Abstract: The present invention relates to a specifically novel recombinant method of production of the omega-3 fatty acid, Eicosapentaenoic acid (EPA) by a potentially safe recombinant organism Saccharomyces cerevisiae. The invention describes the process of bioconversion of oleic acid to EPA through a series of enzymatic conversions facilitated through the cloning of the respective genes into appropriate vectors and the final expression of the EPA in the host cell, Yeast.
1. A method for the production of Arachidonic acid comprising: (a) providing a host cell comprising: (i) an isolated nucleotide molecule encoding a DELTA-12 desaturase polypeptide sequence as set forth in SEQ ID NO: 1; (ii) an isolated nucleotide molecule encoding a DELTA-6 desaturase polypeptide sequence as set forth in SEQ ID NO: 2; and (iii) an isolated nucleotide molecule encoding a cl8/c20 elongase polypeptide sequence as set forth in SEQ ID NO: 3; (iv) an isolated nucleotide molecule encoding a DELTA - 5 desaturase polypeptide sequence as set forth in SEQ ID NO: 4; (v) an isolated nucleotide molecule encoding a co-3 desaturase polypeptide sequence as set forth in SEQ ID NO: 5; (b) growing the host cell of step (a) under conditions wherein the nucleic acid molecule encoding the DELTA 12 and DELTA 6 desaturase, elongase Delta 5 desaturase and co-S desaturase polypeptide is expressed and the Oleic acid is converted to Eicosapentaenoic acid; and (c) optionally recovering the Eicosapentaenoic acid of step (b).
2. An isolated nucleotide molecule encoding a DELTA 12 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO: 1.
3. An isolated nucleotide molecule encoding a DELTA 6 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID N0:2.
4. An isolated nucleotide molecule encoding a C18/C20 elongase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID N0:3.
5. An isolated nucleotide molecule encoding a DELTA 5 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID N0:4.
6. An isolated nucleotide molecule encoding a co-3 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO: 5.
7. A chimeric gene comprising the isolated nucleic acid molecule of claim 2, operably linked to suitable regulatory sequences.
8. A chimeric gene as claimed in claim 7 comprising the isolated nucleic acid molecule of claim 3 operably linked to suitable regulatory sequences.
9. A chimeric gene as claimed in 8 comprising the isolated nucleic acid molecule of claim 4 operably linked to suitable regulatory sequences.
10. A chimeric gene as claimed in 9 comprising the isolated nucleic acid molecule of claim 5 operably linked to suitable regulatory sequences.
11. A chimeric gene as claimed in 10 comprising the isolated nucleic acid molecule of claim 6 operably linked to suitable regulatory sequences
12. An isolated transformed host cell comprising the isolated nucleic acid molecules of claim 11 is an oleaginous yeast, such as but not limited to Saccharomyces cervisiae.
FIELD OF INVENTION
The instant invention pertains to methods of expressing enzymes comprising fatty acid biosynthetic pathway in an oleaginous yeast host for the production of Eicosapentaenoic acid. The oleaginous yeast used in this method includes Saccaromyces cervisceae. Further, the invention relates to transformation of Delta-12 desaturase, Delta-6 desaturase, C18/C20 elongase, Delta-5 desaturase and co-3 desaturase into yeast host. Such methods include, transforming a yeast cell with a nucleic acid molecules, which encode proteins having an activity of catalyzing the formation of double bonds in the oleic acid, linoleic acid, elongating gamma linolenic acid and desaturating dihomogammalinolenic acid and Arachidonic acid respectively. Advantageously, the invention is feasible and can be used commercially.
The nucleic acid sequences depicted herein are incorporated in a vector and are operably linked to a promoter or other regulatory elements for the expression of the genes in host cell.
BACKGROUND OF THE INVENTION
Eicosapentaenoic Acid (EPA) is a member of the Omega-3 fatty acid family. This is one of the essential fatty acids needed for the normal functioning. Essential fatty acids play a part in almost every function of the body. They govern growth, vitality and mental state. Essential fatty acids are critical for good physical health, mental health, concentration and memory.
Research consistently links mood disorders to low concentrations of Omega 3 fatty acids in the body. Omega 3 fatty acids keep the brain's traffic pattern of thoughts, reactions, and reflexes running smoothly and efficiently. Numerous studies show that children with the symptoms of Attention Deficit Disorder have lower levels of essential fatty acids. Studies also show that lower levels of essential fatty acids can resuh in problems with learning, behavior, temper, sleep, and immune function. A diet rich in Omega 3 essential fatty acids can reduce hypertension and improve the symptoms of lupus, Raynaud's disease, and other autoimmune diseases.
EPA is required for the production of a special group of substances in the body called prostaglandins, which control blood clotting and other arterial functions. EPA also provides a natural approach to lower blood cholesterol and triglycerides.
Some benefits of Eicosapentaenoic Acid are providing- anti-inflammatory activity, enhance the immune system, thin blood and lower blood pressure. The cardiovascular benefits of EPA are numerous.In relation
to cardiovascular health Eicosapentaenoic Acid can reduce the occurrence of angina attacks and Help the heart to maintain a steady rhythm by positively affecting the electrical activity.
Dietary sources of EPA are cold water fatty fish, including salmon, tuna, mackerel, sardines, shellfish, and herring.The human body can also convert a-linolenic acid (ALA) to EPA, but this is much less efficient than the resorption of EPA from food containing it.Hence the production of EPA in the microbial system has an immense value.
BRIEF SUMMARY OF INVENTION
Present invention is directed to the transformation of Delta-12 desaturase, Delta-6 desaturase, D-6
elongase and D5 desaturase into yeast host.
The D-12 desaturase from B.juncea is a desaturase that can introduce double bond into oleic acid to
convert it to Linoleic acid.
D-6 desaturase from Malpina is capable of introducing a double bond into Linoleic acid to convert it to
gamma linolenic acid.
D-6 elongase from M.alpina is capable of introducing a double bond into GLA to convert it to DHGLA.
D-5 desaturase from M.alpina introduces double bond into DHGLA to convert it to Arachidonic acid.
00-3 desaturase from P.pastoris converts ARA to Eicosapentaenoic acid be introducing a double bong into
it.
Accordingly the present invention features methods of producing EPA in yeast. Such methods include,
transforming a yeast cell with a nucleic acid molecules, which encode proteins having an activity of
catalyzing the formation of double bonds in the oleic acid, linoleic acid, Dihomogamma linolenic acid
and ARA respectively. It also includes nucleic acid molecules which encode activity of elongation of Cjg
to C20 molecules. The nucleic acid sequences depicted herein are incorporated in a vector and is operably
linked to a promoter or other regulatory elements for the expression of the genes in host cell.
DESCRIPTION OF THE ACCOMPANYING DRWAINGS
FIGURE 1: Amplification of A-12 desaturase from B.juncea.
FIGURE 2: Fatty acid desaturase domain in the 1.16kb sequence of A-12 desaturase of BPR 559
FIGURE 3: A-12 desaturase cloned into the MCSII site under the GALl promoter of pESC-His.
FIGURE 4: Amplification of A-6 desaturase from total RNA of Malpina
FIGURE 5: Map of the construct pESC-Trp/M.alp-A6 desaturase
FIGURE 6: Construct map for pESCHis-BjD12+M.alpD6
FIGURE 7: Amplification of Elongase from Total RNA ofM. alpina through RT PCR
FIGURE 8: Map of the construct pESC-Trp/M.alpElongase
FIGURE 9: Map of the construct pESC-Trp/M.aIpEIongase+D5 desaturase
Fig 10: Map of the construct pESC-Leu/P.pastoris w-3 desaturase
Fig 11: GC-MS profile for the yeast clones subjected to proof of function experiment.
Description of the Sequence Listings:
SBQ ID NO 1: Codon optimized sequence of deltal2 desaturase from Brassica juncea BPR559 with
nucleotide substitutions. SEQ ID NO 2: Nucleotide Sequence of delta-6 desaturase ORF isolated from M.alpina 32222 SEQ ID NO 3: Nucleotide Sequence of Cig/Caoelongase from M.alpma 32222 SEQ ED NO 4: Nucleotide sequence of Delta-5 desaturase from Malpina 32222. SEQ ID NO 5: Nucleotide sequence of co-3 desaturase from P.pastoris.
DETAILED DESCRIPTION
Amplification and cloning of A-12 desaturase from Brassica juncea
The A-12 desaturase has been cloned from genomic DNA of Brassica juncea and has been found to have a single exon, with an ORF of 1155bp (Katavic and Taylor, 2000). Primers designed to amplify the gene from Brassica juncea are given below:
A-12 Forward: I 5'-ATGGGTGCAGGTGGAAGAATGCAAGTCTCTCCTC-3'
A-12 Reverse 5'- TCATAACTTATTGTTGTACCAGAAC -3'
DNA was isolated from three popular varieties oi Brassica juncea - RL-99-27, BPR-559 and Brassica rapa Skm-9S16.
lOOng of genomic DNA of RL-99-27, Skm-9816 and BPR-559 varieties of B. juncea were used to amplify the ORF of A-12 desaturase.(FIGURE 1)
Comparison of the nucleotide and amino acid sequences of A-12 desaturase of B. juncea varieties RL-99-27, BPR-559 and B. rapa SKM-9816 with that of B. napus (Ace. No. AAS 92240) clearly showed that the sequence of BPR-559 was the closest to that of 5. napus.
The cDNA sequence of all varieties translates into a protein of 384aa. Search for motifs confirmed that the sequence isolated has the fatty acid desaturase domain required for desaturase activity.(FIGURE 2)
The codon bias of Brassica is considerably different from that of yeast; hence, the codons used in the A-12 desaturase oi Brassica had to be optimized for expression in yeast - the target organism for production ofPUFAs.
A total of 23 changes had to be made in the sequence for optimizing A-12 desaturase for expression in yeast. The A-12 desaturase of BPR559 was subjected to nucleotide changes using the Quickchange Multi site-directed mutagenesis Kit from Stratagene. Codon optimized sequence for D12 desaturase is given in SEQIDl
The YPH 499 cells were transformed with the construct (FIGURE 3) and the transformants were selected
on SDHis- medium. The transformants were subjected to POP (Proof Of Function) experiment by the
protocol outlined below.
Twenty four hour old culture of yeast cells carrying plasmid of interest was inoculated into 7ml of SD-
AA selection medium (0.67%YNB without AA, 2%Dextrose, 0.13% AA dropout powder minus His).
Cultures were Incubated at 30°C for overnight .10%(3.0ml) of inoculum was used to inoculate into 30ml
of SD-/ SG-AA selection medium.(0.67%YNB without AA, 2% Galactose, 0.13% AA drop out powder
minus His) Cultures were incubated for 24 hours at 25°C. Cells were pelleted, washed with media w/o
carbon source and water. Fatty acid extraction was done using hexane and profiling was done using GC-
MS. __^
Fatty I
Acid YPH499/ pESC-His/B. j A12
#1 I #2 I #3 I ^ f I Vector Control
SD I SG SD I SG SD I SG~ SD I SG~ SD I SG
14:0 0.96 1.18 1.06 1.97 2.88 0.99 0.99 1.31 2.04 0.98
15:0 10.59 0.27 0.2 0.28 0.47 0.38 0.28 0.98 0.39 0.27
16:0 34.37 37.4 33.86 37.4 34.6 37.15 29.61 38.29 40.54 30.04
16:1 20.2 29.93 29.88 29.8 27.68 28.49 34.42 29.05 27.49 32.74
17:0 9.65 0.07 0.03 0.03 0.18 0.22 0.03 0.08 0.07 0.07
18:0 5.49 7.9 4.57 8.44 8.1 8.25 4.68 7.32 4.66 5.95
I8;l 18.1 14.06 30.14 13.62 26.09 15.37 29.47 14.34 24.08 29.6
18;2 I 0 I 8.84 | 0 | 7.94 | 0 | 8.92 | 0 18.361 0 | 0
* SD and SG correspond to Uninduced and Induced samples. Result
It can be noted that conversion from OA to LA, was observed in all the induced clones. These results confirm the activity of A-12 desaturase {B.j) in yeast.
Amplification and cloning of A-6 desaturase from M.alpina
Cloning of A6 desaturase has been reported (Sakuradani, E, 1999). Gene specific primers with the restriction sites were designed to amplify the fragment.
MalpESD6F TTGGAATTCATGGCTGCTGCTC
MalpESD6R |ATAGATCGATTTACTGCGCCTTAC
RT PCR reaction was performed using cMaster RT Plus PCR system (Eppendorf) in order to amplify the gene from total RNA.(FIGURE 4)
The 1.3 KB PCR fragment was cloned into pGEM-T easy vector. A-6 desaturase of Malpina present in pGEM-T easy vector was cloned between EcoRI and Spel sites of the pESC-Trp vector(FIGURE 5). The clones were confirmed by RE digestion and DNA sequencing. (SEQ ID 2).
YPH499was transformed with the construct (FIGURE 5) and PDF performed with the addition of LA and ALA into the medium in presence of 0.1% tergitol. SD and SG correspond to Uninduced and Induced samples. GCMS results are tabulated here
Fatty Acid I pESC-TrpI M.a pina P-6 desaturase with the addition of ALA(tg;3n-3)
SD I SG TsDl ISGl 3SDl3SGl4SDl4SGlSSDl5SGl6SPl6SG
14:0 2.3 2.5 1.3 - 1.7 - 1.8 I 1.7 I 1.1 I - I 1.2 I 0.7
15:0 3 3.6 0.5 - 0.8 1 1.4 1.7 - 0.4 0.8
16:0 47.7 44.1 26.5 20.9 35.2 31.8 41.9 33.2 2S.4 25.3 29.4 30.7
16:1 - 19.3 1.3 11.3 1.7 8.2 1 ^ - 17.1 1
17:0 1.4 1.5 0.1 1 0.4 0.7 0.5 1.3 1.3 2 0.2
18:0 23.9 26.9 7.9 10.1 7.2 10.6 9 15 22.7 17.9 7.7 11.5
18:1 11.9 13.2 15.2 2.9 8.3 3 7.2 5.6 8.9 6.7 12.4 3.2
18:2 5.6 5.9 0.9 1.1 0.4 1.5 1.1 2.2 3.5 2.8 0.8 1.4
18;3fALA) 4.2 2.3 28.1 35.6 32.6 27.8 29.1 23.7 29 31.4 30.5 29.3
18:4 (ST A) - - - 2S.1 - 21.4 - 13.2 - 2.4 - 21.4
20:0 0.2 0.3 0.4 0.2 ; ;; 0.3
22:5 : 0.2 0.5 0.2 0.3 1.5 -_
22:6 I - I - I - I 1.5 I 1.2 I 1.1 | 0.2 I 1.7 | 6.1 | 10 | - | -
Result: Conversion of LA to GLA and ALA to STA is seen indicating that the gene A-6 desaturase is
functional in yeast.
Cloning of B.juncea A12 desaturase and M. alpina A6 desaturase into single construct.
A6-Desaturase of M alpina was cloned into EcoRI and Clal sites of the pESC-His construct having codon optimized A12 desaturase present in. construct map Fig: 6.
Proof of Function:
YPH 499 was transformed with the plasmid containing the BjA\2 desaturase and M.alp A-6 desaturase. Clones were induced with galactose and were grown without the addition of fatty acid into the medium. SD and SG correspond to Uninduced and Induced samples. GCMS analysis gave the following result.
Fatty acid pESC-His/B.j-P12+M.alp-D6 0A-LA-GLA
#1 I #2 I #3 I Vector Control "
SD I SG SD I SG SD I SG ' SD I SG
13;0 0 1.32 0.73 0.61 0.52 0 0.82 0.98
14;0 0.7 0 0 0 0 1.67 0 0
15;0 55 0.37 0.2 0.46 0.33 0.24 0.16 0
16;0 37.17 33.5 35.43 38.56 33.74 34.06 29.64 30.55
16;1 31.86 31.98 31.77 22.38 32.05 32.81 35.79 37.56
16;2 0 4.09 0 3.04 0 3.61 0 0
18;0 5.77 7.53 7.49 12.98 7.08 5.7 5.95 5.28
18;HOA) 23.96 15.86 24.37 16.27 26.27 18.15 27.65 25.63
18;2(LA) 0 0.41 0 1.06 0 0.88 0 0
~18;3(GLA) | 0 | 4.95 | 0 | 4.63 | 0 | 2.89 | 0 | 0
Result: Conversion of OA to GLA via LA is seen in the induced samples indicating that both the genes are functional.
Amplification and cloning of Elongase:
Cloning of Elongase from M alpina has already been reported (Parker-Barnes, J. M. et al., 2000). Gene specific primers with the restriction sites were designed to amplify the fragment.
MaipESeloF IACG GAA TTC AAG ATG GAG TCG ATT GCG CCA TTC C MalpESeloR |GCC ATC CAT TTA CTG CAA CTT CCT TGC CTT CTC C
RT PCR reaction was performed using cMaster RT Plus PCR system (Eppendorf) in order to amplify the gene (FIGURE 7). The PCR product (957bp) was cloned into pGEM-T easy vector. (SEQ ID 3) M alpina Elongase present in pGEM-T easy vector has been digested with EcoRI and Clal enzymes and cloned directionally into pESC-Trp vector digested with the same enzymes. Map of the construct is given in FIGURE 8.
Yeast host YPH 499 was transformed with the construct. Clones were subjected to proof of function experiments as detailed earlier. The pellets were used for the extraction of total lipids. The fatty acids extracted were converted into FAMES and analysed by GC-MS. SD and SG correspond to Uninduced and Induced samples. GCMS analysis gave the following result.
Proof of Function of gene combinations (D12+D6)+(Elo)
Host yeast YPH 499 cells was co-transformed with pESC-His/(B.jA12+M.alpA6) and pESC-Trp/(M.alp Elongase). Clones were induced with galactose and were grown without the addition of fatty acid into the medium. FAMEs were analysed by GC-MS. SD and SG correspond to Uninduced and Induced samples. GCMS analysis gave the following result.
Result: Conversion of OA to DGLA via GLA is seen in the induced samples indicating that all the three genes are functional and produce DGLA in yeast.
Cloning oiM.alpina D5 desaturase into pESC-Trp/Ma/p/na-EIo construct,
M.alpina D5 desaturase (SEQ K) 4) was amplified using the primers carrying Apal and Nhel restriction sites. PCR product was digested with the above enzymes and cloned into MCSII of pESCTrp/ Malpina Elongase construct directionally. Construct pESC-Trp/Mfl//j/«fl-Elo+D5 desaturase (FIGURE 9) was transformed into YPH499 and clones obtained were subjected to POF experiment with the addition of GLA into the medium.
Result: All the clones showed the conversion of GLA-DHGLA and ARA. This proves functionalities of both the Elongase and D5 desaturase genes in construct.
Transformation of pESCHis l{B. juncea D12Co+M. alpina D6)+ pESC-Ura/ M. alpina Elo+D5 desaturase into YPH499
Constructs pESCHisfB.jmcea Dl2Co+M.alpmaD6 (FIGURE 6) and pESC-Ura/Afa/p/«a/D6-Elo+D5 (FIGURE 9) desaturase were co-transformed into YPH499 electro-competent cells. Clones obtained were confirmed by amplification with the gene-specific primers. Clones were subjected to proof of function experiment by simple induction.
Result: All the clones showed the conversion of OA-LA-GLA-DHGLA-ARA, proving all the four genes are functional and bringing about the desired conversions.
Isolation and cloning of w-3 desaturase gene from Pichia pastoris
Q)-3 desaturase gene was amplified from Pichia pastoris (SEQ ID 5)and cloned into pESCLeu vector between BamHI and Xhol in the MCS II(Fig 10).
Proof of function for the Yeast clones carrying Pichia pastoris w3 desaturase was performed with the addition ARA
Result: All the induced clones showed the conversion of ARA to EPA.
Transformation of D12+D6+Elo+D5 and W-3 desaturase for the production of EPA
Constructs in Fig 6, Fig 8 and Fig 10 were co-transformed into S.cerevisiae strain YPH499. Transformants were selected on SD medium lacking Tryptophan, Histidine and Leucine. Clones were subjected to proof of function experiment by simple induction.
Result:
Conversion of OA to EPA is seen in all the samples. Both the n-3 and n-6 intermediates are foimd in the samples. (Ref Fig 11 for GC-MS profiling)
We claim:
1. A method for the production of Arachidonic acid comprising: (a) providing a host cell
comprising: (i) an isolated nucleotide molecule encoding a DELTA-12 desaturase polypeptide sequence as
set forth in SEQ ID NO: 1; (ii) an isolated nucleotide molecule encoding a DELTA-6 desaturase polypeptide sequence as set
forth in SEQ ID NO: 2; and (iii) an isolated nucleotide molecule encoding a cl8/c20 elongase polypeptide sequence as set
forth in SEQ ID NO: 3; (iv) an isolated nucleotide molecule encoding a DELTA - 5 desaturase polypeptide sequence as
set forth in SEQ ID NO: 4; (v) an isolated nucleotide molecule encoding a co-3 desaturase polypeptide sequence as set forth
in SEQ ID NO: 5;
(b) growing the host cell of step (a) under conditions wherein the nucleic acid molecule encoding the DELTA 12 and DELTA 6 desaturase, elongase Delta 5 desaturase and co-S desaturase polypeptide is expressed and the Oleic acid is converted to Eicosapentaenoic acid; and
(c) optionally recovering the Eicosapentaenoic acid of step (b).
2. An isolated nucleotide molecule encoding a DELTA 12 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO: 1.
3. An isolated nucleotide molecule encoding a DELTA 6 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID N0:2.
4. An isolated nucleotide molecule encoding a C18/C20 elongase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID N0:3.
5. An isolated nucleotide molecule encoding a DELTA 5 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID N0:4.
6. An isolated nucleotide molecule encoding a co-3 desaturase enzyme, as described in Claim 1, having sequence as set forth in SEQ ID NO: 5.
7. A chimeric gene comprising the isolated nucleic acid molecule of claim 2, operably linked to suitable regulatory sequences.
8. A chimeric gene as claimed in claim 7 comprising the isolated nucleic acid molecule of claim 3 operably linked to suitable regulatory sequences.
9. A chimeric gene as claimed in 8 comprising the isolated nucleic acid molecule of claim 4 operably linked to suitable regulatory sequences.
10. A chimeric gene as claimed in 9 comprising the isolated nucleic acid molecule of claim 5 operably linked to suitable regulatory sequences.
11. A chimeric gene as claimed in 10 comprising the isolated nucleic acid molecule of claim 6 operably linked to suitable regulatory sequences
12. An isolated transformed host cell comprising the isolated nucleic acid molecules of claim 11 is an
oleaginous yeast, such as but not limited to Saccharomyces cervisiae.
| # | Name | Date |
|---|---|---|
| 1 | 3233-che-2009 form-5 30-12-2009.pdf | 2009-12-30 |
| 2 | 3233-che-2009 form-3 30-12-2009.pdf | 2009-12-30 |
| 3 | 3233-che-2009 form-2 30-12-2009.pdf | 2009-12-30 |
| 4 | 3233-che-2009 form-1 30-12-2009.pdf | 2009-12-30 |
| 5 | 3233-che-2009 drawings 30-12-2009.pdf | 2009-12-30 |
| 6 | 3233-che-2009 description(complete) 30-12-2009.pdf | 2009-12-30 |
| 7 | 3233-che-2009 correspondence others 30-12-2009.pdf | 2009-12-30 |
| 8 | 3233-che-2009 claims 30-12-2009.pdf | 2009-12-30 |
| 9 | 3233-che-2009 abstract 30-12-2009.pdf | 2009-12-30 |