Sign In to Follow Application
View All Documents & Correspondence

"Production Of Ara (Arachidonic Acid) In Yeast And A Method Thereof"

Abstract: The present invention relates to a specifically novel recombinant method of production of the omega-3 fatty acid, Arachidonic acid (ARA) by a potentially safe recombinant organism Saccharomyces cerevisiae. The invention describes the process of bioconversion of oleic acid to ARA through a series of enzymatic conversions facilitated through the cloning of the respective genes into appropriate vectors and the final expression of the ARA in the host cell, Yeast.

Get Free WhatsApp Updates!
Notices, Deadlines & Correspondence

Patent Information

Application #
Filing Date
26 October 2009
Publication Number
19/2012
Publication Type
INA
Invention Field
BIOTECHNOLOGY
Status
Email
Parent Application

Applicants

AVESTHAGEN LIMITED
'DISCOVERER', 9TH FLOOR, INTERNATIONAL TECH PARK, WHITEFIELD ROAD, BANGALORE - 560 066.

Inventors

1. PATELL, VILLOO MORAWALA
C/O AVESTHAGEN LIMITED, 'DISCOVERER', 9TH FLOOR, INTERNATIONAL TECH PARK, WHITEFIELD ROAD, BANGALORE - 560 066.
2. KRISHNASWAMY, SAROJA MYSORE
C/O AVESTHAGEN LIMITED, 'DISCOVERER', 9TH FLOOR, INTERNATIONAL TECH PARK, WHITEFIELD ROAD, BANGALORE - 560 066.
3. RANGANATH, PAVANA
C/O AVESTHAGEN LIMITED, 'DISCOVERER', 9TH FLOOR, INTERNATIONAL TECH PARK, WHITEFIELD ROAD, BANGALORE - 560 066.

Claims

1. A process for the production of Arachidonic acid comprising of the following steps: (a) a host cell comprising: (i) an isolated nucleotide molecule encoding a DELTA-12 desaturase polypeptide sequence as set forth in SEQ ID NO: 1; (ii) an isolated nucleotide molecule encoding a DELTA-6 desaturase polypeptide sequence as set forth in SEQ ID NO: 2; and (iii) an isolated nucleotide molecule encoding a cl8/c20 elongase polypeptide sequence as set forth in SEQ ID NO: 3; (iv) an isolated nucleotide molecule encoding a DELTA - 5 desaturase polypeptide sequence as set forth in SEQ ID NO: 3; (b) growing the host cell of step (a) under conditions wherein the nucleic acid molecule encoding the DELTA 12 and DELTA 6 desaturase, elongase and Delta 5 desaturase polypeptide is expressed and the Oleic acid is converted to Arachidonic acid; and (c) optionally recovering the Arachidonic acid of step (b).

2. An isolated nucleotide molecule encoding a DELTA 12 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:l.

3. An isolated nucleotide molecule encoding a DELTA 6 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:2.

4. An isolated nucleotide molecule encoding a C18/C20 elongase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:3.

5. An isolated nucleotide molecule encoding a DELTA 5 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:4.

6. A chimeric gene comprising the isolated nucleic acid molecule of claim 2, operably linked to suitable regulatory sequences.

7. A chimeric gene as claimed in claim 6 comprising the isolated nucleic acid molecule of claim 3 operably linked to suitable regulatory sequences.

8. A chimeric gene as claimed in 7 comprising the isolated nucleic acid molecule of claim 4 operably linked to suitable regulatory sequences.

9. A chimeric gene as claimed in 8 comprising the isolated nucleic acid molecule of claim 5 operably linked to suitable regulatory sequences.

10. An isolated transformed host cell comprising the isolated nucleic acid molecules of claim 9 being oleaginous yeast, such as but not limited to Saccharomyces cerevisiae.

Specification

The following specification particularly describes and ascertains the nature of this invention and the manner in which it is to be performed.

FIELD OF INVENTION

The instant invention pertains to methods of expressing enzymes comprising polyunsaturated fatty acid biosynthetic pathway in an oleaginous yeast host for the production of Arachidonic acid (ARA) The oleaginous yeast used in this method includes Saccaromyces cervisceae.

Further, the invention relates to transformation of transformation of Delta-12 desaturase, Delta-6 desaturase, D-6 elongase and D5 desaturase into yeast host Such methods include, transforming a yeast cell with nucleic acid molecules, which encode proteins having an activity of catalyzing the formation of double bonds in the oleic acid, linoleic acid, gamma linolenic acid and dihomo gamma linolenic acid respectively.

Advantageously, the invention is feasible and also commercially viable.

The nucleic acid sequences depicted herein are incorporated in a vector and are operably linked to a promoter or other regulatory elements for the expression of the genes in host cell.

BACKGROUND OF THE INVENTION

Arachidonic acid is one of the essential fatty acids required by most mammals. AA is a 20 carbon Omega 6 fatty acid, with four double bonds 20:4(co-6). Some mammals lack the ability to or have a very limited capacity to convert linoleic acid into arachidonic acid, making it an essential part of their diet. Animal food is the main source of Arachidonic acid.

Arachidonic acid is a polyunsaturated fatty acid that is present in the phospholipids (especially phosphatidylethanolamine, phosphatidylcholine and phosphatidylinositides) of membranes of the body's cells, and is abundant in the brain.lt is also involved in cellular signaling as a second messenger.lt is the source of several other molecules with specific roles.

Arachidonic acid is one of the most abundant fatty acids in the brain, and is present in similar quantities to DHA (docosahexaenoic acid). The two account for approximately 20% of its fatty acid content.Like DHA, neurological health is reliant upon sufficient levels of arachidonic acid.

Among other things, arachidonic acid helps to maintain hippocampal cell membrane fluidity. It also helps protect the brain from oxidative stress by activating perioxisomal proliferator-activated receptor-y.ARA also activates syntaxin-3 (STX-3), a protein involved in the growth and repair of neurons.

An important family of regulatory molecules is derived from arachidonic acid, and these molecules collectively are often called the eicosanoids. They are synthesized by most tissues and have an incredibly wide range of actions. However, many of the most important are linked to defense against damage and pathogens. We will encounter them especially in the areas of inflammation and hemostasis.

GLA is available in Borage oil. Arachidonic acid is available only from animal source. As a result of this limitation, extensive work has been conducted towards the development of recombinant sources to produce the desired PUFAs commercially.

BRIEF SUMMARY OF INVENTION

Present invention is directed to the transformation of Delta-12 desaturase, Delta-6 desaturase, D- 6 elongase and D5 desaturase into yeast host.

The D-12 desaturase from B. juncea is a desaturase that can introduce double bond into oleic acid to convert it to Linoleic acid.

D-6 desaturase from M. alpina is capable of introducing a double bond into Linoleic acid to convert it to gamma linolenic acid.

D-6 elongase from M. alpina is capable of introducing a double bond into GLA to convert it to DHGLA.

D-5 desaturase from M. alpina introduces double bond into DHGLA to convert it to Arachidonic acid.

Accordingly the present invention features methods of producing Arachidonic acid in yeast.

Such methods include, transforming a yeast cell with a nucleic acid molecules, which encode proteins having an activity of catalyzing the formation of double bonds in the oleic acid, linoleic acid and gamma linolenic acid respectively.

The nucleic acid sequences depicted herein are incorporated in a vector and is operably linked to a promoter or other regulatory elements for the expression of the genes in host cell.

DESCRIPTION OF THE ACCOMPANYING DRWAINGS

FIGURE 1: Amplification of D-12 desaturase from B. juncea.

FIGURE 2: Fatty acid desaturase domain in the 1.16kb sequence of D-12 desaturase of BPR 559

FIGURE 3: D12 desaturase cloned into the MCSII site under the GAL1 promoter of pESC-His.

FIGURE 4: Amplification of D-6 desaturase from total RNA of M.alpina

FIGURE 5: Map of the construct pESC-Trp/M.alp-D6 desaturase

FIGURE 6: Construct map for pESCHis-BjD12+M.alpD6

FIGURE 7: Amplification of Elongase from Total RNA of M. alpina through RT PCR

FIGURE 8: Map of the construct pESC-Trp/M.alpElongase

FIGURE 9: Map of the construct pESC-Trp/M.alpElongase+D5 desaturase

FIGURE 10:GC-MS profile for fatty acids extracted from yeast clones subjected to proof of function experiment.

Description of the Sequence Listings:

SEQ ID NO 1: Codon optimized sequence of deltal2 desaturase from Brassica juncea BPR559 with nucleotide substitutions. SEQ ID NO 2: Nucleotide Sequence of delta-6 desaturase ORF isolated from M.alpina 32222 SEQ ID NO 3: Nucleotide Sequence of C18/C20elongase from M.alpina 32222 SEQ ID NO 4: Nucleotide sequence of Delta-5 desaturase from M.alpina 32222.

DETAILED DESCRIPTION

Archidonic acid is an essential fatty acid and the dietary source for this fatty acid is only through egg, meat and fish. Humans have a limited capacity to synthesize these essential fatty acids. Biotechnology has been thought to be an efficient way to synthesize the essential fatty acids. Synthesis of these fatty acids is achieved by manipulating the biosynthetic pathways in microorganisms by recombinant DHA technology. The methodology has proven to be cost-effective, renewable and also has minimal side effects. S. cerevisiae has been established as a

platform for the production of several fatty acids. The same platform has been chosen for developing a method for the production of Arachidonic acid. Present invention is based in part, on the cloning of the three desaturases and an elongase required for the conversion of Oleic Acid, which is indigenously present in the yeast to ARA an essential fatty acid.
Amplification and cloning of D-12 desaturase from Bras ska juncea
The D-12 desaturase has been cloned from genomic DNA of Brassica juncea and has been found to have a single exon, with an ORF of 1155bp (Katavic and Taylor, 2000). Primers designed to amplify the gene from Brassica juncea are given below:

A-12 Forward:

5' -ATGGGTGCAGGTGGAAGAATGCAAGTCTCTCCTC-3'


A-12 Reverse

5'- TCATAACTTATTGTTGTACCAGAAC -3'

DNA was isolated from three popular varieties of Brassica juncea - RL-99-27, BPR-559 and Brassica rapa Skm-9816.

lOOng of genomic DNA of RL-99-27, Skm-9816 and BPR-559 varieties of B. juncea were used to amplify the ORF of D-12 desaturase.(FIGURE 1)

Comparison of the nucleotide and amino acid sequences of D-12 desaturase of B. juncea
varieties RL-99-27, BPR-559 and B. rapa SKM-9816 with that of B. napus (Ace. No. AAS 92240) clearly showed that the sequence of BPR-559 was the closest to that of B. napus. The cDNA sequence of all varieties translates into a protein of 384aa. Search for motifs confirmed that the sequence isolated has the fatty acid desaturase domain required for desaturase activity.(FIGURE 2)

The codon bias of Brassica is considerably different from that of yeast; hence, the codons used in the D-12 desaturase of Brassica had to be optimized for expression in yeast - the target organism for production of PUFAs. 'CTC coding for leucine and 'CGC coding for arginine had to be replaced by appropriate nucleotides in order to optimize the expression of this gene in yeast.

A total of 23 changes had to be made in the sequence for optimizing D-12 desaturase for expression in yeast. The D12 desaturase of BPR559 was subjected to nucleotide changes using the Quickchange Multi site-directed mutagenesis Kit from Stratagene. Codon optimized sequence for D12 desaturase is given in SEQ ID 1

The YPH 499 cells were transformed with the construct (FIGURE 3) and the transformants were selected on SDHis- medium. The transformants were subjected to POF (Proof Of Function) experiment by the protocol outlined below.

Twenty four hour old culture of yeast cells carrying plasmid of interest was inoculated into 7ml of SD-AA selection medium (0.67%YNB without AA, 2%Dextrose, 0.13% AA dropout powder minus His). Cultures were Incubated at 30°C for overnight .10%(3.0ml) of inoculum was used to inoculate into 30ml of SD-/ SG-AA selection medium.(0.67%YNB without AA, 2% Galactose, 0.13% AA drop out powder minus His) Cultures were incubated for 24 hours at 25°C. Cells were pelleted, washed with media w/o carbon source and water. Fatty acid extraction was done using hexane and profiling was done using GC-MS.


Result

It can be noted that conversion from OA to LA, was observed in all the induced clones. These results confirm the activity of D12 desaturase (B.j) in yeast.

Amplification and cloning of D-6 desaturase from M.alpina
Cloning of D6 desaturase has been reported (Sakuradani, E, 1999). Gene specific primers with the restriction sites were designed to amplify the fragment.

RT PCR reaction was performed using cMaster RT Plus PCR system (Eppendorf) in order to amplify the gene from total RNA.(FIGURE 4)

The 1.3 KB PCR fragment was cloned into pGEM-T easy vector. D-6 desaturase of M.alpina present in pGEM-T easy vector was cloned between EcoRI and Spel sites of the pESC-Trp vector (FIGURE 5). The clones were confirmed by RE digestion and DNA sequencing. (SEQ ID 2).

YPH499was transformed with the construct (FIGURE 5) and POF performed with the addition of LA and ALA into the medium in presence of 0.1% tergitol. SD and SG correspond to Uninduced and Induced samples. GCMS results are tabulated here

Result: Conversion of LA to GLA and ALA to STA is seen indicating that the gene A-6 desaturase is functional in yeast.

Cloning of B.juncea D12 desaturase and M. alpina D6 desaturase into single construct.
D6-Desaturase of M. alpina was cloned into EcoRI and Clal sites of the pESC-His construct having codon optimized D12 desaturase present in. construct map Fig: 6.
Proof of Function:

YPH 499 was transformed with the plasmid containing the Bj D12 desaturase and M.alp D-6 desaturase.

Clones were induced with galactose and were grown without the addition of fatty acid into the medium. SD and SG correspond to Uninduced and Induced samples. GCMS analysis gave the following result.

Result: Conversion of OA to GLA via LA is seen in the induced samples indicating that both the genes are functional.

Amplification and cloning of Elongase:

Cloning of Elongase from M. alpina has already been reported (Parker-Barnes, J. M. et al., 2000). Gene specific primers with the restriction sites were designed to amplify the fragment.

RT PCR reaction was performed using cMaster RT Plus PCR system (Eppendorf) in order to amplify the gene (FIGURE 7). The PCR product (957bp) was cloned into pGEM-T easy vector. (SEQ ID 3) M. alpina Elongase present in pGEM-T easy vector has been digested with EcoRI and Clal enzymes and cloned directionally into pESC-Trp vector digested with the same enzymes. Map of the construct is given in FIGURE 8.
Yeast host YPH 499 was transformed with the construct. Clones were subjected to proof of function experiments as detailed earlier. The pellets were used for the extraction of total lipids. The fatty acids extracted were converted into FAMES and analysed by GC-MS. SD and SG correspond to Uninduced and Induced samples. GCMS analysis gave the following result.

Result: Conversion or GLA to DGLA is seen m the induced samples indicating that the gene Elongase is functional in yeast.

Proof of Function of gene combinations (D12+D6)+(Elo)
Host yeast YPH 499 cells was co-transformed with pESC-His/(B.jA12+M.alpA6) and pESC-Trp/(M.alp Elongase). Clones were induced with galactose and were grown without the addition of fatty acid into the medium. FAMEs were analysed by GC-MS. SD and SG correspond to Uninduced and Induced samples. GCMS analysis gave the following result.

Result: Conversion of OA to DGLA via GLA is seen in the induced samples indicating that all the three genes are functional and produce DGLA in yeast.

Cloning of M.alpina D5 desaturase into pESC-Trp/Ma/pma-Elo construct,
M.alpina D5 desaturase (SEQ ID 4) was amplified using the primers carrying Apal and Nhel restriction sites. PCR product was digested with the above enzymes and cloned into MCSII of pESCTrp/ M.alpina Elongase construct directionally. Construct pESC-Trp/Ma//>/«a-Elo+D5 desaturase (FIGURE 9) was transformed into YPH499 and clones obtained were subjected to POF experiment with the addition of GLA into the medium.
Result: All the clones showed the conversion of GLA-DHGLA and ARA. This proves functionalities of both the Elongase and D5 desaturase genes in construct.

Transformation of pESCHis /(B.juncea D12Co+Af. alpina D6)+ pESC-Ura/M alpina Elo+D5 desaturase into YPH499

Constructs pESCHis/B.juncea D12Co+M.alpinaD6 (FIGURE 6) and pESC-Ura/M.a/pma/D6-Elo+D5 (FIGURE 9) desaturase were co-transformed into YPH499 electro-competent cells. Clones obtained were confirmed by amplification with the gene-specific primers. Clones were subjected to proof of function experiment by simple induction.

Result: All the clones showed the conversion of OA-LA-GLA-DHGLA-ARA, proving all the four genes are functional and bringing about the desired conversions. (REFER FIGURE 10)

We claim:

1. A process for the production of Arachidonic acid comprising of the following steps:
(a) a host cell comprising:

(i) an isolated nucleotide molecule encoding a DELTA-12 desaturase polypeptide
sequence as set forth in SEQ ID NO: 1;

(ii) an isolated nucleotide molecule encoding a DELTA-6 desaturase polypeptide
sequence as set forth in SEQ ID NO: 2; and

(iii) an isolated nucleotide molecule encoding a cl8/c20 elongase polypeptide sequence as set forth in SEQ ID NO: 3;

(iv) an isolated nucleotide molecule encoding a DELTA - 5 desaturase polypeptide
sequence as set forth in SEQ ID NO: 3;

(b) growing the host cell of step (a) under conditions wherein the nucleic acid molecule encoding the DELTA 12 and DELTA 6 desaturase, elongase and Delta 5 desaturase polypeptide is expressed and the Oleic acid is converted to Arachidonic acid; and

(c) optionally recovering the Arachidonic acid of step (b).

2. An isolated nucleotide molecule encoding a DELTA 12 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:l.

3. An isolated nucleotide molecule encoding a DELTA 6 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:2.

4. An isolated nucleotide molecule encoding a C18/C20 elongase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:3.

5. An isolated nucleotide molecule encoding a DELTA 5 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO:4.

6. A chimeric gene comprising the isolated nucleic acid molecule of claim 2, operably linked to suitable regulatory sequences.

7. A chimeric gene as claimed in claim 6 comprising the isolated nucleic acid molecule of claim 3 operably linked to suitable regulatory sequences.

8. A chimeric gene as claimed in 7 comprising the isolated nucleic acid molecule of claim 4 operably linked to suitable regulatory sequences.

9. A chimeric gene as claimed in 8 comprising the isolated nucleic acid molecule of claim 5 operably linked to suitable regulatory sequences.

10. An isolated transformed host cell comprising the isolated nucleic acid molecules of claim 9 being oleaginous yeast, such as but not limited to Saccharomyces cerevisiae.

Documents

Application Documents

# Name Date
1 2580-che-2009 form-5 26-10-2009.pdf 2009-10-26
2 2580-che-2009 form-3 26-10-2009.pdf 2009-10-26
3 2580-che-2009 form-2 26-10-2009.pdf 2009-10-26
4 2580-che-2009 form-1 26-10-2009.pdf 2009-10-26
5 2580-che-2009 drawings 26-10-2009.pdf 2009-10-26
6 2580-che-2009 description (provisional) 26-10-2009.pdf 2009-10-26
7 2580-CHE-2009 FORM-2 03-08-2010.pdf 2010-08-03
8 2580-CHE-2009 CORRESPONDENCE OTHERS 03-08-2010.pdf 2010-08-03
9 2580-CHE-2009 CORRESPONDENCE OTHERS 21-10-2010.pdf 2010-10-21
10 2580-CHE-2009 CORRESPONDENCE OTHERS 22-10-2010.pdf 2010-10-22
11 2580-CHE-2009 SEQUENCE LISITING 22-10-2010.pdf 2010-10-22
12 2580-CHE-2009 FORM-5 22-10-2010.pdf 2010-10-22
13 2580-CHE-2009 FORM-3 22-10-2010.pdf 2010-10-22
14 2580-CHE-2009 DESCRIPTION (COMPLETE) 22-10-2010.pdf 2010-10-22
15 2580-CHE-2009 CLAIMS 22-10-2010.pdf 2010-10-22
16 2580-CHE-2009 FORM-2 22-10-2010.pdf 2010-10-22
17 2580-CHE-2009 DRAWINGS 22-10-2010.pdf 2010-10-22
18 2580-CHE-2009 ABSTRACT 22-10-2010.pdf 2010-10-22