Abstract: The present invention relates to efficient constitutive expression of rHGH in Pichia pastoris using a GAP promoter, yielding around 10-300 mg/L extracellularly in 24-72 hours of fermentation.
1. An isolated nucleic acid construct comprising: a. a nucleic acid sequence encoding a fusion polypeptide comprising: (1) a signal sequence; (2) recombinant human growth hormone (rHGH); b. a promoter sequence that is constitutively active in Pichia pastoris, wherein expression of the fusion polypeptide is driven by the promoter sequence.
2. The nucleic acid construct of claim 1, wherein the signal sequence is cleavable from the fusion polypeptide by an endogenous Pichia pastoris protein. polypeptide to the exterior of a Pichia pastoris cell.
4. The construct of claim 1, wherein the signal sequence comprises S. cerevisiae alpha mating factor.
5. The construct of claim 1 , wherein the promoter comprises a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter.
6. The construct of claim 1, wherein the signal sequence and the rhGH are functionally linked such that during a process of transcription and translation in a Pichia pastoris host cell, biologically active rHGH polypeptide is secreted into a culture medium.
7. The construct of claim 1, further comprising at least one selectable marker.
8. A pGAPZaA plasmid comprising the nucleic acid construct of claim 1.
9. The plasmid of claim 8, wherein the signal sequence comprises S. cerevisiae alpha mating factor, and wherein the promoter comprises a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter.
10. The construct of claim 1, wherein the signal sequence comprises S. cerevisiae alpha mating factor, wherein the promoter comprises a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter, and wherein the signal sequence and the rHGH are functionally linked such that during a process of transcription and translation in a Pichia pastoris host cell, biologically active rHGH polypeptide is secreted into a culture medium.
11. A Pichia pastoris cell comprising the construct of claim 1 or 10.
12. A Pichia pastoris cell comprising multiple copies of the construct of claim 1 or 10. 13.. A SMD1168H Pichia pastoris cell comprising the construct of claim 1 or 10.
14. A SMD1168H Pichia pastoris cell comprising one or more copies of the plasmid of claim 8 or 9.
15. The Pichia pastoris cell of any one of claims 11-14, wherein a culture of the cells can produce about 100-200 milligrams of rHGH per liter of media in about 24-72 hours of fermentation.
16. A method for producing recombinant human growth hormone (rHGH) polypeptide, the method comprising: culturing the Pichia pastoris cells of any one of claims 11-14 under fermenting conditions, wherein the rHGH polypeptide is expressed and secreted into the culture medium.
17. The method of claim 16, wherein culturing comprises fed batch fermentation.
18. The method of claim 17, wherein the fermentation is carried out in a medium comprising yeast extract, Soytone and dextrose.
19. The method of claim 17, wherein the fermentation is carried out in a medium comprising Yeast extract 1.5%. Soytone 3.0%, dextrose 10% and wherein the fed batch fermentation process is supplemented with 50% dextrose fed at 10 grams per liter every hour.
20. The method of claim 16, wherein the pH of the medium is higher than 5.
21. The method of claim 16, wherein the concentration of rHGH polypeptide in the culture medium is about 100-200 milligrams per liter when the OD6oo value of the Pichia pastoris culture is between 100 and 150 milligrams per liter.
22. The method of claim 16, wherein the concentration of rHGH polypeptide in the culture medium is about 100-200 milligrams per liter of rHGH after about 24—72 hours of culturing under fermenting conditions.
23. The method of claim 22, wherein the concentration of rHGH polypeptide in the culture medium is at least 100 milligrams per liter after about 24-72 hours of culturing under fermenting conditions.
24. The method of claim 16, wherein the concentration of rHGH polypeptide in the culture medium is at least 100 milligrams per liter after about 24hours of culturing under fermenting conditions.
25. The method of claim 16, wherein the cell density during fermentation is less than 200 OD at 600nm.
26. A method for purifying rhGH polypeptide produced by the method of any one of claims 16-20, wherein the method comprises: a. separating the cells from the medium; b. concentrating the medium of step (a); c. processing the concentrated medium of step (b) serially through at least four different chromatography steps comprising (1) gel permeation chromatography; (2) anion exchange chromatography; (3) hydrophobic interaction chromatography; and (4) size exclusion chromatography.
27. A pharmaceutical composition comprising: a. rHGH purified by the method of claim 26; b. histidine; c. Pluronic F68; e. mannitol.
28. A Pichia pastoris cell comprising one or more nucleic acid constructs comprising: a. a nucleic acid sequence encoding a fusion polypeptide comprising: (1) a signal sequence comprising 5. cerevisiae alpha mating factor; (2) recombinant human growth hormone (rHGH); b. a promoter sequence comprising a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter; wherein expression of the nucleic acid sequence encoding the fusion polypeptide is driven by the promoter sequence, and wherein the signal sequence and the rHGH are functionally linked such that after a process of transcription and translation in the Pichia pastoris cell, biologically active rHGH polypeptide is secreted into a culture medium.
29. A method for producing recombinant human growth hormone (rHGH) polypeptide, the method comprising: a. providing a Pichia pastoris cell comprising one or more nucleic acid constructs comprising: (!) a nucleic acid sequence encoding a fusion polypeptide comprising: (a) a signal sequence comprising S. cerevisiae alpha mating factor; (b) recombinant human growth hormone; (2) a promoter sequence comprising a gIyceraldehyde-3-phosphate dehydrogenase (GAP) promoter; wherein expression of the nucleic acid sequence encoding the fusion polypeptide is driven by the promoter sequence, and wherein the signal sequence and the rHGH are functionally linked such that after a process of transcription and translation in the Pichia pastoris cell, biologically active rHGH polypeptide is secreted into a culture medium; b. culturing the Pichia pastoris cell under fermenting conditions, during which the rHGH polypeptide is secreted into a culture medium; c. generating at least 100 milligrams per liter of the rHGH polypeptide in the culture medium after 24-72 hours of culturing under fermenting conditions.
30. The method of claim 29, wherein the method comprises generating at least 100 milligrams per liter of the rHGH polypeptide in the culture medium after 24 hours of culturing under fermenting conditions.
31. An isolated nucleic acid construct, a method for producing recombinant human growth hormone (rHGH) polypeptide, and its compositions as claimed above exemplified herein substantially in the examples and figures.
FORM 2
THE PATENTS ACT, 1970 (39 of 1970)
&
THE PATENT RULES , 2003
COMPLETE SPECIFICATION
(See Section 10; rule 13)
PROCESS FOR RECOMBINANT HUMAN GROWTH HORMONE
RELIANCE LIFE SCIENCES PVT.LTD an Indian Company having its Registered Office at Dhirubhai Ambani Life Sciences Centre, R-282, TTC Area of MIDC, Thane Belapur Road, Rabale, Navi Mumbai - 400 701 Maharashtra India.
The following specification particularly describes and ascertains the nature of this invention and the manner in which it is performed:-
CROSS-REFERENCE TO RELATED PATENT APPLICATIONS:
The present application claims benefit of the filing date of Indian Provisional Patent Application No. 2336/MUM/2009 filed October 7, 2009, which is entirely incorporated herein by reference.
TECHNICAL FIELD:
The present invention relates to an efficient process for the recombinant production of human growth hormone (rHGH) for therapeutic use. In certain embodiments, the invention relates to expression of rHGH in a Pichia Pastoris (P. pastoris) expression system and efficient fermentation and purification resulting in high yield.
BACKGROUND
Human growth hormone (HGH or hGH) is a polypeptide produced by the anterior lobe of the human pituitary gland. HGH exhibits growth-promoting effects and metabolic effects on carbohydrate, fat, protein and bone metabolism. HGH stimulates protein synthesis and uptake of amino acids into cells, and induces lipolysis in adipose tissues. HGH exists in an 191 amino acid form, as well an 192 amino acid form. The 191 amino acid form differs from the 192 amino acid form in that it lacks the presence of a first N-terminal methionine amino acid. The 191 amino acid form is very stable.
Human growth hormone may be produced using recombinant technology. Recombinant human growth hormone (rHGH or rhGH) has been expressed in various
expression systems including E. coli, B. subtilis, S. cerevisiae, Pichia Pastoris and mammalian cells.
Certain literature mentions the expression of HGH in the methylotrophic yeast Pichia pastoris. Previous methods cloned rHGH in Pichia in an inducible expression system, which necessarily involved an inducible promoter, such as the methanol-inducible alcohol oxidase (AOX1) gene promoter. See, e.g., U.S. Pat. No. 6,342,375; Ecamilla et al., Biosynthesis and secretion of recombinant human growth hormone in Pichia Pastoris, Biotechnology letters, 22: 109-117 (2000); Calik et al, Expression system for
synthesis and purification of recombinant human growth hormone in Pichia pastor is and structural analysis by MALDI-Toff Mass spectrometry, Biotechnology Prog., 24(l):221-226 (2008); Chinese Pat. No. CN101139583; CHAI HUI LING (The thesis "Method development in assessing recombinant human growth hormone expression from Pichia pastoris ")
Previously rhGH was expressed in Pichia using inducible expression systems. Such inducible expression systems also required a fermentation process that was time consuming and expensive, and failed to result in higher levels of expression. The industry preferred inducible system is based on a methanol inducible AOX1 promoter. This expression system has certain advantages, such as good control of expression in a highly inducible system. The system involved a growth phase followed by production phases. As a result, the fermentation processes is time consuming, e.g., from 96 hours to 120 hours, and is expensive because of requirement of chemicals such as methanol for induction. In addition, since the fermentation is carried out under high biomass (O.D 600nm > 500), mass transfer of oxygen, etc. becomes difficult.
Thus, as far as Pichia is concerned, previous efforts have cloned HGH under an inducible conditions (AOX1 promoter system). Such inducible systems have so far yielded no more than 50 mg/L of rHGH. By contrast, the present invention uses a constitutive promoter, such as the GAP promoter, which is constitutively active and promotes expression in Pichia. Using expression systems and methods disclosed herein, Pichia clones transformed with a rHGH construct yield at least 100 mg/L in about 30 hours of Pichia growth under fermenting conditions. Clones of the present invention also yield at least 150 mg/1 of rHGH in 48 hours of Pichia growth under fermenting conditions. In addition, because the current system involves constitutive expression, it reduces overall fermentation time and therefore turnaround time. In one embodiment, fermentation is not done under high cell density. The commonly used expression system for Pichia is inducible system where in there are 2 steps first is attaining high cell density and second is inducing the expression of desired (cloned) gene with methanol. As a result the whole process runs for atleast 7 days. Since the expression system deployed in the current study is constitutive, growth phase as well as production phase is same which results in saving lot of time. Thus, problems of mass transfer and oxygen transfer do not arise; also resulting in high yield.
STATEMENT OF THE INVENTION:
The present invention provides an efficient process of producing recombinant human growth hormone in Pichia pastoris using a constitutively active promoter, such as a GAP promoter, resulting in extracellular expression yielding at least about 150 mg/L of rHGH under batch mode growth under fermentation. Likewise, Pichia clones transformed with rHGH constructs of the present invention yield at least 100 mg/L in about 30 hours of Pichia growth under fermenting conditions.
OBJECTIVES OF THE INVENTION:
It is the aim of the present invention to provide a highly efficient process for the preparation of recombinant human growth hormone.
It is the aim of the present invention to provide a constitutive expression of rHGH in Pichia using a GAP promoter.
It is the aim of the present invention to provide a process without the use of toxic chemicals for the induction of protein expression.
It is the aim of the present invention to provide decreased fermentation time.
It is the aim of the present invention to provide an efficient purification process for the preparation of rHGH.
It is the aim of the present invention to provide higher yields of rHGH.
SUMMARY OF INVENTION
The present invention provides an efficient constitutive expression of rHGH in Pichia pastoris using a constitutively active promoter, such as a GAP promoter, resulting in increased yield extracellularly, in less time.
In one embodiment, the present invention provides methods of cloning a nucleic acid encoding HGH (having 191 amino acids) in frame with an alpha mating factor signal sequence in order tcr obtain extracellular secretion of the protein. In one embodiment,
expression in a relevant construct is guided by a glyceraidehyde-3-phosphate dehydrogenase (GAP) promoter.
In one embodiment, the present invention uses Pichia pastoris for the constitutive expression. In one embodiment, the present invention uses Pichia pastoris SMD 1168H for transformation, for example by a plasmid comprising a relevant construct, resulting in a high number of stable Pichia clones expressing rHGH.
In one embodiment, the present invention provides a P. pastoris clone that produces about 100-300 mg/L rHGH in 24-72 hours extracellularly. In one embodiment, the present invention provides a yield extracellularly of about 175mg/L of rHGH under batch mode growth under fermenting conditions in about 48 hours. In other embodiments, Pichia clones transformed with rHGH constructs of the present invention yield at least 100 mg/L in about 30 hours of Pichia growth under fermenting conditions.
The fermentation was carried out in fed batch mode wherein media used was Yeast extract: 30 g/L Peptone: 60 g/L Dextrose: 100 g/L. The batch process was fed with once with yeast extract: 5 g/L Peptone: 10 g/L Dextrose: 10 g/L followed by addition of glucose at 10 g/L every hour. Conditions maintained were as follows: temperature 30°C + 1°C, pH 7 + 0.3, DO 30% ± 10. Expression of protein was monitored through Reverse phase - High performance liquid chromatography (RP-HPLC). Productivity was confirmed by performing 5 independent batches. The batches were run for 25-30h wherein the OD at 600nm was found to be in the range of 75-110 and the productivity was found to be in the range of 125-180 mg/L.
In one embodiment, the present invention provides optimized fermentation conditions. The media used for shake flask experiment is Yeast extract 10 g/L, peptone 20 g/L and Dextrose 20 g/L). In one embodiment, the present invention provides a fermentation media which is comprised of Yeast extract: 30 g/L Peptone: 60 g/L Dextrose: 100 g/L. The batch process was fed with once with yeast extract: 5 g/L Peptone: 10 g/L Dextrose: 10 g/L followed by addition of glucose at 10 g/L every hour.
In one embodiment, the present invention provides a fermentation process, wherein the pH in the media is higher than 5.00. A pH higher than 5 not only yielded better growth, but also improved rHGH expression levels.
In one embodiment, the present invention provides a purification process for rHGH, which comprises chromatography. In one embodiment, the present invention provides purification steps, wherein gel filtration is used for clarification of the harvest sample of rHGH. This clarified rHGH is then captured on a strong anion exchange chromatography column, followed by a hydrophobic interaction chromatography (HIC) with a unique way of loading and elution patterns. Finally, gel permeation chromatography is used as a polishing step to obtain a purity of not less than 98%.
In one embodiment, the present invention provides comparative analysis of physico-chemical characteristics and biochemical/ immunological characteristics of the rHGH of the present invention, i.e., as compared to standard commercial samples (such as commercially available rHGH, Norditropin®).
Thus the present invention provides systems for producing recombinant HGH that involve the following features:
1. constitutive expression rHGH;
2. reduced fermentation time;
3. reducing or eliminating the use of toxic chemicals, such as methanol, during protein expression;
4. obtaining yields of rHGH higher than previously reported; and
5. achieving purity at a level of greater than 98%..
BRIEF DESCRIPTION OF DRAWINGS
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure, the inventions of which can be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
Figure 1. Expression analysis of Pichia pastoris SMD 1168/GH/4.4 grown in 50 mL YEPD medium in shake flask.
Figure 2. Chromatograms of trypsin-digested standard (Norditropin®) and in-house rHGH samples obtained using the disclosed systems/methods.
Figure 3. Reducing and non-reducing SDS PAGE analysis of in-house rHGH and a comparison to positive standard Norditropin®.
Figure 4. Western analysis of in-house rHGH and positive standard Norditropin®.
Figure 5. RP-HPLC analysis of in-house rHGH and positive standard Norditropin®-
Figure 6. SEC-HPLC analysis of in-house rHGH and positive standard Norditropin®
Figure 7. Biologically active ELISA to compare activity of in-house rHGH and positive standard Norditropin®.
Figure 8: The consistency of productivity in all 5 different batches
DETAILED DESCRIPTION DEFINITIONS:
The term "recombinant HGH" (or "rHGH" or "rhGH") as used herein refers to the 191 amino acid form of HGH (lacking an N-termmal methionine) that is cloned and expressed in a cell of an organism, such as yeast, using recombinant technologies.. Recombinant HGH has characteristics similar to the naturally occurring endogenous
HGH.
The term "constitutive expression" or "constitutively expressed" as used herein refers to expression of protein during all phases of growth of yeast. This expression does not require the presence of any inducers.
The term "signal sequence" as used herein refers to nucleotide or amino acid sequence which is fused in frame with hGH sequence in order to secrete the mature hGH in the culture supernatant
The term "promoter" as used herein is defined by a nucleotide sequence which drives transcription of gene cloned downstream. GAP promoter is a promoter driving transcription of Glyceraldehyde-3-phosphate dehydrogenase gene.
The present invention uses a Pichia system to provide constitutive expression and extracellular production of rHGH. This invention provides a simple time saving and cheaper method of producing rHGH.
In the present invention, a nucleic acid sequence encoding 191 amino acid rHGH was fused to the signal sequence of alpha mating factor from Saccharomyces cerevisiae. The signal sequence is cleavable from the fusion protein by endogenous Pichia pastors proteins, such as those present in the cell membrane. The fusion protein was cloned downstream to a yeast glyceraldehyde-3 -phosphate dehydrogenase (GAP) promoter. The promoter is expressed constitutively in Pichia. The whole cassette was part of a pGAPZαA plasmid. Pichia pastors SMD1168H was transformed with the cassette (after linearising with Avr II) and transformants obtained were screened on different concentration of the selection marker drug zeocin. Such selection techniques were used to obtain multicopy clones of rHGH expressing Pichia (i.e. clones having more than one copy of a rHGH expressing cassette per clone).
The screening method developed yielded stable Pichia clones with multiple copies of the rHGH cassette. Pichia clones were screened on varying concentrations of zeocin (100μg, 250μg and 500μg). Clones growing on 500μg zeocin were selected for expression. Further screening was done in terms of expression. Herein the Pichia clones were inoculated in YEPD broth (Yeast extract: 10 g/L, Peptone: 20 g/L, Dextrose: 30 g/L and samples were collected after regular time interval and hGH was estimated The best Pichia clone was selected where maximum expression obtained at the shake flask was 40 -50mg/L. Primary screening of Pichia clones (obtained post transfections) was using Zeocin. The clones growing on higher concentration of Zeocin were supposed to be multi copy clones i.e. the genome is harboring more than one copy of hGH expressing cassette
(reference Invitrogen manual). Further Pichia clones growing on higher concentration of zeocin were selected for expression analysis at shake flask level. In this clones were inoculated in 50 ml YEPD in 250 ml shake flask. The culture was grown at 30°C 200 rpm. Culture supernatants were collected at regular time interval and expression levels of hGH was checked. Under such shake flask conditions, the best expression obtained was 40-50 mg / L. The clone yielding above mentioned expression was selected for conducting fermentation studies using a bioreactor The clone was further taken up for carrying out fermentation studies. Under certain conditions, the clone expressed 175 mg/L of hGH in 48 h.
The present invention provides a simple method of expression of rHGH. The method of production is constitutive and time saving and yields protein more than reported in the
literature.
Experiments were conducted in flask and lab scale fermenters (4L) and an optimized process was then scaled-up to 30L fermenter. In one embodiment, cultivation of a recombinant Pichia pastoris pGAPZ oc/SMD/4.4 clone was carried out in flask and in fermenter using complex medium (YPD medium). The inoculum was prepared in a shake flask containing above said sterile medium using a shaker incubator. The fermenter was equipped with automatic control of pH, cultivation temperature, dissolved oxygen level and agitator speed. Temperature of the fermenter was set at desired value and pH of the production medium was adjusted with NH3 solution before the addition of inoculum.
The fermenter containing sterile production media was inoculated with the inoculum culture. Growth of the organism was monitored by measuring optical density at 600 nm using a UV-VIS spectrophotometer. Glucose feed was added to the fermenter after the initial glucose was exhausted. Adding antifoam controlled excess foam inside the fermenter. Cultivation samples were taken at a regular interval for the analysis of rHGH expression. Culture was harvested at the end of the fed-batch fermentation process. Culture broth was centrifuged and the supernatant was collected for purification. The cell pellet was discarded.
The harvest from the fermentation was processed further to purify rHGH via a four step chromatography process that also included two ultrafiltration (UF) steps. The supernatant
was concentrated and processed on a gel filtration column to exchange buffer contents in the sample. After the buffer exchange, the sample was then loaded onto an anion exchange column. The bound rHGH was eluted by a high conductivity salt solution, and the fractions were pooled based on rHGH content and relative purity. The elulion pool from the anion exchange column was loaded onto a hydrophobic interaction chromatography column, where rHGH bound to the column, while most of the impurities and pigmented materials appeared in the flow through fraction. The bound rHGH was eluted by a low conductivity salt solution in different fractions. The fractions showing good rHGH content and purity were pooled and concentrated further by ultra.filtration necessary for loading onto the last size exclusion chromatography column. The running buffer for the size exclusion column consists of formulation components and thus this step also serves as the formulation step. After loading the size exclusion column, multiple fractions were collected from the column.
Formulation components were added to the pooled fractions and filtered through a 0.2 micron filter to produce drug substance solution. The rHGH drug substance was stored at 2-8°C.
Physico-chemical characterization of the product: The rHGH of the present invention was analysed and compared with reference standards. Unless stated otherwise, the reference standard was Norditropin®. Tests included amino-terminal peptide analysis, intact mass analysis, peptide mapping, SDS PAGE, identification and purity testing by RP-HPLC, analysis of covalent dimers by size exclusion HPLC. Biological and immunological characterization of product of the present invention included ELISA and Western blot analysis
The following examples are included to demonstrate certain embodiments of the invention. It will be appreciated by those of skill in the art that the techniques disclosed in the examples represent techniques discovered by the inventor to function well in the practice of the invention. However, those of skill in the art will, in light of the present disclosure, appreciate that many changes can be made in the disclosed embodiments and still obtain a like or similar result without departing from the spirit and scope of the invention.
EXAMPLE 1: Cloning and expression of recombinant human growth hormone in Pichia
a) Cloning of hGH cDNA isolation and amplification
Full length nucleotide sequence coding for hGH was obtained using polymerase chain
reaction (PCR) from commercially available human pituitary glands. The primers used for
the purpose were as follows
Forward primer for amplifying full length GH (with native signal sequenceof GH).
TPG 67 5'd(AGCTGCAATGGCTACAGG)3;
Reverse primer for amplifying full length GH.
TPG-68 5'd(TTTATTAGGACAAGGCTGG)3'
The 753 bp nucleotide sequence obtained from PCR was ligated into pGEMT-EASY (Promega, Madison. Wl) vector. The vector provides blue white selection on media supplemented with X-gal wherein white colonies are due to recombinants. The ligation mixture was transformed into E. coli Top 30 F'. The transformation mixture was plated out on Luria Bertani Agar medium with ampicillin [1% Tryptone, 1% Sodium Chloride, and 0.5% Yeast Extract, 2% agar]. Ampicillin concentration was l00μl/ml. The white colonies obtained post incubation at 37 C for 16h were inoculated in Luria broth. The growth obtained was used for plasmid extraction using Qiagen miniprep kit (Qiagen, Valencia, CA). The plasmids were subjected to restriction digestion using EcoRI. The digested samples were run on 1% Agarose gel. The ones showing insert of 753 bp were selected for sequencing. Sequencing was performed using Big dye terminator kit (Applied Biosystems).
Further amplification of 573 bp amplicon of rHGH (191 amino acids) was performed by
PCR using following
Forward primer for HGH (191 aa).
TPG 1620 5'd(GCCTCGAGAAAAGATTCCCAACCATTCCCTTATC)3'
The primer contained GC clamps followed by Xho I site for cloning in pGAPZaA.
Reverse primer for HGH (191 aa).
TPG-1621 5'd(GCTCTAGA CTAGAAGCCACAGCTGCCCT)35
The primer contained Xba I site for cloning in pGAPZaA.
The amplicons were checked, cloned and sequenced as mentioned above. The plasmids (TPG3032) carrying perfect sequence of hGH (573 bp) was selected for subcloning in pGAPZalpha A
c) Subcloning of hGH(573) in pGAPZaA.
TPG 3032 and pGAPZaA were digested with Xho I and Xba I. . 20pL digestion system was set up using 3.0 pL of the template, 0.3pL each of the enzymes and 2.0 pL of buffer. The volume was made up using MilliQ water. The digested samples were loaded on a 0.7% agarose gel. The bands corresponding to the vector (pGAPZaA) pand the insert (hGH) were gel eluted following the Qiagen Gel Extraction protocol (Qiagen, Valencia, CA). A 15.0 pL ligation system was set up using 5.0 pL of the vector and the insert, 1.5 pL of T4 DNA Ligase buffer and 1.0 μL of the T4 DNA Ligase (NEB ) enzyme. The system was incubated at 16 C. This ligation mix was transformed into E. coli TOP10F2 cells and plated on LB-Zeocin (Invitrogen) plates. The colonies developed on the media were were inoculated into LB-Zeocin media to isolate the plasmids. The presence of the insert was confirmed by digesting the plasmids with Xho I and Xba I enzymes. The clones showing insert of 573 were further confirmed by sequencing the plasmid.
d) Expression analysis of rHGH expressing Pichia pastoris clones.
15 pg of pGAPZaA/rHGH plasmid was linearised using Avr II enzyme at 37 C, followed by ethanol precipitation. The precipitated DNA was resuspended in 10 mM Tris EDTA (pH 8) to give a final concentration of 1 pg/pL. This linearized plasmid was used for Pichia pastoris transformation. Pichia transformation was done by electroporation. Pichia pastoris SMD1168H cells were grown on YEPD (1% Yeast Extract, 2% Peptone and 2% Dextrose) medium.
The culture was incubated at 30°C, 200 rpm for 16 h. The OD600 of the overnight culture was noted and the culture was inoculated into 50 mL YEPD medium. It was incubated as mentioned above till the OD6oo reached 1.5. Once the required OD was reached, the culture was centrifuged at 1500 x g, 4°C for 5 min. The pellet was resuspended in 50 mL of ice-cold sterile MilliQ water. The cells were again centrifuged as mentioned above and the pellet was resuspended in 25 mL sterile MilliQ water. Cells were centrifuged as above and the pellet was resuspended in 2 mL ice-cold 1M Sorbitol. Cells were centrifuged and the pellet was resuspended in 100 pL of ice cold 1M Sorbitol. 80 pL of the competent cells
was mixed well with 10 μg linearized DNA, and was transferred to an ice-cold 0.2 cm electroporation cuvette (BTX ).The cuvette was kept on ice for 5 min before transferring it to the electroporator.
The parameters for electroporation were; Voltage-2000V, Capacitance (μF) - 25, Resistance- 200, Pulse length (ms) - 3.7. Immediately after electroporation, 1 mL of ice cold 1M Sorbitol was added to the cuvette, and the contents were transferred into a sterile micro centrifuge tube. The culture was incubated at 30°C, in a water bath for 2 h, following which 100 uL, 200 uL, 300 uL and 400 μL aliquots of the culture was plated out on YEPD agar with Zeocin (100ug/ml).The plates were incubated at 30°C till the colonies developed.
For selecting multicopy recombinants, colonies were streaked on YEPD plates containing 100, 500, and 1000 μg/mL Zeocin (Invitrogen Manual). Clones growing on 500 and 1000 μg/ml zeocin plates were selected for colony PCR for confirming insertion of gene of interest in the genome and for expression analysis.
Colony PCR reaction was set up using 12.5 μL of 2X PCR mango mix (Lucigen), and 1.0 uL each of the primers; TPG-1620 and TPG-1621. The volume was made up to 25 u.L using MilliQ water. To this scrap of colony was added and the touch down PCR protocol was set up as mentioned earlier. The positive clones were selected for expression studies of the protein.
Expression Study of the protein
A colony of selected clone was inoculated in 3 ml YEPD and incubated at 30 C 200 rpm for 24 h. The growth was observed and 0.5 ml from this was inoculated into 50 ml of YEPD media in 250 ml flask. The incubation continued at above mentioned conditions. Samples were withdrawn after every 24 h. Culture supernatant was separated by centrifugation at 13000x g and were loaded on a 12% SDS gel and run at ]50 V for 90 min. The gels were either stained with comassie brilliant blue (CBB) or was used to transfer the proteins to nitrocellulose membrane (Bio Rad ) for western analysis. The primary used for western was anti hGH monoclonal antibody ( ) whereas secondary used was anti mouse rabbit ALP conjugated (fig 1).
Example 2: Fermentation Process Description
Preparation of inoculum was initated by thawing working cell bank of Pichia pastoris SMD hGH in sterile YPD. After achieving desired OD600 value of 2.5 - 3.5, the shake . flasks was withdrawal from the incubator and then inoculated aseptically into higher volume of complex medium in a flask. After achieving desired ODgoo value of 6.0 - 8.5, the shake flasks were withdrawn from the incubator and the culture was aseptically inoculated into the fermenter.
A fed batch process was carried out for production of hGH. The media used for the fed batch was Yeast extract: 30 g/L Peptone: 60 g/L Dextrose: 100 g/L. on the day of the seed inoculation. The batch process was fed once with yeast extract: 5 g/L Peptone: 10 g/L Dextrose: 10 g/L followed by addition of glucose at 10 g/L every hour The process parameters maintained were temprature 30 C pH 7. Dissolved oxygen was maintained at30%. Glucose feeding in the fermenter was initiated when initial glucose reduced below 20g/L in the fermenter. 10% antifoam solution was used to break the foam, generated during the process. The culture was harvested when sufficient OD6oo (75-90) was achieved. The harvested broth was centrifuged and supernatant collected for purification. The consistency of productivity in all 5 different batches is as shown in figure 8.
Example 3 : Purification procedure
From the fermenter harvest, Pichia cells were removed by centrifugation. The supernatant was filtered through 0.45μ and concentrated by ultrafilteration using 5 KDa membrane (Millipore ) .
The concentrated sample was loaded on Sephadex G25 (GE). Before loading the column, the column was cleaned with 0.1N NaOH, washed with water for injection (WFI) and
equilibrated with 10 mMTris buffer (pH8). Post loading of sample, elution was carried out using l0mM Tris buffer pH8.0. This buffer exchanged samples were loaded on Q sepharose which is a strong anion exchange chromatography.
The column was cleaned with 0.5 N NAOH, washed with water and equilibrated with l0mM Tris pH 8. The samples were loaded, followed by wash with 10 mMTris pH8.
Bound protein was eluted in linear gradient (0-250nM) NaCl in Tris buffer pH8.0. Post
strong anion exchanger chromatography, the fractions were loaded on Phenyl sepharose
chromatography.
Before loading the samples pH of the sample was adjusted to 4.8 and salt concentration was
adjusted to 1M using sodium chloride. Elution was carried out by descreasing salt
concentration (from 1Mto 1mM).
Finally the eluted material was concentrated by ultrafiIteration using 5 KDa cut-off ultrafiltration membranes (MilliPore ) and loaded on Supradex S75 (GE ) and eluted in formulation buffer (Mannitol 4 mg/L, Pluronic F68 3mg/L L histidine 0.667mg/ml pH6.8)
Example 4 : Physico-chemical characterization of in-house rHGH 1. Ammo-Terminal Peptide Analysis of in-house rHGH
N-terminal sequencing was conducted on purified rHGH drug substance. The drug substance was loaded onto a RP-HPLC column. The concentrated portion of peak coming out from RP-HPLC column was collected in a 1.5 ml eppendroff tubes and sent for N-terminal sequence analysis to Proteomics Inc.. Australia. The result are given in the table below: Table I:
Sample Amino acid sequencing results
Amino acid position 1 2 3 4 5 6 7 8 9 10
Published sequence F P T I P L S R L F
Reference product
sequence F P T I P L S R L F
rHGH of the present invention F P T I P L S R L F
The N-terminal sequencing result for the rHGH of the present invention matches with the published sequence and reference product of recombinant Human Growth Hormone and also the sequence as per the European pharmacopoeia (EP) monograph (first 10 amino acids).
2 Intact Mass analysis:
The intact mass of rHGH was measured using Matrix Assisted Laser Desorption and Ionization time of flight (MALDI-TOF) methodology. Human growth homone eurpean pharmacopoeia standard was used for the comaparative studies. The rHGH as well as standard were loaded onto RP-HPLC independently. The concentrated portion of peaks were collected for intact mass analysis. Analysis was carried out at Proteomics Inc. Australia. The results indicated that in-house rHGH had similar molecular weight as that of European pharmacopoeia standard, i.e., 22124 Da
3 Peptide mapping
Peptide mapping involves comparative testing of specific maps for each unique protein (the test sample) against a reference standard or reference material treated in an identical fashion. The process of generating a peptide map consists of four steps: isolation and purification of the protein, selective cleavage into the resulting peptides, the chromatographic separation, and the final analysis. The in-house sample and the reference standard were digested with trypsin, and the digests were loaded on RP-HPLC and eluted using a linear gradient of solvent A and solvent B wherein Solvent A is 0.1% TFA in water and solvent B is 90% Acetonitrile with 0.1% TFA. The chromatograms of the digested standard (Norditropin) and the samples are given in Figure 2. The peptide mapping profile of the rHGH of the present invention is similar to that of the standard. This indicated that the amino acid sequence and the primary structure of the rHGH produced by the process of the present invention is same as that of the standard.
4 SDS-PAGE and western analysis of purified rHGH
Purified rHGH was separated on 12% reducing and non reducing SDS-PAGE along with a Norditropin standard (Figure 3). The gel was stained with silver staining. Results indicated that the in-house sample and the standard had same electrophoretic mobility on the 12% reducing and non reducing SDS-PAGE gels. The similarity in banding pattern of the in-house rHGH and reference samples indicated product similarity. HGH identity was confirmed by SDS-PAGE coupled with Western analysis (Figure 4). In this analysis, antibodies raised against HGH were employed to detect the protein for confirmation. Standard molecular biology steps were followed to separate the proteins on 12% SDS-PAGE and transferred onto nitrocellulose membrane. Rabbit
anti-HGH antibody was used as primary whereas Goat anti-rabbit HRP labeled antibody was used as secondary. Blot was developed using BCIP/NBT substrate solution. Western blotting indicated that the reference standard and the in house sample were recognized by anti-HGH antibody and both the protein had similar mobility on 12% reducing SDS-PAGE.
5 Identity confirmation and purity check by RP-HPLC
The in house sample and reference sample were run on RP-HPLC to study product similarity (Figure 5). The conditions followed for the same are as mentioned in European pharmacopia (Somatropin bulk solution Ph. Eur. Monograph 0950). The retention time matched for both the standard and samples indicating similarity .
6. Analysis of covalent dimers by size exclusion HPLC
Characterization of covalent dimers between reference standard and in house sample was tested using size exclusion HPLC (Figure 6). The conditions followed for the same are as mentioned in European pharmacopia (Somatropin bulk solution Ph. Eur. Monograph 0950). The system used for this analysis was Shimadzu 2010 LC. As can be seen the retention times and the peak profile are identical between the two samples indicating product similarity in terms of overall size and shape of the molecules. The overall purity of the two samples is also similar. SEC-HPLC chromatogram for rHGH of the present invention as compared with the reference sample.
7. Biological activity of rHGH estimated by Bioactive GH ELISA
Bioactive GH ELISA is an enzymatically amplified two step sandwich type immuno-
functional assay involving a unique anti-HGH monoclonal antibody and biotinylated
recombinant HGH binding protein (Bioactive GH) that bind: respectively, to HGH receptor binding site- 2 and binding site-1 present on biologically active HGH molecules. The kit was procured from Diagnostic Systems Laboratories, Inc. The assay was performed as per the protocol provided by the manufacturer. All samples were analyzed in duplicates and compared with market standard, which is Norditropin® (Figure 7). The results showed that rHGH has retained bioactivity even during storage for three months at 2-8°C.
All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of certain embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents that are chemically or physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
Claims:
1. An isolated nucleic acid construct comprising:
a. a nucleic acid sequence encoding a fusion polypeptide comprising:
(1) a signal sequence;
(2) recombinant human growth hormone (rHGH);
b. a promoter sequence that is constitutively active in Pichia pastoris,
wherein expression of the fusion polypeptide is driven by the promoter sequence.
2. The nucleic acid construct of claim 1, wherein the signal sequence is cleavable from the fusion polypeptide by an endogenous Pichia pastoris protein.
polypeptide to the exterior of a Pichia pastoris cell.
4. The construct of claim 1, wherein the signal sequence comprises S. cerevisiae alpha mating factor.
5. The construct of claim 1 , wherein the promoter comprises a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter.
6. The construct of claim 1, wherein the signal sequence and the rhGH are functionally linked such that during a process of transcription and translation in a Pichia pastoris
host cell, biologically active rHGH polypeptide is secreted into a culture medium.
7. The construct of claim 1, further comprising at least one selectable marker.
8. A pGAPZaA plasmid comprising the nucleic acid construct of claim 1.
9. The plasmid of claim 8, wherein the signal sequence comprises S. cerevisiae alpha mating factor, and wherein the promoter comprises a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter.
10. The construct of claim 1, wherein the signal sequence comprises S. cerevisiae alpha mating factor, wherein the promoter comprises a glyceraldehyde-3-phosphate dehydrogenase (GAP) promoter, and wherein the signal sequence and the rHGH are functionally linked such that during a process of transcription and translation in a Pichia pastoris host cell, biologically active rHGH polypeptide is secreted into a culture medium.
11. A Pichia pastoris cell comprising the construct of claim 1 or 10.
12. A Pichia pastoris cell comprising multiple copies of the construct of claim 1 or 10.
13.. A SMD1168H Pichia pastoris cell comprising the construct of claim 1 or 10.
14. A SMD1168H Pichia pastoris cell comprising one or more copies of the plasmid of claim 8 or 9.
15. The Pichia pastoris cell of any one of claims 11-14, wherein a culture of the cells can produce about 100-200 milligrams of rHGH per liter of media in about 24-72 hours of fermentation.
16. A method for producing recombinant human growth hormone (rHGH) polypeptide, the method comprising:
culturing the Pichia pastoris cells of any one of claims 11-14 under fermenting conditions, wherein the rHGH polypeptide is expressed and secreted into the culture medium.
17. The method of claim 16, wherein culturing comprises fed batch fermentation.
18. The method of claim 17, wherein the fermentation is carried out in a medium comprising yeast extract, Soytone and dextrose.
19. The method of claim 17, wherein the fermentation is carried out in a medium comprising Yeast extract 1.5%. Soytone 3.0%, dextrose 10% and wherein the fed batch fermentation process is supplemented with 50% dextrose fed at 10 grams per liter every hour.
20. The method of claim 16, wherein the pH of the medium is higher than 5.
21. The method of claim 16, wherein the concentration of rHGH polypeptide in the culture medium is about 100-200 milligrams per liter when the OD6oo value of the Pichia pastoris culture is between 100 and 150 milligrams per liter.
22. The method of claim 16, wherein the concentration of rHGH polypeptide in the culture medium is about 100-200 milligrams per liter of rHGH after about 24—72 hours of culturing under fermenting conditions.
23. The method of claim 22, wherein the concentration of rHGH polypeptide in the culture medium is at least 100 milligrams per liter after about 24-72 hours of culturing under fermenting conditions.
24. The method of claim 16, wherein the concentration of rHGH polypeptide in the culture medium is at least 100 milligrams per liter after about 24hours of culturing under fermenting conditions.
25. The method of claim 16, wherein the cell density during fermentation is less than 200 OD at 600nm.
26. A method for purifying rhGH polypeptide produced by the method of any one of claims 16-20, wherein the method comprises:
a. separating the cells from the medium;
b. concentrating the medium of step (a);
c. processing the concentrated medium of step (b) serially through at least
four different chromatography steps comprising
(1) gel permeation chromatography;
(2) anion exchange chromatography;
(3) hydrophobic interaction chromatography; and
(4) size exclusion chromatography.
27. A pharmaceutical composition comprising:
a. rHGH purified by the method of claim 26;
b. histidine;
c. Pluronic F68;
e. mannitol.
28. A Pichia pastoris cell comprising one or more nucleic acid constructs comprising:
a. a nucleic acid sequence encoding a fusion polypeptide comprising:
(1) a signal sequence comprising 5. cerevisiae alpha mating factor;
(2) recombinant human growth hormone (rHGH);
b. a promoter sequence comprising a glyceraldehyde-3-phosphate
dehydrogenase (GAP) promoter;
wherein expression of the nucleic acid sequence encoding the fusion polypeptide is driven by the promoter sequence, and wherein the signal sequence and the rHGH are functionally linked such that after a process of transcription and translation in the Pichia pastoris cell, biologically active rHGH polypeptide is secreted into a culture medium.
29. A method for producing recombinant human growth hormone (rHGH) polypeptide, the
method comprising:
a. providing a Pichia pastoris cell comprising one or more nucleic acid
constructs comprising: (!) a nucleic acid sequence encoding a fusion polypeptide comprising:
(a) a signal sequence comprising S. cerevisiae alpha mating factor;
(b) recombinant human growth hormone;
(2) a promoter sequence comprising a gIyceraldehyde-3-phosphate dehydrogenase (GAP) promoter;
wherein expression of the nucleic acid sequence encoding the fusion polypeptide is driven by the promoter sequence, and wherein the signal sequence and the rHGH are functionally linked such that after a process of transcription and translation in the Pichia pastoris cell, biologically active rHGH polypeptide is secreted into a culture medium;
b. culturing the Pichia pastoris cell under fermenting conditions, during which
the rHGH polypeptide is secreted into a culture medium;
c. generating at least 100 milligrams per liter of the rHGH polypeptide in the
culture medium after 24-72 hours of culturing under fermenting conditions.
30. The method of claim 29, wherein the method comprises generating at least 100 milligrams per liter of the rHGH polypeptide in the culture medium after 24 hours of culturing under fermenting conditions.
31. An isolated nucleic acid construct, a method for producing recombinant human growth hormone (rHGH) polypeptide, and its compositions as claimed above exemplified herein substantially in the examples and figures.
| # | Name | Date |
|---|---|---|
| 1 | abstract1.jpg | 2018-08-10 |
| 2 | 2336-MUM-2009-FORM 5(8-10-2010).pdf | 2018-08-10 |
| 3 | 2336-mum-2009-form 3.pdf | 2018-08-10 |
| 4 | 2336-MUM-2009-FORM 3(8-10-2010).pdf | 2018-08-10 |
| 5 | 2336-mum-2009-form 2.pdf | 2018-08-10 |
| 7 | 2336-mum-2009-form 2(title page).pdf | 2018-08-10 |
| 8 | 2336-MUM-2009-FORM 2(TITLE PAGE)-(8-10-2010).pdf | 2018-08-10 |
| 9 | 2336-mum-2009-form 2(8-10-2010).pdf | 2018-08-10 |
| 10 | 2336-mum-2009-form 1.pdf | 2018-08-10 |
| 11 | 2336-MUM-2009-FORM 1(8-10-2010).pdf | 2018-08-10 |
| 12 | 2336-mum-2009-drawing.pdf | 2018-08-10 |
| 13 | 2336-MUM-2009-DRAWING(8-10-2010).pdf | 2018-08-10 |
| 14 | 2336-mum-2009-description(provisional).pdf | 2018-08-10 |
| 16 | 2336-MUM-2009-DESCRIPTION(COMPLETE)-(8-10-2010).pdf | 2018-08-10 |
| 17 | 2336-mum-2009-correspondence.pdf | 2018-08-10 |
| 18 | 2336-MUM-2009-CORRESPONDENCE(8-10-2010).pdf | 2018-08-10 |
| 19 | 2336-MUM-2009-CLAIMS(8-10-2010).pdf | 2018-08-10 |
| 20 | 2336-MUM-2009-ABSTRACT(8-10-2010).pdf | 2018-08-10 |