cellular secretion of Brazzein in TB medium, M represents the Low weight molecular weight marker, Lane 1: Cell free supernatant of uninduced cells, Lane 2: Cell free supernatant after 2 hours of induction with 5 mM Lactose, Lane 3: Cell free supernatant after 18 hours of induction with 5 mM Lactose, Lane 4: Cell free supernatant after 24 hours of induction with 5.0 mM Lactose, and Lane 5: Cell free supernatant after 36 hours of induction with 5.0 mM Lactose, Lane 6: Cell free supernatant after 48 hours of induction with 5.0 mM Lactose;
Figure 7 depicts Lactose induced extra-cellular secretion of pelB-Brazzein(A28D) in TB media, M represents the Low weight molecular weight marker, Lane 1: Cell free supernatant of uninduced cells, Lane 2: Cell free supernatant after 4 hours of induction with 5 mM Lactose, Lane 3: Cell free supernatant after 18 hours of induction with 5 mM Lactose, Lane 4: Cell free supernatant after 24 hours of induction with 5.0 mM Lactose, and Lane 5: Cell free supernatant after 36 hours of induction with 5.0 mM Lactose, Lane 6: Cell free supernatant after 48 hours of induction with 5.0 mM Lactose. The position of mature Brazzein(A28D) is indicated by the arrow.
Figure 8 depicts lactose induced extra-cellular secretion of ompA-Brazzein(A28D) in TB medium, M: Low weight molecular weight marker, Lane 1: Cell free supernatant of uninduced cells, Lane 2: Cell free supernatant after 4 hours of induction with 5 mM Lactose, Lane 3: Cell free supernatant after 18 hours of induction with 5 mM Lactose, Lane 4: Cell free supernatant after 24 hours induction with 5.0 mM Lactose, and Lane 5: Cell free supernatant after 36 hours induction with 5.0 mM Lactose, Lane 6: Cell free supernatant after 48 hours induction with 5.0 mM Lactose.
Figure 9 depicts Lactose induced extra-cellular secretion of pelB-Brazzein(A28D) in a Fermentor, M represents the Low weight molecular weight marker, Lane 1: Cell free supernatant of uninduced cells, Lane 2: Cell free supernatant after 2 hours of induction with 5 mM Lactose, Lane 3: Cell free supernatant after 12 hours of induction with 5 mM Lactose, Lane 4: Cell free supernatant after 18 hours of induction with 5.0 mM Lactose, and Lane 5: Cell free supernatant after 24 hours of induction with 5.0 mM Lactose. The position of mature Brazzein(A28D) is indicated by the arrow.
Figure 10 depicts purification of Brazzein(A28D) from cell culture supernatant after expression in a fermentor. Lane 1: clarified sample after ammonium sulfate precipitation; Lane 2: final purified sample.
Figure 11 depicts thermal stability of secreted brazzein synthesized by the present process, which was subjected to treatment at high temperature. M depicts the Low weight molecular weight marker. Lane 1:Untreated control sample of the cell free supernatant from a 72 hour lactose induced culture. Lane 2: Same as in Lane 1, except that the cell free supernatant was heated at 80°C for 60 mins, centrifuged at 17,500 g and the soluble supernatant was analysed. Presence of Brazzein in lanes 1 and 2 is indicated by an arrow.
DETAILED DESCRIPTION OF THE INVENTION:
The invention will now be described in detail in connection with certain preferred and optional embodiments, so that various aspects thereof may be more fully understood and appreciated.
In a preferred embodiment, the present invention provides a process for the extracellular secretion of recombinant brazzein with improved yield comprising:
(a) ligating a nucleotide sequence encoding a signal leader sequence conjugated to Brazzein in a recombinant vector to obtain a recombinant DNA construct and inserting the said construct in BL21(DE3) E. coli cells by transformation;
(b) culturing the transformed cells of step (a) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 4 hrs to72 hrs to obtain secretion of Brazzein in the culture medium, and
(c) separating culture medium from cells and purifying Brazzein from the clarified medium
Accordingly, nucleotide sequence encoding the signal leader sequence conjugated to the Brazzein is amplified with primers. The signal sequence-Brazzein amplified gene is ligated in an expression vector to obtain a recombinant vector construct which is transformed in BL21(DE3) E. coli cells. The transformed cells of E. coli carrying the recombinant construct is cultivated in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 4 hrs to72 hrs, to obtain the extracellular secretion of brazzein. The cells are separated from the culture medium post induction and the culture medium also termed as the extracellular fraction is subjected to heating at temperatures as high as 90°C to obtain Brazzein having >90% purity and in increased yield. As a result of heating, most of the endogenous E.coli proteins present in the cell free supernatant are precipitated, leaving >90% pure Brazzein in solution.
In an embodiment, the signal leader sequence to be conjugated to Brazzein is selected from the group consisting of the pelB s ompA, Bla, PhoA, PhoS, MalE, LivK, LivJ, MglB, AraF, AmpC, RbsB,MerP, CpdB, Lpp, LamB, OmpC, PhoE, OmpF, TolC, BtuB and LutA signal sequences.
In another embodiment, the present invention provides induction of signal leader-Brazzein expression in E. coli cells by addition of lactose ranging from 2.5 mM to 5 mM in the culture medium.
In yet another embodiment, the present invention provides induction of signal leader-Brazzein expression in E. coli cells by IPTG addition ranging from 0.25 mM to 0.5 mM in the culture medium.
Accordingly, extra-cellular secretion of brazzein at varying concentration of IPTG i.e. 0.25 mM and 0.5 mM at durations ranging from 24 hrs to 72hrs is depicted in Figure 4. Extra-cellular secretion of brazzein at varying concentration of lactose, i.e. 2.5 mM and 5 mM at durations ranging from 2 hrs to 72hrs is depicted in Figure 5 and Figure 6. Post addition of the inducing agents in the culture medium, growth of cells is performed at temperatures ranging from temperatures between 25°C to 37°C and subjecting the cells to shaking conditions.
In another preferred embodiment, the present invention provides a process for extracellular synthesis of recombinant Brazzein with improved yield comprising:
a) ligating a pET vector with a nucleotide sequence encoding a pelB signal leader sequence conjugated to Brazzein to obtain a recombinant DNA construct and inserting the said construct in BL21(DE3) E. coli cells by transformation;
b) culturing the transformed cells of step (a) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 2 hrs to72 hrs, and
c) separating culture medium from cells 4-72 hours post induction and purifying Brazzein from the clarified medium .
Accordingly, the process for extracellular synthesis of recombinant Brazzein conjugated to the pelB signal leader sequence comprises (a) inserting the pelB-Brazzein coding sequence in a vector, wherein the said coding sequence is amplified by employing primers selected from sequences represented by Seq Id No.3 and Seq Id No.4; (b) ligating pelB-Brazzein coding sequence in a pET vector to obtain a recombinant construct and inserting the said construct in BL21(DE3) E. coli cells by transformation; (c) culturing the transformed cells of step (b) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose, (d) separating culture medium from cells post induction and purifying Brazzein from the clarified medium.
Accordingly, the pET recombinant vector employed to carry the pelB-Brazzein nucleotide sequence is depicted in Figure 1 of the present invention.
The molecular weight of the pelB signal leader sequence conjugated to Brazzein is 8.5 kD. However, after cleavage of the signal peptide, the molecular weight of mature Brazzein is 6.3 kD. The major band corresponding to expression of mature brazzein is indicated by arrow in Figure 4.
In another preferred embodiment, the present invention provides a process for extracellular secretion of recombinant Brazzein with improved yield comprising:
a) ligating a pET vector with a nucleotide sequence encoding an ompA signal leader sequence conjugated to brazzein to obtain recombinant DNA construct and inserting the said construct in BL21(DE3) E. coli cells by transformation;
b) culturing transformed cells of step (a) carrying the recombinant construct in a culture medium in presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose for a period ranging from 2 hrs to72 hrs, and
c) separating culture medium from cells post induction and purifying Brazzein from the clarified medium.
Accordingly, the process for extracellular synthesis of recombinant brazzein conjugated to ompA signal leader sequence comprises (a) inserting ompA Brazzein nucleotide coding sequence in a vector, wherein the said coding sequence is amplified by employing primers selected from sequences represented by Seq Id No.4 and Seq Id No.9; (b) ligating ompA-Brazzein coding sequence in a pET vector to obtain a recombinant construct and inserting the said construct in BL21(DE3) E. coli cells by transformation; (c) culturing the transformed cells of step (b) carrying the recombinant construct in a culture medium in presence of Dextrose and inducing protein expression with inducing agents selected from IPTG or lactose to obtain secretion of Brazzein into the culture medium, and
(d) separating culture medium from cells post 4-72 hours post induction and purifying Brazzein from the clarified medium.
In yet another preferred embodiment, the present invention provides Brazzein expressed in the culture medium is selected from wild-type functional type III brazzein, a variant or multi-variant of the type III form comprising a substitution at the 28th position of the type III brazzein from Aspartate to Alanine D28A.
Accordingly, the present invention provides the production of extracellular wild-type functional type III Brazzein represented by Seq Id No. 8, which is encoded by Seq Id No.7. Post synthesis amino acids1 to 22 of Seq Id No. 8 representing the pelB signal sequence are cleaved by post translational processes, to yield a mature wild-type functional type III Brazzein protein.
In one preferred embodiment, the present invention provides a process for extracellular synthesis of Brazzein in enhanced yield, wherein the yield of brazzein ranging between 0.5 g/l to 5g/l.
Accordingly, the present process for extracellular synthesis of Brazzein is performed in a – 1 or10 litre scale fermenter.
Brazzein synthesized is found to be stable at temperatures ranging from 4°C to 90°C.
The following examples, which include preferred embodiments, will serve to illustrate the practice of this invention, it being understood that the particulars shown are by way of example and for purpose of illustrative discussion of preferred embodiments of the invention.
Examples :
Source of expression host: E.coli BL21(DE3) cells were commercially obtained from BioBharati Life Sciences, Kolkata, India
Source of expression vector: pET-28a vector was commercially obtained from Novagen.
Example 1: Codon Optimization and Gene Synthesis:
The amino acid sequence of the Type III form of Brazzein was retrieved from Accession source P56552 (Ming D et al, FEBS Lett. 355:106-108(1994)). This amino acid sequence was back translated into a nucleotide sequence that was codon optimized for E. coli. The codon optimized gene also included an Aspartate 28 to an Alanine mutation. This variant was previously shown to exhibit a greater sweet profile in comparison to wildtype Type III Brazzein (Assadi-Porter FM, et al JL.;Arch Biochem Biophys. 2000 Apr 15;376(2):259-65).
The codon optimized gene was fused at the N-terminus with a sequence encoding for the pelB leader sequence and at the C-terminus with three tandem stop codons. The final codon optimized nucleotide sequence of pelB-Brazzein is shown in SeqID 1 and the corresponding amino acid translation in SeqID 2.
pelB-Brazzein gene was synthesized by Genscript (New Jersey, USA) and cloned into pUC57 cloning vector to generate the plasmid Final PELBRAZ.
Example 2: Construction of pET-pelB-Brazzein
The PCR reaction setup is provided in the Table 1 below:
Table 1
Component Concentration
Final PELBRAZ plasmid 50 ng
primer PelBLun-FNcoNde (Seq Id No. 3) 10 picomoles
primer Braz-Rbam (Seq ID No. 4) 10 picomoles
Pfu-X reaction Buffer 5 µL
dNTP mix 1µM
Pfu-X polymerase 0.5 µL (1 unit)
Sterile water To make up the final volume to 50 µL
Table 2
Stages of PCR Amplification:
Steps Temperature Duration (Minutes)
1 95°C 5 min
2 95°C 1 min
3 55°C 0.5 min
4 72°C 1 min
5 Steps 2, 3 and 4 were repeated 29 times --
6 72°C 10 mins
7 8°C hold
The PCR amplification reaction was analyzed on a 1.6 %(w/v) Agarose gel. The approximate 250 bp PCR amplification product (Figure 2) corresponding to pelB-Brazzein was excised from the gel and purified using a commercially available kit. The purified product was digested with NdeI and BamHI for 4 hours at 37°C and purified using a PCR spin column kit. This was ligated with pET-28a vector that was previously digested with NdeI and BamHI and gel purified. The ligation mixture was transformed into DH5 alpha competent cells. The transformed cells were plated out on LB plates containing 50 µg/mL Kanamycin and incubated overnight at 37° C. Single colonies were picked from the plate into 5mL LB broth containing 50 ug/mL Kanamycin and grown for 16 hrs in an orbital shaker at 37 °C and 210 rpm. Plasmid DNA was isolated from the cultures and analysed by DNA sequencing. A plasmid clone containing the desired pelB-Brazzein insert was identified and labelled as pET-pelB-Brazzein and used for protein expression studies.
Example 3: Construction of pET-pelB-Brazzein(A28D)
In order to create wild-type TypeIII Brazzein, amino acid residue number 50 of pelB-Brazzein was mutated from an Alanine to an Aspartate and is referred to as pelB-Brazzein(A28D).
The first PCR reaction was setup with final PELBRAZ plasmid, primer PelBLun-FNcoNde (Seq Id No.3), primer BRAZ-A28DRSOE (Seq Id No. 5), Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final PCR reaction solution volume to 50 µL. The specific concentrations of the said components are provided in Table 3.
Seq Id No. 3: 5’- GCGCGCCCATGGCATATGAAATACCTGCTGCCGACC GC-3’
Seq Id No.5: 5’ – CACCGCTACGCGCATGTTTATCCAGTTTACAGTCGTA GTTACATTG GTTCGC- 3’
Table 3: PCR solution for the first reaction
Components Concentration
Final PELBRAZ plasmid 50 ng
PelBLun-FNcoNde (Seq Id No.3) 10 picomoles
BRAZ-A28DRSOE (Seq Id No. 5) 10 picomoles
Pfu-X reaction Buffer 5 µL
dNTP mix 1µM
Pfu-X polymerase 0.5 µL (1 unit)
Sterile water To make up the final volume to 50 µL
Table 4: Reaction Conditions
Stages of PCR Amplification:
Steps Temperature Duration (Minutes)
1 95°C 5 min
2 95°C 1 min
3 55°C 0.5 min
4 72°C 1 min
5 Steps 2, 3 and 4 were repeated 29 times --
6 72°C 10 mins
7 8°C hold
PCR amplification reaction was analyzed on a 1.6 %(w/v) Agarose gel. The approx.170 bp PCR amplification product was excised from the gel and purified using a commercially available gel extraction kit. This purified fragment was labelled as Frag 1.
The second PCR reaction was setup with: Final PELBRAZ plasmid, primer BRAZ-A28DFSOE (Seq Id No. 6), primer Braz-Rbam (Seq Id No.4), Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume of the second reaction solution to 50 uL.
Seq Id No. 6: 5’-GATAAACATGCGCGTAGCGGTG-3’
Seq Id No. 4: 5’-GCGCGCGGATCCTCATTATTAATATTCACAGTAGTCAC AGATACATTGCAG- 3’
Table 5: PCR solution for the second reaction
Components Concentration
Final PELBRAZ plasmid 50 ng
BRAZ-A28DFSOE (Seq Id No. 6), 10 picomoles
Braz-Rbam (Seq Id No.4), 10 picomoles
Pfu-X reaction Buffer 5 µL
dNTP mix 1µM
Pfu-X polymerase 0.5 µL (1 unit)
Sterile water To make up the final volume to 50 µL
PCR amplification was performed by employing the reaction conditions and PCR parameters specified in Table 4. The PCR amplification reaction was analyzed on a 1.6 %(w/v) agarose gel. The eighty base pair PCR amplification product was excised from the agarose gel and purified using a commercially available gel extraction kit. The final purified fragment was labelled as Frag 2.
The third PCR reaction comprised splicing by overlap extension PCR reaction, the said reaction setup comprising Frag1, Frag2, primer PelBLun-FNcoNde (Seq Id No.3), primer Braz-Rbam(Seq Id No.4), Pfu-X reaction Buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume to 50 µL.
Table 6: PCR solution for the third reaction
Component Concentration
Frag1 5µL
Frag2 5µL
primer PelBLun-FNcoNde (Seq Id No. 3) 10 picomoles
primer Braz-Rbam (Seq ID No. 4) 10 picomoles
Pfu-X reaction Buffer 5 µL
dNTP mix 1µM
Pfu-X polymerase 0.5 µL (1 unit)
Sterile water To make up the final volume to 50 µL
PCR amplification was performed by employing the reaction conditions and PCR parameters specified in Table 4.
The PCR amplification reaction was analyzed on a 1.6 %(w/v) Agarose gel. The approximate 250 bp PCR amplification product corresponding to pelB-Brazzein(A28D) was excised from the gel and purified using a commercially available kit. The purified product was digested with NdeI and BamHI for 4 hours at 37°C and purified using a PCR spin column kit. This was ligated with pET-28a vector that was previously digested with NdeI and BamHI and gel purified. The ligation mixture was transformed into DH5 alpha competent cells. The transformed cells were plated out on LB plates containing 50 µg/mL Kanamycin and incubated overnight at 37° C. Single colonies were picked from the plate into 5mL LB broth containing 50 µg/mL Kanamycin and grown for 16 hrs in an orbital shaker at 37 °C and 210 rpm. Plasmid DNA was isolated from the cultures and analysed by DNA sequencing. A plasmid clone containing the desired pelB-Brazzein(A28D) insert was identified and labelled as pET-pelB-Brazzein(A28D) and used for protein expression studies.
The final nucleotide sequence of pelB-Brazzein(A28D) is shown in Seq Id No. 7 and the corresponding amino acid translation in Seq Id No. 8.
Example 4: Construction of pET-ompA-Brazzein(A28D)
The ompA-Brazzein(A28D) nucleotide sequence was PCR amplified using following primers: The PCR reaction was setup with pET-pelB-Brazzein(A28D) plasmid, primer ompANde, primer Braz-Rbam, Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume to 50 µL.
ompANde (Seq Id No.9): 5’GCGCGCCCATGGCAATGAAAAAAACGGCAATTGCGATAGCGGTTGCGCTAGCTGGTTTTGCCACGGTGGCGCAGGCTGACAAATGTAAAAAGG- 3’
Braz-Rbam (Seq Id No.4): 5’GCGCGCGGATCCTCATTATTAATATTCACAGTAGTCACAGATACAT TGCAG- 3’
The PCR reaction was setup with pET-pelB-Brazzein(A28D) plasmid, primer ompANde, primer Braz-Rbam, Pfu-X reaction buffer, dNTP mix, Pfu-X polymerase and sterile water was used to make up the final volume to 50 µL.
Table 5: PCR solution
Component Concentration
pET-pelB-Brazzein(A28D) plasmid 50 ng
ompANde (Seq Id No.9) 10 picomoles
Braz-Rbam (Seq Id No.4) 10 picomoles
Pfu-X reaction Buffer 5 µL
dNTP mix 1µM
Pfu-X polymerase 0.5 µL (1 unit)
Sterile water To make up the final volume to 50 µL
PCR amplification was performed by employing the reaction conditions and PCR parameters specified in Table 2.
PCR amplification reaction was analyzed on a 1.6 %(w/v) agarose gel. The approx.250 bp PCR amplification product corresponding to ompA-Brazzein(A28D) was excised from the gel and purified using a commercially available gel extraction kit. The purified product was digested with NdeI and BamHI for 4 hours at 37°C and purified using a PCR spin column kit. This was ligated with pET-28a vector that was previously digested with NdeI and BamHI and gel purified. The ligation mixture was transformed into DH5alpha competent cells. The transformed cells were plated out on LB plates containing 50 µg/mL Kanamycin and incubated overnight at 37°C. Single colonies were picked from the plate into 5mL LB containing 50 ug/mL Kanamycin and grown for 16 hrs in an orbital shaker at 37°C and 210 rpm. Plasmid DNA was isolated from the cultures and submitted for DNA sequencing. A plasmid clone containing the desired ompA-BRAZ insert was identified and labeled as pET-ompA-Brazzein(A28D) and used for protein expression studies.
The final nucleotide sequence of ompA-Brazzein is shown in Seq Id No. 10 and the corresponding protein expressed in Seq Id No. 11.
Example 5: Protein Expression
(i) Expression of pelB-Brazzein with IPTG in LB medium
The pET-pelB-Brazzein plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50µg/mL Kanamycin and incubated at 30°C overnight. A single colony was picked from the plate in 5 mL LB containing 50 µg/mL Kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30 °C and 180 rpm. The culture was diluted into two 250 mL baffled flasks containing 25 mL of LB supplemented with 50 µg/mL kanamycin, 0.1% dextrose and growth was continued at 30 °C and 210 rpm. When optical density (OD600) of the cultures reached 0.4, protein expression was induced by adding IPTG to a final concentration of 0.25 mM and 0.5 mM and growth continued 30° C and 210 rpm. Samples were harvested at 24, 48 and 72 hrs post-induction by spinning down 100 µL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at -20°C and the supernatants at 4°C till further analysis by SDS-PAGE (see figures 3 and 4).
(ii) Expression of pelB-Brazzein with with Lactose in LB medium:
pET-pelB-Brazzein plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 µg/mL Kanamycin and incubated at 30°C overnight. A single colony was picked from the plate in 5 mL LB containing 50 µg/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C and 180 rpm. The culture was diluted into two 250 mL baffled flasks containing 25 mL of LB supplemented with 50 ug/mL kanamycin and growth was continued at 30°C and 210 rpm. When optical density (OD600) of the cultures reached 0.4, protein expression was induced by adding Lactose to a final concentration of 2.5 mM and 5 mM and growth was continued 30°C and 210 rpm. Samples were harvested at 24, 48 and 72 hrs post-induction by spinning down 100 µL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at -20°C and the supernatants at 4°C till further analysis by SDS-PAGE (see Figure 5).
(iii) Expression of pelB-Brazzein with Lactose in TB medium:
pET-pelB-Brazzein plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 µg/mL Kanamycin and incubated at 30°C overnight. A single colony was picked from the plate in 5 mL LB containing 50 ug/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C and 180 rpm. The culture was diluted into a baffled flask containing 25 mL of TB supplemented with 50µg/mL kanamycin, 0.1% (w/v) Dextrose and growth was continued at 30°C and 210 rpm. When optical density (OD600) of the cultures reached 9.0, protein expression was induced by adding Lactose to a final concentration of 5 mM and growth continued at 30°C and 210 rpm. Samples were harvested at 4, 18, 24, 48 and 72 hrs post-induction by spinning down 100 µL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at -20°C and the supernatants at 4°C till further analysis by SDS-PAGE (see Figure 6).
(iv) Expression of pelB-Brazzein(A28D) with Lactose in TB medium:
pET-pelB-Brazzein(A28D) plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 µg/mL Kanamycin and incubated at 30°C overnight. A single colony was picked from the plate in 5 mL LB containing 50 ug/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C and 180 rpm. The culture was diluted into a baffled flask containing 25 mL of TB supplemented with 50 µg/mL kanamycin, 0.1% (w/v) Dextrose and growth was continued at 30°C and 210 rpm. When optical density (OD600) of the cultures reached 9.0, protein expression was induced by adding Lactose to a final concentration of 5 mM and growth continued 30°C and 210 rpm. Samples were harvested at 4, 18, 24, 48 and 72 hrs post-induction by spinning down 100 µL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at -20°C and the supernatants at 4°C till further analysis by SDS-PAGE (see Figure 7).
(v) Expression of ompA-Brazzein(A28D) with Lactose in TB medium:
pET-ompA-Brazzein(A28D) plasmid was transformed into BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 µg/mL Kanamycin and incubated at 30°C overnight. A single colony was picked from the plate in 5 mL LB containing 50 µg/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C and 180 rpm. The culture was diluted into a baffled flask containing 25 mL of TB supplemented with 50 µg/mL kanamycin, 0.1% (w/v) Dextrose and growth was continued at 30°C and 210 rpm. When optical density (OD600) of the cultures reached 9.0, protein expression was induced by adding Lactose to a final concentration of 5 mM and growth continued 30°C and 210 rpm. Samples were harvested at 4, 18, 24, 48 and 72 hrs post-induction by spinning down 100 µL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at -20°C and the supernatants at 4°C till further analysis by SDS-PAGE (see Figure 8).
(vi) Expression of pelB-Brazzein(A28D) in fermentor by fed-batch cultivation
Fermentor based expression of pelB-Brazzein(A28D) was carried out in a 5 l fermentor by fed-batch cultivation. pET-pelB-Brazzein(A28D) plasmid was transformed in E.coli BL21(DE3) cells. The transformed cells were plated out on LB Agar plates containing 50 µg/mL Kanamycin and incubated at 30°C overnight. A single colony was picked from the plate in 5 mL LB containing 50 µg/mL kanamycin and 1% (w/v) Dextrose and grown for 16 hours at 30° C and 180 rpm. A 1.5 mL aliquot of the overnight culture was diluted into a baffled flask containing 150 mL of LB supplemented with 50 µg/mL kanamycin, 1% (w/v) Dextrose and growth was continued for 12 hours at 30°C and 210 rpm. 4.2 L of sterile TB medium in the fermentor were inoculated with 100ml of this culture and supplemented with 0.1%(w/v) Dextrose and 50 µg/mL Kanamycin. During the fermentation, the temperature and pH were maintained at 30°C and 7.0, respectively. The dissolved oxygen level was maintained at 30-40% by using air or pure oxygen and the speed was maintained at 600 rpm. After the optical density (OD600) reached 10, a final concentration of 5mM Lactose was added to induce the expression of pelB-Brazzein(A28D). Samples of the culture were harvested at 4, 12, 18 and 24 hours post induction by spinning down 5 mL of culture and carefully separating the supernatant from the cell pellet. The cell pellets were stored at -20°C and the supernatants at 4°C till further analysis by SDS-PAGE (see Figure 9).
(vii) Purification of Brazzein(A28D)
The culture from the fermentor was spun at 5000g and the clarified cell free supernatant was transferred to a fresh container. To this, powdered 1.2 kg ammonium sulfate was slowly added with gentle stirring. The mixture was incubated for 1 hour with gentle stirring at room temperature and subsequently spun at 5000g for 30 mins. The supernatant obtained after the spin was discarded and pellet containing precipitated brazzein and other proteins was dissolved in 200 mL of deionized water. This solution was heated to 90°C for 1 hour and subsequently spun at 5000g for 30 mins. The supernatant was carefully decanted and transferred to a fresh vessel and it was found that Brazzein (A28D) constitutes a major fraction of the total protein in this supernatant. The supernatant was passed through a 10 kDa MW cut-off centrifugal concentrator at 3000g. Majority Brazzein passes through the filter membrane and is collected in the flow-through fraction while remaining higher molecular weight proteins do not pass through the membrane and are retained as the retentate fraction in the concentrator. The flow-through fraction was transferred to a 2 kDa MW cut-off centrifugal concentrator and buffer exchanged to water by repeated concentration and dilution with deionized water. This was continued till the colour of the retentate fraction in the concentrator was colourless and the flow-through fraction did not have any salty taste. During this, it was found that Brazzein was completely retained by the membrane in the retentate fraction while low molecular weight molecules passed through into the flow-through fraction (see Figure 10).
The retentate fraction containing Brazzein was harvested into a fresh vessel and stored at 4°C for further analysis. Protein Quantitation of the sample gave a final yield of 4.4 grams of Brazzein per litre of culture. Purity of Brazzein in lane 2 of Figure 10 is greater than 95% pure by SDS-PAGE analysis.
(viii) Sensory Analysis of Brazzein
A portion of the purified Brazzein(A28D) was lyophilized and re-dissolved in deionized water to 1.0 mg/mL. From this, Brazzein(A28D) solutions with following concentrations were made: 0.5, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10.0 µg/mL. A 1% (w/v) sucrose solution, the lowest concentration of sucrose detectable by humans, was used as a reference. The taste panel consisted of fifteen females and fifteen males with normal health and normal sense of taste. Two-hundred-microliter samples were applied to the anterior region of the tongue. After each test, the mouth was rinsed with tap water. The tasters sampled from the lower concentration samples to higher. Each taster chose the first sample that could be sensed for sweetness. Sweetness potencies were reported relative to sucrose on a weight basis. The purified Brazzein(A28D) was found to be 1660 times sweeter than sucrose on a weight basis.
Table 6: Sensory Analysis of Purified Brazzzein
Molecule Experimental Threshold
% [g/100 mL] Relative Sweetness
(by weight)
Sucrose 1 1
Brazzein(A28D) 0.0006 1660
(ix) SDS-PAGE analysis
Protein expression was analyzed by SDS-PAGE on 15% Tris-Glycine gels. To analyze protein in the cell culture medium, 17 µL of cell free supernatant (corresponding to 0.07% of total culture volume) was mixed with 17 µL of 2X reducing sample buffer, heated for 5 mins in a PCR machine, briefly spun and loaded into the gel. The gel was run at a constant voltage of 125V till the dye front exited the gel. The gels were washed in Milli-Q water for 1 hour and stained with Coomassie Stain. To analyze protein in whole cells, frozen cell pellets were thawed, re-suspended in 50 µL of Milli-Q water. 17 µL of resuspended cells were mixed with 17 µL of 2X Reducing Sample Buffer, heated for 5 mins in a PCR machine, briefly spun and loaded into the gel. The gel was run at constant voltage of 125V till the dye front exited it. The gels were washed in Milli-Q water for 1 hour and stained with Coomassie Stain.
(x) Thermal Stability and Protein Estimation
Cell free supernatant from (i) was heated to 90°C for 1 hour in a water bath and spun at 17,500 g for 30 mins. The supernatant was analyzed by SDS-PAGE. Protein quantitation was done using BCA assay kit. As a result of heating, most of the endogenous E.coli proteins present in the cell free supernatant precipitated, leaving >90% pure Brazzein in solution. Protein estimation of the supernatant from the heated and spun sample demonstrated a yield of 0.56 g/L of Brazzein (Figure 11).
(xi)N-Terminal Sequencing
Protein was separated on SDS-PAGE and transferred onto a 0.22 um pore size PVDF membrane. The membrane was stained with Coommassie Blue till protein bands appeared. The membrane was transferred to Milli-Q water. The band corresponding to Brazzein was cut out with a clean scalpel and submitted for N-terminal sequencing of the first five amino acids. Results from the N-terminal sequencing matched the expected sequence of Type III Brazzein.
,CLAIMS:1. A process for extracellular secretion of Brazzein having improved yield comprising:
(a) ligating a nucleotide sequence encoding a signal leader sequence conjugated to Brazzein with an expression vector to obtain a DNA construct and introducing the said construct into BL21(DE3) E. coli cells by transformation;
(b) culturing the transformed cells of step (a) carrying the recombinant construct in a culture medium in the presence of Dextrose and inducing protein expression with agents selected from IPTG or lactose for a period ranging from 2 hrs to 72 hrs to obtain secretion of Brazzein into the culture medium, and
(c) separating culture medium from cells 2-72 hours post induction and purifying Brazzein from the clarified medium..
2. The process according to claim 1, wherein Brazzein is selected from the group consisting of wild type III Brazzein and variants or multi-variants of the type III Brazzein.
3. The process according to claim 1, wherein the recombinant expression vector is selected from a pET vector or an expression vector having an IPTG inducible promoter.
4. The process according to claim 1, wherein the signal leader sequence is selected from the group consisting of pelB ompA, Bla, PhoA, PhoS, MalE, LivK, LivJ, MglB, AraF, AmpC, RbsB,MerP, CpdB, Lpp, LamB, OmpC, PhoE, OmpF, TolC, BtuB and LutA signal sequences.
5. The process according to claim 1, wherein the inducing agent is added to the culture medium in concentrations ranging from about 0.25mM to 5 mM.
6. The process according to claim 1, wherein culturing of cell is carried out at temperatures of between 25°C to 37°C.
7. The process according to claim 1, wherein the yield of Brazzein is ranging from about 0.5 g/l to about 5g/l.
8. The process according to claim 1, where the expression host is selected from the group consisting of BL21(DE3) cell line and derivatives of the parental E.coli BL21 cell line.
9. The process according to claim 1, wherein the inducing agent is selected from the group consisting of Lactose and Lactose Analogues.
10. The process according to claim 1, where Dextrose is a component of the growth media prior to induction.
| # | Name | Date |
|---|---|---|
| 1 | Sequence listing [27-01-2016(online)].pdf | 2016-01-27 |
| 2 | Form 3 [27-01-2016(online)].pdf | 2016-01-27 |
| 3 | Drawing [27-01-2016(online)].pdf | 2016-01-27 |
| 4 | Description(Provisional) [27-01-2016(online)].pdf | 2016-01-27 |
| 5 | 201641002922-Power of Attorney-160216.pdf | 2016-06-29 |
| 6 | 201641002922-Form 1-160216.pdf | 2016-06-29 |
| 7 | 201641002922-Correspondence-F1-PA-160216.pdf | 2016-06-29 |
| 8 | EVIDENCE FOR SSI [24-01-2017(online)].pdf | 2017-01-24 |
| 9 | 201641002922-OTHERS [24-01-2017(online)].pdf | 2017-01-24 |
| 10 | 201641002922-EVIDENCE FOR REGISTRATION UNDER SSI [24-01-2017(online)].pdf | 2017-01-24 |
| 11 | OTHERS [25-01-2017(online)].txt | 2017-01-25 |
| 13 | Drawing [25-01-2017(online)].pdf | 2017-01-25 |
| 14 | Description(Complete) [25-01-2017(online)].pdf_497.pdf | 2017-01-25 |
| 15 | Description(Complete) [25-01-2017(online)].pdf | 2017-01-25 |
| 16 | Assignment [25-01-2017(online)].pdf | 2017-01-25 |
| 17 | CERTIFIED COPIES TRANSMISSION TO IB [06-02-2017(online)].pdf | 2017-02-06 |
| 18 | Form 3 [05-05-2017(online)].pdf | 2017-05-05 |
| 19 | 201641002922-OTHERS [28-08-2017(online)].pdf | 2017-08-28 |
| 20 | 201641002922-FORM FOR SMALL ENTITY [28-08-2017(online)].pdf | 2017-08-28 |
| 21 | 201641002922-EVIDENCE FOR REGISTRATION UNDER SSI [28-08-2017(online)].pdf | 2017-08-28 |
| 22 | 201641002922-FORM 18A [22-09-2017(online)].pdf | 2017-09-22 |
| 23 | 201641002922-FER.pdf | 2017-10-25 |
| 24 | 201641002922-FER_SER_REPLY [24-04-2018(online)].pdf | 2018-04-24 |
| 25 | 201641002922-CORRESPONDENCE [24-04-2018(online)].pdf | 2018-04-24 |
| 26 | 201641002922-CLAIMS [24-04-2018(online)].pdf | 2018-04-24 |
| 27 | Marked up Claims_Granted 297560_11-06-2018.pdf | 2018-06-11 |
| 28 | Drawings_Granted 297560_11-06-2018.pdf | 2018-06-11 |
| 29 | Description_Granted 297560_11-06-2018.pdf | 2018-06-11 |
| 30 | Claims_Granted 297560_11-06-2018.pdf | 2018-06-11 |
| 31 | Abstract_Granted 297560_11-06-2018.pdf | 2018-06-11 |
| 32 | 201641002922-PatentCertificate11-06-2018.pdf | 2018-06-11 |
| 33 | 201641002922-IntimationOfGrant11-06-2018.pdf | 2018-06-11 |
| 34 | 201641002922-RELEVANT DOCUMENTS [23-03-2019(online)].pdf | 2019-03-23 |
| 35 | 201641002922-POWER OF AUTHORITY [04-08-2020(online)].pdf | 2020-08-04 |
| 36 | 201641002922-FORM-16 [04-08-2020(online)].pdf | 2020-08-04 |
| 37 | 201641002922-ASSIGNMENT WITH VERIFIED COPY [04-08-2020(online)].pdf | 2020-08-04 |
| 38 | 297560-Correspondence-POA-Assignment-20-08-2020.pdf | 2020-08-20 |
| 39 | 201641002922-FORM 4 [30-01-2024(online)].pdf | 2024-01-30 |
| 1 | SearchStrategy_24-10-2017.pdf |