Sign In to Follow Application
View All Documents & Correspondence

Process For Stable Expression Of Spike Subunit Protein Of Sars Cov 2 Virus In Pichia Pastoris For Vaccine Development

Abstract: ABSTRACT The present invention relates to the development of Pichia pastoris clones inserted with gene sequences responsible for spike protein (S- Protein subunit 1 and subunit 2) expres-sion of SARS-CoV-2 virus using recombinant DNA technology. The gene sequence was constructed artificially using available genome sequences SARS-CoV-2 virus and then inserted into suitable plasmid vector. Pichia pastoris cells are then transformed to fuse the vector containing viral gene into the host cell. Another object of the present inven-tion was to provide a high level of expression of S-Protein by Pichia pastoris when in-duced with methanol as a sole carbon source. More specifically the present invention was to provide a stable single and /or bivalent antigen (s) vaccine composition against SARS CoV-2 virus.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
23 April 2020
Publication Number
40/2021
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
susmita@techinvention.biz
Parent Application

Applicants

Techinvention Lifecare Pvt. Ltd.
#1004, The Summit Business Park, Off WEH Metro Station, Andheri Kurla Road, Andheri East, Mumbai 400093. INDIA

Inventors

1. KUMRAJ, Ganesh
#1004, The Summit Business Park, Off WEH Metro Station, Andheri Kurla Road, Andheri East, Mumbai 400093. INDIA
2. JAIN, Jainendra
#1004, The Summit Business Park, Off WEH Metro Station, Andheri Kurla Road, Andheri East, Mumbai 400093. INDIA
3. BHATI, Davender Kumar
#1004, The Summit Business Park, Off WEH Metro Station, Andheri Kurla Road, Andheri East, Mumbai 400093. INDIA

Claims

1. A process for producing a stable single-antigen vaccine composition, the process comprising: a. S1-antigen composition, wherein the S1 antigen expressed in yeast as in-dividual clone, b. purification of expressed single S1antigen ,and c. adding and mixing S1 with non-antigenic component (s) for stability of the single S1 -antigen vaccine against SARS CoV-2 virus.

2. The single-antigen vaccine composition as claimed in claim 1, wherein yeast is Pichia pastoris .

3. The process of producing a stable single -antigen composition as claimed in claim 1, wherein the vaccine is a fully liquid vaccine.

4. The process of producing a fully liquid Single -antigen vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consists of S1 antigen about 5 µg to about 20 µg per dose each of 0.5ml of the composition.

5. A process of producing a fully liquid single -antigen vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consist of S1 antigen is at least 10 µg per dose each of 0.5ml of the composition.

6. The single-antigen vaccine composition as claimed in claim 1, wherein the sin-gle -antigen vaccine composition further comprises one or more non-antigenic com-ponent(s) that are pharmaceutically acceptable excipients selected from adjuvant, stabilizer, non-mercury preservative, tonicity agent, pH modifier, and buffer.

7. The single-antigen vaccine composition as claimed in claim 6, wherein the ad-juvant is alum salt preferably Aluminum phosphate.

8. The single-antigen vaccine composition as claimed in claim 7, wherein the Aluminum content (Al3+) in the composition is about 0.5 mg to about 1.25 mg .

9. The single-antigen vaccine composition as claimed in claim 8, wherein the alu-minum content (Al3+) in the composition is at least 0.25 mg in 0.5ml.

10. The single-antigen vaccine composition as claimed in claim 6, wherein the pre-servative is 2-phenoxyethanol (2-POE) in the composition should not exceed 0.1mg/ml.

11. The single-antigen vaccine composition as claimed in claim 6, wherein the pre-servative is 2-phenoxyethanol (2-POE) in the composition is at least 0.05mg/ml.

12. The single -antigen vaccine as claimed in claim 6,wherein the tonicity modify-ing agent is selected from the group of salt including NaCl, MgCl2, KCl, and CaCl2; sugar including Dextrose, Mannitol, and Lactose; amino acid including Arginine, Glycine, and Histidine; polyol including Glycerol and Sorbitol; or mixture thereof.

13. The single-antigen vaccine as claimed in claim 6, wherein the pH modifier is se-lected from sodium hydroxide, hydrochloric acid or combination and comprises a pH in the range of 6 – 7.

14. The single-antigen vaccine as claimed in claim 6, wherein the buffer is selected from sodium phosphate, potassium phosphate, citrate buffer or combinations thereof.

15. A process of producing a fully liquid single-antigen vaccine composition , the process comprising: a. adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Alumi-num phosphate and blending, b. addition of physiological saline, stabilizer and non-mercury preservative 2-phenoxyethanol (2-POE) at pH of about 6.4-6.8 to the mixture of absorbed S1 antigen, on Aluminum phosphate ,and c. further, blending by stirring the composition at a speed of about 200-300 rpm-for a period of about 8-16 hrs.

16. The single -antigen vaccine composition as claimed in claim 1, wherein the composition may contain additional antigen along with S1 antigen.

17. The single -antigen vaccine composition as claimed in claim 16, wherein the composition contain S2 antigen along with S1 antigen.

18. The single -antigen vaccine composition as claimed in claim 1, wherein the S2 subunit is express separately in Pichia pastoris.

19. A process of producing a fully liquid bivalent antigen vaccine composition , the process comprising: a. adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Aluminum phosphate and blending, b. adding at least 10 µg S2 antigen to adsorb on Alum salt preferably Aluminum phosphate and blending, c. addition of physiological saline, stabilizer and non-mercury preservative 2-phenoxyethanol (2-POE) at pH of about 6.4-6.8 to the mixture of absorbed S1 and S2 antigens , on Aluminum phosphate ,and d. further, blending by stirring the composition at a speed of about 200-300 rpm-for period of about 8-16 hrs.

20. The fully liquid vaccine composition as claimed in claims 15 and 19, wherein the single –antigen and bivalent antigen vaccine composition may or may not be a lyophi-lized composition.

21. The fully liquid vaccine composition as claimed in claims 15 and 19, wherein the purification process of S1 and/or S2 antigen (s) comprising: a. chromatography steps used as single or in combination with 2 or more chromatography steps with different resins and parameters for binding and elu- tion of protein, b. One of the resin was composed of a base material of hydroxylated methacrylic polymer beads functionalized with diethylaminoethyl - DEAE and used as ion exchange chromatography agent, c. Other resin used in combination or alone is ceramic Hydroxyapatite type 1 used as mix mode chromatography, and d. chromatography steps used as standalone steps as well as in combination with other techniques of purification such as TFF and centrifugation to purify the S1and or S2 antigen(s) by employing appropriate buffers for equilibration and elution.

22. The fully liquid multi-antigen vaccine composition as claimed in claims 15 and 19, wherein the single –antigen and bivalent antigen vaccine composition are presented as single and multi - dose presentation.

Specification

DESC:RELATED APPLICATION
This application claims the benefit to Indian Provisional Application No. 202021017463, filed on 23rd April, 2020, the contents of which are incorporated by reference herein.

FIELD OF THE INVENTION
The present invention relates to a process for the preparation of a stable recombinant clone using Pichia pastoris host system and expression of Spike subunit protein of SARS-CoV-2 virus which will be used for development and formulation of a prophylac-tic vaccine against COVID-19 infections to be used in paediatric, adult and geriatric hu-man populations.

BACKGROUND OF THE INVENTION
Background description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifi-cally or implicitly referenced in this application is prior art. Disclosures of these publi-cations in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.

The beginning of 2020 has seen the emergence of COVID-19 outbreak caused by a novel coronavirus, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). This vi-rus has been names as COVID-19 is a positive-sense single-stranded RNA viruses be-longing to the family Coronaviridae. These viruses mostly infect animals, including birds and mammals. In humans, they generally cause mild respiratory infections, such as those observed in the common cold. However, some recent human coronavirus infec-tions have resulted in lethal endemics.
It has a genome size of ~30 kilobases, which like other coronaviruses, encodes for multi-ple structural and non-structural proteins. The structural proteins include the Spike (S) protein, the envelope (E) protein, the membrane (M) protein, and the nucleocapsid (N) protein.
In recent days, numerous news about different patents protecting Wuhan coronavirus have been published, but, finally, it has been shown that those patents claim other coro-naviruses. Some of them are:
Patent with publication number EP 3 172 319 B1 filed by The Pirbright Institute and granted by the European Patent Office. This patent actually protects an attenuated coro-navirus comprising a variant of the replicase gene, obtained from the avian infectious bronchitis virus, belonging to the Gammacoronavirus genus, other than Wuhan’s coro-navirus; Patent with publication number EP 2 898 067 B1.
Granted by the European Patent Office on 15 January 2020. This patent protects the MERS-CoV virus, as well as in vitro methods for diagnosing infections caused by this virus and the use of the MERS-CoV virus for the treatment or prevention of these infections.
Patent with publication number US 7,220,852 B1. This patent actually protects the nucle-ic acid sequence of the SARS-CoV virus, and was granted in 2007.

Again, spike protein of the SARS coronavirus is disclosed in EP1618127B1, WO2005063801A2, CN1566346A and US20150275183A1 the contents of the documents cited in this paragraph are incorporated by reference.

During experimental studies, it was shown that a set of B cell and T cell epitopes derived from the spike (S) and nucleocapsid (N) proteins in SARS-COV maps identically to SARS-COV-2 proteins. Immune targeting of these epitopes may potentially offer protec-tion against this novel virus.
The quest for a vaccine against the novel SARS-COV-2 is recognized as an urgent prob-lem. Effective vaccination could indeed play a significant role in curbing the spread of the virus, and help to eliminate it from the human population.
Therefore, the present invention aims to provide a process of producing a stable single-antigen vaccine against SARS-CoV-2 virus, wherein the antigen is S1 subunit expressed in Yeast.

The present invention further relates to an additional antigen in the composition, wherein the additional antigen is S2 subunit.
The present invention further relates to clone the gene responsible for the expression of Spike protein (Subunit 1 which has a Receptor Binding Domain (RBD) and Subunit 2 which allows the fusion of the virus to the host cell) into Pichia pastoris host systems using an established vector and promoter. The subunit protein will be used for develop-ment and formulation of a novel vaccine against SARS-CoV-2 (COVID19) infections to be used in paediatric, adult and geriatric populations.

OBJECTIVE OF THE INVENTION

The object of the present invention is to provide a process of producing a stable single-antigen vaccine against SARS-CoV-2 virus.

Another object of the present invention is to provide a process of producing yeast based single-antigen vaccine comprising of S1 antigen for the prevention of SARS-CoV-2, wherein the yeast is Pichia pastoris.

Another object of the present invention is to provide a composition for a stable adjuvant based single-antigen vaccine comprising S1 antigen and non-antigenic component(s) wherein the adjuvant is alum salt, preferably Aluminum phosphate.

Another object of the present invention is to provide a fully liquid adjuvant based single-antigen vaccine composition comprising S1 antigen and non-antigenic component(s), wherein the vaccine remains stable for longer duration.

Another object of the present invention is to provide a fully liquid adjuvant based single -antigen vaccine composition comprising S1 antigen, wherein the composition further comprising of addition antigen S2 along with S1 antigen.

Another object of the present invention is to provide single antigen and bivalent antigen vaccine compositions, wherein the vaccine composition may or may not be a lyophilized composition.

Yet another object the present invention provides a method of production and purifica-tion of Spike Protein (S-Protein) by using specific fermentation media to grow the re-combinant Pichia pastoris and purification involves various physicochemical methods including different chromatographic media, TFF process and centrifugation, alone or in combination.

Yet another object of the present invention is to provide a fully liquid single-antigen vaccine composition comprising of S1 antigen and non-antigenic component is in single and multi-dose presentation.

SUMMARY OF THE INVENTION
In a general aspect the present invention provides a process of producing a stable single-antigen vaccine against SARS-CoV-2 virus.

In an embodiment, the present invention provides a process of producing yeast based single-antigen vaccine comprising of S1 antigen for the prevention of SARS-CoV-2, wherein the yeast is Pichia pastoris.

In an embodiment, the present invention provides a composition for a stable adjuvant based single-antigen vaccine comprising S1 antigen and non-antigenic component(s) wherein the adjuvant is alum salt, preferably Aluminum phosphate.

In an embodiment, the present invention provides a fully liquid adjuvant based single-antigen vaccine composition comprising S1 antigen and non-antigenic component(s), wherein the vaccine remains stable for longer duration.

In an embodiment, the present invention provides a fully liquid adjuvant based single-antigen vaccine composition comprising S1 antigen, wherein the composition further comprising of addition antigen S2 along with S1 antigen.

In an embodiment, the present invention provides single–antigen and bivalent antigen vaccine compositions, wherein the vaccine composition may or may not be a lyophilized composition.

In an embodiment, the present invention provides a method of production and purifica-tion of Spike Protein (S-Protein) by using specific fermentation media to grow the re-combinant Pichia pastoris and purification involves various physicochemical methods including different chromatographic media, TFF process and centrifugation, alone or in combination.

In an embodiment, the present invention provides a process which does not use any com-ponents of animal origin during any stage of the manufacturing process (inoculums de-velopment, upstream processing, downstream processing and final product formulation, thus rendering it open to Halal certification.

BRIEF DESCRIPTION OF ACCOMPANYING FIGURES:
Fig 1: Restriction Digestion Map of protein subunit 1(S1)
Fig 2: pPIC3.5-S protein subunit 1 map
Fig 3: PCR verification results of SARS-CoV-2 spike(S) protein subunit 1
Fig 4: SDS-PAGE to detect protein secretion and expression of SARS-CoV-2 spike (S)
protein subunit 1
Fig 5: SDS-PAGE to detect protein secretion and expression SARS-CoV-2 spike(S) pro-tein subunit 1
Fig 6: Western Blot to detect protein secretion and expression of SARS-CoV-2 spike(S) protein subunit 1
Fig 7: Restriction Digestion Map of SARS-CoV-2 spike(S) protein subunit 2 protein
Fig 8: pPIC3.5-S protein subunit 2 map of SARS-CoV-2 spike(S) protein subunit 2
Fig 9: PCR verification results of SARS-CoV-2 spike(S) protein subunit 2
Fig 10: SDS-PAGE to detect protein secretion and expression of SARS-CoV-2 spike(S) protein subunit 2
Fig 11: Western Blot to detect protein secretion and expression of SARS-CoV-2 spike(S) protein subunit 2
Fig -12: SDS-PAGE - protein expression of Batch 1

Fig 13: SDS-PAGE - protein expression of Batch 2

BRIEF DESCRIPTION OF ACCOMPANYING SEQUENCE LISTINGS:
SEQ ID NO: 1: Amino acid sequence of SARS-CoV-2 spike(S) protein subunit 1
SEQ ID NO: 2: Amino acid sequence of SARS-CoV-2 spike(S) protein subunit 2

DETAILED DESCRIPTION OF THE INVENTION
The following is a detailed description of some of the embodiments and explanation of the present invention with some examples thereof. The embodiments are in such detail as to clearly communicate the disclosure. However, the amount of detail offered is not intended to limit the anticipated variations of embodiments; on the contrary, the inten-tion is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present disclosure as defined by the appended claims.
Unless the context requires otherwise, throughout the specification which follow, the word “comprise” and variations thereof, such as, “comprises” and “comprising” are to be construed in an open, inclusive sense that is as “including, but not limited to.”
Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable man-ner in one or more embodiments.
As used in this specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the content clearly dictates otherwise. It should also be noted that the term “or” is generally employed in its sense including “and/or” unless the content clearly dictates otherwise.
In some embodiments, the numbers expressing quantities of ingredients, properties such as concentration, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” Accordingly, in some embodiments, the numerical parameters set forth in the written description are approximations that can vary depending upon the de-sired properties sought to be obtained by a particular embodiment. In some embodi-ments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific exam-ples are reported as precisely as practicable.
The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.
All processes described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all ex-amples, or exemplary language (e.g., “such as”) provided with respect to certain embod-iments herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specifi-cation should be construed as indicating any non-claimed element essential to the prac-tice of the invention.
The headings and abstract of the invention provided herein are for convenience only and do not interpret the scope or meaning of the embodiments.
The following discussion provides many example embodiments of the inventive subject matter. Although each embodiment represents a single combination of inventive ele-ments, the inventive subject matter is considered to include all possible combinations of the disclosed elements. Thus, if one embodiment comprises elements A, B, and C, and a second embodiment comprises elements B and D, then the inventive subject matter is also considered to include other remaining combinations of A, B, C, or D, even if not explicitly disclosed.
Various terms as used herein are shown below. To the extent a term used in a claim is not defined below, it should be given the broadest definition persons in the pertinent art have given that term as reflected in printed publications and issued patents at the time of filing.
The term ‘fully liquid’ as used herein refers to the state of the vaccine, which is in the liquid form ready to be administered, wherein all the components of the vaccine are pro-vided in liquid state and there is no component of the vaccine that is provided in lyophi-lized or any other form so that it has to be mixed with the other components of the vac-cine before administering it to a subject.
The term ‘adjuvant’ as used herein refers to the non-antigenic component of the vaccine that enhances the immune response of the antigens comprised in the vaccine by facilitat-ing the contact between the antigen and the immune system. The adjuvant causes pro-longed immune responses against the antigens.
The term ‘coupling or adsorbing’ as used herein refers to any form of physical bonding between the antigen and the adjuvant components of the vaccine.
The term ‘stable’ as used herein means that each of the antigens of the vaccine composi-tion has a potency/immunogenicity more than that set as the normal acceptance limit, after the incubation of the vaccine at 30o C for at least 1 month to 6 months.
The term ‘immunologically active’ as used herein means when administered, the vaccine of the present invention is able to elicit antibodies against each of the antigens of the said combination so as to protect the vaccine against the respective diseases or infec-tions.
Reference will now be made in detail to the exemplary embodiments of the present dis-closure, examples of which are illustrated in the accompanying drawings. Wherever pos-sible, the same reference numbers are used in the drawings and the description to refer to the same or like parts.
The term ‘Lyophilization ‘(freeze drying) as used herein means a process frequently uti-lized to improve long term stability of various protein preparations.
The present invention relates to the roles of S protein in receptor binding and membrane fusion indicate that vaccines based on the S protein could induce antibodies to block vi-rus binding and fusion or neutralize virus infection. S protein has therefore been selected as an important target for vaccine development.
The S protein molecule contains two subunits S1 and S2. The S1 subunit has an RBD that interacts with its host receptor, whereas the S2 subunit mediates fusion between the virus and host cell membranes for releasing RNA into the cytoplasm for replication. Hence S-protein based vaccines possibly induce antibodies that block not only viral receptor bind-ing but also virus genome un-coating. The S protein has a major role in the induction of protective immunity during infection with SARS-CoV-2 by eliciting neutralizing anti-bodies and T cell responses.


The sequence which will be used for gene selection using the published sequence
https://www.ncbi.nlm.nih.gov/protein/1791269090
LOCUS QHD43416 1273 aa linear VRL 18-MAR-2020
Defination surface glycoprotein [Severe acute respiratory syndrome coronavirus 2]
ACCESSION QHD43416 VERSION QHD43416.1
DBSOURCE accession MN908947.3
SOURCE Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) ORGAN-ISM
ORIGIN
1 mfvflvllpl vssqcvnltt rtqlppaytn sftrgvyypd kvfrssvlhs tqdlflpffs
61 nvtwfhaihv sgtngtkrfd npvlpfndgv yfasteksni irgwifgttl dsktqslliv
121 nnatnvvikv cefqfcndpf lgvyyhknnk swmesefrvy ssannctfey vsqpflmdle
181 gkqgnfknlr efvfknidgy fkiyskhtpi nlvrdlpqgf saleplvdlp iginitrfqt
241 llalhrsylt pgdsssgwta gaaayyvgyl qprtfllkyn engtitdavd caldplsetk
301 ctlksftvek giyqtsnfrv qptesivrfp nitnlcpfge vfnatrfasv yawnrkrisn
361 cvadysvlyn sasfstfkcy gvsptklndl cftnvyadsf virgdevrqi apgqtgkiad
421 ynyklpddft gcviawnsnn ldskvggnyn ylyrlfrksn lkpferdist eiyqagstpc
481 ngvegfncyf plqsygfqpt ngvgyqpyrv vvlsfellha patvcgpkks tnlvknkcvn
541 fnfngltgtg vltesnkkfl pfqqfgrdia dttdavrdpq tleilditpc sfggvsvitp
601 gtntsnqvav lyqdvnctev pvaihadqlt ptwrvystgs nvfqtragcl igaehvnnsy
661 ecdipigagi casyqtqtns prrarsvasq siiaytmslg aensvaysnn siaiptnfti
721 svtteilpvs mtktsvdctm yicgdstecs nlllqygsfc tqlnraltgi aveqdkntqe
781 vfaqvkqiyk tppikdfggf nfsqilpdps kpskrsfied llfnkvtlad agfikqygdc
841 lgdiaardli caqkfngltv lpplltdemi aqytsallag titsgwtfga gaalqipfam
901 qmayrfngig vtqnvlyenq klianqfnsa igkiqdslss tasalgklqd vvnqnaqaln
961 tlvkqlssnf gaissvlndi lsrldkveae vqidrlitgr lqslqtyvtq qliraaeira
1021 sanlaatkms ecvlgqskrv dfcgkgyhlm sfpqsaphgv vflhvtyvpa qeknfttapa
1081 ichdgkahfp regvfvsngt hwfvtqrnfy epqiittdnt fvsgncdvvi givnntvydp
1141 lqpeldsfke eldkyfknht spdvdlgdis ginasvvniq keidrlneva knlneslidl
1201 qelgkyeqyi kwpwyiwlgf iagliaivmv timlccmtsc csclkgccsc gscckfdedd
1261 sepvlkgvkl hyt
Reference will now be made in detail to the exemplary embodiments of the present dis-closure, examples of which are illustrated in the accompanying drawings. Wherever pos-sible, the same reference numbers are used in the drawings and the description to refer to the same or like parts.
In a general aspect the present invention provides a process of producing a stable single-antigen vaccine against SARS-CoV-2 virus.

In an embodiment, the present invention provides a process of producing yeast based single-antigen vaccine comprising of S 1 antigen for the prevention of SARS-CoV-2, wherein the yeast is Pichia pastoris.

In an embodiment, the present invention provides a composition for a stable adjuvant based single-antigen vaccine comprising S1 antigen and non-antigenic component(s) wherein the adjuvant is alum salt, preferably Aluminum phosphate.

In an embodiment, the present invention provides a fully liquid adjuvant based single-antigen vaccine composition comprising S1 antigen and non-antigenic component(s), wherein the vaccine remains stable for longer duration.

In an embodiment, the present invention provides a fully liquid adjuvant based single -antigen vaccine composition comprising S1 antigen, wherein the composition further comprising of additional antigen S2 along with S1 antigen.
In an embodiment, the present invention provides single–antigen and bivalent antigen vaccine compositions, wherein the vaccine composition may or may not be a lyophilized composition.

In an embodiment, the present invention provides a method of production and purifica-tion of S1 subunit of Spike Protein (S-Protein) by using specific fermentation media to grow the recombinant Pichia pastoris and purification involves various physicochemical methods including different chromatographic media, TFF process and centrifugation, alone or in combination.
In an embodiment, the present invention provides a process which does not use any com-ponents of animal origin during any stage of the manufacturing process (inoculums de-velopment, upstream processing, downstream processing and final product formulation, thus rendering it open to Halal certification.

In an embodiment, the present invention provides a composition for immunizing humans against SARS-CoV-2 virus (COVID-19) infection, formulated with or without using any adjuvant, formulated with or without any preservative.

Preparation with suitable adjuvant containing Aluminum salt with appropriate buffer is represented as liquid vaccine buffer whereas Lyophilized presentation is consisting of suitable stabilizer and buffer.
Both immunizing preparations i.e., liquid and lyophilized are manufactured with or without preservative.
In an embodiment, the present invention provides a formulation of final product and presentation in either liquid of lyophilized format preferably liquid format.
In an embodiment, the present invention provides a fully Liquid vaccine preparation with suitable adjuvant containing Aluminum salt with appropriate buffer is manufactured with either Thiomersal or 2-Phenoxyethanol preferably 2-Phenoxyethanol as a preserva-tive preferably not more than 0.05mg/ml.
Lyophilized presentation is consisting of suitable stabilizer and buffer is manufactured with either Thiomersal or 2-Phenoxyethanol as a preservative preferably not more than 0.05mg/ml.
The final preferred volume for inoculation will be 0.5 – 1.0 ml per dose preferably 0.5 ml.

The present invention allows for expression of S1 subunit of S-Protein and formulates it with an adjuvant such as Aluminium compound, in presence of suitable buffer for pre-paring a prophylactic vaccine against SARS-CoV-2 virus. Infections to be used in paedi-atric, adult and geriatric human populations.

The present invention also allows for expression of Subunit S1 protein (~75 kDa) and formulate with an adjuvant such as Aluminium compound for developing a prophylactic vaccine against SARS-CoV-2 virus infections to be used in paediatric, adult and geriat-ric human populations.

The present invention allows for expression of Subunit S1 (~75 kDa protein and Subunit S2 (~60 kDa) protein separately and combines them along with an adjuvant such as Al-uminium for preparing a bivalent vaccine against Covid19 infections to be used in pedi-atric, adult and geriatric human populations.

In an embodiment, the present invention further allows a fusion of Subunit S1 protein and Subunit S2 protein using chemical cross linkers with long and flexible spacers to help them approach the reactive side chains of the target proteins. This fusion protein will be formulated with or without adjuvant, with or without preservative for preparation of a fusion protein vaccine against COVID-19 infections to be used in paediatric, adult and geriatric human populations.

In an embodiment, the composition of the present invention each of the antigens is pre-sent in an amount so as to elicit a protective immune response against the said antigen. It was surprisingly found by the inventors that when the antigens and conjugate were in-cluded in the composition in specific quantities, the composition for adjuvant based mul-ti-antigen vaccine of the present invention not only they elicit immune response against the said antigen but the composition also remains stable.
In an embodiment, S1 antigen is present in the range of 5-20 µg, preferably 10 µg per dose of 0.5 ml of the composition.
In an embodiment, S2 antigen is present in the range of 5-20 µg, preferably 10 µg per dose of 0.5ml of the composition.
The composition of the present invention can further comprise one or more non-antigenic component(s) that are pharmaceutically acceptable excipients selected from but not limited to adjuvant, preservative, tonicity agent, pH modifier, and buffer.
Any adjuvant that helps to stimulate a stronger immune response can be included. In an embodiment, the composition of the present invention includes aluminum-based adju-vant such as aluminium phosphate or aluminium hydroxide. In one embodiment, the aluminum-based adjuvant is aluminum phosphate.
The composition of the present invention can include any suitable buffer to control the osmotic pressure gradient of the vaccine composition. In an embodiment the composi-tion of the present invention includes a tonicity modifying agent. The tonicity agent that can be incorporated in the composition is selected from but not limiting to a group of salt including NaCl, MgCl2, KCl, and CaCl2; sugar including dextrose, mannitol, and lactose; amino acid including arginine, glycine, and histidine; polyol including glycerol and sorbitol; or mixture thereof. In an embodiment, a physiological salt such as sodium salt is used in the composition of the present invention. In one embodiment, sodium chloride (NaCl) is included in the composition of the present invention,
The composition of the present invention can include any suitable pH modifier to adjust the pH of the vaccine composition selected from but not limiting to sodium hydroxide, hydrochloric acid or combination thereof. The pH modifier in included in sufficient quantity so as to adjust the pH of the composition between pH 6–7.
The composition of the present invention can include any suitable buffer selected from but not limiting to sodium phosphate, potassium phosphate, citrate buffer or combina-tions thereof.
In an embodiment, the present invention provides a liquid single and /or multi-antigen vaccine formulations obtained as mentioned above, formulated, filled, stoppered, sealed and labeled in appropriate single dose and multidose containers for individual as well as mass vaccination. The labeled vials were stored at about 2-8°C for optimum shelf life.
The single dose formulation was without any preservative whereas multidose formula-tion contained Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0.

In an embodiment, the adjuvant-based vaccine comprises S1 antigen and S2 antigen are adsorbed on adjuvant aluminum phosphate.
The composition can include a suitable preservative to avoid the contamination with harmful microbes. The preservative that can be included in the composition is 2-phenoxyethanol (2-POE), also known as 1-hydroxy 2-phenoxyethane, 2-hydroxyethyl phenyl ether or by other synonyms. The safety profile of 2-phenoxy ethanol is better than that of mercurial preservatives such as thiomersal and hence such non-mercurial pre-servative is preferred over mercurial preservative.
In an embodiment, the preservative is 2-phenoxyethanol present in an amount of about 5 mg/ml, (0.5% w/v) of the mg per 0.5 ml of the vaccine.
In another aspect, the present invention provides a process for producing a fully liquid adjuvant based single-antigen vaccine having composition comprising S1 antigen and non-antigenic component(s).

A process of producing a fully liquid single-antigen vaccine composition, the process comprising:
a) adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Aluminum phosphate and blending,
b) addition of physiological saline, stabilizer and non mercury preserva-tive 2-phenoxyethanol (2-POE) at pH of about 6.0-7.0 (preferably 6.4-6.8) to the mixture of absorbed S1 antigen on Alum salt Preferably Aluminum phosphate ,and
c) further, mixing by stirring the composition at a speed of about 100-400 rpm (preferably at 200-300 rpm) for period of about 4-18 hrs (prefer-ably 8-16 hrs)rpm (preferably 200-300 rpm) for about 1-25 hours (preferably 12-18 hrs).
In one embodiment, mixing as per steps adsorbed onto aluminum. In one embodiment the adsorption of antigens onto aluminum phosphate is carried out in the presence of physiological saline, stabilizer and non-mercury preservative for example 2-phenoxyethanol (2-POE) and by mixing the antigens and aluminum phosphate for exam-ples by stirring at speed of about 100-400 phosphate obtained is carried out for example by stirring at about 100-400 rpm for about 6-24 hrs.

The present invention further relates to an additional antigen in the composition, wherein the additional antigen is S2 subunit.
In one embodiment, S2 antigen is added after S1 antigen on Aluminum salt and mixed well followed by addition of isotonic salt solution, stabilizer and preservative.

In an embodiment, A process of producing a fully liquid bivalent antigen vaccine com-position , the process comprising:

a) adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Alumi-num phosphate and blending,
b) adding at least 10 µg S2 antigen to adsorb on Alum salt preferably Alumi-num phosphate and blending,
c) addition of physiological saline, stabilizer and non-mercury preservative 2-phenoxyethanol (2-POE) at pH of about 6.4-6.8 to the mixture of absorbed S1 and S2 antigens, on Aluminum phosphate, and
d) further, blending by stirring the composition at a speed of about 200-300 rpm for period of about 8-16 hrs.

In one embodiment, the sequence of adsorption of antigens S1 antigen and S2 antigen on aluminum phosphate is in chronological order.

In an embodiment, the fully liquid single -antigen vaccine of the present invention com-prises per dose of 0.5ml, with 10 µg of S1 antigen.
In some of the embodiments the content of adjuvant aluminum (Al+3) included is 1.25 mg per 0.5 ml of vaccine, preferably 1 mg per 0.5 ml of vaccine, 0.8 mg per 0.5 ml of vaccine and, preferably 0.5 mg per 0.5 ml.
In some of the embodiments the preservative used is preferably but not limited to non mercury agent 2-phenoxyethanol in the quantity of 5mg/ml of the vaccine.

The present invention also allows for use of a preservative in multi-dose presentations preferably 2-phenoxy ethanol in the formulation of the final prophylactic vaccine.

The present invention allows for manufacture of vaccine which does not use any animal component during the manufacturing process thus enabling it to be certified as halal.

While the foregoing description discloses various embodiments of the disclosure, other and further embodiments of the invention may be devised without departing from the basic scope of the disclosure. The invention is not limited to the described embodiments, versions or examples, the invention is described hereinafter, with reference to the fol-lowing examples, which are to enable a person having ordinary skill in the art to make and use the invention when combined with information and knowledge available to the person having ordinary skill in the art, such examples are illustrative only and should not be construed to the limit of the scope of present invention.

EXAMPLES
The present disclosure is further explained in the form of following examples. However, it is to be understood that the foregoing examples are merely illustrative and are not to be taken as limitations upon the scope of the invention. Various changes and modifica-tions to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications may be made without departing from the scope of the inven-tion.
Example-1
Cloning and Production of recombinant proteins in Pichia pastoris host
The cloning of the host will be done using a suitable plasmid vector using pPIC9, pPICZa-A, pPICZa-B pPICZa-C, pBR 322, pUC19 preferably pPIC3.5. The MCS (Mul-tiple Cloning Sites) of the selected plasmid vector is used to insert the artificially con-structed gene.
Pichia pastoris strain GS115, strain KS71 or strain X33 but preferably GS115 wild type strain which has promoter region AOX1 and AOX2 genes, and grows on methanol utiliz-ing it at the wild-type rate (Mut+), is then transformed using suitable technology to inte-grate the plasmid containing S- Protein gene sequence. AOX1 promoter tightly regulate the expression of the desired protein i.e. S-Protein, subunit 1 protein or subunit 2 protein by controlling the Transcription repression/derepression mechanism. It allows high lev-els expression of foreign proteins, even if they are toxic to the cell.
Good cell growth is obtained before the gene product is overexpressed by ensuring the repression of transcription of the initial carbon source. Post consumption of the initial carbon, Induction of transcription is easily achieved by the addition of methanol.
The Biosynthetic marker HIS4 (Histidinol dehydrogenase gene) is used as marker for selection purpose to identify the positive clones.
Production of recombinant proteins in Pichia pastoris host is both extracellular or intra-cellular manner, but preferably intracellular
The method for production of expressed S-protein comprising the step of preparing pre inoculum of Pichia pastoris which is used for the preparation of inoculum for fermenta-tion and production of desired end product are S-protein, S subunit 1 protein, S subunit 2 protein.
The process of the invention is applicable to recombinant Pichia pastoris cells producing S- Protein or S protein subunit 1 or S protein subunit 2.
Clone Construct:
The recombinant clone SARS-CoV-2 spike (S) protein subunit1 in P. pastoris GS115 via pPIC3.5) is used as the pre cell bank for preparation of seed bank.
The cloning of the host is done using plasmid vector pPIC3.5.
Target Sequencing:

S- Protein domains
RBD = receptor binding domain; SP = signal peptide; SR = serine-arginine-rich; TM = transmembrane domain
A) SARS-CoV-2 spike (S) protein subunit1 (Val16 - Gln690) expression in Pichia pastoris GS115 via pPIC3.5.
The sequence of the S1 protein is not limited to the SEQ ID NO:1.

Seq ID No -1

Cloning and expression
SARS-CoV-2 spike (S) protein subunit1 expression in Pichia pastoris GS115 via pPIC3.5
The plasmid was linearized with restriction enzyme pmeI. Then transformed into the competent cell of Pichia GS115 by electroporation as in Fig 1, Fig 2 and amino acid Seq of S1 as Seq ID No:1(GenBank: MN908947.3. NCBI)
. Inoculated onto MD plates, and cultured upside-down at 30 °C for 2-3 days to observe the growth. Positive clones ware picked and performed PCR with S-T-F and S-T-F pri-mers as in Fig 3.
S-T-F:ATGGTTAACTTGACTACTAGAACT
S-T-F:AACGGATCTAGCTCTTCTTGGAGA
Expression validation
5 verified recombinant clones were selected and inoculated into BMGY medium, and cultured at 30? until OD600=4~6 (log-phase growth). Replace with BMMY medium for induction, and put the resuspended bacterial solution at 30? and 220rpm. Add meth-anol with a final concentration of (0.5%) every 24 h (induction for 5 days).After induc-tion, centrifuge at 1500-3000g for 5 minutes to collect cells. After removing the superna-tant, immediately sonicate the cells. Use SDS-PAGE (as in Fig no 4 and Fig no 5) and Western Blot to detect protein secretion and expression as in Fig :6

Target gene synthesis and cloning of SARS-CoV-2 spike(S) protein Subunit 1
CERTIFICATE OF ANALYSIS
Gene Name SARS-CoV-2 spike (S) protein subunit1
Insert Size 2065bp
Cloning Vector pPIC3.5
Cloning Sites BamHI(GGATCC)-EcoRI(GAATTC)

QC Results
Test Items Specifications Results
Insert Sequence Insert sequence results consistent with target Pass
Vector Sequence Flanking sequence consistent with ex-pected N/A
ORF Across Junction Correct and consistent with target N/A
Restriction Digest Expected fragment sizes observed N/A

PCR Amplification Correct without non - specific bands Pass

DNA Quantity/Quality Actual yield (by A 260 ) 5µg
Concentration (n/a if lyophilized) N/A
Purity (A 260/A280 = 1.8 - 2.0) Pass
# of Tubes 1
Matrix TE (lyophilized)
Endotoxin Test Verified, <0.1 EU/µg (Endo-Free Preps Only) N/A
Appearance Clear, no visible particles Pass
Label Correct and white Pass

B) SARS-CoV-2 spike (S) protein subunite2 (S2) (Ser 686 - Pro 1213) expression in P. pastoris GS115 via pPIC3.5.
The sequence of the S2 protein is not limited to the SEQ ID NO: 2.

Seq ID No -2
Cloning and expression
The plasmid was linearized with restriction enzyme pmeI. Then transformed into the competent cell of Pichia GS115 by electroporation as in Fig 7, Fig 8 and amino acid Seq of S2 as Seq ID No:2(GenBank: MN908947.3. NCBI). Inoculated into MD plates, and cultured upside-down at 30 °C for 2-3days to observe the growth. Positive clones were picked and performed PCR with 5AOX and 3AOX primers as in Fig 9.
5AOX:GACTGGTTCCAATTGACAAGC
3AOX:GCAAATGGCATTCTGACATCC
Expression validation
5 verified recombinant clones were selected and inoculated into 2mLYPD medium, and cultured at 30? until OD600=4~6(log-phase growth). Inoculate 1% volume into10 mL BMGY medium and cultivate at 30°C, 200 rpm. When the OD600 is 2-6, centrifuge the-bacteria with a sterile centrifuge tube. Discard BMGY medium, induce expression with 20 mL BMMY medium at 30°C, add methanol with a final concentration of (0.5%)every 24 h, and take samples(induction for 5days).After induction, centrifuge at 1500-3000 g for 5 minutes to collect cells. After removing the supernatant, immediate lysonicate the cells. Use SDS-PAGE and Western Blot to detect protein secretion and expression as in Fig 10 and Fig 11.

BMGY medium composition 1% yeast extract, 2% peptone, 1% glycerol, 4×10-5 % bio-tin, 1.34%YNB, and 0.1 M potassium phosphate, pH 6.0
BMMY medium composition 1% yeast extract, 2% peptone, 4×10-5% biotin, 1.34%YNB, and 0.1 M potassium phosphate, pH 6.0

Target gene synthesis and cloning of SARS-CoV-2 spike(S) protein Subunit -2

C. Preparation of Cell bank:
The preparation of seed bank is performed keeping in view of high productivity. A well-established fact about microorganism is that they are highly potent at the Log phase of their lifecycle.

Stock Culture (received from Creative Biogene) is inoculated into YPD medium and incubated at 200 ± 10 rpm at 30 ± 0.5ºC till the final opacity reaches 10-14 OD units at 600nm. Once the culture attains the log phase, the incubation of the flask is stopped and 80% (v/v) glycerol is added aseptically to the culture to make the final concentration (v/v) of glycerol 20%. 1.5 mL culture is aliquoted into sterile Cryovials under aseptic conditions and vials stored at -80ºC.

Manufacturing process:
The manufacturing of the expressed S1 protein was performed under the principle of seed lot system. Starting from a vial of the Cell Bank of SARS-CoV-2 spike (S) protein subunit 1. Erlenmeyer flasks of 500 mL capacity each containing 100 mL of culture me-dium are inoculated with cell bank and incubated in a shaker at a temperature range of 30ºC at 180 to 200 rpm for 24 to 30 hours. After the incubation, the Erlenmeyer flask was selected on the basis of Optical Density at 600 nm as well as by checking wet weight and microbial purity. The content of one Erlenmeyer flask was aseptically transferred to an inoculation siphon which was used for the inoculation of fermentor (5L working vol-ume of fermenter).
Inoculum was transferred in to the fermentor containing culture media and Fermentation Parameters are kept as Airflow: 1.0 – 2.0 vvm, Temperature: 30º C, pH: 4.8 – 5.2, Stir-rer: 250 - 1000 rpm, DO: =20. Optical density at 600nm, Weight wet (g/L) and microbial purity of fermentation culture was monitored during fermentation. After the wet weight was achieved 75-100 g/L (20 -24 Hrs of culture), fed batch fermentation starts with ex-ternal feeding of glycerol. When the wet weight reaches 250-300 g/L, the culture in fer-mentor starved for one hour. After completion of starvation, Induction feed (Methanol) starts and continues till 108 ± 12 hours. Fermentation was carried out till 120 hours (108 ± 12 hours).
After completion of fermentation, the fermented broth was harvested and centrifuged at 5000 rpm for 15 mins at 2-8ºC. The pellet was collected and resuspended in lysis buffer and sonication was carried out at 750Hz in cold conditions. The sample after sonication was analyzed by SDS-PAGE for protein expression.

Two batches were taken at 5L fermentation scale.

Recombinant clone of SARS-CoV-2 spike (S) protein subunit 1 was cultivated using a 7 L bioreactor (working volume of 5 L) with a control system. The bioreactor was first filled with the basal medium (compound 1 to 6 in Table 1) before being sterilized in situ for 20 minutes at 121°C. Just before inoculation the proper amount of stock solutions (Compound 8 to 9 in table 1) were added to the medium. The bioreactor was inoculated using pre-culture, cultivated on a 100 mL scale using CGM medium (Compound in Ta-ble 2) using glycerol seed lot of the SARS-CoV-2 spike (S) protein subunit 1 stored at -80ºC. The glycerol stock of cell bank was prepared in YPD media (Compound in Table 3).
Table 1 : Composition of Fermentation Basal media
S. No Reagents Concentration/L
1. Phosphoric acid 26.7 mL
2. Calcium Sulfate dihydrate 0.93 g
3. Potassium Sulfate 18.2
4. Magnesium Sulfate heptahydrate 14.9
5. Potassium hydroxide 4.13
6. Glycerol 40 mL
7. WFI Make up 1000 mL
8. Trace element 4.5 mL
9. Biotin solution 7.0 mL

Note: Compounds 1 to 6 can be dissolved in WFI and In-situ sterilized after adjusting the pH to 5.0. Compound 8 to 9 needs separate solution preparation and sterilization.

Table 2 : Composition of CGM media
S. No Reagents Concentration/L
1. Yeast extract 10 g
2. Peptone (Bacteriological) 20 g
3. Casamino acid 15 g
4. Glycerol 40 g
5. Phosphate buffer 100 mL
6. Water For Injection APR

Table 3 : Composition of YPD media
S. No Reagents Concentration/L
1. Peptone (Bacteriological) 20 g
2. Yeast extract 10 g
3. Dextrose 20 g
4. Water For Injection APR

The pH was maintained 4.8 to 5.2 using 25% Ammonia. The temperature was kept con-stant at 30°C. The airflow was maintained in between 1.0 vvm to 2.0 vvm. The dissolved oxygen (DO) was kept at =20% using agitation and aeration.

Samples were collected at an interval of 4 hr. As the growing culture reached the wet weight 75-100 g/L, glycerol feeding was initiated. The feed rate was monitored and con-trolled. As the wet weight of the culture reached 250-300g/L, the glycerol feed was stopped and culture in fermentor was starved for one hour. After starvation of one hour, the Induction feed (Methanol feed) was initiated and feed rate was monitored and con-trolled. The fermentation of Batch 1 and batch 2 was carried for 80-96 hours which may be taken to 110-120 hrs. to get better cell mass.

After completion of fermentation, the fermented broth was harvested in container and the material was centrifuged at 5000 rpm for 15 mins at 2-8ºC. The pellet was collected and suspended in lysis buffer.
After resuspension of pellet in lysis buffer, the sample was withdrawn and sonication is carried out at 750Hz in cold conditions. The S1 samples after sonication of Batch 1 and 2, were analyzed by SDS-PAGE for protein expression. (Fig no - 12 and 13)

Example-2
Extraction and purification of S1 and/or S2 antigen(s) of S- Protein
The extraction and purification of S- Protein S protein subunit-1 and S protein subunit-2 from recombinant Pichia pastoris which has been grown to a satisfactory cell density preferably upto 300 gms/L of fermentation broth (on wet weight basis) preferably re-quires 3 successive steps which are:
(1) Removing of expressed protein from the cell interior by mechanical forces such as shearing forces (for example X-press, or French press) or shaking the glass beads/milling of various sizes ranging up to 1.5mm size but preferably 0.5mm, prefera-bly bead mill eventually with addition of a suitable buffer containing detergent and high strength salt.
(2) Selective enrichment of supernatant with S-Protein using various physico-chemical techniques;
(3) Eliminating substantially all contaminants from the medium using techniques such as
adsorption /desorption using colloidal silica, Centrifugation, Chromatography methods TFF and Ultracentrifugation.
Purification steps:
After re suspension of pellet in lysis buffer and the samples were withdrawn for protein expression, the OD600nm of washed cell was adjusted to 220-280 with lysis buffer. Tween 20 (5.5g/L) was added to the OD adjusted cells under stirring. The cell lysis was initiated using dynomill and lysed cells were collected. 5M NaCl (1/10th volume of ly-sate) was added to the total volume of lysed cells and lysate was stirred for 60 minutes. 50% PEG solution (1/10th of 5M NaCl treated lysate) is added to the total volume of 5M NaCl treated lysate and stirred for 60 minutes. The PEG treated cell lysate was precipi-tated for 10-12 hrs at 8±4oC. Clarification of PEG treated cell lysate was carried out by centrifugation at 6000-8000 RPM and supernatant was collected.

Adsorption and desorption of clarified PEG supernatant was performed by added the sil-ica-based material (Aerosil) suspension and stirring at 8±4ºC. The process takes 4-6 hours for completion. On settling of silica-based material adsorption, the supernatant was decanted off. At this stage the washing of silica-based material bed was carried out using wash buffer with NaCl and stir for 10-20 minutes. The sup was decanted off after settling of the washed silica-based material. After decanting the sup, the wash buffer without NaCl was added to the material and stirring takes place for 10-20 minutes. The washed sup was decanted off.

The washed adsorbed silica-based material was transferred to the desorption vessel con-taining elution buffer added under stirring conditions at 37-40? for 2-4 hours. The de-sorbed silica-based material was loaded on depth filtration system and recirculate for 10-20 minutes. The clarified desorbate material was collected through 0.45µm membrane filter in vessel/container. The depth filtration system was rinsed with elution buffer to recover the desorbed content.
The purification of the filtered desorbate was performed by Ion exchange chromatog-raphy.
The chosen resin was composed of a base material of hydroxylated methacrylic polymer beads that have been functionalized with diethylaminoethyl (DEAE) weak anion ex-change groups. Alternatively mix mode chromatography was used by employing ceramic Hydroxyapatite type 1 resin to purify the antigen by employing appropriate buffers for equilibration and elution.
The material was loaded followed by washing of column resin with buffer. Elution of 0.2 to 0.3 M fraction was carried out and the fraction was collected into sterile glass bottle. Elution of 0.5 to M fraction was carried out and the collected elute was drained.

Concentration of 0.2 M fractions was performed using UFS (Ultra filtration system). 30 Kd size MWCO Cassette was used to carry out thaws process. At thaws stage the 0.2 M elution fraction was concentrated and the concentrated fraction (retentive) was collected in sterile glass bottle and permeate was discarded. The process takes 8-16 hrs. hours for completion.

Cesium chloride (27g of CsCl for 100 mL of concentrate) was added to the 30 kD con-centrate and mix well (adjusted to the 1.2). The 1.2 adjusted 30 kD concentrate was cen-trifuged at about 65,000 rpm for about 20 to about 24 hours at 4? temperature. The an-tigen band (golden brown ring) was collected using sterile syringe into a sterile bottle. The unwanted solution (other than golden brown ring) was collected in to another sterile bottle.

The antigen was filtered with 0.2 µ filter and filtrate was collected into sterile bottle. The filtered ultra-purified antigen was sampled and tested for Description, Protein content, Purity, Lipid content, Carbohydrate content, DNA content and stored at 5 ? 3°C till further purification step.

Further Potassium thiocyanate or other suitable high concentration salt buffer was added to ultra – purified antigen and incubated for about 4 to about 10 minutes at 37 ± 1 ?. The KSCN treated ultra - purified antigen was chilled to 2 to 8? temperature.

Ultra – purified antigen was concentrated using 10 kD filtration system at 2 -8? fol-lowed by diafiltration (until it reaches the original 1/3 volume) with PBD buffer. The diafiltered bulk was collected in sterile bottle. Followed by 0.45-micron filtration.

The last stage of the production process of the Active Raw Material was the sterile filtra-tion which was carried out using PES capsule or cartridge filter, pore size 0.22-?m. The filtered material was sampled to test/analyse various parameters and 50 mg/mL 2-Phenoxyethanol was added to the filtered bulk (to get the final concentration of 0.05 mg/mL of 2_PE of bulk). The final material was sampled to test/analyse various parame-ters and was stored in cold room at about 2 to about 8 ºC.

Example -3
Formulation and Fill Finish process
Purified Bulk antigen was formulated into desired doses form using appropriate buffer, Aluminium compound adjuvant and suitable preservative. Formulation activity was per-formed at required temperature for desired time with mixing parameters. The antigen S1 subunit of S protein was added to the Aluminium based adjuvant followed by addition of isotonic salt solution, stabilizer and preservative.
In case of bivalent antigen composition, the other subunit of S protein S2 protein was added after S1 antigen on Aluminium salt and mixed well followed by addition of iso-tonic salt solution, stabilizer and preservative. Once tested and approved, formulated vaccine was filled of desired dose volume.
Lyophilized formulation comprises of antigen S1 of S-protein along with appropriate stabilizer and buffer. Freeze drying of formulated composition was carried out for 24-36 ºC.

A. Process for producing a fully liquid adjuvant based S1 single –antigen Vaccine:
S1 antigen was added to sterile Aluminium phosphate gel aseptically. The mixture was stirred gently at 100-400 rpm (preferably 200-300 rpm) for 2-4 hrs followed by addition of sterile isotonic sodium chloride solution, suitable stabilizer and preservative 2-Phenoxyethanol (2-POE) at pH ranging between 6.0-7.0 (preferably 6.4-6.8). The mix was blended for 1-3 hrs (preferably 2 hrs) at 100-400 rpm (preferably 200-300 rpm) at temperature 8-18 °C (preferably 12-14 °C) to form a sterile and uniform suspension.

The fully liquid S1 antigen vaccine formulation obtained as mentioned above, formulat-ed, filled, stoppered, sealed and labelled in appropriate single dose and multi dose con-tainers for individual as well as mass vaccination. The labelled vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any preservative whereas multi dose formulation contained suitable stabilizer and 2- Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0.

B. Process for producing a fully liquid adjuvant bivalent based (S1+ S2 antigens) Vaccine:
The Bi-valent formulation comprising of S1 antigen and S2 antigen are adsorbed on ad-juvant alum salt preferably aluminium phosphate to provide fully liquid vaccine compo-sition.
S1 antigen was added to sterile Aluminium phosphate gel aseptically. The mixture was stirred gently at 100-400 rpm (preferably 200-300 rpm) for 2-4 hrs followed by addition S2 antigen. The mixture was stirred gently at 100-400 rpm (preferably 200-300 rpm) for 2-4 hrs followed by addition of sterile isotonic sodium chloride solution, suitable stabi-lizer and preservative 2-Phenoxyethanol (2-POE) at pH ranging between 6.0 -7.0 (prefer-ably 6.4-6.8). The mix was blended for 1-3 hrs (preferably 2 hrs) at 100-400 rpm (prefer-ably 200-300 rpm) at temperature 8-18 °C (preferably 12-14 °C) to form a sterile and uniform suspension.

The fully liquid S1 & S2 antigen vaccine formulation obtained as mentioned above, for-mulated, filled, stoppered, sealed and labelled in appropriate single dose and multi dose containers for individual as well as mass vaccination. The labelled vials were stored at about 2-8°C for optimum shelf life. The single dose formulation was without any pre-servative whereas multi dose formulation contained suitable stabilizer and 2-Phenoxyethanol (2-POE) as preservative at pH ranging between 6.0 -7.0.

Example- 4
Process for producing Lyophilized vaccine using S1 and /or S2 antigen(s)
Lyophilized formulation comprises of antigen S1 and/or S2 antigen(s) of S-protein along with appropriate stabilizer and buffer. Freeze drying of formulated composition was car-ried out for 24-36 hrs (preferably 30-34 hrs) using primary as well as secondary drying in recipe.

The Lyophilized vaccine containing S1 and/or S2 antigen obtained as mentioned in the above examples, followed by formulated, filled, freeze dried, stoppered, sealed and la-belled in appropriate single dose containers for individual use. The labelled vials were stored at about 2-8°C for optimum shelf life.

Although the preferred embodiments of the present invention and their respective varia-tions have been described, people having ordinary skills in the art would envision vari-ous modifications of those embodiments. Accordingly, the present invention should not be limited to precise forms and manners in the above disclosure and description but should simply be taken by way of examples. Thus, the present invention can be varied and modified without departing the true scope and spirit thereof as defined in the ap-pended claims.
,CLAIMS:WE CLAIMS:

1. A process for producing a stable single-antigen vaccine composition, the process comprising:
a. S1-antigen composition, wherein the S1 antigen expressed in yeast as in-dividual clone,
b. purification of expressed single S1antigen ,and
c. adding and mixing S1 with non-antigenic component (s) for stability of the single S1 -antigen vaccine against SARS CoV-2 virus.
2. The single-antigen vaccine composition as claimed in claim 1, wherein yeast is
Pichia pastoris .

3. The process of producing a stable single -antigen composition as claimed in claim
1, wherein the vaccine is a fully liquid vaccine.

4. The process of producing a fully liquid Single -antigen vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consists of S1 antigen about 5 µg to about 20 µg per dose each of 0.5ml of the composition.

5. A process of producing a fully liquid single -antigen vaccine composition as claimed in claim 3, wherein the fully liquid vaccine consist of S1 antigen is at least 10 µg per dose each of 0.5ml of the composition.

6. The single-antigen vaccine composition as claimed in claim 1, wherein the sin-gle -antigen vaccine composition further comprises one or more non-antigenic com-ponent(s) that are pharmaceutically acceptable excipients selected from adjuvant, stabilizer, non-mercury preservative, tonicity agent, pH modifier, and buffer.
7. The single-antigen vaccine composition as claimed in claim 6, wherein the ad-juvant is alum salt preferably Aluminum phosphate.

8. The single-antigen vaccine composition as claimed in claim 7, wherein the Aluminum content (Al3+) in the composition is about 0.5 mg to about 1.25 mg .

9. The single-antigen vaccine composition as claimed in claim 8, wherein the alu-minum content (Al3+) in the composition is at least 0.25 mg in 0.5ml.

10. The single-antigen vaccine composition as claimed in claim 6, wherein the pre-servative is 2-phenoxyethanol (2-POE) in the composition should not exceed 0.1mg/ml.

11. The single-antigen vaccine composition as claimed in claim 6, wherein the pre-servative is 2-phenoxyethanol (2-POE) in the composition is at least 0.05mg/ml.

12. The single -antigen vaccine as claimed in claim 6,wherein the tonicity modify-ing agent is selected from the group of salt including NaCl, MgCl2, KCl, and CaCl2; sugar including Dextrose, Mannitol, and Lactose; amino acid including Arginine, Glycine, and Histidine; polyol including Glycerol and Sorbitol; or mixture thereof.

13. The single-antigen vaccine as claimed in claim 6, wherein the pH modifier is se-lected from sodium hydroxide, hydrochloric acid or combination and comprises a pH in the range of 6 – 7.

14. The single-antigen vaccine as claimed in claim 6, wherein the buffer is selected from sodium phosphate, potassium phosphate, citrate buffer or combinations thereof.

15. A process of producing a fully liquid single-antigen vaccine composition , the process comprising:
a. adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Alumi-num phosphate and blending,
b. addition of physiological saline, stabilizer and non-mercury preservative 2-phenoxyethanol (2-POE) at pH of about 6.4-6.8 to the mixture of absorbed S1 antigen, on Aluminum phosphate ,and
c. further, blending by stirring the composition at a speed of about 200-300 rpm-for a period of about 8-16 hrs.

16. The single -antigen vaccine composition as claimed in claim 1, wherein the
composition may contain additional antigen along with S1 antigen.

17. The single -antigen vaccine composition as claimed in claim 16, wherein the
composition contain S2 antigen along with S1 antigen.

18. The single -antigen vaccine composition as claimed in claim 1, wherein the S2
subunit is express separately in Pichia pastoris.

19. A process of producing a fully liquid bivalent antigen vaccine composition , the process comprising:
a. adding at least 10 µg S1 antigen to adsorb on Alum salt preferably Aluminum phosphate and blending,
b. adding at least 10 µg S2 antigen to adsorb on Alum salt preferably Aluminum phosphate and blending,
c. addition of physiological saline, stabilizer and non-mercury preservative 2-phenoxyethanol (2-POE) at pH of about 6.4-6.8 to the mixture of absorbed S1 and S2 antigens , on Aluminum phosphate ,and
d. further, blending by stirring the composition at a speed of about 200-300 rpm-for period of about 8-16 hrs.

20. The fully liquid vaccine composition as claimed in claims 15 and 19, wherein the single –antigen and bivalent antigen vaccine composition may or may not be a lyophi-lized composition.

21. The fully liquid vaccine composition as claimed in claims 15 and 19, wherein the purification process of S1 and/or S2 antigen (s) comprising:
a. chromatography steps used as single or in combination with 2 or more
chromatography steps with different resins and parameters for binding and elu-
tion of protein,

b. One of the resin was composed of a base material of hydroxylated methacrylic polymer beads functionalized with diethylaminoethyl - DEAE and used as ion exchange chromatography agent,

c. Other resin used in combination or alone is ceramic Hydroxyapatite type 1 used as mix mode chromatography, and

d. chromatography steps used as standalone steps as well as in combination with other techniques of purification such as TFF and centrifugation to purify the S1and or S2 antigen(s) by employing appropriate buffers for equilibration and elution.

22. The fully liquid multi-antigen vaccine composition as claimed in claims 15 and 19, wherein the single –antigen and bivalent antigen vaccine composition are presented as single and multi - dose presentation.

Documents

Application Documents

# Name Date
1 202021017463-PROVISIONAL SPECIFICATION [23-04-2020(online)].pdf 2020-04-23
2 202021017463-POWER OF AUTHORITY [23-04-2020(online)].pdf 2020-04-23
3 202021017463-FORM FOR SMALL ENTITY(FORM-28) [23-04-2020(online)].pdf 2020-04-23
4 202021017463-FORM FOR SMALL ENTITY [23-04-2020(online)].pdf 2020-04-23
5 202021017463-FORM 1 [23-04-2020(online)].pdf 2020-04-23
6 202021017463-EVIDENCE FOR REGISTRATION UNDER SSI(FORM-28) [23-04-2020(online)].pdf 2020-04-23
7 202021017463-EVIDENCE FOR REGISTRATION UNDER SSI [23-04-2020(online)].pdf 2020-04-23
8 202021017463-DECLARATION OF INVENTORSHIP (FORM 5) [23-04-2020(online)].pdf 2020-04-23
9 202021017463-RELEVANT DOCUMENTS [17-04-2021(online)].pdf 2021-04-17
10 202021017463-POA [17-04-2021(online)].pdf 2021-04-17
11 202021017463-FORM 13 [17-04-2021(online)].pdf 2021-04-17
12 202021017463-SEQUENCE LISTING (.txt) [22-04-2021(online)].txt 2021-04-22
13 202021017463-FORM-9 [22-04-2021(online)].pdf 2021-04-22
14 202021017463-FORM 18 [22-04-2021(online)].pdf 2021-04-22
15 202021017463-DRAWING [22-04-2021(online)].pdf 2021-04-22
16 202021017463-CORRESPONDENCE-OTHERS [22-04-2021(online)].pdf 2021-04-22
17 202021017463-COMPLETE SPECIFICATION [22-04-2021(online)].pdf 2021-04-22
18 Abstract1.jpg 2021-10-19
19 202021017463-MARKED COPIES OF AMENDEMENTS [05-08-2022(online)].pdf 2022-08-05
20 202021017463-FORM-26 [05-08-2022(online)].pdf 2022-08-05
21 202021017463-FORM 13 [05-08-2022(online)].pdf 2022-08-05
22 202021017463-AMENDED DOCUMENTS [05-08-2022(online)].pdf 2022-08-05
23 202021017463-FORM-8 [01-10-2022(online)].pdf 2022-10-01
24 202021017463-RELEVANT DOCUMENTS [07-12-2022(online)].pdf 2022-12-07
25 202021017463-POA [07-12-2022(online)].pdf 2022-12-07
26 202021017463-MARKED COPIES OF AMENDEMENTS [07-12-2022(online)].pdf 2022-12-07
27 202021017463-FORM 13 [07-12-2022(online)].pdf 2022-12-07
28 202021017463-AMENDED DOCUMENTS [07-12-2022(online)].pdf 2022-12-07
29 202021017463-Proof of Right [19-01-2023(online)].pdf 2023-01-19
30 202021017463-FER.pdf 2025-08-29
31 202021017463-OTHERS [06-10-2025(online)].pdf 2025-10-06
32 202021017463-FER_SER_REPLY [06-10-2025(online)].pdf 2025-10-06
33 202021017463-CLAIMS [06-10-2025(online)].pdf 2025-10-06

Search Strategy

1 202021017463_SearchStrategyNew_E_SearchStrategyE_06-08-2025.pdf