Abstract: The invention provides fully liquid Bi-antigenic adjuvant based vaccine against SARS CoV-2 virus, a vaccine and a preparation method of the vaccine, relating to the technical field of vaccines. The fully liquid Bi-antigenic adjuvant based vaccine comprising of S1 and N antigen expressed in Yeast and can be delivered into body for the elicitation of humoral and cellular immunity for the prevention of SARS CoV-2 virus in all section of population. Again, the Bi-antigenic vaccine provides short term and long-term protection against the SARS-CoV-2. The present Bi-antigenic vaccine is designed to be effective against variants and mutations of the SARS-CoV-2 virus.
1. A process for producing a stable Bi-antigenic vaccine composition against SARS CoV-2 virus comprising a. Bi-antigenic composition , wherein the Bi-antigenic consisting of S1 antigen and N antigen, b. above mentioned antigens expressed in yeast as individual clone. c. purification of expressed Bi-antigenic d. adding and mixing S1 and N antigens with non-antigenic component (s) for stability of the Bi-antigenic vaccine against SARS CoV-2 virus.
2. The Bi-antigenic vaccine composition as claimed in claim 1, wherein yeast is Pichia pastoris
3. A process of producing a stable Bi-antigenic composition as claimed in claim 1, wherein the vaccine is a fully liquid vaccine.
4. A process of producing a fully liquid Bi-antigenic vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consist of S1 antigen and N antigen is about 5 µg to about 20 µg per dose each of 0.5ml of the composition
5. A process of producing a fully liquid Bi-antigenic vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consist of S1 antigen and N antigen is at least 10 µg per dose each of 0.5ml of the composition.
6. The Bi-antigenic vaccine composition as claimed in claim 1, wherein the Bi-antigenic vaccine composition further comprises one or more non-antigenic com-ponent(s) that are pharmaceutically acceptable excipients selected from adjuvant, stabilizer, non mercury preservative, tonicity agent, pH modifier, and buffer.
7. The Bi-antigenic composition as claimed in claim 6, wherein the adjuvant is alum salt preferably Aluminum phosphate.
8. The Bi-antigenic composition as claimed in claim 7, wherein the Aluminum con-tent (Al3+) in the composition is about 0.5 mg to about 1.25 mg .
9. The Bi-antigenic vaccine composition as claimed in claim 8, wherein the alumi-num content (Al3+) in the composition is at least 0.25 mg.
10. The Bi-antigenic vaccine composition as claimed in claim 6, wherein the preserva-tive is 2-phenoxyethanol (2-POE) in the composition should not exceed 0.1mg/ml.
11. The Bi-antigenic vaccine composition as claimed in claim 6, wherein the preserva-tive is 2-phenoxyethanol (2-POE) in the composition is at least 0.05mg/ml.
12. The Bi-antigenic vaccine composition as claimed in claim 6,wherein the tonicity modifying agent is selected from the group of salt including NaCl, MgCl2, KCl, and CaCl2; sugar including Dextrose, Mannitol, and Lactose; amino acid includ-ing Arginine, Glycine, and Histidine; polyol including Glycerol and Sorbitol; or mixture thereof.
13. The Bi-antigenic vaccine composition as claimed in claim 6,wherein the pH modifier is selected from sodium hydroxide, hydrochloric acid or combination and comprises a pH in the range of 6 – 7.
14. The Bi-antigenic composition as claimed in claim 6 , wherein the buffer is se-lected from sodium phosphate, potassium phosphate, citrate buffer or combina-tions thereof.
15. A process of producing a fully liquid Bi-antigenic vaccine composition compris-ing the steps of: a) adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Alumi-num phosphate and blending, b) adding at least 10 µg N-antigen adsorb on Alum salt preferably Alumi-num phosphate (with already absorbed S1 antigen) obtained in step (a) and mixing to obtain Bi-antigenic vaccine against SARS CoV 2 virus, c) further, addition of physiological saline, stabilizer and non-mercury preserv-ative 2-phenoxyethanol (2-POE) at pH of about 6.4-6.8 to the mixture of ab-sorbed S1 antigen and N antigens on Aluminum phosphate obtained in step (b) and mixing, d) further, blending by stirring the composition at a speed of about 200-300 rpmfor period of about 8-16 hrs.
16. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the process for producing Bi-antigenic vaccine composition as shown in Fig A.
17. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the composition overages of the S1 antigen and N antigens as low as 5% to as high as 25%.
18. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the composition is effective against all SARS CoV-2 virus variants and mutations.
19. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen and N antigen and non-antigenic component(s) gives short term and long term protection against all SARS CoV-2 virus variants and mutations.
20. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the Bi-antigenic vaccine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi - dose presentation. , Description:PROCESS FOR PRODUCING A FULLY LIQUID BI-ANTIGENIC ADJUVANT BASED VACCINE AGAINST SARS COV-2 VIRUS This is an application for patent of addition for which the main application is 202121007794 filed on 24/02/2021 FIELD OF THE INVENTION The present invention relates to the process of producing Bi-antigenic SARS-CoV-2 Vaccine. In particular the present invention relates to a composition comprising S1 sub-unit and N antigen derived from SARS-CoV-2 virus and expressed in a yeast based ex-pression system and its stable formulation with adjuvant. The present invention also re-lates to a process for producing a stable Bi-antigenic SARS-CoV-2 Vaccine having a broader spectrum of immunity and effective for all section of popula-tion. The present invention provides a fully liquid Bi-antigenic adjuvant based safe, effective and affordable vaccine against SARS CoV-2 virus to provide a broad spectrum mass pro-tection. Again, proposed Bi-antigenic vaccine has short term and long-term protection against the SARS-CoV-2. The present Bi-antigenic vaccine is designed to be effective against variants and mutations of the SARS-CoV-2 virus. BACKGROUND OF THE INVENTION Background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifi-cally or implicitly referenced in this application is prior art. Disclosures of these publi-cations in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains. Coronavirus disease (COVID-19) is an infectious disease caused by a newly discov-ered coronavirus in 2019. The virus is now known as the severe acute respiratory syn-drome coronavirus 2 (SARS-CoV-2). In March 2020, the World Health Organization (WHO) declared the COVID-19 outbreak a pandemic. Signs and symptoms of corona-virus disease 2019 (COVID-19) e.g Fever, Cough, Shortness of breath, Sore throat, Run-ning nose etc may appear two to 14 days after exposure. The severity of COVID-19 symptoms can range from very mild to severe. Older people have higher risk of seri-ous illness from COVID-19, and the risk increases with age. People who have existing chronic medical conditions also may have a higher risk of serious illness. Certain medi-cal conditions that increase the risk of serious illness from COVID-19 include: Heart diseases, such as heart failure, coronary artery disease or cardiomyopathy, Cancer, Chronic obstructive pulmonary disease (COPD), Type 2 diabetes, Chronic kidney dis-ease, Weakened immune system, Asthma, Liver disease and High blood pressure. This list is not inclusive of all detected symptoms. SARS-CoV-2 has a genome size of ~30 kilobases, which like other coronaviruses, en-codes for multiple structural and non-structural proteins. The structural proteins include the spike (S) protein, the envelope (E) protein, the membrane (M) protein, and the nu-cleocapsid (N) protein.( Chen Y, Liu Q, Guo D. [published correction appears in J Med Virol. 2020 Oct;92(10):2249]. J Med Virol. 2020; 92(4):418-423). S protein plays a cru-cial role in eliciting the immune response during disease progression. (KK, Tsang OT, Leung WS, et al. Lancet Infect Dis. 2020; 20(5):565-574). Therefore, spike protein of SARS-CoV -2 become a potential and common target for the first generation vaccine and therapeutic development. However there are several challenges as follows- First genera-tion approved SARS-CoV-2 vaccines will provide population immunity that can reduce transmission of SARS-CoV-2 and lead to a resumption of pre- SARS-CoV-2 “normal-cy” . However, the impact of these SARS-CoV-2 vaccines on infection and thus trans-mission is not being assessed. Even if vaccine were able to confer protection from dis-ease, they might not reduce transmission similarly. Again earlier studies suggest that the full-length S protein-based SARS vaccines can induce neutralizing antibody responses against SARS-CoV infection, they may also in-duce harmful immune responses that cause liver damage of the vaccinated animals or enhanced infection after challenge with homologous SARS-CoV, raising concerns about the safety and ultimate protective efficacy of vaccines that contain the full-length SARS-CoV S protein.( Du L, He Y, Zhou Y, Liu S, Zheng BJ, Jiang S. Nat Rev Microbiol. 2009;7(3):226-236) Again, the mutation loosens the spike protein Earlier publications discloses that sequences Spike (S) protein mediates infection of hu-man cells and is the target of most vaccine strategies and antibody-based therapeutics. Scientist identified mutations in Spike that are accumulating (Ahlén G, Frelin L, Ni-kouyan N, et al . J Virol. 2020;94(18). Mutations are considered in a broader phylogenet-ic context, geographically, and over time, to provide an early warning system to reveal mutations that may confer selective advantages in transmission or resistance to interven-tions. Each one is evaluated for evidence of positive selection, and the implications of the mutation are explored through structural modeling. The mutation Spike D614G is of urgent concern; it began spreading in Europe in early February, and when introduced to new regions it rapidly becomes the dominant form. Researchers have catalogued more than 12,000 mutations in SARS-CoV-2 genomes. Mu-tations that do change proteins are more likely to harm the virus than improve it. (Sources: L. Van Dorp et al. Young et al. Lancet 396, 603–611 (2020) A spike protein is made up of three smaller peptides in ‘open’ or ‘closed’ orientations; when more are open, it’s easier for the protein to bind. The D614G mutation — the result of a single-letter change to the viral RNA code — seems to relax connections between peptides. This makes open conformations more likely and might increase the chance of infection. Again according to Plante, J.A., Liu, Y., Liu, J. et al. Nature (2020), demonstrated that the spike D614G substitution enhances viral replication in the upper respiratory tract and increases the susceptibility of the virus to neutralization by antibodies. These findings have important implications on the evolution and spread of the ongoing SARS–CoV-2 pandemic, and for vaccine efficacy and therapeutic antibody development. Again, recent studies shows One mutation called N501Y alters the most important part of the spike, known as the "receptor-binding domain”. This is where the spike makes first contact with the surface of our body's cells. Any changes that make it easier for the virus to get inside are likely to give it an edge. The other mutation - a H69/V70 deletion, in which a small part of the spike is removed - has emerged several times before, includ-ing famously in infected mink. Again, the SARS-CoV-2 Spike (S) Glycoprotein is directly recognized by the host im-mune system, target for T-cell response (Zhang J, Zeng H, Gu J et al. Vaccines (Basel). 2020;8(2):153, Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82). Studies on SARS-CoV, MERS-CoV and SARS-CoV-2 have described both CD4+ and CD8+ epitopes in the S protein (Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82). The spike protein is a primary target for host immunity after natural infection and main target for COVID-19 vaccines (Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82, Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Menachery VD. Cell Host Microbe. 2021;29(4):508-515). Antibodies that target the spike protein can prevent binding/entry and subsequently inhibit the virus from replicating inside the host cell machinery (Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Menachery VD. Cell Host Microbe. 2021;29(4):508-515, Malik JA, Mulla AH, Farooqi T, Pottoo FH, Anwar S, Rengasamy KRR. Biomed Pharmacother. 2021;137:111254). The Spike protein consists of S1 Subu-nit which has Receptor Binding Domain (RBD) which binds to the host Angiotensin Converting Enzyme (ACE)-2 receptors facilitating attachment. (Yu F, Xiang R, Deng X, et al. Signal Transduct Target Ther. 2020;5(1):212, Naqvi AAT, Fatima K, Mohammad T, et al. Biochim Biophys Acta Mol Basis Dis. 2020;1866(10):165878, Littler DR, MacLachlan BJ, Watson GM, Vivian JP, Gully BS. Biochem Soc Trans. 2020;48(6):2625-2641, Alanagreh L, Alzoughool F, Atoum M. Pathogens. 2020;9(5):331). The Spike Protein also consists of S2 Subunit which is a conserved re-gion and mediates viral cell fusion and its integration into the host cell (Huang Y, Yang C, Xu XF, Xu W, Liu SW. Acta Pharmacol Sin. 2020;41(9):1141-1149). The RBD with-in the S1 Subunit is a highly mutable region, contains multiple dominant neutralizing epitopes and target for human neutralizing antibodies (Yu F, Xiang R, Deng X, et al. Signal Transduct Target Ther. 2020;5(1):212, Liu Z, Xu W, Xia S, et al. Signal Trans-duct Target Ther. 2020;5(1):282, Huang Y, Yang C, Xu XF, Xu W, Liu SW. Acta Phar-macol Sin. 2020;41(9):1141-1149). Also, N-Terminal Domain (NTD) present within S1 is also a target for virus neutralizing antibodies (Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82). The S1 Subunit and its RBD represent the most attractive and potential vaccine target for coronavirus (Wang Y, Wang L, Cao H, Liu C. J Med Virol. 2021;93(2):892-898). The SARS-CoV-2 genome has undergone several mutations from the time it was first identi-fied in Wuhan, China (Rauseo AM, O'Halloran JA. JACC Basic Transl Sci. 2021;6(3):305-308). The emergence of these mutant variants is a major public health concern globally (Gómez CE, Perdiguero B, Esteban M. Vaccines (Basel). 2021;9(3):243). Of particular clinical significance is the high number of mutations in the Spike protein especially within the N-terminal domain (NTD) and the receptor binding domain (RBD) which is the target of potent virus neutralizing antibodies (Gómez CE, Perdiguero B, Esteban M. Vaccines (Basel). 2021;9(3):243, Wang P, Nair MS, Liu L, et al. bioRxiv. 2021;2021.01.25.428137). Changes in key spike residues may also reduce antibody binding/neutralization, reducing the efficacy of vaccine- and natural-infection derived antibodies (Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Men-achery VD. Cell Host Microbe. 2021;29(4):508-515). The S protein mutation outside of the RBD (D614G) emerged early during the pandemic and became the dominant circulating variant globally by June 2020 (Rauseo AM, O'Hal-loran JA. JACC Basic Transl Sci. 2021;6(3):305-308, Grubaugh ND, Hodcroft EB, Fauver JR, Phelan AL, Cevik M. Cell. 2021;184(5):1127-1132). This D614G mutation has shown to improve SARS-CoV-2 infection in the upper airways (Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Menachery VD. Cell Host Microbe. 2021;29(4):508-515). Since then, several variants have been identified with some desig-nated as “Variants of Concern” namely B.1.1.7 (first detected in UK, September 2020), B.1.351 (first detected in South Africa, December 2020) and P.1 (first reported in Brazil, 2021) (Rauseo AM, O'Halloran JA. JACC Basic Transl Sci. 2021;6(3):305-308, Abdool Karim SS, de Oliveira T. N Engl J Med. 2021;NEJMc2100362. ). They all share the D614G mutation in addition to other novel mutations of the S protein, including 2 other mutations in the RBD that are of particular concern namely N501Y which increases af-finity for ACE2 receptor, and E484K which is considered an escape mutation, as it po-tentially reduces antibody neutralization sensitivity, thereby evading the immune system which is of greatest concern (Rauseo AM, O'Halloran JA. JACC Basic Transl Sci. 2021;6(3):305-308). New and more transmissible variants, such as the B.1.617 variant (designated by the WHO as Variants of Concern) contains has two RBD mutations name-ly E484Q and L452R, known to be associated with increased infectivity and immune es-cape along with D614G mutation. (Chatterjee P. BMJ. 2021;373: n978, Vaidyanathan G Nature. 2021;593(7859):321-322, Winger A, Caspari T. Viruses. 2021;13(6):1002). Variants of concern might be associated with changes in both morbidity and mortality (Darby AC, Hiscox JA. BMJ. 2021;372:n771). Poor clinical outcomes might be due high viral loads in infected individuals, altered transmission dynamics, or suppression of the host immune response (Darby AC, Hiscox JA. BMJ. 2021;372:n771). Newer SARS-CoV-2 variants of concern will continue to emerge as the pandemic progresses which would not only exacerbate already crippling outbreaks but also reduce the efficacy of some vaccines, cause increased rates of reinfections and prolong the pandemic (Grubaugh ND, Hodcroft EB, Fauver JR, Phelan AL, Cevik M. Cell. 2021;184(5):1127-1132). The Nucleocapsid (N) Protein has multiple functions such as nucleocapsid formation, signal transduction virus budding RNA replication and mRNA transcription (Dutta NK, Mazumdar K, Gordy JT. J Virol. 2020;94(13):e00647-20). The N Protein is the most abundant protein in coronavirus, highly conserved (N gene is more conserved and stable, with 90% amino acid homology and has fewer mutations over time), highly immunogen-ic, and are abundantly expressed throughout the course of the infection (Zhang J, Zeng H, Gu J et al. Vaccines (Basel). 2020;8(2):153, Dutta NK, Mazumdar K, Gordy JT. J Vi-rol. 2020;94(13):e00647-20, Oliveira SC, de Magalhães MTQ, Homan EJ. Front Immu-nol. 2020 Oct 28;11:587615, Cong Y, Ulasli M, Schepers H, et al. J Virol. 2020;94(4):e01925-19). It is a representative antigen for T-cell mediated response in-cluding T-cell proliferation and cytotoxic activity (Zhang J, Zeng H, Gu J et al. Vaccines (Basel). 2020;8(2):153). As per Ahlen et al, N and/or other structural proteins in addition to spike protein sequences adds the benefits of increasing immunogenicity and ensures a more future-proof vaccine design (Ahlén G, Frelin L, Nikouyan N, et al. J Virol. 2020;94(18):e01279-20). Also, the highly conserved N protein across coronavirus spe-cies makes it a potential target for a universal coronavirus vaccine (Liu YD, Chi WY, Su JH et al. J Biomed Sci. 2020; 27: 104). Recent studies have shown that antibodies against the N protein are more sensitive indi-cators than anti–S protein antibodies for the detection of early SARS-CoV-2 infection (Burbelo PD, Riedo FX, Morishima C et al. J Infect Dis. 2020 Jun 29;222(2):206-213). The bioinformatics analysis have predicted the major B and T cell epitopes on the SARS-CoV-2 N protein by comparing to other coronaviruses that infect humans (Oliveira SC, de Magalhães MTQ, Homan EJ. Front Immunol. 2020 Oct 28;11:587615). The N protein of SARS-CoV-2 is believed to induce T cell responses. Reports have demonstrated that a DNA vaccine encoding SARS-CoV N protein induce T cell prolif-eration and cytotoxic T cell responses in rhesus monkeys, and mice (Zhao P, Cao J, Zhao LJ, et al. Virology. 2005;331(1):128-135, Gao W, Tamin A, Soloff A, D'Aiuto L et al. Lancet. 2003 Dec 6;362(9399):1895-6). However, in vivo protection conferred by vac-cines containing the N protein has not yet been experimentally validated. Therefore, a vaccine with the high immunogenicity against SARS-Cov2 and effective against VOC will be the ultimate goal one should achieve to eradicate COVID-19. Study proposed to achieve this goal by combining the S1 subunit protein with N protein in a recombinant vaccine form. Morespecificaly, Pichia pastoris based high yielding production of these (S1 and N) recombinant proteins. Although there is no report on this particular combination vaccine in Pichia based expression system, Hong et al., have cor-roborated our hypothesis by showing the combination of RBD/P2 and N increase T-cell activation along with TH1-prone responses result faster viral clearance in non-human primates (NHP) (Hong SH, Oh H, Park YW et al. Sci Adv. 2021 May 28;7(22): eabg7156). In this study, a Bi-antigenic composition comprising S1 antigen and N antigen designed and prepared and expressed in an yeast based expression system , preferably Pichia pas-toris. The invention also provides a stable composition of the Bi-antigenic vaccine with a non-antigenic component. However, mere combining immunogenic antigens does not ensure a stable and immuno-genic preparation as all the antigens are of different nature e.g. S1 antigen and N antigen . none reveal approach of the prior art talks about combination of Bi-antigenic vaccines expression in Pichia pastoris and its stable composition with adjuvant. The present invention provides a liquid Bi-antigenic vaccine formulation (s) obtained as a single dose and multidose for Individual and mass vaccination. The sealed vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any preservative whereas multidose formulation contained Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0. In the present invention, a stable Bi-antigenic vaccine was designed against The S1 sub-unit of S protein , Nucleocapsid Protein of SARS–CoV-2 Proposed vaccine is efficient in eliciting primary, secondary and tertiary immune re-sponses and therefore, can target on the broader Population coverage against the SARS–CoV-2 virus. The aim of the present invention is to develop a fully liquid Bi-antigenic adjuvant based safe, effective and affordable vaccine against SARS CoV-2 virus to provide a broad spectrum mass protection. Again, proposed Bi-antigenic vaccine has short term and long-term protection against the SARS-CoV-2. The present Bi-antigenic vaccine is de-signed to be effective against variants and mutations of the SARS-CoV-2 virus. OBJECTS OF THE INVENTION The object of the present invention is to provide a process of producing a stable Bi-antigenic vaccine against SARS CoV-2 virus. Another object of the present invention is to provide a process of producing yeast based Bi-antigenic vaccine comprising of S 1 and N antigen for the prevention of SARS CoV2, wherein the yeast is Pichia pastoris. Another object of the present invention is to provide a composition for a stable adjuvant based Bi-antigenic vaccine comprising S1 antigen , N antigen and non-antigenic compo-nent(s) wherein the adjuvant is alum salt ,preferably Aluminum phosphate. Another object of the present invention is to provide a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen , N antigen and non-antigenic component(s), wherein the vaccine remains stable for longer duration. Another object of the present invention is to provide a provide a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen , N antigen and non-antigenic component(s) gives short term and long term protection . Another object of the present invention is to provide a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent(s) effective against variants and mutations of the SARS CoV2 virus. Yet another object of the present invention is to provide a fully liquid Bi-antigenic vac-cine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi - dose presentation. SUMMARY OF THE INVENTION In a general aspect the present invention provides a process of producing a stable Bi-antigenic vaccine against SARS CoV-2 virus. In an embodiment, the present invention provides a process of producing a yeast based Bi-antigenic vaccine comprising of S1 and N antigen for the prevention of infection against SARS CoV2 wherein the yeast is Pichia Pastoris. In an embodiment, the present invention provides a composition for a stable adjuvant based Bi-antigenic anti- SARS CoV-2 vaccine comprising S1 antigen ,N antigen and non-antigenic component(s) wherein the adjuvant is alum salt ,preferably Aluminum phosphate. In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent(s), wherein the vaccine remains stable for longer duration. In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen , N antigen and non-antigenic component (s) gives short term and long term protection. In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent (s) effective against variants and mutations of the SARS CoV2 virus. In another embodiment, the present invention is to provide a fully liquid Bi-antigenic vaccine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi- dose presentation. BRIEF DESCRIPTION OF ACCOMPANYING FIGURES: Fig 1: Restriction Digestion Map of protein subunit 1(S1) Fig 2: pPIC3.5-S protein subunit 1 map Fig 3: PCR verification results of SARS-CoV-2spike(S) protein subunit 1 Fig 4: SDS-PAGE to detect protein secretion and expression of SARS-CoV-2spike(S) protein subunit 1 Fig 5: SDS-PAGE to detect protein secretion and expression SARS-CoV-2spike(S) pro-tein subunit 1 Fig 6: Western Blot to detect protein secretion and expression of SARS-CoV 2spike(S) protein subunit 1 Fig 7: Western Blot to detect protein secretion and expression Fig No 8: PCR verification results (pPIC3.5-N protein) Fig No 9: SDS-PAGE to detect N protein secretion and expression Fig No 10: Western Blot to detect protein secretion and expression Fig A: Process flow for producing Bi-antigenic vaccine BRIEF DESCRIPTION OF ACCOMPANYING SEQUENCE LISTINGS: SEQ ID NO: 1: Amino acid sequence of SARS-CoV-2spike(S) protein subunit 1 SEQ ID NO: 3: Amino acid sequence of SARS-CoV-2 N protein DETAILED DESCRIPTION OF THE INVENTION The following is a detailed description of some of the embodiments and explanation of the present invention with some examples thereof. The embodiments are in such detail as to clearly communicate the disclosure. However, the amount of detail offered is not intended to limit the anticipated variations of embodiments; on the contrary, the inten-tion is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims. Unless the context requires otherwise, throughout the specification which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense that is as “including, but not limited to.” Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable man-ner in one or more embodiments. As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and/or” unless the content clearly dictates otherwise. In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description are approximations that can vary depending upon the de-sired properties sought to be obtained by a particular embodiment. In some embodi-ments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific exam-ples are reported as precisely as practicable. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All process described herein can be performed in any suitable order unless otherwise in-dicated herein or otherwise clearly contradicted by context. The use of any and all ex-amples, or exemplary language (e.g. “such as”) provided with respect to certain embod-iments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specifi-cation should be construed as indicating any non-claimed element essential to the prac-tice of the invention. The headings and abstract of the invention provided herein are for convenience only and do not interpret the scope or meaning of the embodiments. The following discussion provides many example embodiments of the inventive subject matter. Although each embodiment represents a single combination of inventive ele-ments, the inventive subject matter is considered to include all possible combinations of the disclosed elements. Thus if one embodiment comprises elements A, B, and C, and a second embodiment comprises elements B and D, then the inventive subject matter is also considered to include other remaining combinations of A, B, C, or D, even if not explicitly disclosed. Various terms as used herein are shown below. To the extent a term used in a claim is not defined below, it should be given the broadest definition persons in the pertinent art have given that term as reflected in printed publications and issued patents at the time of filing. The term ‘fully liquid’ as used herein refers to the state of the vaccine, which is in the liquid form ready to be administered, wherein all the components of the vaccine are pro-vided in liquid state and there is no component of the vaccine that is provided in lyophi-lized or any other form so that it has to be mixed with the other components of the vac-cine before administering it to a subject. The term mutation or mutations’ as used herein is a an organism or a new genetic char-acter arising or resulting from an instance of mutation, which is generally an alteration of the DNA sequence of the genome or chromosome of an organism. It is a characteristic that would not be observed naturally in a specimen. Again the term “variants” or "genet-ic variants" is used to describe a subtype of a microorganism that is genetically distinct from a main strain, but not sufficiently different to be termed a distinct strain. The genetic material of all viruses is encoded in either DNA or RNA; one interesting feature of RNA viruses is that they change much more rapidly than DNA viruses. Every time they make a copy of their genes they make one or a few mistakes. This is expected to occur many times within the body of an individual who is infected with SARS-CoV-2 The current vaccines induce the immune system to produce antibodies that recognize and target the spike protein on the virus, which is essential for invading human cells. Scien-tists have observed the accumulation of multiple changes in the spike protein in the South African variant. These changes allows SARS-CoV-2, to attach more tightly to the ACE2 receptor and en-ter human cells more efficiently Those alterations could enable the virus to infect cells more easily and enhance its transmissibility. The term ‘adjuvant’ as used herein refers to the non-antigenic component of the vaccine that enhances the immune response of the antigens comprised in the vaccine by facilitat-ing the contact between the antigen and the immune system. The adjuvant causes pro-longed immune responses against the antigens. The term ‘coupling or adsorbing’ as used herein refers to any form of physical bonding between the antigen and the adjuvant components of the vaccine. The term ‘stable’ as used herein means that each of the antigens of the vaccine composi-tion has a potency/immunogenicity more than that set as the normal acceptance limit, after the incubation of the vaccine at 30o C for at least 1 month to 6 months. The term ‘immunologically active’ as used herein means when administered, the Bi-antigenic vaccine of the present invention is able to elicit antibodies against each of the antigens of the said combination so as to protect the vaccine against the respective dis-eases or infections. Reference will now be made in detail to the exemplary embodiments of the present dis-closure, examples of which are illustrated in the accompanying drawings. Wherever pos-sible, the same reference numbers are used in the drawings and the description to refer to the same or like parts. The present invention relates to a process of producing a stable Bi-antigenic vaccine against SARS CoV-2 virus. In an embodiment, the present invention provides a process of producing a yeast based Bi-antigenic vaccine comprising of S1 and N antigen for the prevention of infection against SARS CoV2 wherein the yeast is Pichia Pastoris. In an embodiment, the present invention provides a composition for a stable adjuvant based Bi-antigenic anti- SARS CoV2 vaccine comprising S1 antigen, N antigen and non-antigenic component(s) wherein the adjuvant is alum salt ,preferably Aluminum phos-phate. In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent(s), wherein the vaccine remains stable for longer duration. In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent (s) gives short term and long term protection. In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent (s) effective against variants and mutations of the SARS CoV2 virus. Yet another object of the present invention is to provide a fully liquid Bi-antigenic vac-cine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi -dose presentation. Recombinant Bi-Antigen SARS-CoV-2 S1 Subunit and N Protein Vaccine : Mecha-nism of Action Following intramuscular injection of the vaccine, SARS-CoV-2 viral antigens are en-gulfed by the specialized “Antigen Presenting Cells” called the Dendritic Cells (DCs). DCs present antigen to naive T cells, which become activated and differentiated into ef-fector cells to form cytotoxic T lymphocytes (CD8+) or Helper T cells (CD4+). Helper T Cells stimulate B-Cells to differentiate into Plasma Cells which produce antibodies. These antibodies prevent the virus from infecting other cells as well as mark the virus for destruction. Cytotoxic T Lymphocytes identify and destroy the virus infected cells. After the primary immune response, both memory B and T cells are formed which after can immediately mount an immune response when same SARS-CoV-2 viral antigen en-ters the body and thereby prevents subsequent infection. In an embodiment, the composition of the present invention each of the antigens is pre-sent in an amount so as to elicit a protective immune response against the said antigen. It was surprisingly found by the inventors that when the antigens and conjugate were in-cluded in the composition in specific quantities, the composition for adjuvant based Bi-antigenic vaccine of the present invention not only they elicit immune response against the said antigen but the composition also remains stable. In an embodiment, S1 antigen is present in the range of 5-20 µg, preferably 10 µg per dose of 0.5 ml of the composition. In an embodiment, N antigen is present in the range of 5-20 µg , preferably 10 µg per dose of 0.5ml of the composition. In an embodiment, composition of the present invention for Bi-antigenic vaccine com-prises overages for all the components of vaccine S1 antigen and N antigen which can be in the concentration of as low as 5%. In an embodiment, composition of the present invention for Bi-antigenic vaccine com-prises overages for all the components of vaccine S1 antigen and N antigen which can be in the concentration of as high as 25%. The composition of the present invention can further comprise one or more non-antigenic component(s) that are pharmaceutically acceptable excipients selected from but not limited to adjuvant, preservative, tonicity agent, pH modifier, and buffer. Any adjuvant that helps to stimulate a stronger immune response can be included. In an embodiment, the composition of the present invention includes aluminum based adju-vant such as aluminium phosphate or aluminium hydroxide. In one embodiment, the aluminum based adjuvant is aluminum phosphate. The composition of the present invention can include any suitable buffer to control the osmotic pressure gradient of the vaccine composition. In an embodiment the composi-tion of the present invention includes a tonicity modifying agent. The tonicity agent that can be incorporated in the composition is selected from but not limiting to a group of salt including NaCl, MgCl2, KCl, and CaCl2; sugar including dextrose, mannitol, and lac-tose; amino acid including arginine, glycine, and histidine; polyol including glycerol and sorbitol; or mixture thereof. In an embodiment, a physiological salt such as sodium salt is used in the composition of the present invention. In one embodiment, sodium chloride (NaCl) is included in the composition of the present invention, The composition of the present invention can include any suitable pH modifier to adjust the pH of the vaccine composition selected from but not limiting to sodium hydroxide, hydrochloric acid or combination thereof. The pH modifier in included in sufficient quantity so as to adjust the pH of the composition between pH 6 – 7. The composition of the present invention can include any suitable buffer selected from but not limiting to sodium phosphate, potassium phosphate, citrate buffer or combina-tions thereof. In an embodiment, the present invention provides a liquid Bi-antigenic vaccine formula-tions obtained as mentioned above, formulated, filled, stoppered, sealed and labeled in appropriate single dose and multidose containers for individual as well as mass vaccina-tion. The labeled vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any preservative whereas multidose formulation contained Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0. In an embodiment, the adjuvant based Bi-antigenic vaccine comprises S1 antigen, N an-tigen are adsorbed on adjuvant aluminum phosphate. The composition can include a suitable preservative to avoid the contamination with harmful microbes. The preservative that can be included in the composition is 2-phenoxyethanol (2-POE), also known as 1-hydroxy 2-phenoxyethane, 2-hydroxyethyl phenyl ether or by other synonyms. The safety profile of 2-phenoxy ethanol is better than that of mercurial preservatives such as thiomersal and hence such non-mercurial pre-servative is preferred over mercurial preservative. In an embodiment, the preservative is 2-phenoxyethanol present in an amount of about 5 mg/ml, (0.5% w/v) of the mg per 0.5 ml of the vaccine. In another aspect the present invention provides a process for producing a fully liquid adjuvant based Bi-antigenic vaccine having composition comprising S1 antigen, N anti-gen and non-antigenic component(s). In an embodiment, the present invention provides a process for producing a fully liquid adjuvant based Bi-antigenic vaccine comprising the composition of the present inven-tion, in which the process comprises the steps of: A process of producing a fully liquid Bi-antigenic vaccine composition comprising the steps of: a) adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Aluminum phosphate and blending, b) adding at least 10 µg N-antigen adsorb on Alum salt preferably Alumi-num phosphate (with already absorbed S1 antigen) obtained in step (a) and mixing to obtain Bi-antigenic vaccine against SARS CoV 2 virus, c) further, addition of physiological saline, stabilizer and non mercury preservative 2-phenoxyethanol (2-POE) at pH of about 6.0-7.0 (pref-erably 6.4-6.8) to the mixture of absorbed S1 antigen and N antigens on Alum salt Preferably Aluminum phosphate obtained in step (b) and blending, d) further, mixing by stirring the composition at a speed of about 100-400 rpm (preferably at 200-300 rpm) for period of about 4-18 hrs (preferably 8-16 hrs). In one embodiment the adsorption of antigens onto aluminum phosphate is carried out in the presence of physiological saline, stabilizer and non mercury preservative for exam-ple 2-phenoxyethanol (2-POE) and by mixing the antigens and aluminum phosphate for examples by stirring at speed of about 100-400 rpm (preferably 200-300 rpm) for about 1-25 hours (preferably 12-18 hrs). In one specific embodiment the mixture of S1 antigen and N antigen adsorbed onto alu-minum phosphate is provided by adding S1 antigen and N antigen in a sequence to alu-minum phosphate followed by addition of physiological saline and preservative 2-phenoxyethanol (2-POE) at pH of about 6.0-7.0, mixing for example by stirring at speed of about 100-400 rpm for period of about 4-18 hrs. In one embodiment, mixing as per steps adsorbed onto aluminum phosphate obtained is carried out for example by stirring at about 100-400 rpm for about 6-24 hrs. In one embodiment, the sequence of adsorption of antigens S1 antigen and N antigen on aluminum phosphate is in chronological order. In an embodiment, the fully liquid Bi-antigenic vaccine of the present invention com-prises per dose of 0.5ml, with 10 µg of each antigen. In an embodiment, the fully liquid Bi-antigenic vaccine of the present invention com-prises overages for all the components of vaccine, S1 antigen N antigen which can be in the concentration of as low as 5%. In an embodiment, the fully liquid Bi-antigenic vaccine of the present invention com-prises overages for all the components of vaccine S1 antigen and N antigen which can be in the concentration of as high as 25%. In some of the embodiments the content of adjuvant aluminum (Al+3) included is 1.25 mg per 0.5 ml of vaccine, preferably 1 mg per 0.5 ml of vaccine, 0.8 mg per 0.5 ml of vaccine and, preferably 0.5 mg per 0.5 ml. In some of the embodiments the preservative used is preferably but not limited to non mercury agent 2-phenoxyethanol in the quantity of 5mg/ml of the vaccine. Without being bound to any theory it is believed that the unexpected ability of the Bi-antigenic vaccine of the present invention induce immunogenicity, maintenance of the right form of the antigens and to remain stable due to one or more reasons of the compo-sition that is the combination of particular antigens, the way the composition has been formulated , which may include the sequence of addition of the antigens, the use of spe-cific adjuvants for certain antigens, the use of various parameters including agitation, temperature, pH and time duration. In an aspect the present invention provides a process of inducing immunological re-sponse to a subject by administering the multivalent vaccine of the present invention. In an embodiment, the present invention provides a process of immunological response to a subject by administering through parenteral route for example by injecting an Bi-antigenic vaccine of the present invention comprising immunological active amount of Bi-antigenic vaccine of the present invention comprises overages for all the components of vaccine , S1 antigen and N antigen. The present invention provides a fully liquid stable adjuvant based Bi-antigenic vaccine that comprises a variety of the vaccine antigens that are suitable for the prevention and treatment of multiple disease states that meet the criterion for the seroprotection for each of the said vaccine components. The advantages of the present invention include a Bi-antigenic vaccine which is fully liquid and hence ready to be administered and does not need to be reconstituted at the time of administration thus aiding ease to the practitioner. The Bi-antigenic vaccine of the present invention can confer protection against SARS-CoV2 infections in a safe and efficacious manner. The Bi-antigenic vaccine of the present invention is capable of providing immunogenicity to various diseases and infections without any interference of any of the antigen that is present in the vaccine. Thus, a single shot and/or a booster dose of vaccine would confer immunogenicity against various diseases and infections, making the vaccine more patients compliant. Since a single shot would afford immunity against a number of infections and diseases, the cost of vaccination would be reduced. The vac-cine of the present invention would be beneficial in the sense that it will reduce the number of visits to the vaccination center and also the number of shots to be given for number of different diseases and infections. This aspect of the present invention would make it more useful and advantageous especially with the older and younger population who need to be vaccinated to acquire immunity to a large number of infections and dis-eases. Thus, the present invention provides a vaccine that is more advantageous in terms of cost effectiveness as well as patient friendly. While the foregoing description discloses various embodiments of the disclosure, other and further embodiments of the invention may be devised without departing from the basic scope of the disclosure. The invention is not limited to the described embodiments, versions or examples, the invention is described hereinafter, with reference to the fol-lowing examples, which are to enable a person having ordinary skill in the art to make and use the invention when combined with information and knowledge available to the person having ordinary skill in the art, such examples are illustrative only and should not be construed to the limit of the scope of present invention. EXAMPLES The present disclosure is further explained in the form of following examples. However, it is to be understood that the foregoing examples are merely illustrative and are not to be taken as limitations upon the scope of the invention. Various changes and modifica-tions to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications may be made without departing from the scope of the inven-tion. Example 1: Cloning and expression 1)SARS-CoV-2 spike (S) protein subunit1 expression in Pichia pastoris GS115 via pPIC3.5 The plasmid was linearized with restriction enzyme pmeI. Then transformed into the competent cell of Pichia GS115 by electroporation as in Fig 1, Fig 2 and amino acid Seq of S1 as Seq ID No:1(GenBank: MN908947.3. NCBI) . Inoculated onto MD plates, and cultured upside-down at 30 °C for 2-3 days to observe the growth. Positive clones ware picked and performed PCR with S-T-F and S-T-F pri-mers as in Fig 3. S-T-F:ATGGTTAACTTGACTACTAGAACT S-T-F:AACGGATCTAGCTCTTCTTGGAGA 1.1) Expression validation 5 verified recombinant clones were selected and inoculated into BMGY medium, and cultured at 30? until OD600=4~6 (log-phase growth). Replace with BMMY medium for induction, and put the resuspended bacterial solution at 30? and 220rpm. Add meth-anol with a final concentration of (0.5%) every 24 h (induction for 5 days).After induc-tion, centrifuge at 1500-3000g for 5 minutes to collect cells. After removing the superna-tant, immediately sonicate the cells. Use SDS-PAGE (as in Fig no 4 and Fig no 5) and Western Blot to detect protein secretion and expression as in Fig :6. 2) SARS-CoV-2 N Protein expression in Pichia pastoris GS115 via pPIC3.5 SARS-CoV-2 N Protein (419aa) expression in P. pastoris GS115 via pPIC3.5. The plas-mid was linearized with restriction enzyme pmeI separately and amino acid sequence of N as Seq ID No:3 (GenBank: MN908947.3. NCBI) as in Fig :7 .Then transformed into the competent cell of Pichia GS115 by electroporation. Inoculated onto MD plates, and cultured upside-down at 30 °C for 2-3 days to observe the growth. Positive clones ware picked and performed PCR with 5AOX and 3AOX primers separately as in Fig : 8 5AOX:GACTGGTTCCAATTGACAAGC 3AOX:GCAAATGGCATTCTGACATCC 2.1. Expression validation 5 verified recombinant clones were selected and inoculated into 2mL YPD medium, and cultured at 30? until OD600=4~6 (log-phase growth). Inoculate 1% volume into 10 mL BMGY medium and cultivate at 30°C, 200 rpm. When the OD600 is 2-6, centrifuge the bacteria with a sterile centrifuge tube. Discard BMGY medium, induce expression with 20 mL BMMY medium at 30°C, add methanol with a final concentration of (0.5%) every 24 h, and take samples (induction for 5 days). After induction, centrifuge at 1500-3000g for 5 minutes to collect cells. After removing the supernatant, immediately sonicate the cells. Use SDS-PAGE and Western Blot to detect protein secretion and expression as in Fig 9 and Fig: 10 respectively. 2.2. Expression validation (Western Blot) (1) Prepare bacterial lysates, resolving gel (8-12%) and stacking gel (5%). Load 5 µl bacterial lysates into the wells along with molecular weight markers. Run the resolving gel for 2 h at 80 V. Run the stacking gel for 2 h at 60 V. (2) Activate PVDF with metha-nol for 1 min and rinse with Tris-Glycine transfer buffer (containing 5% methanol) be-fore preparing the stack. Place the SDS-PAGE gel in Tris-Glycine transfer buffer for 30 min. Transfer in a coldroom at a constant voltage of 100 V for 2 h. (3) Block the mem-brane for 1 h at room temperature using blocking buffer TBST (containing 3%BSA). Wash the membrane in three washes of TBST, 5 min each. (4) Dissolve the primary an-tibody in T-TBS (containing 3% BSA) in a certain proportion. Incubate overnight in the primary antibody solution at 4°C. Wash the membrane in three washes of TBST, 5 min each. (5) Dissolve the secondary antibody in T-TBS (containing 3% BSA) in a certain proportion. Incubate overnight in the primary antibody solution at 4°C. Wash the mem-brane in three washes of TBST, 5 min each. (6) Using SuperSignal® West Dura Extend-ed Duration Substrate, prepare 1ml ECL working solution of chemiluminescent substrate based upon manufacture instruction. Incubate the blot with the working solution for 1 min. Remove the blot from working solution and drain excess ECL reagent. Place the blot in clear plastic wrap and remove bubbles by rolling with blot roller or glass pipette. Image the blot using X-ray film. 10×YNB (yeast nitrogen base) - Dissolve 13.4g YNB in 100ml water, filter sterilize or autoclave. 500×Biotin (0.02%)- Dissolve 20mg of biotin in 100ml water, filter sterilize BMGY me-dium composition 1% yeast extract, 2% peptone, 1% glycerol, 4×10-5 % biotin, 1.34%YNB, and 0.1 M potassium phosphate, pH 6.0 . BMMY medium composition - 1% yeast extract, 2% peptone, 4×10-5% biotin, 1.34%YNB, and 0.1 M potassium phosphate, pH 6.0. Example 2 Process for producing fully liquid bi-antigenic vaccine (S1 and N) against SARS-CoV-2 in details Composition and process for producing Bi-antigenic vaccine This recombinant vaccine shall be produced using Pichia pastoris yeast into which the Bi-antigenic of SARS-CoV-2 recombinant protein has been transformed and expressed. The yeast cells are grown in fermentor to produce the recombinant proteins (S1 and N) of SARS-CoV-2. The expressed recombinant proteins will be purified by lysing the yeast cells and separating proteins by biochemical and biophysical techniques as shown in process Flow Diagram in Fig A. This process does not involve handling of disease caus-ing organism hence process is safe and chances of infections are less. . Fig A- Process flow for producing Bi-antigenic antigen vaccine Example 3 Bulk Production Process: The frozen working seed vial is thawed and grown in required amount of medium by in-cubating at required temperature for desired time. The seed is propagated further in shake flasks and incubated at required temperature for desired time. Once getting desired levels of growth and passing the microscopic observations, the culture is inoculated into the fermentor. Fermentation cycle consists of 4 distinct phases: Glycerol batch phase (GB), Glycerol Fed-batch (GFB), Starvation phase and Methanol Induction Phase (MIP).After attaining the required cell mass, Methanol feed has to be supplied to initiate the protein expres-sion. After attaining fermentation to desired level, cells are harvested and washed with buffers. Cells are then subjected to disruption by biophysical techniques to get the proteins re-leased. The crude protein then subjected to various purification process including poly-mer and Salt treatment, primary purification followed by secondary purification includ-ing Centrifugation, Chromatography purification, Ultra filtration TFF, Ultra Centrifuga-tion and Salt treatment to achieve desired level of purity. The purified antigen is filter sterilized and stored till its next use of formulation of vaccine as mentioned in Fig-A. Example 4 Formulation and Fill Finish process Purified Bulk antigen is formulated into desired doses form using appropriate buffer, Aluminium compound adjuvant and suitable preservative. Formulation activity is per-formed at required temperature for desired time. Once tested and approved, formulated vaccine is filled of desired dose volume. The basic manufacturing path and most of the steps to produce all four antigens (S1and N) remain same with variations in their fermentation strategies and purification parame-ters such as chromatographic purification and centrifugation. Example 5 Process for producing fully liquid Bi-antigenic adjuvant based vaccine: S1 antigen was added to Aluminum phosphate aseptically. The mixture was stirred gen-tly at 100-400 rpm (preferably 200-300 rpm) for 2-4 hrs followed by addition of N anti-gen at constant stirring of 100-400 rpm (preferably 200-300 rpm). S1 antigen and N an-tigen are added during constant stirring at 100-400 rpm (preferably 200-300 rpm) at an interval of 2-4 hrs. Once the blending part completed addition of isotonic sodium chlo-ride solution, suitable stabilizer and preservative 2-Phenoxyethanol (2-POE) at pH rang-ing between 6.0 -7.0 (preferably 6.4-6.8) in a sterile and uniform suspension. The Bi-antigenic formulation comprising S1 antigen and N antigen adsorbed on adjuvant alum salt preferably aluminum phosphate to provide fully liquid Bi-antigenic vaccine composition. The fully liquid Bi-antigenic vaccine formulation obtained as mentioned above, formu-lated, filled, stoppered, sealed and labeled in appropriate single-dose and multi - dose containers for individual as well as mass vaccination. The labeled vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any pre-servative whereas multi- dose formulation presentation contained suitable stabilizer and 2- Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0. Although the preferred embodiments of the present invention and their respective varia-tions have been described, people having ordinary skills in the art would envision vari-ous modifications of those embodiments. Accordingly, the present invention should not be limited to precise forms and manners in the above disclosure and description but should simply be taken by way of examples. Thus, the present invention can be varied and modified without departing the true scope and spirit thereof as defined in the ap-pended claims.
Claims:WE CLAIMS:
1. A process for producing a stable Bi-antigenic vaccine composition against SARS CoV-2 virus comprising
a. Bi-antigenic composition , wherein the Bi-antigenic consisting of
S1 antigen and N antigen,
b. above mentioned antigens expressed in yeast as individual clone.
c. purification of expressed Bi-antigenic
d. adding and mixing S1 and N antigens with non-antigenic component (s) for stability of the Bi-antigenic vaccine against SARS CoV-2 virus.
2. The Bi-antigenic vaccine composition as claimed in claim 1, wherein yeast is
Pichia pastoris
3. A process of producing a stable Bi-antigenic composition as claimed in claim 1, wherein the vaccine is a fully liquid vaccine.
4. A process of producing a fully liquid Bi-antigenic vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consist of S1 antigen and N antigen is about 5 µg to about 20 µg per dose each of 0.5ml of the composition
5. A process of producing a fully liquid Bi-antigenic vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consist of S1 antigen and N antigen is at least 10 µg per dose each of 0.5ml of the composition.
6. The Bi-antigenic vaccine composition as claimed in claim 1, wherein the Bi-antigenic vaccine composition further comprises one or more non-antigenic com-ponent(s) that are pharmaceutically acceptable excipients selected from adjuvant, stabilizer, non mercury preservative, tonicity agent, pH modifier, and buffer.
7. The Bi-antigenic composition as claimed in claim 6, wherein the adjuvant is alum salt preferably Aluminum phosphate.
8. The Bi-antigenic composition as claimed in claim 7, wherein the Aluminum con-tent (Al3+) in the composition is about 0.5 mg to about 1.25 mg .
9. The Bi-antigenic vaccine composition as claimed in claim 8, wherein the alumi-num content (Al3+) in the composition is at least 0.25 mg.
10. The Bi-antigenic vaccine composition as claimed in claim 6, wherein the preserva-tive is 2-phenoxyethanol (2-POE) in the composition should not exceed 0.1mg/ml.
11. The Bi-antigenic vaccine composition as claimed in claim 6, wherein the preserva-tive is 2-phenoxyethanol (2-POE) in the composition is at least 0.05mg/ml.
12. The Bi-antigenic vaccine composition as claimed in claim 6,wherein the tonicity modifying agent is selected from the group of salt including NaCl, MgCl2, KCl, and CaCl2; sugar including Dextrose, Mannitol, and Lactose; amino acid includ-ing Arginine, Glycine, and Histidine; polyol including Glycerol and Sorbitol; or mixture thereof.
13. The Bi-antigenic vaccine composition as claimed in claim 6,wherein the pH modifier is selected from sodium hydroxide, hydrochloric acid or combination and comprises a pH in the range of 6 – 7.
14. The Bi-antigenic composition as claimed in claim 6 , wherein the buffer is se-lected from sodium phosphate, potassium phosphate, citrate buffer or combina-tions thereof.
15. A process of producing a fully liquid Bi-antigenic vaccine composition compris-ing the steps of:
a) adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Alumi-num phosphate and blending,
b) adding at least 10 µg N-antigen adsorb on Alum salt preferably Alumi-num phosphate (with already absorbed S1 antigen) obtained in step (a) and mixing to obtain Bi-antigenic vaccine against SARS CoV 2 virus,
c) further, addition of physiological saline, stabilizer and non-mercury preserv-ative 2-phenoxyethanol (2-POE) at pH of about 6.4-6.8 to the mixture of ab-sorbed S1 antigen and N antigens on Aluminum phosphate obtained in step (b) and mixing,
d) further, blending by stirring the composition at a speed of about 200-300 rpmfor period of about 8-16 hrs.
16. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the process for producing Bi-antigenic vaccine composition as shown in Fig A.
17. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the composition overages of the S1 antigen and N antigens as low as 5% to as high as 25%.
18. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein
the composition is effective against all SARS CoV-2 virus variants and mutations.
19. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein
the fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen and N antigen and non-antigenic component(s) gives short term and long term protection against all SARS CoV-2 virus variants and mutations.
20. The fully liquid Bi-antigenic vaccine composition as claimed in claim 15, wherein the Bi-antigenic vaccine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi - dose presentation.
, Description:PROCESS FOR PRODUCING A FULLY LIQUID BI-ANTIGENIC ADJUVANT BASED VACCINE AGAINST SARS COV-2 VIRUS
This is an application for patent of addition for which the main application is 202121007794 filed on 24/02/2021
FIELD OF THE INVENTION
The present invention relates to the process of producing Bi-antigenic SARS-CoV-2
Vaccine. In particular the present invention relates to a composition comprising S1 sub-unit and N antigen derived from SARS-CoV-2 virus and expressed in a yeast based ex-pression system and its stable formulation with adjuvant. The present invention also re-lates to a process for producing a stable Bi-antigenic SARS-CoV-2
Vaccine having a broader spectrum of immunity and effective for all section of popula-tion.
The present invention provides a fully liquid Bi-antigenic adjuvant based safe, effective and affordable vaccine against SARS CoV-2 virus to provide a broad spectrum mass pro-tection. Again, proposed Bi-antigenic vaccine has short term and long-term protection against the SARS-CoV-2. The present Bi-antigenic vaccine is designed to be effective against variants and mutations of the SARS-CoV-2 virus.
BACKGROUND OF THE INVENTION
Background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifi-cally or implicitly referenced in this application is prior art. Disclosures of these publi-cations in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.
Coronavirus disease (COVID-19) is an infectious disease caused by a newly discov-ered coronavirus in 2019. The virus is now known as the severe acute respiratory syn-drome coronavirus 2 (SARS-CoV-2). In March 2020, the World Health Organization (WHO) declared the COVID-19 outbreak a pandemic. Signs and symptoms of corona-virus disease 2019 (COVID-19) e.g Fever, Cough, Shortness of breath, Sore throat, Run-ning nose etc may appear two to 14 days after exposure. The severity of COVID-19 symptoms can range from very mild to severe. Older people have higher risk of seri-ous illness from COVID-19, and the risk increases with age. People who have existing chronic medical conditions also may have a higher risk of serious illness. Certain medi-cal conditions that increase the risk of serious illness from COVID-19 include:
Heart diseases, such as heart failure, coronary artery disease or cardiomyopathy, Cancer, Chronic obstructive pulmonary disease (COPD), Type 2 diabetes, Chronic kidney dis-ease, Weakened immune system, Asthma, Liver disease and High blood pressure. This list is not inclusive of all detected symptoms.
SARS-CoV-2 has a genome size of ~30 kilobases, which like other coronaviruses, en-codes for multiple structural and non-structural proteins. The structural proteins include the spike (S) protein, the envelope (E) protein, the membrane (M) protein, and the nu-cleocapsid (N) protein.( Chen Y, Liu Q, Guo D. [published correction appears in J Med Virol. 2020 Oct;92(10):2249]. J Med Virol. 2020; 92(4):418-423). S protein plays a cru-cial role in eliciting the immune response during disease progression. (KK, Tsang OT, Leung WS, et al. Lancet Infect Dis. 2020; 20(5):565-574). Therefore, spike protein of SARS-CoV -2 become a potential and common target for the first generation vaccine and therapeutic development. However there are several challenges as follows- First genera-tion approved SARS-CoV-2 vaccines will provide population immunity that can reduce transmission of SARS-CoV-2 and lead to a resumption of pre- SARS-CoV-2 “normal-cy” . However, the impact of these SARS-CoV-2 vaccines on infection and thus trans-mission is not being assessed. Even if vaccine were able to confer protection from dis-ease, they might not reduce transmission similarly.
Again earlier studies suggest that the full-length S protein-based SARS vaccines can induce neutralizing antibody responses against SARS-CoV infection, they may also in-duce harmful immune responses that cause liver damage of the vaccinated animals or enhanced infection after challenge with homologous SARS-CoV, raising concerns about the safety and ultimate protective efficacy of vaccines that contain the full-length SARS-CoV S protein.( Du L, He Y, Zhou Y, Liu S, Zheng BJ, Jiang S. Nat Rev Microbiol. 2009;7(3):226-236)
Again, the mutation loosens the spike protein
Earlier publications discloses that sequences Spike (S) protein mediates infection of hu-man cells and is the target of most vaccine strategies and antibody-based therapeutics. Scientist identified mutations in Spike that are accumulating (Ahlén G, Frelin L, Ni-kouyan N, et al . J Virol. 2020;94(18). Mutations are considered in a broader phylogenet-ic context, geographically, and over time, to provide an early warning system to reveal mutations that may confer selective advantages in transmission or resistance to interven-tions. Each one is evaluated for evidence of positive selection, and the implications of the mutation are explored through structural modeling.
The mutation Spike D614G is of urgent concern; it began spreading in Europe in early February, and when introduced to new regions it rapidly becomes the dominant form.
Researchers have catalogued more than 12,000 mutations in SARS-CoV-2 genomes. Mu-tations that do change proteins are more likely to harm the virus than improve it.
(Sources: L. Van Dorp et al. Young et al. Lancet 396, 603–611 (2020)
A spike protein is made up of three smaller peptides in ‘open’ or ‘closed’ orientations; when more are open, it’s easier for the protein to bind. The D614G mutation — the result of a single-letter change to the viral RNA code — seems to relax connections between peptides. This makes open conformations more likely and might increase the chance of infection.
Again according to Plante, J.A., Liu, Y., Liu, J. et al. Nature (2020), demonstrated that the spike D614G substitution enhances viral replication in the upper respiratory tract and increases the susceptibility of the virus to neutralization by antibodies. These findings have important implications on the evolution and spread of the ongoing SARS–CoV-2 pandemic, and for vaccine efficacy and therapeutic antibody development.
Again, recent studies shows One mutation called N501Y alters the most important part of the spike, known as the "receptor-binding domain”. This is where the spike makes first contact with the surface of our body's cells. Any changes that make it easier for the virus to get inside are likely to give it an edge. The other mutation - a H69/V70 deletion, in which a small part of the spike is removed - has emerged several times before, includ-ing famously in infected mink.
Again, the SARS-CoV-2 Spike (S) Glycoprotein is directly recognized by the host im-mune system, target for T-cell response (Zhang J, Zeng H, Gu J et al. Vaccines (Basel). 2020;8(2):153, Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82). Studies on SARS-CoV, MERS-CoV and SARS-CoV-2 have described both CD4+ and CD8+ epitopes in the S protein (Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82). The spike protein is a primary target for host immunity after natural infection and main target for COVID-19 vaccines (Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82, Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Menachery VD. Cell Host Microbe. 2021;29(4):508-515). Antibodies that target the spike protein can prevent binding/entry and subsequently inhibit the virus from replicating inside the host cell machinery (Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Menachery VD. Cell Host Microbe. 2021;29(4):508-515, Malik JA, Mulla AH, Farooqi T, Pottoo FH, Anwar S, Rengasamy KRR. Biomed Pharmacother. 2021;137:111254). The Spike protein consists of S1 Subu-nit which has Receptor Binding Domain (RBD) which binds to the host Angiotensin Converting Enzyme (ACE)-2 receptors facilitating attachment. (Yu F, Xiang R, Deng X, et al. Signal Transduct Target Ther. 2020;5(1):212, Naqvi AAT, Fatima K, Mohammad T, et al. Biochim Biophys Acta Mol Basis Dis. 2020;1866(10):165878, Littler DR, MacLachlan BJ, Watson GM, Vivian JP, Gully BS. Biochem Soc Trans. 2020;48(6):2625-2641, Alanagreh L, Alzoughool F, Atoum M. Pathogens. 2020;9(5):331). The Spike Protein also consists of S2 Subunit which is a conserved re-gion and mediates viral cell fusion and its integration into the host cell (Huang Y, Yang C, Xu XF, Xu W, Liu SW. Acta Pharmacol Sin. 2020;41(9):1141-1149). The RBD with-in the S1 Subunit is a highly mutable region, contains multiple dominant neutralizing epitopes and target for human neutralizing antibodies (Yu F, Xiang R, Deng X, et al. Signal Transduct Target Ther. 2020;5(1):212, Liu Z, Xu W, Xia S, et al. Signal Trans-duct Target Ther. 2020;5(1):282, Huang Y, Yang C, Xu XF, Xu W, Liu SW. Acta Phar-macol Sin. 2020;41(9):1141-1149). Also, N-Terminal Domain (NTD) present within S1 is also a target for virus neutralizing antibodies (Dai L, Gao GF. Nat Rev Immunol. 2021;21(2):73-82).
The S1 Subunit and its RBD represent the most attractive and potential vaccine target for coronavirus (Wang Y, Wang L, Cao H, Liu C. J Med Virol. 2021;93(2):892-898). The SARS-CoV-2 genome has undergone several mutations from the time it was first identi-fied in Wuhan, China (Rauseo AM, O'Halloran JA. JACC Basic Transl Sci. 2021;6(3):305-308). The emergence of these mutant variants is a major public health concern globally (Gómez CE, Perdiguero B, Esteban M. Vaccines (Basel). 2021;9(3):243). Of particular clinical significance is the high number of mutations in the Spike protein especially within the N-terminal domain (NTD) and the receptor binding domain (RBD) which is the target of potent virus neutralizing antibodies (Gómez CE, Perdiguero B, Esteban M. Vaccines (Basel). 2021;9(3):243, Wang P, Nair MS, Liu L, et al. bioRxiv. 2021;2021.01.25.428137). Changes in key spike residues may also reduce antibody binding/neutralization, reducing the efficacy of vaccine- and natural-infection derived antibodies (Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Men-achery VD. Cell Host Microbe. 2021;29(4):508-515).
The S protein mutation outside of the RBD (D614G) emerged early during the pandemic and became the dominant circulating variant globally by June 2020 (Rauseo AM, O'Hal-loran JA. JACC Basic Transl Sci. 2021;6(3):305-308, Grubaugh ND, Hodcroft EB, Fauver JR, Phelan AL, Cevik M. Cell. 2021;184(5):1127-1132). This D614G mutation has shown to improve SARS-CoV-2 infection in the upper airways (Plante JA, Mitchell BM, Plante KS, Debbink K, Weaver SC, Menachery VD. Cell Host Microbe. 2021;29(4):508-515). Since then, several variants have been identified with some desig-nated as “Variants of Concern” namely B.1.1.7 (first detected in UK, September 2020), B.1.351 (first detected in South Africa, December 2020) and P.1 (first reported in Brazil, 2021) (Rauseo AM, O'Halloran JA. JACC Basic Transl Sci. 2021;6(3):305-308, Abdool Karim SS, de Oliveira T. N Engl J Med. 2021;NEJMc2100362. ). They all share the D614G mutation in addition to other novel mutations of the S protein, including 2 other mutations in the RBD that are of particular concern namely N501Y which increases af-finity for ACE2 receptor, and E484K which is considered an escape mutation, as it po-tentially reduces antibody neutralization sensitivity, thereby evading the immune system which is of greatest concern (Rauseo AM, O'Halloran JA. JACC Basic Transl Sci. 2021;6(3):305-308). New and more transmissible variants, such as the B.1.617 variant (designated by the WHO as Variants of Concern) contains has two RBD mutations name-ly E484Q and L452R, known to be associated with increased infectivity and immune es-cape along with D614G mutation. (Chatterjee P. BMJ. 2021;373: n978, Vaidyanathan G Nature. 2021;593(7859):321-322, Winger A, Caspari T. Viruses. 2021;13(6):1002).
Variants of concern might be associated with changes in both morbidity and mortality (Darby AC, Hiscox JA. BMJ. 2021;372:n771). Poor clinical outcomes might be due high viral loads in infected individuals, altered transmission dynamics, or suppression of the host immune response (Darby AC, Hiscox JA. BMJ. 2021;372:n771). Newer SARS-CoV-2 variants of concern will continue to emerge as the pandemic progresses which would not only exacerbate already crippling outbreaks but also reduce the efficacy of some vaccines, cause increased rates of reinfections and prolong the pandemic (Grubaugh ND, Hodcroft EB, Fauver JR, Phelan AL, Cevik M. Cell. 2021;184(5):1127-1132).
The Nucleocapsid (N) Protein has multiple functions such as nucleocapsid formation, signal transduction virus budding RNA replication and mRNA transcription (Dutta NK, Mazumdar K, Gordy JT. J Virol. 2020;94(13):e00647-20). The N Protein is the most abundant protein in coronavirus, highly conserved (N gene is more conserved and stable, with 90% amino acid homology and has fewer mutations over time), highly immunogen-ic, and are abundantly expressed throughout the course of the infection (Zhang J, Zeng H, Gu J et al. Vaccines (Basel). 2020;8(2):153, Dutta NK, Mazumdar K, Gordy JT. J Vi-rol. 2020;94(13):e00647-20, Oliveira SC, de Magalhães MTQ, Homan EJ. Front Immu-nol. 2020 Oct 28;11:587615, Cong Y, Ulasli M, Schepers H, et al. J Virol. 2020;94(4):e01925-19). It is a representative antigen for T-cell mediated response in-cluding T-cell proliferation and cytotoxic activity (Zhang J, Zeng H, Gu J et al. Vaccines (Basel). 2020;8(2):153). As per Ahlen et al, N and/or other structural proteins in addition to spike protein sequences adds the benefits of increasing immunogenicity and ensures a more future-proof vaccine design (Ahlén G, Frelin L, Nikouyan N, et al. J Virol. 2020;94(18):e01279-20). Also, the highly conserved N protein across coronavirus spe-cies makes it a potential target for a universal coronavirus vaccine (Liu YD, Chi WY, Su JH et al. J Biomed Sci. 2020; 27: 104).
Recent studies have shown that antibodies against the N protein are more sensitive indi-cators than anti–S protein antibodies for the detection of early SARS-CoV-2 infection (Burbelo PD, Riedo FX, Morishima C et al. J Infect Dis. 2020 Jun 29;222(2):206-213). The bioinformatics analysis have predicted the major B and T cell epitopes on the SARS-CoV-2 N protein by comparing to other coronaviruses that infect humans (Oliveira SC, de Magalhães MTQ, Homan EJ. Front Immunol. 2020 Oct 28;11:587615). The N protein of SARS-CoV-2 is believed to induce T cell responses. Reports have demonstrated that a DNA vaccine encoding SARS-CoV N protein induce T cell prolif-eration and cytotoxic T cell responses in rhesus monkeys, and mice (Zhao P, Cao J, Zhao LJ, et al. Virology. 2005;331(1):128-135, Gao W, Tamin A, Soloff A, D'Aiuto L et al. Lancet. 2003 Dec 6;362(9399):1895-6). However, in vivo protection conferred by vac-cines containing the N protein has not yet been experimentally validated.
Therefore, a vaccine with the high immunogenicity against SARS-Cov2 and effective against VOC will be the ultimate goal one should achieve to eradicate COVID-19.
Study proposed to achieve this goal by combining the S1 subunit protein with N protein in a recombinant vaccine form. Morespecificaly, Pichia pastoris based high yielding production of these (S1 and N) recombinant proteins. Although there is no report on this particular combination vaccine in Pichia based expression system, Hong et al., have cor-roborated our hypothesis by showing the combination of RBD/P2 and N increase T-cell activation along with TH1-prone responses result faster viral clearance in non-human primates (NHP) (Hong SH, Oh H, Park YW et al. Sci Adv. 2021 May 28;7(22): eabg7156).
In this study, a Bi-antigenic composition comprising S1 antigen and N antigen designed and prepared and expressed in an yeast based expression system , preferably Pichia pas-toris. The invention also provides a stable composition of the Bi-antigenic vaccine with a non-antigenic component.
However, mere combining immunogenic antigens does not ensure a stable and immuno-genic preparation as all the antigens are of different nature e.g. S1 antigen and N antigen .
none reveal approach of the prior art talks about combination of Bi-antigenic vaccines expression in Pichia pastoris and its stable composition with adjuvant.
The present invention provides a liquid Bi-antigenic vaccine formulation (s) obtained as a single dose and multidose for Individual and mass vaccination. The sealed vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any preservative whereas multidose formulation contained Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0.
In the present invention, a stable Bi-antigenic vaccine was designed against The S1 sub-unit of S protein , Nucleocapsid Protein of SARS–CoV-2
Proposed vaccine is efficient in eliciting primary, secondary and tertiary immune re-sponses and therefore, can target on the broader Population coverage against the SARS–CoV-2 virus.
The aim of the present invention is to develop a fully liquid Bi-antigenic adjuvant based safe, effective and affordable vaccine against SARS CoV-2 virus to provide a broad spectrum mass protection. Again, proposed Bi-antigenic vaccine has short term and long-term protection against the SARS-CoV-2. The present Bi-antigenic vaccine is de-signed to be effective against variants and mutations of the SARS-CoV-2 virus.
OBJECTS OF THE INVENTION
The object of the present invention is to provide a process of producing a stable Bi-antigenic vaccine against SARS CoV-2 virus.
Another object of the present invention is to provide a process of producing yeast based Bi-antigenic vaccine comprising of S 1 and N antigen for the prevention of SARS CoV2, wherein the yeast is Pichia pastoris.
Another object of the present invention is to provide a composition for a stable adjuvant based Bi-antigenic vaccine comprising S1 antigen , N antigen and non-antigenic compo-nent(s) wherein the adjuvant is alum salt ,preferably Aluminum phosphate.
Another object of the present invention is to provide a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen , N antigen and non-antigenic component(s), wherein the vaccine remains stable for longer duration.
Another object of the present invention is to provide a provide a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen , N antigen and non-antigenic component(s) gives short term and long term protection .
Another object of the present invention is to provide a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent(s) effective against variants and mutations of the SARS CoV2 virus.
Yet another object of the present invention is to provide a fully liquid Bi-antigenic vac-cine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi - dose presentation.
SUMMARY OF THE INVENTION
In a general aspect the present invention provides a process of producing a stable Bi-antigenic vaccine against SARS CoV-2 virus.
In an embodiment, the present invention provides a process of producing a yeast based Bi-antigenic vaccine comprising of S1 and N antigen for the prevention of infection against SARS CoV2 wherein the yeast is Pichia Pastoris.
In an embodiment, the present invention provides a composition for a stable adjuvant based Bi-antigenic anti- SARS CoV-2 vaccine comprising S1 antigen ,N antigen and non-antigenic component(s) wherein the adjuvant is alum salt ,preferably Aluminum phosphate.
In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent(s), wherein the vaccine remains stable for longer duration.
In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen , N antigen and non-antigenic component (s) gives short term and long term protection.
In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent (s) effective against variants and mutations of the SARS CoV2 virus.
In another embodiment, the present invention is to provide a fully liquid Bi-antigenic vaccine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi- dose presentation.
BRIEF DESCRIPTION OF ACCOMPANYING FIGURES:
Fig 1: Restriction Digestion Map of protein subunit 1(S1)
Fig 2: pPIC3.5-S protein subunit 1 map
Fig 3: PCR verification results of SARS-CoV-2spike(S) protein subunit 1
Fig 4: SDS-PAGE to detect protein secretion and expression of SARS-CoV-2spike(S)
protein subunit 1
Fig 5: SDS-PAGE to detect protein secretion and expression SARS-CoV-2spike(S) pro-tein subunit 1
Fig 6: Western Blot to detect protein secretion and expression of SARS-CoV 2spike(S) protein subunit 1
Fig 7: Western Blot to detect protein secretion and expression
Fig No 8: PCR verification results (pPIC3.5-N protein)
Fig No 9: SDS-PAGE to detect N protein secretion and expression
Fig No 10: Western Blot to detect protein secretion and expression
Fig A: Process flow for producing Bi-antigenic vaccine
BRIEF DESCRIPTION OF ACCOMPANYING SEQUENCE LISTINGS:
SEQ ID NO: 1: Amino acid sequence of SARS-CoV-2spike(S) protein subunit 1
SEQ ID NO: 3: Amino acid sequence of SARS-CoV-2 N protein
DETAILED DESCRIPTION OF THE INVENTION
The following is a detailed description of some of the embodiments and explanation of the present invention with some examples thereof. The embodiments are in such detail as to clearly communicate the disclosure. However, the amount of detail offered is not intended to limit the anticipated variations of embodiments; on the contrary, the inten-tion is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims.
Unless the context requires otherwise, throughout the specification which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense that is as “including, but not limited to.”
Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable man-ner in one or more embodiments.
As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and/or” unless the content clearly dictates otherwise.
In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description are approximations that can vary depending upon the de-sired properties sought to be obtained by a particular embodiment. In some embodi-ments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific exam-ples are reported as precisely as practicable.
The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.
All process described herein can be performed in any suitable order unless otherwise in-dicated herein or otherwise clearly contradicted by context. The use of any and all ex-amples, or exemplary language (e.g. “such as”) provided with respect to certain embod-iments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specifi-cation should be construed as indicating any non-claimed element essential to the prac-tice of the invention.
The headings and abstract of the invention provided herein are for convenience only and do not interpret the scope or meaning of the embodiments.
The following discussion provides many example embodiments of the inventive subject matter. Although each embodiment represents a single combination of inventive ele-ments, the inventive subject matter is considered to include all possible combinations of the disclosed elements. Thus if one embodiment comprises elements A, B, and C, and a second embodiment comprises elements B and D, then the inventive subject matter is also considered to include other remaining combinations of A, B, C, or D, even if not explicitly disclosed.
Various terms as used herein are shown below. To the extent a term used in a claim is not defined below, it should be given the broadest definition persons in the pertinent art have given that term as reflected in printed publications and issued patents at the time of filing.
The term ‘fully liquid’ as used herein refers to the state of the vaccine, which is in the liquid form ready to be administered, wherein all the components of the vaccine are pro-vided in liquid state and there is no component of the vaccine that is provided in lyophi-lized or any other form so that it has to be mixed with the other components of the vac-cine before administering it to a subject.
The term mutation or mutations’ as used herein is a an organism or a new genetic char-acter arising or resulting from an instance of mutation, which is generally an alteration of the DNA sequence of the genome or chromosome of an organism. It is a characteristic that would not be observed naturally in a specimen. Again the term “variants” or "genet-ic variants" is used to describe a subtype of a microorganism that is genetically distinct from a main strain, but not sufficiently different to be termed a distinct strain.
The genetic material of all viruses is encoded in either DNA or RNA; one interesting feature of RNA viruses is that they change much more rapidly than DNA viruses. Every time they make a copy of their genes they make one or a few mistakes. This is expected to occur many times within the body of an individual who is infected with SARS-CoV-2
The current vaccines induce the immune system to produce antibodies that recognize and target the spike protein on the virus, which is essential for invading human cells. Scien-tists have observed the accumulation of multiple changes in the spike protein in the South African variant.
These changes allows SARS-CoV-2, to attach more tightly to the ACE2 receptor and en-ter human cells more efficiently Those alterations could enable the virus to infect cells more easily and enhance its transmissibility.
The term ‘adjuvant’ as used herein refers to the non-antigenic component of the vaccine that enhances the immune response of the antigens comprised in the vaccine by facilitat-ing the contact between the antigen and the immune system. The adjuvant causes pro-longed immune responses against the antigens.
The term ‘coupling or adsorbing’ as used herein refers to any form of physical bonding between the antigen and the adjuvant components of the vaccine.
The term ‘stable’ as used herein means that each of the antigens of the vaccine composi-tion has a potency/immunogenicity more than that set as the normal acceptance limit, after the incubation of the vaccine at 30o C for at least 1 month to 6 months.
The term ‘immunologically active’ as used herein means when administered, the Bi-antigenic vaccine of the present invention is able to elicit antibodies against each of the antigens of the said combination so as to protect the vaccine against the respective dis-eases or infections.
Reference will now be made in detail to the exemplary embodiments of the present dis-closure, examples of which are illustrated in the accompanying drawings. Wherever pos-sible, the same reference numbers are used in the drawings and the description to refer to the same or like parts.
The present invention relates to a process of producing a stable Bi-antigenic vaccine against SARS CoV-2 virus.
In an embodiment, the present invention provides a process of producing a yeast based Bi-antigenic vaccine comprising of S1 and N antigen for the prevention of infection against SARS CoV2 wherein the yeast is Pichia Pastoris.
In an embodiment, the present invention provides a composition for a stable adjuvant based Bi-antigenic anti- SARS CoV2 vaccine comprising S1 antigen, N antigen and non-antigenic component(s) wherein the adjuvant is alum salt ,preferably Aluminum phos-phate.
In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent(s), wherein the vaccine remains stable for longer duration.
In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent (s) gives short term and long term protection.
In another embodiment, the present invention provides a fully liquid adjuvant based Bi-antigenic vaccine composition comprising S1 antigen, N antigen and non-antigenic com-ponent (s) effective against variants and mutations of the SARS CoV2 virus.
Yet another object of the present invention is to provide a fully liquid Bi-antigenic vac-cine composition comprising of S1 antigen, N antigen and non-antigenic component is in single and multi -dose presentation.
Recombinant Bi-Antigen SARS-CoV-2 S1 Subunit and N Protein Vaccine : Mecha-nism of Action
Following intramuscular injection of the vaccine, SARS-CoV-2 viral antigens are en-gulfed by the specialized “Antigen Presenting Cells” called the Dendritic Cells (DCs). DCs present antigen to naive T cells, which become activated and differentiated into ef-fector cells to form cytotoxic T lymphocytes (CD8+) or Helper T cells (CD4+). Helper T Cells stimulate B-Cells to differentiate into Plasma Cells which produce antibodies. These antibodies prevent the virus from infecting other cells as well as mark the virus for destruction. Cytotoxic T Lymphocytes identify and destroy the virus infected cells. After the primary immune response, both memory B and T cells are formed which after can immediately mount an immune response when same SARS-CoV-2 viral antigen en-ters the body and thereby prevents subsequent infection.
In an embodiment, the composition of the present invention each of the antigens is pre-sent in an amount so as to elicit a protective immune response against the said antigen. It was surprisingly found by the inventors that when the antigens and conjugate were in-cluded in the composition in specific quantities, the composition for adjuvant based Bi-antigenic vaccine of the present invention not only they elicit immune response against the said antigen but the composition also remains stable.
In an embodiment, S1 antigen is present in the range of 5-20 µg, preferably 10 µg per dose of 0.5 ml of the composition.
In an embodiment, N antigen is present in the range of 5-20 µg , preferably 10 µg per dose of 0.5ml of the composition.
In an embodiment, composition of the present invention for Bi-antigenic vaccine com-prises overages for all the components of vaccine S1 antigen and N antigen which can be in the concentration of as low as 5%.
In an embodiment, composition of the present invention for Bi-antigenic vaccine com-prises overages for all the components of vaccine S1 antigen and N antigen which can be in the concentration of as high as 25%.
The composition of the present invention can further comprise one or more non-antigenic component(s) that are pharmaceutically acceptable excipients selected from but not limited to adjuvant, preservative, tonicity agent, pH modifier, and buffer.
Any adjuvant that helps to stimulate a stronger immune response can be included. In an embodiment, the composition of the present invention includes aluminum based adju-vant such as aluminium phosphate or aluminium hydroxide. In one embodiment, the aluminum based adjuvant is aluminum phosphate.
The composition of the present invention can include any suitable buffer to control the osmotic pressure gradient of the vaccine composition. In an embodiment the composi-tion of the present invention includes a tonicity modifying agent. The tonicity agent that can be incorporated in the composition is selected from but not limiting to a group of salt including NaCl, MgCl2, KCl, and CaCl2; sugar including dextrose, mannitol, and lac-tose; amino acid including arginine, glycine, and histidine; polyol including glycerol and sorbitol; or mixture thereof. In an embodiment, a physiological salt such as sodium salt is used in the composition of the present invention. In one embodiment, sodium chloride (NaCl) is included in the composition of the present invention,
The composition of the present invention can include any suitable pH modifier to adjust the pH of the vaccine composition selected from but not limiting to sodium hydroxide, hydrochloric acid or combination thereof. The pH modifier in included in sufficient quantity so as to adjust the pH of the composition between pH 6 – 7.
The composition of the present invention can include any suitable buffer selected from but not limiting to sodium phosphate, potassium phosphate, citrate buffer or combina-tions thereof.
In an embodiment, the present invention provides a liquid Bi-antigenic vaccine formula-tions obtained as mentioned above, formulated, filled, stoppered, sealed and labeled in appropriate single dose and multidose containers for individual as well as mass vaccina-tion. The labeled vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any preservative whereas multidose formulation contained Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0.
In an embodiment, the adjuvant based Bi-antigenic vaccine comprises S1 antigen, N an-tigen are adsorbed on adjuvant aluminum phosphate.
The composition can include a suitable preservative to avoid the contamination with harmful microbes. The preservative that can be included in the composition is 2-phenoxyethanol (2-POE), also known as 1-hydroxy 2-phenoxyethane, 2-hydroxyethyl phenyl ether or by other synonyms. The safety profile of 2-phenoxy ethanol is better than that of mercurial preservatives such as thiomersal and hence such non-mercurial pre-servative is preferred over mercurial preservative.
In an embodiment, the preservative is 2-phenoxyethanol present in an amount of about 5 mg/ml, (0.5% w/v) of the mg per 0.5 ml of the vaccine.
In another aspect the present invention provides a process for producing a fully liquid adjuvant based Bi-antigenic vaccine having composition comprising S1 antigen, N anti-gen and non-antigenic component(s).
In an embodiment, the present invention provides a process for producing a fully liquid adjuvant based Bi-antigenic vaccine comprising the composition of the present inven-tion, in which the process comprises the steps of:
A process of producing a fully liquid Bi-antigenic vaccine composition comprising the steps of:
a) adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Aluminum phosphate and blending,
b) adding at least 10 µg N-antigen adsorb on Alum salt preferably Alumi-num phosphate (with already absorbed S1 antigen) obtained in step (a) and mixing to obtain Bi-antigenic vaccine against SARS CoV 2 virus,
c) further, addition of physiological saline, stabilizer and non mercury preservative 2-phenoxyethanol (2-POE) at pH of about 6.0-7.0 (pref-erably 6.4-6.8) to the mixture of absorbed S1 antigen and N antigens on Alum salt Preferably Aluminum phosphate obtained in step (b) and blending,
d) further, mixing by stirring the composition at a speed of about 100-400 rpm (preferably at 200-300 rpm) for period of about 4-18 hrs (preferably 8-16 hrs).
In one embodiment the adsorption of antigens onto aluminum phosphate is carried out in the presence of physiological saline, stabilizer and non mercury preservative for exam-ple 2-phenoxyethanol (2-POE) and by mixing the antigens and aluminum phosphate for examples by stirring at speed of about 100-400 rpm (preferably 200-300 rpm) for about 1-25 hours (preferably 12-18 hrs).
In one specific embodiment the mixture of S1 antigen and N antigen adsorbed onto alu-minum phosphate is provided by adding S1 antigen and N antigen in a sequence to alu-minum phosphate followed by addition of physiological saline and preservative 2-phenoxyethanol (2-POE) at pH of about 6.0-7.0, mixing for example by stirring at speed of about 100-400 rpm for period of about 4-18 hrs.
In one embodiment, mixing as per steps adsorbed onto aluminum phosphate obtained is carried out for example by stirring at about 100-400 rpm for about 6-24 hrs.
In one embodiment, the sequence of adsorption of antigens S1 antigen and N antigen on aluminum phosphate is in chronological order.
In an embodiment, the fully liquid Bi-antigenic vaccine of the present invention com-prises per dose of 0.5ml, with 10 µg of each antigen.
In an embodiment, the fully liquid Bi-antigenic vaccine of the present invention com-prises overages for all the components of vaccine, S1 antigen N antigen which can be in the concentration of as low as 5%.
In an embodiment, the fully liquid Bi-antigenic vaccine of the present invention com-prises overages for all the components of vaccine S1 antigen and N antigen which can be in the concentration of as high as 25%.
In some of the embodiments the content of adjuvant aluminum (Al+3) included is 1.25 mg per 0.5 ml of vaccine, preferably 1 mg per 0.5 ml of vaccine, 0.8 mg per 0.5 ml of vaccine and, preferably 0.5 mg per 0.5 ml.
In some of the embodiments the preservative used is preferably but not limited to non mercury agent 2-phenoxyethanol in the quantity of 5mg/ml of the vaccine.
Without being bound to any theory it is believed that the unexpected ability of the Bi-antigenic vaccine of the present invention induce immunogenicity, maintenance of the right form of the antigens and to remain stable due to one or more reasons of the compo-sition that is the combination of particular antigens, the way the composition has been formulated , which may include the sequence of addition of the antigens, the use of spe-cific adjuvants for certain antigens, the use of various parameters including agitation, temperature, pH and time duration.
In an aspect the present invention provides a process of inducing immunological re-sponse to a subject by administering the multivalent vaccine of the present invention.
In an embodiment, the present invention provides a process of immunological response to a subject by administering through parenteral route for example by injecting an Bi-antigenic vaccine of the present invention comprising immunological active amount of Bi-antigenic vaccine of the present invention comprises overages for all the components of vaccine , S1 antigen and N antigen.
The present invention provides a fully liquid stable adjuvant based Bi-antigenic vaccine that comprises a variety of the vaccine antigens that are suitable for the prevention and treatment of multiple disease states that meet the criterion for the seroprotection for each of the said vaccine components.
The advantages of the present invention include a Bi-antigenic vaccine which is fully liquid and hence ready to be administered and does not need to be reconstituted at the time of administration thus aiding ease to the practitioner. The Bi-antigenic vaccine of the present invention can confer protection against SARS-CoV2 infections in a safe and efficacious manner. The Bi-antigenic vaccine of the present invention is capable of providing immunogenicity to various diseases and infections without any interference of any of the antigen that is present in the vaccine. Thus, a single shot and/or a booster dose of vaccine would confer immunogenicity against various diseases and infections, making the vaccine more patients compliant. Since a single shot would afford immunity against a number of infections and diseases, the cost of vaccination would be reduced. The vac-cine of the present invention would be beneficial in the sense that it will reduce the number of visits to the vaccination center and also the number of shots to be given for number of different diseases and infections. This aspect of the present invention would make it more useful and advantageous especially with the older and younger population who need to be vaccinated to acquire immunity to a large number of infections and dis-eases. Thus, the present invention provides a vaccine that is more advantageous in terms of cost effectiveness as well as patient friendly.
While the foregoing description discloses various embodiments of the disclosure, other and further embodiments of the invention may be devised without departing from the basic scope of the disclosure. The invention is not limited to the described embodiments, versions or examples, the invention is described hereinafter, with reference to the fol-lowing examples, which are to enable a person having ordinary skill in the art to make and use the invention when combined with information and knowledge available to the person having ordinary skill in the art, such examples are illustrative only and should not be construed to the limit of the scope of present invention.
EXAMPLES
The present disclosure is further explained in the form of following examples. However, it is to be understood that the foregoing examples are merely illustrative and are not to be taken as limitations upon the scope of the invention. Various changes and modifica-tions to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications may be made without departing from the scope of the inven-tion.
Example 1:
Cloning and expression
1)SARS-CoV-2 spike (S) protein subunit1 expression in Pichia pastoris GS115 via pPIC3.5
The plasmid was linearized with restriction enzyme pmeI. Then transformed into the competent cell of Pichia GS115 by electroporation as in Fig 1, Fig 2 and amino acid Seq of S1 as Seq ID No:1(GenBank: MN908947.3. NCBI)
. Inoculated onto MD plates, and cultured upside-down at 30 °C for 2-3 days to observe the growth. Positive clones ware picked and performed PCR with S-T-F and S-T-F pri-mers as in Fig 3.
S-T-F:ATGGTTAACTTGACTACTAGAACT
S-T-F:AACGGATCTAGCTCTTCTTGGAGA
1.1) Expression validation
5 verified recombinant clones were selected and inoculated into BMGY medium, and cultured at 30? until OD600=4~6 (log-phase growth). Replace with BMMY medium for induction, and put the resuspended bacterial solution at 30? and 220rpm. Add meth-anol with a final concentration of (0.5%) every 24 h (induction for 5 days).After induc-tion, centrifuge at 1500-3000g for 5 minutes to collect cells. After removing the superna-tant, immediately sonicate the cells. Use SDS-PAGE (as in Fig no 4 and Fig no 5) and Western Blot to detect protein secretion and expression as in Fig :6.
2) SARS-CoV-2 N Protein expression in Pichia pastoris GS115 via pPIC3.5
SARS-CoV-2 N Protein (419aa) expression in P. pastoris GS115 via pPIC3.5. The plas-mid was linearized with restriction enzyme pmeI separately and amino acid sequence of N as Seq ID No:3 (GenBank: MN908947.3. NCBI) as in Fig :7 .Then transformed into the competent cell of Pichia GS115 by electroporation. Inoculated onto MD plates, and cultured upside-down at 30 °C for 2-3 days to observe the growth. Positive clones ware picked and performed PCR with 5AOX and 3AOX primers separately as in Fig : 8
5AOX:GACTGGTTCCAATTGACAAGC
3AOX:GCAAATGGCATTCTGACATCC
2.1. Expression validation
5 verified recombinant clones were selected and inoculated into 2mL YPD medium, and cultured at 30? until OD600=4~6 (log-phase growth). Inoculate 1% volume into 10 mL BMGY medium and cultivate at 30°C, 200 rpm. When the OD600 is 2-6, centrifuge the bacteria with a sterile centrifuge tube. Discard BMGY medium, induce expression with 20 mL BMMY medium at 30°C, add methanol with a final concentration of (0.5%) every 24 h, and take samples (induction for 5 days). After induction, centrifuge at 1500-3000g for 5 minutes to collect cells. After removing the supernatant, immediately sonicate the cells. Use SDS-PAGE and Western Blot to detect protein secretion and expression as in Fig 9 and Fig: 10 respectively.
2.2. Expression validation (Western Blot)
(1) Prepare bacterial lysates, resolving gel (8-12%) and stacking gel (5%). Load 5 µl bacterial lysates into the wells along with molecular weight markers. Run the resolving gel for 2 h at 80 V. Run the stacking gel for 2 h at 60 V. (2) Activate PVDF with metha-nol for 1 min and rinse with Tris-Glycine transfer buffer (containing 5% methanol) be-fore preparing the stack. Place the SDS-PAGE gel in Tris-Glycine transfer buffer for 30 min. Transfer in a coldroom at a constant voltage of 100 V for 2 h. (3) Block the mem-brane for 1 h at room temperature using blocking buffer TBST (containing 3%BSA). Wash the membrane in three washes of TBST, 5 min each. (4) Dissolve the primary an-tibody in T-TBS (containing 3% BSA) in a certain proportion. Incubate overnight in the primary antibody solution at 4°C. Wash the membrane in three washes of TBST, 5 min each. (5) Dissolve the secondary antibody in T-TBS (containing 3% BSA) in a certain proportion. Incubate overnight in the primary antibody solution at 4°C. Wash the mem-brane in three washes of TBST, 5 min each. (6) Using SuperSignal® West Dura Extend-ed Duration Substrate, prepare 1ml ECL working solution of chemiluminescent substrate based upon manufacture instruction. Incubate the blot with the working solution for 1 min. Remove the blot from working solution and drain excess ECL reagent. Place the blot in clear plastic wrap and remove bubbles by rolling with blot roller or glass pipette. Image the blot using X-ray film.
10×YNB (yeast nitrogen base) - Dissolve 13.4g YNB in 100ml water, filter sterilize or autoclave.
500×Biotin (0.02%)- Dissolve 20mg of biotin in 100ml water, filter sterilize BMGY me-dium composition 1% yeast extract, 2% peptone, 1% glycerol, 4×10-5 % biotin, 1.34%YNB, and 0.1 M potassium phosphate, pH 6.0 .
BMMY medium composition - 1% yeast extract, 2% peptone, 4×10-5% biotin, 1.34%YNB, and 0.1 M potassium phosphate, pH 6.0.
Example 2
Process for producing fully liquid bi-antigenic vaccine (S1 and N) against SARS-CoV-2 in details
Composition and process for producing Bi-antigenic vaccine
This recombinant vaccine shall be produced using Pichia pastoris yeast into which the Bi-antigenic of SARS-CoV-2 recombinant protein has been transformed and expressed. The yeast cells are grown in fermentor to produce the recombinant proteins (S1 and N) of SARS-CoV-2. The expressed recombinant proteins will be purified by lysing the yeast cells and separating proteins by biochemical and biophysical techniques as shown in process Flow Diagram in Fig A. This process does not involve handling of disease caus-ing organism hence process is safe and chances of infections are less. .
Fig A- Process flow for producing Bi-antigenic antigen vaccine
Example 3
Bulk Production Process:
The frozen working seed vial is thawed and grown in required amount of medium by in-cubating at required temperature for desired time. The seed is propagated further in shake flasks and incubated at required temperature for desired time. Once getting desired levels of growth and passing the microscopic observations, the culture is inoculated into the fermentor.
Fermentation cycle consists of 4 distinct phases: Glycerol batch phase (GB), Glycerol Fed-batch (GFB), Starvation phase and Methanol Induction Phase (MIP).After attaining the required cell mass, Methanol feed has to be supplied to initiate the protein expres-sion. After attaining fermentation to desired level, cells are harvested and washed with buffers.
Cells are then subjected to disruption by biophysical techniques to get the proteins re-leased. The crude protein then subjected to various purification process including poly-mer and Salt treatment, primary purification followed by secondary purification includ-ing Centrifugation, Chromatography purification, Ultra filtration TFF, Ultra Centrifuga-tion and Salt treatment to achieve desired level of purity. The purified antigen is filter sterilized and stored till its next use of formulation of vaccine as mentioned in Fig-A.
Example 4
Formulation and Fill Finish process
Purified Bulk antigen is formulated into desired doses form using appropriate buffer, Aluminium compound adjuvant and suitable preservative. Formulation activity is per-formed at required temperature for desired time. Once tested and approved, formulated vaccine is filled of desired dose volume.
The basic manufacturing path and most of the steps to produce all four antigens (S1and N) remain same with variations in their fermentation strategies and purification parame-ters such as chromatographic purification and centrifugation.
Example 5
Process for producing fully liquid Bi-antigenic adjuvant based vaccine:
S1 antigen was added to Aluminum phosphate aseptically. The mixture was stirred gen-tly at 100-400 rpm (preferably 200-300 rpm) for 2-4 hrs followed by addition of N anti-gen at constant stirring of 100-400 rpm (preferably 200-300 rpm). S1 antigen and N an-tigen are added during constant stirring at 100-400 rpm (preferably 200-300 rpm) at an interval of 2-4 hrs. Once the blending part completed addition of isotonic sodium chlo-ride solution, suitable stabilizer and preservative 2-Phenoxyethanol (2-POE) at pH rang-ing between 6.0 -7.0 (preferably 6.4-6.8) in a sterile and uniform suspension.
The Bi-antigenic formulation comprising S1 antigen and N antigen adsorbed on adjuvant alum salt preferably aluminum phosphate to provide fully liquid Bi-antigenic vaccine composition.
The fully liquid Bi-antigenic vaccine formulation obtained as mentioned above, formu-lated, filled, stoppered, sealed and labeled in appropriate single-dose and multi - dose containers for individual as well as mass vaccination. The labeled vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any pre-servative whereas multi- dose formulation presentation contained suitable stabilizer and 2- Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0.
Although the preferred embodiments of the present invention and their respective varia-tions have been described, people having ordinary skills in the art would envision vari-ous modifications of those embodiments. Accordingly, the present invention should not be limited to precise forms and manners in the above disclosure and description but should simply be taken by way of examples. Thus, the present invention can be varied and modified without departing the true scope and spirit thereof as defined in the ap-pended claims.
| # | Name | Date |
|---|---|---|
| 1 | 202123032636-STATEMENT OF UNDERTAKING (FORM 3) [20-07-2021(online)].pdf | 2021-07-20 |
| 2 | 202123032636-SEQUENCE LISTING(PDF) [20-07-2021(online)].pdf | 2021-07-20 |
| 3 | 202123032636-SEQUENCE LISTING [20-07-2021(online)].txt | 2021-07-20 |
| 4 | 202123032636-REQUEST FOR EXAMINATION (FORM-18) [20-07-2021(online)].pdf | 2021-07-20 |
| 5 | 202123032636-POWER OF AUTHORITY [20-07-2021(online)].pdf | 2021-07-20 |
| 6 | 202123032636-FORM FOR SMALL ENTITY(FORM-28) [20-07-2021(online)].pdf | 2021-07-20 |
| 7 | 202123032636-FORM FOR SMALL ENTITY [20-07-2021(online)].pdf | 2021-07-20 |
| 8 | 202123032636-FORM 18 [20-07-2021(online)].pdf | 2021-07-20 |
| 9 | 202123032636-FORM 1 [20-07-2021(online)].pdf | 2021-07-20 |
| 10 | 202123032636-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [20-07-2021(online)].pdf | 2021-07-20 |
| 11 | 202123032636-EVIDENCE FOR REGISTRATION UNDER SSI [20-07-2021(online)].pdf | 2021-07-20 |
| 12 | 202123032636-DRAWINGS [20-07-2021(online)].pdf | 2021-07-20 |
| 13 | 202123032636-DECLARATION OF INVENTORSHIP (FORM 5) [20-07-2021(online)].pdf | 2021-07-20 |
| 14 | 202123032636-COMPLETE SPECIFICATION [20-07-2021(online)].pdf | 2021-07-20 |
| 15 | Abstract1.jpg | 2022-02-11 |