PRODUCTION OF VIRAL CAPSIDS
FIELD OF THE INVENTION
5 The present invention relates generally to methods and materials for generating 'empty'
viral capsids in host cells which are do not carry the natural RNA viral genome, and
hence are non-infective.
BACKGROUND OF THE INVENTION
10
Cowpea mosaic virus (CPMV) is a bipartite single-stranded, positive-sense RNA virus
and is the type member of the genus comovirus which is classified with genera fabaand
nepovirus as genera within the family Comoviridae. CPMV has a genome
consisting of two molecules of positive-strand RNA (RNA-1 and RNA-2) which are
15 separately encapsidated in icosahedral particles of approximately 28nm diameter.
These particles contain 60 copies each of a Large (L) and Small (S) protein arranged
with pseudo T=3 (P=3) symmetry (Lomonossoff and Johnson, 1991 ; Lin et a/., 1999).
The L and S proteins are situated around the 3- and 5-fold symmetry axes and contain
two and one P-barrel, respectively. The S protein can exist in two forms, fast and slow,
20 depending on whether the C-terminal 24 amino acids are present (Taylor et a/., 1999)
Both CPMV genomic RNAs are expressed through the synthesis and subsequent
processing of large precursor polyproteins (for a review, see Goldbach and Wellink,
1 996).
25
RNA-1 encodes the proteins involved in protein processing and RNA replication
(Lomonossoff & Shanks, 1983). The polyprotein encoded by RNA-1 self-processes in
cis through the action of the 24K proteinase domain to give the 32K proteinase cofactor,
the 58K helicase, the VPg, the 24K proteinase and the 87K RNA-dependent
30 RNA-polymerase.
RNA-2 is translated to give a pair of polyproteins,(the 105K and 95K proteins) as a
result of initiation at two different AUG codons at positions 161 and 512. These
polyproteins are processed by the RNA-I-encoded 24K proteinase in trans at 2 sites to
35 give the 58W48K pair of proteins (which differ only at their N-terminus) and the mature
L and S coat proteins (Fig. la).
Two cleavages of the 9511 05K polyprotein are required to produce the mature L and S
coat protein - at a GlnIMet site between the 58148K protein and the L coat protein and
at a GlnIGly site between the L and S coat proteins. Cleavage at the 58148K-L junction
5 requires not only the action of the 24K proteinase but is also dependent on the
presence of the RNA-I-encoded 32K proteinase co-factor (Vos et a/., 1988). Cleavage
at this site leads to the production of an L-S fusion protein (termed VP60) which has
been proposed as the immediate precursor of the mature L and S proteins (Franssen
et a/., 1982; Wellink eta/., 1987).
10
Detailed knowledge of the structure of the CPMV particle, coupled with its robustness,
has led to it being extensively used in bio- and nanotechnology (for a recent reviews,
see Steinmetz et a/., 2009; Destito et a/., 2009).
15 However, though much is known about the structure and properties of the mature
CPMV particle, relatively little is known about the mechanism of virus assembly. It has,
to date, proved impossible to develop an in vitro assembly assay since the L and S
proteins isolated from virions are insoluble in the absence of denaturants (Wu and
Bruening, 1971).
20
To date, CPMV particles have generally been isolated from infected plants. Yields of
up to Ig of virus per kg of starting leaf material are readily obtained from typical CPMV
infections. In such natural preparations approximately 90% of the particles contain
either the viral RNA-I or RNA-2. The presence of viral RNA within the particles has
25 several undesirable consequences for their technological application. These include:
The virus preparations retain their ability to infect plants and spread in the
environment.
While CPMV RNAs have not be shown to be capable of replication in
mammalian cells, uptake of particles does occur both in vitro and in vivo, raising
biosafety concerns if RNA-containing particles are used for veterinary or
medical applications
The presence of the RNA within the particles precludes the incorporation of
additional material within the CPMV capsids.
To address these issues, attempts have been made to inactivate or eliminate the viral
RNAs.
Langeveld et al., 2001 reported a canine parvovirus vaccine based on a recombinant
5 chimeric CPMV construct (CPMV-PARVOI). This was inactivated by UV treatment to
remove the possibility of replication of the recombinant plant virus in a plant host after
manufacture of the vaccine.
Rae et al., 2008 used UV irradiation to crosslink the RNA genome within intact
10 particles. Intermediate doses of 2.0-2.5 JIcm2 were reported to maintain particle
structure and chemical reactivity, with cellular binding properties being reported to be
similar to CPMV-WT.
Ochoa et al., 2006 reported a method to generate a CPMV empty capsids from their
15 native nucleoprotein counterparts by removing the encapsidated viral genome by
chemical means.
Phelps et al., 2007 reported chemical Inactivation and purification of cowpea mosaic
virus-like particles displaying peptide antigens from Bacillus anthracis.
20
However, all these inactivation or purification processes have to be carefully monitored
as they risk altering the structural properties of the particles.
Shanks & Lomonossof (2000) describes how regions of RNA-2 of Cowpea mosaic
25 virus (CPMV) that encoded the L and S coat proteins could be expressed either
individually or together in Spodoptera frugiperda (sf21) cells using baculovirus vectors.
Co-expression of the two coat proteins from separate promoters in the same construct
resulted in the formation of virus-like particles whose morphology closely resembled
that of native CPMV virions. The authors concluded that the expression of the coat
30 proteins in insect cells could provide a fruitful route for the study of CPMV
morphogenesis.
A presentation was given at the ASSOCIATION OF APPLIED BIOLOGISTS (AAB)
"Advances in Virology" meeting, University of Greenwich, UK held on 11 -12
35 September 2007, entitled "Cowpea mosaic virus from insect cell culture; a template for
bionanotechnology" by K SAUNDERS, M SHANKS & G P LOMONOSSOFF (John
Innes, Norwich, UK). This presentation described possible uses of CPMV produced
from insect cell culture in bionanotechnology. It was reported that virus like particles
could result from co-expression of the L and S coat proteins in insect cells.
Additionally, insect cells co-infected with RNAI and RNA2 derived constructs produced
5 high molecular weight bands when probed with suitable antibodies.
Wellink et a/., 2006 reported studies in which the coding regions for CPMV capsid
proteins VP37 (L) and VP23 (S) were introduced separately into a transient plant
expression vector containing an enhanced CaMV 35s promoter. Significant expression
10 of either capsid protein was reportedly observed only in protoplasts transfected
simultaneously with both constructs. lmmunosorbent electron microscopy apparently
revealed the presence of virus-like particles in extracts of these protoplasts. An extract
of protoplasts transfected with both constructs together with RNA-1 was able to initiate
a new infection, which was interpreted as showing that the two capsid proteins of
15 CPMV can form functional particles containing RNA-1 and that the 60-kDa capsid
precursor is not essential for this process.
Interestingly, when Wellink and co-workers attempted to generate particles from a
construct (pMMB110) encoding a hybrid polyprotein comprising a 24kDa proteinase
20 fused to VP60 (the capsid proteins precursor) no particles were found. Wellink and coworkers
were unclear why no virus like particles are formed in pMMBl 10-transfected
protoplasts, and noted that the amount of capsid proteins present in these cells was
similar to the amount found in the cotransfected cells. The authors suggested that the
conformation of the coat proteins produced in this manner may not have been correct
25 to permit assembly. Alternatively, it may indicate that the processing of the artificial
precursor was insufficiently precise, since processing by the 24K proteinase is less
specific in cis than in trans (Clark et al., 1999).
This difficulty in mimicking the situation plants which occurs during a virus infection
30 (where the mature L and S proteins are both produced by proteolytic processing of the
RNA-2-encoded polyprotein) is consistent with earlier experiments with plants
transgenic for VP60, which showed that it could not assemble into VLPs (Nida et al.,
1992). Likewise attempts to examine the role of VP60 have been further hampered by
the fact that it only accumulates to very low levels during infection of plants (Rezelman
35 et a/., 1989) and that cleavage at the L-S site only occurs at very low haemin
concentration in reticulocyte lysates (Bu and Shih, 1989).
At a presentation on 1 to 3 April 2009 given in Harrogate, UK ("Advances in Plant
Virology" held by the Assoc, of Applied Biologists in conjunction with the Society for
General Microbiology) one or more of the present inventors described proteolytic
5 processing of the CPMV coat polyprotein precursor and formation of virus-like particles
in insect cell culture.
The authors of the presentation attempted to define the minimum requirements for
capsid formation, and produced virus-like particles in which the S protein was of the
10 slower migrating form following the co-expression of VP60 (consisting of a fused L-S
protein), with the 24K proteinase. Thus it was concluded that the movement protein
expressed at the amino terminus of the coat protein precursor polyprotein (PI 05lP95)
was not essential for capsid formation. In contrast both the faster and slower migrating
S protein forms were present in virus-like particles as a consequence of the co-
15 expression of VP60 with the amino terminal portion of RNA 1. This suggested that the
32K processing regulator expressed within the amino terminal region of RNAI, in
addition to the 24K proteinase, had a role in the processing of the S coat protein but
was also non-essential for virus-like particle formation.
20 Thus it can be seen that at the priority date, some steps had been taken to form CPMV
virus-like particles (VLPs) in both cowpea protoplasts (Wellink et a/., 1996) and
Spodoptera frugiperda (Sf21) insect cells (Shanks and Lomonossoff, 2000) by the coexpression
of the individual L and S coat proteins. However in both cases the yield of
assembled particles was low. Additionally, problems were reported in using polyprotein
25 precursors, particularly in plant cells (Wellink et a/., 1996).
PCT/GB2009/000060 was filed but not published prior to the presently claimed priority
date. It describes the so called CPMV "HT high-expression system. It is noted that it
may be used in the transient format in N. benthamiana to co-express the CPMV S and
30 L coat proteins for assembly into virus-like particles.
Part of the work described herein was published after the presently claimed priority
date as " Cowpea Mosaic Virus Unmodified Empty Viruslike Particles Loaded with
Metal and Metal Oxide" Aljabali, Sainsbury, Lomonossoff, & Evans: Small V6, 17 , pp
35 818-821.
SUMMARY OF INVENTION
The present invention concerns the use of host cells to produce 'empty' capsids using
a high-yield expression system in combination with heterologous nucleic acid encoding
5 the L and S coat proteins. In the description below these 'empty' capsids, where
devoid or nearly devoid of 'native' RNA, may be referred to "eVLPsn for brevity.
To investigate the requirements for VLP formation when the mature L and S proteins
are produced by proteolytic processing of a precursor in trans, the present inventors
10 first examined the processing of CPMV RNA-2 polyprotein by the RNA-I-encoded 24K
proteinase in insect cells. The results showed that VLPs were efficiently produced
when the L and S proteins are released from either the full-length RNA-2 polyproteins
or from VP60.
15 However, while processing and VLP formation from the full-length RNA-2 polyproteins
required the simultaneous presence of both the 32K co-factor and the 24K proteinase,
the inventors showed that processing from VP60 required just the 24K proteinase and
gives rise to very efficient VLP formation.
20 In separate experiments, agroinfiltration of the VP60 and 24K proteinase constructs
into plants also gave rise to VLPs demonstrating that this approach is suitable for the
generation of empty particles for use in bio- and nanotechnology. Using the VP60 with
the 24kDa proteinase ensures that the L and S proteins are produced in exactly equal
amounts, as they are found in the natural capsid.
25
The inventors have also shown that encoding VP60 and 24K on a single construct
gave rise to VLPs at even higher yields than those obtained using separate constructs.
Additionally, the present inventors have shown that expressing the separate L and S
30 proteins in plants using a high-yield expression system such as the "CPMV-HT system
also results in the formation of empty capsids.
In preferred embodiments of the invention, capsids are prepared from the coat protein
precursor VP60 through the action of the CPMV 24kDa proteinase in planta.
35 Elimination of infectivity by irradiation with ultraviolet light or chemically treatment risks
altering the structural properties of the particles. The use of plants inoculated with
constructs encoding VP60 and the 24K proteinase to produce non-infectious empty
capsids circumvents this problem.
Additionally, producing empty particles in this manner rather than through an infection
5 process has the advantage that the particles no longer need to be competent at
packaging RNA or spreading within plant tissue. Accordingly the systems of the
present invention extend the range of modifications that it is possible to introduce into
the coat proteins, thereby extending the range of their applications.
10 Thus in one aspect there is provided a method of producing RNA virus capsids in a
host cell, which capsids are incapable of infection of the host cell, which method
comprises:
(a) introducing one or more recombinant nucleic acid (generally DNA) vectors into the
host cell or an ancestor thereof, wherein said one or more vectors comprise:
15 (i) a first nucleotide sequence encoding a polyprotein which can be
- proteolytically processed in the host cell to viral S and L coat proteins for
assembly in the host cell into viral capsids; and
(ii) a second nucleotide sequence encoding a proteinase capable of said
proteolytically processing;
20 (b) permitting expression of said polyprotein and proteinase from said first and second
nucleotide sequences,
such that the polyprotein is proteolytically processed in the host cell to viral S
and L coat proteins which assemble in the host cell into viral capsids;
25 Preferred vectors for use in the invention are high-level expression vectors, such as the
CPMV-HT ("hyper translatable") vectors described in prior-filed patent application
PCT/GB2009/000060 or Sainsbury & Lomonossoff 2008.
As noted above the first and second nucleotide sequences may be on the same or
30 different vectors (cf, compare Figures 8 and 10). In some preferred embodiments they
are on the same vector and hence only one vector need be introduced into the cell.
Typically the polyprotein includes a cleavage site naturally recognised by a proteinase
from the same or a closely related RNA virus. However as described below, in other
35 embodiments the cleavage site mayfrom an unrelated virus or source, and a proteinase
which is specific for that site is used.
In another aspect there is provided a method of producing RNA virus capsids in a host
cell, , which capsids are incapable of infection of the host cell, which method
comprises:
5 (a) introducing one or more recombinant nucleic acid (generally DNA) vectors into the
host cell or an ancestor thereof, wherein said one or more vectors comprise:
(i) a first nucleotide sequence encoding a viral S coat protein; and
(ii) a second nucleotide sequence encoding a viral L coat protein,
each being present in a high-level expression vector,
10 (b) permitting expression of said S coat protein and L coat protein from said first and
second nucleotide sequences,
such that S and L coat proteins are assembled in the host cell into viral capsids.
As above the first and second nucleotide sequences may be on the same or different
15 vectors.
Again the preferred high-level expression vector is the CPMV-HT vector. The
expression of separate L and S proteins permits the relative amounts to be varied,
where that is desired -for Example if they are modified such as to alter the standard
20 60:60 ratio present in wild-type capsids.
Typically the RNA virus is a bipartite RNA virus will be a comovirus such as CPMV. All
genera of the family Comoviridae appear to encode two carboxy-coterminal proteins.
The genera of the Comoviridae family include Comovirus, Nepovirus, Fabavirus,
25 Cheravirus and Sadwavirus. Comoviruses include Cowpea mosaic virus (CPMV),
Cowpea severe mosaic virus (CPSMV), Squash mosaic virus (SqMV), Red clover
mottle virus (RCMV), Bean pod mottle virus (BPMV). The sequences of the RNA-2
genome segments of these comoviruses and several specific strains are available from
the NCBl database as described in PCT/GB2009/000060.
30
The host cell may be present in cell culture or in a host organism such as a plant. In
such cases the method may further comprise harvesting a tissue (e.g. leaf) in which the
CPMV capsids have been assembled, and optionally isolating them from the tissue.
35 As described below, the present inventors have further devised an improved protocol
for extracting or isolating empty CPMV capsids from leaf tissues which omits the
previously used organic solvent extraction step. In conjunction with the other methods
herein (for example in which the first and second nucleotide sequences are on the
same vector), the protocol can provide yields of up to 0.2glKg leaf tissue (i.e. 0.02%
WIW) or more.
5
In another aspect there is provided a gene expression system for producing CPMV
capsids in a host cell, which system comprises one or more recombinant nucleic acid
vectors (generally DNA, high-level expression vectors), wherein said one or more
vectors comprise:
10 (i) a first nucleotide sequence encoding a polyprotein which can be
proteolytically processed in the host cell to CPMV S and L coat proteins for
assembly in the host cell into CPMV capsids; and
(ii) a second nucleotide sequence encoding a proteinase capable of said
proteolytically processing.
15
As above the first and second nucleotide sequences may be on the same or different
vectors.
In another aspect there is provided a method comprising the step of introducing the
20 gene expression system into the host cell or organism.
In other aspects there are provided CPMV capsids, particularly those which are
essentially free of CPMV RNA, for example as obtainable using methods herein.
25 In any of the aspects described herein the capsids may include a payload which may
be, by way of non-limiting example, a nucleic acid (e.g. silencing agent such as siRNA),
protein, carbohydrate, or lipid, a drug molecule e.g. a chemotherapeutic, or an
inorganic material such as a heavy metal or salts thereof. The payload may or may not
be fluorescent. Internal mineralisation using inorganic materials such as cobalt or iron
30 oxide is demonstrated in the Examples below. As noted elsewhere herein, the capsids
may themselves be empty, but modified e.g. to present foreign protein sequences as
part of the L or S sequences. The inventors have shown, for example, that the Cterminus
of VP60 can be modified to carry foreign sequences without impairing its'
ability to form eVLPs.
In the practice of the invention, the host cell will be eukaryotic host, which is typically a
plant or in insect. Preferred hosts are plants. The vectors or nucleotide sequences
described above may thus be employed transiently or incorporated into stable
transgenic plants. Such hosts form further aspects of the invention, which thus
5 provides:
A host cell organism obtained or obtainable by a method described above.
A host organism transiently transfected with a gene expression system as
described herein.
10 A transgenic host organism stably transformed with a gene expression system
as described herein.
To avoid packaging of naturally infective RNA within the capsids, the nucleic acid
vectors of the invention do not encode both the native RNAI and RNA2 genome of
15 CPMV.
Thus at least one of the native RNA genomes will be absent, or modified such that no
infectious virus is produced.
20 Most preferably, the RNA-2 of the system is truncated such that no infectious virus is
produced.
Where an entire native 951105 protein is encoded by the RNA-2 derived nucleic acid,
then preferably the region encoded by the 5' half of RNA-1 (both the 32kDa and 24kDa
25 proteins) would be included, but preferably not the 3' portion encoding the remaining
proteins.
Nevertheless, preferably the first nucleotide sequence encoding the polyprotein will not
encode the 32K movement protein which is encoded by the native RNA2 (cf.
30 Greenwich disclosure discussed supra). This movement protein expressed at the
amino terminus of the coat protein precursor polyprotein is not essential for capsid
formation.
In the invention the proteinase, which is typically a CPMV native 24K proteinase, is
35 generally not expressed as part of the same polyprotein as the L-S polyprotein (cf.
Wellink et al . disclosure discussed supra wherein no particles were produced). Rather
the L and S proteins are produced by proteolytic processing of a polyprotein precursor
in trans.
Preferably the polyprotein comprises only the L and S coat proteins, as exemplified for
5 example by the "VP60" protein described herein. As demonstrated by the inventors,
processing of the VP60 protein does not require the CPMV 32K proteinase co-factor.
Rather, the CPMV 24K proteinase alone can efficiently process VP60. Furthermore,
the L and S proteins resulting from in trans proteolytic processing of the precursor
polyprotein, can assemble into CPMV capsids.
10
It will of course be appreciated that the L and S coat proteins themselves may be
genetically modified using conventional techniques to incorporate additional features or
activities according to the desired purpose of the capsids - for example epitopes,
binding entities and so on. Chemical modification after production is also
15 encompassed by the present invention.
Some particular embodiments of the invention will now be described in more detail.
Capsids
20
The invention may be utilised to produce "empty1' CPMV capsids, by which is meant
that they are essentially free of native CPMV RNA which would be present in capsids
using conventional prior art techniques and which would lead to infective particles.
Generally they will also be free of unwanted cellular nucleic acids. The term "empty" is
25 therefore used for simplicity since it will be well understood by those skilled in the art.
Nevertheless it will be appreciated from the present disclosure that the "empty" capsids
of the invention may be used to carry a non-natural payload. This is discussed in
more detail below.
30 As used herein, the terms "capsids" and "virus-like particles" (or "VLPs") are used
interchangeably unless context demands otherwise.
"Essentially CPMV RNA-free" refers to a capsid which contains little or no CPMVderived
RNA, and in particular does not encapsulate CPMV RNA which is capable of
35 infection of a plant. Thus the need for irradiation with ultraviolet light or chemical
treatment is obviated.
Preferably the method may be used to produce CPMV capsids of which at least 50,
60, 70, 80, 90, 95, 96, 97, 98, or 99% of the capsids are essentially CPMV RNA-free as
judged by sucrose gradient density analysis (see Example 5). Particles which are
5 essentially CPMV RNA-free will generally sediment to a position characteristic of 'Top'
components produced during a natural infection.
It will be understood that in certain embodiments of the invention it may be desirable to
use the capsids to actually deliver artificial RNAs (such as siRNAs) carrying the
10 appropriate encapsidation signals. The packaging of such artificial RNAs (which will be
encoded by nucleic acid introduced into the cell or ancestor thereof specifically for this
purpose, and will not consist of natural RNAI or RNA2 or endogenous cellular mRNA)
forms one aspect of the invention.
15 By contrast, in natural preparations of CPMV particles, approximately 90% of the
particles contain the viral either RNA-1 or RNA-2.
L-S Polyprotein
20 As noted above, a preferred polyprotein consists essentially of the L and S proteins
(optionally modified). VP60 is an example of such a polyprotein. In the Examples
below translation iniation was designed to occur from the methionine which forms the
N-terminal residue of the L protein, with termination occurring at the natural stop codon
downstream of the S protein.
25
In embodiments of the invention, the S protein may or may not include the 24 carboxylterminal
amino acids, which are often lost by proteolysis.
Furthermore, in experiments (not shown) the present inventors have demonstrated the
30 substitution of the carboxy-terminal 24 amino acids of VP60 with a hexahistidine
sequence and expression of this modified protein (VP6O-His) in plants using the
CPMV-HT system. The expressed protein was purified from plant extracts in a onestep
process using Ni-affinity chromatography.
35 In other experiments co-infiltration of VP6O-His with the CPMV 24K proteinase led to
processing to give L and S-His which assembled into eVLPs. These eVLPs could also
be purified by Ni-affinity chromatography. This confirms that, by way of non-limiting
example, the C-terminus of VP60 can be modified to carry foreign sequences (in this
case a His-tag) thus demonstrating the utility of eVLPs as a protein presentation
system. This and other example modifications of the L and\or S proteins are discussed
5 in more detail in the section entitled "Utilities for CPMV capsids" below.
By way of non-limiting example, the L or S protein of CPMV can be engineered to
display peptides of protective antigens on the surface loop.
10 Alternatively, the enclosed space in the interior of the capsids may be modified (e.g. to
enhance or inhibit accumulation or packaging of a desired or undesired material) by
modification of the L protein in regions which are internally presented.
As yet a further alternative, appropriate modification of the proteins can cause the
15 formation of pores in the capsid, where such are desired.
Proteinasess
As discussed above, the L-S polyprotein includes a cleavage site recognised by a
20 proteinase. Preferably this is one naturally recognised by a proteinase from the same
or a closely related bipartite RNA virus (e.g. CPMV 24K proteinase and VP60).
However in other embodiments the cleavage site may be one that is introduced, but
originates from an unrelated virus or source, and a proteinase which is specific for that
25 site is used. For example a cleavage site for an unrelated proteinase (e.g. the well
known TEV sequence) may be inserted in the polyprotein between the L and S
proteins. Those skilled in the art are aware that many viruses use proteolytic
processing to achieve expression of their proteins and the cleavages are highly
specific. Examples of suitable sequences and proteinases which may be applied in the
30 present invention can be found in Spall, V.E., Shanks, M. and Lomonossoff, G.P.
(1997). Polyprotein processing as a strategy for gene expression in RNA viruses.
Seminars in Virology 8, 15-23.
Recovery of CPMV plasmids
As discussed in Example 7, the present inventors have further devised an improved
protocol for extracting or isolating empty CPMV capsids from leaf tissues which omits
the previously used organic solvent extraction step.
5 Thus a preferred method for extracting or isolating empty CPMV capsids from suitably
transformed or treated plants comprises the following steps:
(1) providing plant material from the plant;
(2) homogenising said material;
(3) adding an insoluble binding agent which binds polysaccharides and phenolics;
10 (4) removing solid matter;
(5) precipitate the virus particles with a polyol;
(6) recovering the polyol precipitate, optionally by centrifugation;
(7) redissolving the pellet in aqeous buffer;
(8) high-speed centrifuging and discarding pelletable material (e.g. 27000 g for 20
15 mins)
(9) ultracentrifuging and discarding supernatant (e.g. 118,700 g for 150 mins)
(10) resuspending pellet in aqeous buffer;
( I I ) optionally medium-speed centrifuging and discarding pelletable material (e.g.
10,000 g for 5 mins).
20
The method may be characterised by not using an organic solvent extraction step.
Utilities for CPMV capsids
25 The observation that VP60 can be used as a precursor in planta as well as in insect
cells, provides the means for the generation of significant quantities of empty CPMV
capsids. The availability of such particles is of considerable use in bio- and nanotechnology.
30 Reviews of utility of CPMV capsids in bio- and nanotechnology include those of
Steinmetz et a/., 2009 and Destito et a/., 2009. The capsids of the invention may be
used in a manner analogous to those described in the art.
For example chemical and genetic modifications on the surface of viral protein cages
35 such as the CPMV can confer unique properties to the virus particles. The enclosed
space in the interior of the virus particles further increases its versatility as a
nanomaterial and CPMV is increasingly being used as a nanoparticle plafform for
multivalent display of molecules via chemical bioconjugation to the capsid surface. A
growing variety of applications have employed the CPMV multivalent display
technology including nanoblock chemistry, in vivo imaging, and materials science.
5
Chimeric cowpea mosaic virus (CPMV) particles displaying foreign peptide antigens on
the particle surface are suitable for development of peptide-based vaccines.
Example utilities are as follows:
10
RNA-containing CPMV particles from have previously been used extensively to display
peptides on the virus surface for immunological and targeting purposes(Destito et al.,
2009; Steinmetz et al., 2009). This has been done by inserting the sequences into
exposed loops on either the L or S protein. However, there are restrictions concerning
15 the size and sequence of the inserted which is tolerated before the ability of the virus to
multiply and spread within plants is impaired (Porta et al., 2003). The current invention
obviates the need for replication and spread and therefore allows for a far wider range
of peptides, including polypeptides, to be expressed on the virus surface. This
expression would is achieved by inserting sequences encoding the desired peptide into
20 loops on the surface of the L and S proteins using conventional molecular biology
techniques, and then forming these into capsids according to the present invention.
Chemical conjugation of proteins or other compounds to the viral surface can be
achieved by linking them to reactive functional groups on the virus surface. Naturally
25 occurring groups, such as carboxylates provided by the amino acids aspartic and
glutamic acid or amino groups provided by lysine residues, on both the L and S
proteins have been used to modify wild-type virus particles isolated from plants
(Steinmetz et al., 2009). It has also proved possible to introduce amino acids with
different functional groups e.g. cysteine with a sulphydryl group while still preserving
30 viral viability. As well as introducing new groups it is also possible to remove them - an
example of this is the selective removal of lysine residues (Chatterji et al., 2004).
However, the need to retain infectivity has previously limited the number and nature of
the amno acids which can be introducedteliminated. The elimination of the
requirement for infectivity means that far more radical changes can be made to the L
35 and S proteins using site-directed mutagenesis to add, remove or change specific
amino acids. This increases the range of uses to which CPMV particles can be put.
To date there are no reports of modifications to the inner surface of CPMV particles. It
is believed that this is because of the need to retain the RNA-binding properties of the
capsids to ensure they encapsidate the viral genome which is a prerequisite for virus
5 viability. In other words, producing virus particles by the normal infection route in
plants precludes modifications to the inner surface virus surface. The use of the
systems of the present invention ensures that there is no need to retain RNA-binding
properties, or to removed RNA prior to encapsidating a "guest" molecule. Rather, the L
and S proteins can be modified such as to provide an environment suitable for
10 encapsidating desired molecules, examples of which can be found in Young et al.
(2008).
The liberation from the need to retain viral infectivity imeans that it is possible to
envisage making more radical changes to the viral capsid, for example in terms of
15 morphology and permeability, than has hitherto been possible. For example, it may be
desired to increase the size of the channel at the 5-fold axis from its wild-type value of
7.54 (Lin et al., 1999) to allow the ingress of larger molecules. Likewise, it may be
desired to make the capsid respond to changes in pH andlor ionic environment so that
it undergoes structural rearrangements. This would enable guest molecules to be
20 introduced when the virus is in an "open" conformation and then trapped when
conditions are changed. It may also be desired to change the size of the virus particles
by making changes to the inter-subunit contacts.
Over the past decade or so there has also been a growing interest in the use of viruses
25 as templates, scaffolds and synthons for exploitation in (bio)nanotechnology in areas
as diverse as materials science, engineering, electronics, photonics, magnetic storage,
catalysis and bi~medicine.'-~P lant virus particles having icosahedral symmetry are
able to encapsulate nanoparticles within the size and shape constrained viral capsid.
For example, host-guest encapsulation of tungstate, ana ad ate,'^^" titanial* and
30 Prussian blue nanoparticlesI3 has been previously demonstrated within the particles of
Cowpea chlorotic mottle virus. This was facilitated, in part, by the ease with which
nucleic acid-free empty particles can be obtained by in vitro assembly. As noted
above, until now, CPMV has not been used to encapsulate materials as it has been
very difficult to obtain empty particles as these comprise only a small fraction (5-1 0%)
35 of particles produced during an infection. However, as confirmed in the Examples
below, using the systems described herein unmodified empty CPMV virus-like particles
can be loaded with metal and metal oxide under environmentally benign conditions.
Vectors and high-level expression vectors
5
As note above, preferred vectors for use in the invention are high-level expression
vectors.
"Vector" as used herein is defined to include, inter alia, any plasmid, cosmid, phage,
10 viral or Agrobacterium binary vector in double or single stranded linear or circular form
which may or may not be self transmissible or mobilizable, and which can transform a
prokaryotic or eukaryotic host either by integration into the cellular genome or exist
extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication).
The constructs used will be wholly or partially synthetic. In particular they are
15 recombinant in that nucleic acid sequences which are not found together in nature (do
not run contiguously) have been ligated or otherwise combined artificially. Unless
specified otherwise a vector according to the present invention need not include a
promoter or other regulatory sequence, particularly if the vector is to be used to
introduce the nucleic acid into cells for recombination into the genome.
20
In embodiments of the invention, a high-level expression system is used. Such
systems exist for bacteria (such as E. coli), yeasts (such as Pischia Pastoris), insect
cells (through the use of baculovirus-based vectors) or mammalian expression
systems (such as CHO cells) or plants (using either transient expression or stable
25
In plants, high-level expression can most readily achieved using transient expression.
Vectors for this purpose can be based on either replicating DNA- or RNA-containing
viruses (Lomonossoff and Montague, 2008). Alternatively, the sequences can be
expressed from non-replicating constructs in the presence of a suppressor of gene
30 silencing (Sainsbury and Lomonossoff, 2008; Vezina et al., 2009 ).
Similar systems may also be used in transgenic plants.
A preferred high-level expression vector for use in plants will generally achieve a yield
35 of at least around 100 mg capsidslkg of harvested fresh weight of tissue (typically
leaves). Thus the weight % yield of capsids, including payload where applicable, is
preferably at least 0.1 / 1000x 100 = 0.01% but may in other embodiments be at least
or between 0.001 and 0.1%, more preferably at least 0.005 or 0.05%. Such yields can
readily be achieved as evidenced by the Examples herein.
5 A preferred high-level expression vector is the CPMV-HT ("hyper translatable") vectors
described in prior-filed patent application PCT/GB2009/000060. The disclosure of
PCT/GB2009/000060 is specifically incorporated herein in support of the embodiments
using the CPMV-HT system - for example vectors based on pEAQ-HT expression
plasmids.
10
Thus the vectors for use in the present invention will typically comprise an expression
cassette comprising:
(i) a promoter, operably linked to
(ii) an enhancer sequence derived from the RNA-2 genome segment of a bipartite RNA
15 virus, in which a target initiation site in the RNA-2 genome segment has been mutated;
(iii) a first or second nucleotide sequence as described above (encoding L-S
polyprotein or proteinase);
(iv) a terminator sequence; and optionally
(v) a 3' UTR located upstream of said terminator sequence.
20
"Expression cassette" refers to a situation in which a nucleic acid is under the control
of, and operably linked to, an appropriate promoter or other regulatory elements for
transcription in a host cell such as a microbial or plant cell.
25 A "promoter" is a sequence of nucleotides from which transcription may be initiated of
DNA operably linked downstream (i.e. in the 3' direction on the sense strand of doublestranded
DNA).
"Operably linked" means joined as part of the same nucleic acid molecule, suitably
30 positioned and oriented for transcription to be initiated from the promoter.
"Enhancer" sequences (or enhancer elements), as referred to herein, are sequences
derived from (or sharing homology with) the RNA-2 genome segment of a bipartite
RNA virus, such as a comovirus, in which a target initiation site has been mutated.
35 Such sequences can enhance downstream expression of a heterologous ORF to which
they are attached. Without limitation, it is believed that such sequences when present
in transcribed RNA, can enhance translation of a heterologous ORF to which they are
attached.
A "target initiation site" as referred to herein, is the initiation site (start codon) in a wild-
5 type RNA-2 genome segment of a bipartite virus (e.g. a comovirus) from which the
enhancer sequence in question is derived, which serves as the initiation site for the
production (translation) of the longer of two carboxy coterminal proteins encoded by the
wild-type RNA-2 genome segment.
10 Typically the RNA virus will be a comovirus as described hereinbefore.
For example the enhancer sequence may comprise nucleotides 1 to 507 of the cowpea
mosaic virus RNA-2 genome segment sequence shown in Table A, wherein the AUG
at position 161 has been mutated as shown in Table B, located downstream of the
15 promoter. As described in PCT/GB2009/000060, it is believed that mutation of the
initiation site at position 161 in the CPMV RNA-2 genome segment is thought to lead to
the inactivation of a translation suppressor normally present in the CPMV RNA-2. It is
further believed that mutations around the start codon at position 161 may have the
same (or similar) effect as mutating the start codon at position 161 itself, for example,
20 disrupting the context around this start codon may mean that the start codon is bypassed
more frequently.
In one embodiment of the invention, the enhancer sequence comprises nucleotides 1
to 512 of the CPMV RNA-2 genome segment (see Table A), wherein the target
25 initiation site at position 161 has been mutated. In another embodiment of the
invention, the enhancer sequence comprises an equivalent sequence from another
comovirus, wherein the target initiation site equivalent to the start codon at position 161
of CPMV has been mutated. The target initiation site may be mutated by substitution,
deletion or insertion. Preferably, the target initiation site is mutated by a point mutation.
30
In alternative embodiments of the invention, the enhancer sequence comprises
nucleotides 10 to 512, 20 to 512, 30 to 512, 40 to 512, 50 to 512, 100 to 512, 150 to
512, 1 to 514, 10 to 514,20 to 514, 30 to 514,40 to 514,50 to 514, 100 to 514, 150 to
514, 1 to 511, 10 to 511, 20 to 511, 30 to 511, 40 to 511, 50 to 511, 100 to 511, 150 to
35 51 1, 1 to 509, 10 to 509,20 to 509, 30 to 509,40 to 509, 50 to 509, 100 to 509, 150 to
509, 1 to 507, 10 to 507,20 to 507,30 to 507,40 to 507, 50 to 507, 100 to 507, or 150
to 507 of a comoviral RNA-2 genome segment sequence with a mutated target
initiation site. In other embodiments of the invention, the enhancer sequence
comprises nucleotides 10 to 512, 20 to 512, 30 to 512, 40 to 512, 50 to 512, 100 to
512, 150 to 512, 1 to 514, 10 to 514,20 to 514,30 to 514,40 to 514,50 to 514, 100 to
5 514,150to514,1to511,10to511,20to511,30to511,40to511,50to511,100to
51 1, 150 to 51 1, 1 to 509, 10 to 509,20 to 509,30 to 509,40 to 509,50 to 509, 100 to
509, 150 to 509, 1 to 507, 10 to 507,20 to 507, 30 to 507,40 to 507, 50 to 507, 100 to
507, or 150 to 507 of the CPMV RNA-2 genome segment sequence shown in Table A,
wherein the target initiation site at position 161 in the wild-type CPMV RNA-2 genome
10 segment has been mutated.
In further embodiments of the invention, the enhancer sequence comprises nucleotides
1 to 500, 1 to 490, I to 480, 1 to 470, 1 to 460, 1 to 450, 1 to 400, 1 to 350, 1 to 300, 1
to 250, 1 to 200, or 1 to 100 of a comoviral RNA-2 genome segment sequence with a
15 mutated target initiation site.
In alternative embodiments of the invention, the enhancer sequence comprises
nucleotides 1 to 500, 1 to 490, 1 to 480, 1 to 470, 1 to 460, 1 to 450, 1 to 400, 1 to 350,
1 to 300, 1 to 250, 1 to 200, or 1 to 100 of the CPMV RNA-2 genome segment
20 sequence shown in Table A, wherein the target initiation site at position 161 in the wildtype
CPMV RNA-2 genome segment has been mutated.
Enhancer sequences comprising at least 100 or 200, at least 300, at least 350, at least
400, at least 450, at least 460, at least 470, at least 480, at least 490 or at least 500
25 nucleotides of a comoviral RNA-2 genome segment sequence with a mutated target
initiation site are also embodiments of the invention.
In addition, enhancer sequences comprising at least 100 or 200, at least 300, at least
350, at least 400, at least 450, at least 460, at least 470, at least 480, at least 490 or at
30 least 500 nucleotides of the CPMV RNA-2 genome segment sequence shown in Table
A, wherein the target initiation site at position 161 in the wild-type CPMV RNA-2
genome segment has been mutated, are also embodiments of the invention.
In a preferred embodiment, the promoter is an inducible promoter.
The term "inducible" as applied to a promoter is well understood by those skilled in the
art. In essence, expression under the control of an inducible promoter is "switched on"
or increased in response to an applied stimulus. The nature of the stimulus varies
between promoters. Some inducible promoters cause little or undetectable levels of
5 expression (or no expression) in the absence of the appropriate stimulus. Other
inducible promoters cause detectable constitutive expression in the absence of the
stimulus. Whatever the level of expression is in the absence of the stimulus,
expression from any inducible promoter is increased in the presence of the correct
stimulus.
10
The termination (terminator) sequence may be a termination sequence derived from
the RNA-2 genome segment of a bipartite RNA virus, e.g. a comovirus. In one
embodiment the termination sequence may be derived from the same bipartite RNA
virus from which the enhancer sequence is derived. The termination sequence may
15 comprise a stop codon. Termination sequence may also be followed by
polyadenylation signals.
Gene expression cassettes, gene expression constructs and gene expression systems
of the invention may also comprise a 3' untranslated region (UTR). The UTR may be
20 located upstream of a terminator sequence present in the gene expression cassette,
gene expression construct or gene expression system. More specifically the UTR may
be located downstream of the first or second nucleotide sequence. The UTR may be
derived from a bipartite RNA virus, e.g. from the RNA-2 genome segment of a bipartite
RNA virus. The UTR may be the 3' UTR of the same RNA-2 genome segment from
25 which the enhancer sequence present in the gene expression cassette, gene
expression construct or gene expression system is derived. Preferably, the UTR is the
3' UTR of a comoviral RNA-2 genome segment, e.g. the 3' UTR of the CPMV RNA-2
genome segment e.g. a 3' UTR which is optionally derived from the same bipartite
RNA virus as the enhancer sequence e.g. nucleotides 3302 to 3481 of the cowpea
30 mosaic virus RNA-2 genome segment sequence shown in Table A, located
downstream of the expressed first or second nucleotide sequence.
Preferred hyper-translatable plant vectors
35 Where the host is a plant, the promoter used to drive the gene of interest will preferably
be a strong plant promoter. Examples of published promoters include:
(1) CAMV p35S
(2) Cassava Vein Mosaic Virus promoter, pCAS
(3) Promoter of the small subunit of ribulose biphosphate carboxylase, pRbcS
5 Other strong promoters include pUbi (for monocots and dicots) pActin and the
plastocyanin promoter (Vezina et al., 2009).
Preferably the vectors of the present invention which are for use in plants comprise
border sequences which permit the transfer and integration of the expression cassette
10 into the plant genome. Preferably the construct is a plant binary vector. Preferably the
binary transformation vector is based on pPZP (Hajdukiewicz, et a/. 1994). Other
example constructs include pBinl9 (see Frisch, D. A., L. W. Harris-Haller, et al. (1995).
"Complete Sequence of the binary vector Bin 19." Plant Molecular Biology 27: 405-
409).
15
As described herein, and in PCT/GB2009/000060, the invention may be practiced by
moving an expression cassette with the requisite components into an existing pBin
expression cassette, or in other embodiments a direct-cloning pBin expression vector
may be utilised.
20
These examples represent preferred binary plant vectors. Preferably they include the
ColEl origin of replication, although plasmids containing other replication origins that
also yield high copy numbers (such as pRi-based plasmids, Lee and Gelvin, 2008) may
also be preferred, especially for transient expression systems.
2 5
As is well known to those skilled in the art, a "binary vector" system includes (a) border
sequences which permit the transfer of a desired nucleotide sequence into a plant cell
genome; (b) desired nucleotide sequence itself, which will generally comprise an
expression cassette of (i) a plant active promoter, operably linked to (ii) the target
30 sequence and\or enhancer as appropriate. The desired nucleotide sequence is
situated between the border sequences and is capable of being inserted into a plant
genome under appropriate conditions. The binary vector system will generally require
other sequence (derived from A. tumefaciens) to effect the integration. Generally this
may be achieved by use of so called "agro-infiltration" which uses Agrobacterium-
35 mediated transient transformation. Briefly, this technique is based on the property of
Agrobacterium tumefaciens to transfer a portion of its DNA ("T-DNA) into a host cell
where it may become integrated into nuclear DNA. The T-DNA is defined by left and
right border sequences which are around 21-23 nucleotides in length. The infiltration
may be achieved e.g. by syringe (in leaves) or vacuum (whole plants). In the present
invention the border sequences will generally be included around the desired
5 nucleotide sequence (the T-DNA) with the one or more vectors being introduced into
the plant material by agro-infiltration.
If desired, selectable genetic markers may be included in the construct, such as those
that confer selectable phenotypes such as resistance to antibiotics or herbicides (e.g.
10 kanamycin, hygromycin, phosphinotricin, chlorsulfuron, methotrexate, gentamycin,
spectinomycin, imidazolinones and glyphosate).
Most preferred vectors are the pEAQ vectors of PCT/GB2009/000060 which permit
direct cloning version by use of a polylinker between the 5' leader and 3' UTRs of an
15 expression cassette including a translational enhancer of the invention, positioned on a
T-DNA which also contains a suppressor of gene silencing and an NPTll cassettes.
The polylinker also encodes one or two sets of 6 x Histidine residues to allow the fusion
of N- or C terminal His-tags to facilitate protein purification. As discussed above, the
inventors have modified the C-terminus of VP60 to include a His-tag (see Figure 9) and
20 shown that eVLPS can still be assembled from it. Nevertheless the His tag enables the
rapid purification of the VP60 and\or assembled eVLPs by Ni-affinity chromatography.
The presence of a suppressor of gene silencing in such gene expression systems is
preferred but not essential. Suppressors of gene silencing are known in the art and
25 described in W0/2007/135480. They include HcPro from Potato virus Y, He-Pro from
TEV, PI 9 from TBSV, rgsCam, B2 protein from FHV, the small coat protein of CPMV,
and coat protein from TCV. A preferred suppressor when producing stable transgenic
plants is the PI 9 suppressor incorporating a R43W mutation.
30 In vitro aspects
As noted above, the present inventors have shown that, using the CPMV-HT system,
but in the absence of the proteinase, unprocessed VP60 can be purified from cells (for
example using Ni-affinity chromatography where the VP60 includes a His-tag). This
35 VP60 may be utilised in other aspects of the invention which can be performed in vitro
whereby purified VP60 (e.g. VP6O-His) is cleaved after purification by the addition of a
suitable proteinase (e.g. the CPMV 24K proteinase) and permitted to assemble into
eVLPs in a non-cellular environment. This may have particular utility for the in vitro
encapsidation of foreign material which might not otherwise readily diffuse into "preassembled"
eVLPs.
5
Thus in another aspect there is provided a method of producing RNA virus capsids
encapsidating a desired payload in vitro,which method comprises:
(a) introducing a recombinant DNA vector into a host cell or an ancestor thereof,
wherein said vector comprises a nucleotide sequence encoding a polyprotein which
10 comprises viral small (S) and large (L) coat proteins from said RNA virus,
(b) permitting expression of said polyprotein from said nucleotide sequence, wherein
said polyprotein is not proteolytically processed in the host cell to said viral S and L
coat proteins,
(c) purifying said polyprotein from said host cell,
15 (d) contacting said polyprotein in vitro with (i) a proteinase capable of proteolytically
processing the polyprotein to said viral S and L coat proteins and (ii) said payload,
such that the viral S and L coat proteins assemble in vitro into viral capsids
encapsidating said payload.
20 Optionally the polyprotein includes a tag (e.g. His-tag) at the N- or C terminal to
facilitate protein purification.
The various preferred embodiments of the other aspects of the invention described
herein apply mutatis mutandis to the in vitro aspect unless context demands othennrise.
25 Thus as in other aspects of the invention, the RNA virus is preferably a bipartite RNA
virus which is preferably a member of the family Comoviridae (e.g. a Comovirus, e.g.
CPMV). The nucleotide sequence preferably encodes CPMV VP60 in which one or
both of the CPMV S and L proteins is optionally modified by way of sequence insertion,
subtitution or deletion. The proteinase is preferably the CPMV 24K proteinase.
30
Other aspects of the invention
In a further aspect of the invention, there is disclosed a host cell containing a
heterologous construct according to the present invention.
Gene expression vectors of the invention may be transiently or stably incorporated into
plant cells.
For small scale production, mechanical agroinfiltration of leaves with constructs of the
5 invention. Scale-up is achieved through, for example, the use of vacuum infiltration.
In other embodiments, an expression vector of the invention may be stably
incorporated into the genome of the transgenic plant or plant cell.
10 In one aspect the invention may further comprise the step of regenerating a plant from
a transformed plant cell.
Specific procedures and vectors previously used with wide success upon plants are
described by Guerineau and Mullineaux (1 993) (Plant transformation and expression
15 vectors. In: Plant Molecular Biology Labfax (Croy RRD ed) Oxford, BlOS Scientific
Publishers, pp 121-148). Suitable vectors may include plant viral-derived vectors (see
e.g. EP-A-194809). If desired, selectable genetic markers may be included in the
construct, such as those that confer selectable phenotypes such as resistance to
antibiotics or herbicides (e.g. kanamycin, hygromycin, phosphinotricin, chlorsulfuron,
20 methotrexate, gentamycin, spectinomycin, imidazolinones and glyphosate).
Nucleic acid can be introduced into plant cells using any suitable technology, such as a
disarmed Ti-plasmid vector carried by Agrobacterium exploiting its natural gene
transfer ability (EP-A-270355, EP-A-0116718, NAR 12(22) 871 1 - 8721 5 1984; the
25 floral dip method of Clough and Bent, 1998), particle or microprojectile bombardment
(US 51 00792, EP-A-444882, EP-A-434616) microinjection (WO 92109696, WO
94100583, EP 331 083, EP 175966, Green et a/. (1 987) Plant Tissue and Cell Culture,
Academic Press), electroporation (EP 290395, WO 8706614 Gelvin Debeyser) other
forms of direct DNA uptake (DE 4005152, WO 9012096, US 468461 I), liposome
30 mediated DNA uptake (e.g. Freeman et a/. Plant Cell Physiol. 29: 1353 (1984)), or the
vortexing method (e.g. Kindle, PNAS U.S.A. 87: 1228 (1990d) Physical methods for the
transformation of plant cells are reviewed in Oard, 1991, Biotech. Adv. 9: 1-1 1. Tiplasmids,
particularly binary vectors, are discussed in more detail below.
35 Agrobacterium transformation is widely used by those skilled in the art to transform
dicotyledonous species. However there has also been considerable success in the
routine production of stable, fertile transgenic plants in almost all economically relevant
monocot plants (see e.g. Hiei et al. (1994) The Plant Journal 6, 271-282)).
Microprojectile bombardment, electroporation and direct DNA uptake are preferred
where Agrobacterium alone is inefficient or ineffective. Alternatively, a combination of
5 different techniques may be employed to enhance the efficiency of the transformation
process, eg bombardment with Agrobacterium coated microparticles (EP-A-486234) or
microprojectile bombardment to induce wounding followed by co-cultivation with
Agrobacterium (EP-A-486233).
10 The particular choice of a transformation technology will be determined by its efficiency
to transform certain plant species as well as the experience and preference of the
person practising the invention with a particular methodology of choice.
It will be apparent to the skilled person that the particular choice of a transformation
15 system to introduce nucleic acid into plant cells is not essential to or a limitation of the
invention, nor is the choice of technique for plant regeneration. In experiments
performed by the inventors, the enhanced expression effect is seen in a variety of
integration patterns of the T-DNA.
20 Thus various aspects of the present invention provide a method of transforming a plant
cell involving introduction of a construct of the invention into a plant tissue (e.g. a plant
cell) and causing or allowing recombination between the vector and the plant cell
genome to introduce a nucleic acid according to the present invention into the genome.
This may be done so as to effect transient expression.
2 5
Alternatively, following transformation of plant tissue, a plant may be regenerated, e.g.
from single cells, callus tissue or leaf discs, as is standard in the art. Almost any plant
can be entirely regenerated from cells, tissues and organs of the plant. Available
techniques are reviewd in Vasil et al., Cell Culture and Somatic Cell Genetics of Plants,
30 Vol I, I1 and 111, Laboratory Procedures and Their Applications, Academic Press, 1984,
and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press,
1989.
The generation of fertile transgenic plants has been achieved in the cereals such as
35 rice, maize, wheat, oat, and barley plus many other plant species (reviewed in
Shimamoto, K. (1 994) Current Opinion in Biotechnology 5, 158-1 62.; Vasil, et a/. (1 992)
Bioflechnology 10, 667-674; Vain et al., 1995, Biotechnology Advances 13 (4): 653-
671; Vasil, 1996, Nature Biotechnology 14 page 702).
Regenerated plants or parts thereof may be used to provide clones, seed, selfed or
5 hybrid progeny and descendants (e.g. F1 and F2 descendants), cuttings (e.g. edible
parts), propagules, etc.
The invention further provides a transgenic plant (for example obtained or obtainable
by a method described herein) in which an expression vector or cassette has been
10 introduced, and wherein CPMV capsids are accumulated.
The invention also provides a plant propagule from such plants, that is any part which
may be used in reproduction or propagation, sexual or asexual, including cuttings, seed
and so on. It also provides any part of these plants which includes the plant cells or
15 heterologous vectors, expression systems, or capsids described above.
Nucleic acids
"Nucleic acid" or a "nucleic acid molecule" as used herein refers to any DNA or RNA
20 molecule, either single or double stranded and, if single stranded, the molecule of its
complementary sequence in either linear or circular form.
Typically the nucleic acid vectors of the present invention are DNA vectors, which
encode portions of the RNA genome of a bipartite RNA virus - in particular the capsid
25 coat proteins -which are transcribed and translated into said coat proteins in a host
cell, optionally as a cleavable polyprotein, and then assembled into capsids.
In discussing nucleic acid molecules, a sequence or structure of a particular nucleic
acid molecule may be described herein according to the normal convention of providing
30 the sequence in the 5' to 3' direction. With reference to nucleic acids of the invention,
the term "isolated nucleic acid" Is sometimes used. This term, when applied to DNA,
refers to a DNA molecule that is separated from sequences with which it is immediately
contiguous in the naturally occurring genome of the organism in which it originated.
For example, an "isolated nucleic acid" may comprise a DNA molecule inserted into a
vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a
prokaryotic or eukaryotic cell or host organism.
5 The nucleic acid described herein (e.g. of the gene expression system, or having the
first or second nucleotide sequence, or providing the enhancer sequence) may thus
consist or consist essentially of DNA encoding a portion, or fragment, of the RNA-1 or
RNA-2 genome segment of CPMV. For example, in one embodiment the nucleic acid
may not encode at least a portion of the coding region of the RNA-1 or RNA-2 genome
10 segment from which it is derived.
The nucleic acid encoding the polyprotein may consist essentially of the coding
sequence for the L and S proteins, and the polyprotein may consist essentially of those
proteins.
15
The phrase "consisting essentially of' when referring to a particular nucleotide or amino
acid has the following meaning:
When used in reference to an amino acid sequence, the phrase includes the sequence
20 per se and molecular modifications that would not affect the basic and novel
characteristics of the sequence or sequences.
When used in reference to a nucleic acid, the phrase includes the sequence per se and
minor changes and\or extensions that would not affect the function of the sequence, or
25 provide further (additional) functionality.
Variants
It will be appreciated by those skilled in the art that the invention may be utilised not
30 only with the specified sequences set out herein, but also by variants of those
sequences sharing the requisite biological activity.
Typically variants of the relevant amino acid or nucleic acid sequences set out herein
will share at least about 60%, or 70%, or 80% identity, most preferably at least about
35 90%, 95%, 96%, 97%, 98% or 99% identity with the recited sequence, as well as
retaining the biological activity thereof. The relevant biological activities are as follows:
The "polyprotein" must be proteolytically processable to native or mutated S and L coat
proteins for assembly in the host cell into capsids. Fore CPMV, these will typically
comprise 60 copies each of a Large (L) and Small (S) protein.
5
The "proteinase" must be capable of proteolytically processing the polyprotein to native
or mutated S and L coat proteins.
The "enhancer" sequences is capable of enhancing downstream expression of the
10 polyprotein and\or proteinase.
By way of non-limiting example, the invention may utilise an expression enhancer
sequence with at least 70% identity to nucleotides 1 to 507 of the cowpea mosaic virus
RNA-2 genome segment sequence shown in Table 1, wherein the AUG at position 161
15 has been mutated, located downstream of the promoter;
Naturally, changes to the nucleic acid which make no difference to the encoded
polypeptide (i.e. 'degeneratively equivalent') are included within the scope of the
invention.
20
Identity may be over the full-length of the relevant sequence shown herein, or may be
over a part of it, preferably over a contiguous sequence of about or greater than about
20, 25, 30, 33, 40, 50, 67, 133, 167, 200, 233, 267, 300, 333, 400 or more amino acids
or codons.
25
Thus, where the S or L protein has been engineered to incorporate a heterologous
sequence (e.g. foreign epitope), the % identity can be assessed based on the S or L
originating parts of the sequence, even if these do not run contiguously.
30 The percent identity of two amino acid or two nucleic acid sequences can be
determined by visual inspection and mathematical calculation, or more preferably, the
comparison is done by comparing sequence information using a computer program.
An exemplary, preferred computer program is the Genetics Computer Group (GCG;
35 Madison, Wis.) Wisconsin package version 10.0 program, 'GAP' (Devereux et al.,
1984, Nucl. Acids Res. 12: 387). The preferred default parameters for the 'GAP'
program includes: (1) The GCG implementation of a unary comparison matrix
(containing a value of 1 for identities and 0 for non-identities) for nucleotides, and the
weighted amino acid comparison matrix of Gribskov and Burgess, Nucl. Acids Res.
14:6745, 1986, as described by Schwartz and Dayhoff, eds., Atlas of Polypeptide
5 Sequence and Structure, National Biomedical Research Foundation, pp. 353-358,
1979; or other comparable comparison matrices; (2) a penalty of 30 for each gap and
an additional penalty of 1 for each symbol in each gap for amino acid sequences, or
penalty of 50 for each gap and an additional penalty of 3 for each symbol in each gap
for nucleotide sequences; (3) no penalty for end gaps; and (4) no maximum penalty for
10 long gaps.
The invention will now be further described with reference to the following non-limiting
Figures and Examples. Other embodiments of the invention will occur to those skilled
in the art in the light of these.
15
The disclosure of all references cited herein, inasmuch as it may be used by those
skilled in the art to carry out the invention, is hereby specifically incorporated herein by
cross-reference.
20 Table A
The complete CPMV RNA-2 genome segment
lnucleotides 1 to 3481 1
1 tattaaaatc ttaataggtt ttgataaaag cgaacgtggg gaaacccgaa ccaaaccttc
61 ttctaaattc tctctcatct ctcttaaagc aaacttctct cttgtctttc ttgcaagc
121 gatcttcaac gttgtcagat cgtgcttcgg caccagtaca attttctt tcactgaagc
181 gaaatcaaag atctctttgt ggacacgtag tgcggcgcca ttaaataacg tgtacttgtc
241 ctattcttgt cggtgtggtc ttgggaaaag aaagcttgct ggaggctgct gttcagcccc
301 atacattact tgttacgatt ctgctgactt tcggcgggtg caatatctct acttctgctt
361 gacgaggtat tgttgcctgt acttctttct tcttcttctt gctgattggt tctataagaa
421 atctagtatt ttctttgaaa cagagttttc ccgtggtttt cgaacttgga gaaagattgt
481 taagcttctg tatattctgc ccaaatttga aatggaaagc att-agcc gtggtattcc
541 ttcaggaatt ttggaggaaa aagctattca gttcaaacgt gccaaagaag ggaataaacc
601 cttgaaggat gagattccca agcctgagga tatgtatgtg tctcacactt ctaaatggaa
661 tgtgctcaga aaaatgagcc aaaagactgt ggatctttcc aaagcagctg ctgggatggg
721 attcatcaat aagcatatgc ttacgggcaa catcttggca caaccaacaa cagtcttgga
781 tattcccgtc acaaaggata aaacacttgc gatggccagt gattttattc gtaaggagaa
841 tctcaagact tctgccattc acattggagc aattgagatt attatccaga gctttgcttc
901 ccctgaaagt gatttgatgg gaggcttttt gcttgtggat tctttacaca ctgatacagc
961 taatgctatt cgtagcattt ttgttgctcc aatgcgggga ggaagaccag tcagagtggt
1021 gaccttccca aatacactgg cacctgtatc atgtgatctg aacaatagat tcaagctcat
1081 ttgctcattg ccaaactgtg atattgtcca gggtagccaa gtagcagaag tgagtgtaaa
1 141 tgttgcagga tgtgctactt ccatagagaa atctcacacc ccttcccaat tgtatacaga
1201 ggaatttgaa aaggagggtg ctgttgttgt agaatactta ggcagacaga cctattgtgc
1261 tcagcctagc aatttaccca cagaagaaaa acttcggtcc cttaagtttg actttcatgt
1321 tgaacaacca agtgtcctga agttatccaa ttcctgcaat gcgcactttg tcaagggaga
1381 aagtttgaaa tactctattt ctggcaaaga agcagaaaac catgcagttc atgctactgt
1441 ggtctctcga gaaggggctt ctgcggcacc caagcaatat gatcctattt tgggacgggt
1501 gctggatcca cgaaatggga atgtggcttt tccacaaatg gagcaaaact tgtttgccct
1561 ttctttggat gatacaagct cagttcgtgg ttctttgctt gacacaaaat tcgcacaaac
1621 tcgagttttg ttgtccaagg ctatggctgg tggtgatgtg ttattggatg agtatctcta
1681 tgatgtggtc aatggacaag attttagagc tactgtcgct tttttgcgca cccatgttat
1741 aacaggcaaa ataaaggtga cagctaccac caacatttct gacaactcgg gttgttgttt
1801 gatgttggcc ataaatagtg gtgtgagggg taagtatagt actgatgttt atactatctg
1861 ctctcaagac tccatgacgt ggaacccagg gtgcaaaaag aacttctcgt tcacatttaa
1921 tccaaaccct tgtggggatt cttggtctgc tgagatgata agtcgaagca gagttaggat
1981 gacagttatt tgtgtttcgg gatggacctt atctcctacc acagatgtga ttgccaagct
2041 agactggtca attgtcaatg agaaatgtga gcccaccatt taccacttgg ctgattgtca
21 01 gaattggtta ccccttaatc gttggatggg aaaattgact tttccccagg gtgtgacaag
21 61 tgaggttcga aggatgcctc tttctatagg aggcggtgct ggtgcgactc aagctttctt
2221 ggccaatatg cccaattcat ggatatcaat gtggagatat tttagaggtg aacttcactt
2281 tgaagttact aaaatgagct ctccatatat taaagccact gttacatttc tcatagcttt
2341 tggtaatctt agtgatgcct ttggttttta tgagagtttt cctcatagaa ttgttcaatt
2401 tgctgaggtt gaggaaaaat gtactttggt tttctcccaa caagagtttg tcactgcttg
2461 gtcaacacaa gtaaacccca gaaccacact tgaagcagat ggttgtccct acctatatgc
2521 aattattcat gatagtacaa caggtacaat ctccggagat tttaatcttg gggtcaagct
2581 tgttggcatt aaggattttt gtggtatagg ttctaatccg ggtattgatg gttcccgctt
2641 gcttggagct atagcacaag gacctgtttg tgctgaagcc tcagatgtgt atagcccatg
2701 tatgatagct agcactcctc ctgctccatt ttcagacgtt acagcagtaa cttttgactt
2761 aatcaacggc aaaataactc ctgttggtga tgacaattgg aatacgcaca tttataatcc
2821 tccaattatg aatgtcttgc gtactgctgc ttggaaatct ggaactattc atgttcaact
2881 taatgttagg ggtgctggtg tcaaaagagc agattgggat ggtcaagtct ttgtttacct
2941 gcgccagtcc atgaaccctg aaagttatga tgcgcggaca tttgtgatct cacaacctgg
3001 ttctgccatg ttgaacttct cttttgatat catagggccg aatagcggat ttgaatttgc
3061 cgaaagccca tgggccaatc agaccacctg gtatcttgaa tgtgttgcta ccaatcccag
31 21 acaaatacag caatttgagg tcaacatgcg cttcgatcct aatttcaggg ttgccggcaa
31 81 tatcctgatg cccccatttc cactgtcaac ggaaactcca ccgttattaa agtttaggtt
3241 tcgggatatt gaacgctcca agcgtagtgt tatggttgga cacactgcta ctgctgctta
3301 actctggttt cattaaattt tctttagttt gaatttactg ttatttggtg tgcatttcta
3361 tgtttggtga gcggttttct gtgctcagag tgtgtttatt ttatgtaatt taatttcttt
3421 gtgagctcct gtttagcagg tcgtcccttc agcaaggaca caaaaagatt ttaattttat
3481 t
The start codons at positions 11 5, 161,512 and 524 of the CPMV RNA-2 genome
segment are shown in bold and underlined.
Table B
Oligonucleotides which can be used in the mutaaenesis of the CPMV RNA-2 sequence
Mutation
Removes AUG (+GUG)
at 1 15 eliminating
translation from uORF
Removes AUG (+ACG)
at 161 eliminating
translation from AUG 161
while maintaining amino
acid sequence of uORF
Oligonucleotide
A1 15G-F
A1 15G-R
U 162C-F
U 162C-R
Sequence
CTTGTCTTTCTTGCGTGAGCGATCTT
CAACG
CGTTGAAGATCGCTCAGGCAAGAAAG
ACAAG
GGCACCAGTACAASGTTTTCTTTCAC
TGAAGCG
CGCTTCAGTGAAAGAAAACGTTGTAC
TGGTGCC
The mutant nucleotide of the oligonucleotides used in the mutagenesis are shown in
bold
BRIEF DESCRIPTION OF THE DRAWINGS
5
Fig. 1.
Diagrammatic representation of baculovirus-expressed CPMV protein constructs.
Genome organization of CPMV RNA-1 and RNA-2 and the location of the open reading
frames cloned into pMFBD. (a) RNA-1 derived constructs driven by the polyhedron
10 promoter, bv-1A and bv-24K. (b) RNA-2 derived constructs cloned behind the p10
promoter, bv-2 including both the 5' and 3' untranslated CPMV sequences and bv-
VP60. (c) bv-VP60/24K, construct possessing both the 24 K and VP60 genes. VPg,
viral protein genome linked.
15 Fig. 2.
Polyacylamide gel and western blot analysis of extracts of Sf 21 cells infected with 1 -
3 bv-2; 4, bv-2 and bv-1A; 5, bv-2 and bv-24K; 6, bv-VP6O; 7, bv-VP6O and bv-1 A; 8,
bv-VP6O and bv-24K; 9, bv-2 and bv-1A. H, extracts from healthy cells. (a) detection of
CPMV coat protein. (b) membrane probed with antibody prepared against the 58148K
20 proteins. L and S, large and small coat proteins.
Fig. 3.
Gradient analysis of virus-like particles (VLPs) prepared from CPMV-infected plants
and baculovirus-infected Sf21 cells. (a) CPMV; (b) bv-2 and bv-1A; (c), bv-VP6O and
25 bv-1A; (d) bv-VP60124K; (e) bv-VP6O. (f) Gradient peak fractions resolved on a single
polyacrylamide gel. 1, bv-2 and bv-1A; 2, bv-VP6O and bv-1A; 3, bv-VP60124K; 4, bv-
VP60. C, CPMV from infected plants. T, top and B, bottom of each gradient.
Fig. 4.
30 Transmission electron microscopy of particles of wild-type CPMV (a). and samples
from the peak gradient fractions of St21 cells infected with bv-2 and bv-1A (b), bv-VP6O
and bv-1A (c), bv-VP60124K (d) and bv-VP6O (e). Bars indicate 20nm.
Fig. 5.
35 Production of VLPs in N. benthamiana leaves. Top panel: VP60 and 24K proteinase
constructs used in plants to produce VLPs. Middle panel: Coomassie Blue-stained
SDS-polyacrylamide gel of extracts from plants infiltrated with the indicated constructs.
Lane 4 conatins a preparation of purified CPMV.
Fig. 6.
5 Analysis of VLPs purified from plants or insect cells. Upper panel: Coomassie Bluestained
SDS-polyacrylamide gel of purified VLPs. Lower Panel: Agarose gel stained
with Coomassie Blue (top) or ethidium bromide (bottom). The samples loaded on the
gels are indicated.
10 Fig. 7.
Western blot showing the processing of VP60 in plants by the 24kDa proteinase. The
blot was probed with an anti-CPMV serum which predominantly recognises the S
protein, thus the L protein appears more faint. The lanes are as follows:
15 Left-hand panel
empty vector (pEAQ-HT): Extract from leaves infiltrated with the empty pEAQ vector;
no CPMV-specific bands.
20 CPMV/L+CPMV/S: Extract from leaves co-infiltrated with pEAQ vectors expressing the
separate L and S proteins; capsids are formed but only the S is detected by the
anti body.
VP60: Extract from leaves infiltrated with pEAQ vector expressing VP60; no processing
25 occurs due to absence of proteinase. and a protein the size of VP60 accumulates.
VP6O+RNA-1: Extract from leaves co-infiltrated with pEAQ vector expressing VP60
and plasmid pBinP-S1 NT expressing RNA-1 as a source of the 24kDa proteinase;
processing to give mature L (faint) and S proteins occurs.
30
VP60+24K: Extract from leaves co-infiltrated with pEAQ vectors expressing VP60 and
the 24kDa proteinase; processing to give mature L (faint) and S proteins occurs.
Middle panel - S coat protein modified to contain 19 amino acid insert in PB-PC loop
VPGO(FMDV5): Extract from leaves infiltrated with pEAQ vector expressing VP60 into
which FMDV sequence has been inserted; no processing occurs due to absence of
proteinase and a protein the size of VP60 + the insert accumulates.
5 VPGO(FMDVS)+RNA-1: Extract from leaves co-infiltrated with pEAQ vector expressing
VP60 with FMDV insert and plasmid pBinP-S1 NT expressing RNA-1 as a source of the
24kDa proteinase; processing to give mature L (faint) and a modified S protein carrying
the FMDV insert occurs.
10 VP60(FMDV5)+24K: VP60+24K: Extract from leaves co-infiltrated with pEAQ vectors
expressing VP60 with the FMDV insert and the 24kDa proteinase; Processing to give
mature L (faint) and S protein with insert occurs.
Right-hand panel
15
CPMV: Proteins from purified CPMV preparation.
Fig. 8.
The structures of the high-level expression plasmids used for plant expression are
20 shown: pEAQ-HT-CPMV-24K (a) and pEAQ-HT-CPMV-6OK (b). The complete
sequence is provided as SEQ ID N0.s 1 and 2 respectively.
Fig. 9.
Construct used by the inventors to express VP60 with a His-tag.
2 5
Fig. 10.
The structure of a combined high-level expression plasmid used for plant expression is
shown as pEAQexpress-VP60-24K. The complete sequence is provided as SEQ ID
NO 3.
30
Fig. 11.
Analysis of eVLPs produced using combined plasmid of Fig. 10 and modified extraction
protocol. The TEM image shows eVLPs negatively stained with 2% Uranyl acetate.
35 Fig. 12.
SDS-PAGE analysis demonstrating that omitting an organic extraction step increases
eVLP recovery.
wt: Highly purified wild-type CPMV particles run as a standard;
Lane 1: eVLPs extracted from leaf tissue using an organic clarification step;
5 Lane 2: eVLPs extracted from the same amount of leaf tissue without the organic
clarification step;
Lane 3: Crude extract
Figure 13
10 SDS-PAGE analysis demonstrating that the Presence of VP60 and 24K genes in the
same T-DNA region enhances eVLP yield. The L and S proteins from particles have
been separated by SDS-PAGE using 12% NuPAGE gels stained with Instant Blue
Coomassie stain. The intensity of bands on the gel shows that the expression is
enhanced at least three-fold if one vector encodes both genes.
15
EXAMPLES
METHODS
20 Plasmid constructions. All CPMV-derived constructs are based on the nucleotide
sequences which appear as GenBank Accession nos. NC-003549 (RNA-1) and
NC-003550 (RNA-2). The recombinant donor plasmid pFastBac Dual was modified by
site-directed mutagensis and oligonucleotide insertion to yield pMFBD. The original
Hindlll and EcoRl restriction sites were deleted and EcoRl and Mlul restriction sites
25 were introduced between the Ncol and Xhol restriction sites. Finally Agel and Hindlll
restriction sites were introduced between the pol 10 and polyhedron promoters. The
polymerase chain reaction was used to clone a full-length copy, including both the 5'
and 3' non-coding nucleotide sequences, of CPMV DNA from pBinPS2NT (Liu and
Lomonossoff, 2002) into pMFBD via its Bbsl and EcoRl restriction sites to yield
30 pMFDB-2. Similarly by PCR, the region of the RNA-2 open reading frame VP60 of
pBinPS2NT was cloned into pMFBD via the Bbsl and EcoRl restriction sites to yield
pMFBD-VP6O. The 5' half of CPMV RNA-1 corresponding to nucleotides 180 to 3857
was obtained by PCR with plasmid pBinPS1NT as template DNA and cloned into
pMFBD via its BamHl restriction site to yield pMFBD-1A. PCR was used to obtain the
35 region of the RNA-1 open reading frame encoding the 24K proteinase sequence from
pBinPS1 NT (Liu and Lomonossoff, 2002) and the sequence was cloned into pMFBD
and pMFBD-VP6O via the BamHl and Spel restriction sites to yield pMFBD-24K and
pMFBD-VP60/24K, respectively. After sequence verification, all resulting plasmids
were transposed into E. coli DH1 OBac and the resulting bacmid DNA was introduced
into Spodoptera frugiperda (Sf21) cells as recommended by the manufacturers of the
5 Bac-to-Bac Baculovirus Expression Systems (Invitrogen Ltd).
Extraction of total proteins from infected insect cells. Infected Sf21 cells were
harvested 2 to 3 days postinfection, by low speed centrifugation, washed in 10mM
sodium phosphate pH 7 recentrifuged and the resulting pellet suspended in 62.5mM
10 Tris-HCI, pH6.8, 2% SDS.
Purification of VLPs from insect cells. At 3 or 4 days postinfection, infected St21
cells were collected by low speed centrifugation and suspended into 100mM sodium
phosphate pH 7, 0.5% NP40 and stirred on ice for 60 minutes. Cell debris was
15 removed by centrifugation at 17,211g for 15 minutes and the resulting supernatant was
centrifuged at 118,7069 for 150 minutes. The virus pellet was suspended in 10 mM
sodium phosphate pH 7 and layered onto 5 mL 10-40% sucrose gradient as described
by (Shanks & Lomonossoff 2000). The gradients were centrifuged at 136,8739 for 2
hours at 4OC and 300pL fractions were collected.
20
Expression of VLPs in plants. For expression of proteins in plants using the CPMVHT
system (Sainsbury and Lomonossoff, 2008), the sequences encoding VP60 and
24K were amplified from pBinP-NS1 (Liu eta/., 2005) and pBinP-S1-NT (Liu and
Lomonossoff, 2002), respectively, using oligonucleotides encoding suitable 5' and 3'
25 restriction sites (see Example 6).
Endonuclease treated PCR products were inserted into appropriately digested pEAQHT
resulting in the expression plasmids pEAQ-HT-VP6O and pEAQ-HT-24K (see Fig. 8
and SEQ ID No.s 1 and 2).
30
Following electroporation of these plasmids into the Agrobacteria tumefaciens strain
LBA4404, transient expression in Nicotiana benthamiana was carried out as previously
described (Sainsbury and Lomonossoff, 2008).
35 RNA-1 expression was provided by pBinP-S1 -NT.
For small scale soluble protein extraction, infiltrated leaf tissue was homogenized in 3
volumes of protein extraction buffer (50 mM Tris-HCI, pH 7.25, 150mM NaCI, 2mM
EDTA, 0.1 % [vlv], Triton X-100). Lysates were clarified by centrifugation and protein
concentrations determined by the Bradford assay. Approximately 20 vg of protein
5 extracts were separated on 12% NuPage gels (Invitrogen) under reducing conditions
and electro-blotted onto nitrocellulose membranes. Blots were probed with G49 and an
anti-rabbit horseradish peroxidase-conjugated secondary antibody was used
(Amersham Biosciences). Signals were generated by chemiluminescence and
captured on Hyperfilm (Amersham Biosciences).
10
Extraction of VLPs from plants. In one method, CPMV VLP purifications were
performed on 10 - 20 g of infiltrated leaf tissue by established methods (van Kammen,
1971). The amount of empty VLPs was estimated spectrophotometrically at a
wavelength of 280 nm, by using the molar extinction coefficient for CPMV empty
15 particles of 1.28.
Subsequently, an improved protocol was developed which is described in Example 7.
Electrophoretic analysis of protein. Extracts of infected cells and gradient fractions
20 were analysed by polyacrylamide gel electrophoresis with the NuPAGE system
(Invitrogen Ltd). Gels were either stained with Instant Blue (Expedeon Ltd) or
transferred to nitrocellulose and probed with anti-CPMV antibodies or an antibody
made to a peptide sequence corresponding to the carboxyl-terminal 14 amino acids of
the 48K158K proteins (Holness et a/., 1989). Proteins were visualized by detection with
25 conjugated secondary antibody to horse radish peroxidise.
Transmission electron microscopy. Selected gradient fractions were washed in
Microcon Ultracel YM 100-kD Spin (Millipore) tubes with water as recommended by the
manufacturer.. Samples were placed onto pyroxylin and carbon-coated copper grids
30 and negatively stained with 2% uranyl acetate. Grids were examined at 200kV in an
FEI Tecnai20 transmission electron microscope (FEI UK Ltd, Cambridge) and images
were obtained using a bottom-mounted AMT XR60 CCD camera (Deben UK Ltd, Bury
St. Edmunds) at a direct magnification of 80000X.
Example 1 - Processinq of the RNA-2-encoded polvproteins in trans in insect cells to
give the L and S coat proteins requires both the 24K proteinase and the 32K proteinase
co-factor
5 A full-length cDNA clone of RNA 2 was assembled in the baculovirus expression vector
pMFBD so that upon transcription the entire nucleotide sequence of RNA-2 would be
generated (Fig 1). Recombinant baculovirus, bv-2, was then produced by transposition
of E. coli DHlObac with the pMFBD recombinant plasmid. The resulting recombinant
baculovirus DNA was transfected into the Bac-to-Bac expression system (Invitrogen) to
10 test for the expression of both the 105 and 95K CPMV polyprotein precursors.
Examination by western blotting of three independently derived samples of Sf21 cells
transfected with this construct using an antibody raised against CPMV capsids failed to
detect protein products of these sizes (Fig 2a lanes 1 to 3). This result was not
surprising as both the 105 and 95K polyproteins are known to be unstable (Wellink et
15 a/., 1989). To achieve processing, a cDNA clone corresponding to nucleotides 207 to
3857 of RNA 1 was constructed in pMFBD (Fig 1). This construct, bv-IA, encodes the
N-terminal portion of the RNA-I-encoded polyprotein and should give rise to the 32K,
58K, VPg and the 24K protein products as a result of the action of the encoded 24K
proteinase. Thus it encodes all the factors necessary for the processing of the RNA-2-
20 encoded polyprotein.
Western blot analysis using an antibody raised against CPMV capsids of extracts of
Sf21 cells coinfected with bv-2 and bv-1A (Fig 2a, lane 4) showed the presence of both
the L and S coat proteins. This result shows that the 24K proteinase product derived
25 from bv-1A can proteolytic cleave the RNA-2 polyprotein in trans, thereby duplicating
the activity of the proteinase found in CPMV infected plants. To confirm processing of
the RNA-2 polyprotein had occurred correctly, an extract of St21 cells coinfected with
bv-2 and bv-1A was probed with an antibody specific to C-terminus of the 58148K
proteins detected the 48K protein product in cells co-infected with bv-2 and bv-1A Fig
30 2b lane 9. This confirms that the 24K and 32K protein products can reproduce their in
trans activity when expressed in insect cells.
To ascertain whether the 24K proteinase can process the 95 andl05K polyproteins in
the absence of the 32K processing regulator, the region of RNA-1 encoding the 24K
35 proteinase was cloned downstream of the polyhedrin promoter to give construct bv-
24K. Translation of this construct initiates from the first methionine of the 24K
sequence (amino acid 948 of the RNA-1 polyprotein; Wellink et al., 1986) and
terminates immediately after the C-terminal glutamine (amino acid 11 55). When bv-24K
was co-inoculated into Sf21 cells in the presence of bv-2, no products corresponding to
the mature L or S protein could be detected on a western blot (Fig 2a, lane 5). This
5 suggests that in the absence of the 32K processing regulator, the 24K proteinase is
ineffective at cleaving the RNA-2 encoded polyproteins. .
Example 2 - Processing of VP60 in trans to give the L and S coat proteins requires onlv
the 24K proteinase in insect cells
10
To examine whether VP60 can act as a precursor for the mature L and S protein, a
cDNA clone, bv-VP60, was constructed which contains the sequence from RNA-2
encoding VP60 (Figl). Translation iniation was designed to occur from the methionine
which forms the N-terminal residue of the L protein, with termination occurring at the
15 natural stop codon downstream of the S protein. Western blot analysis using anti-
CPMV capsid antiserum of extracts of Sf21 cells transfected with bv-VP6O showed the
presence of a protein of approximately 6OkDa which corresponds in size to VP60; a
protein of a size which could represent a C-terminally truncated form of the S coat
protein was also seen in low abundance (Fig 2a, lane 6). Co-infection of Sf21 cells
20 with bv-VP6O and bv-1A resulted in the appearance of both the L and S coat proteins
as well as some residual VP60 (Fig 2a, lane7). To determine whether 24K proteinease
can process VP60 by itself, Sf21 cells were co-infected with bv-VP6O and bv-24K and
cell extracts were examined by western blotting using anti-CPMV capsid serum.
Significant amounts of the mature L and S coat protein were found, indicating that the
25 24K proteinase alone can efficiently process VP60. Higher levels of the L and S protein
were obtained when the VP60 and the 24K sequences were expressed from the same
plasmid (construct bv-VP60124K; data not shown).
Example 3 - The L and S proteins produced bv proteolvtic processinq in trans can
30 assemble into VLPs in insect cells
To ascertain whether the L and S proteins resulting from in trans proteolytic processing
of precursor polypeptides can assemble into VLPs, extracts of infected cells were
prepared and analysed by sucrose gradient density centrifugation. As a control, a
35 preparation of CPMV particles isolated from plants was analysed in parallel. The
positions of the L and S proteins in the gradients were determined by western blot
analysis, using anti-CPMV, antibodies of samples of each fraction. In the case of
CPMV particles isolated from infected plants, most of the L and S protein is found in
fractions from the middle of the gradient (Fig 3a). This represents the sedimentation of
the Middle and Bottom components of CPMV, containing RNA-2 and RNA-1,
5 respectively. The small amounts of the L and S proteins in the fractions at the top of the
gradient are derived from the relatively low levels of empty particles (Top component)
present in a natural preparation of CPMV.
Analysis of extracts prepared from cells infected with bv-2 and bv-1 A, with bv-VPGO
10 and bv-1A or with bvVP60124K showed that in each case the L and S co-sediment
suggesting that they have assembled into VLPs (Fig 3b-d). Moreover, they sediment to
a position similar to that of the CPMV empty particles, suggesting that the VLPs
produced in insect cells do not encapsidate RNA. Density gradient centrifugation of
extracts of cells infected with bv-VP60, which produces uncleaved VP60, showed the
15 presence of a protein of approximately 175 kDa, which was distributed throughout the
gradient (Fig 3e). On the basis of its size, this product could represent an SDS-stable
trimer of VP60 which then forms aggregates of a variety of sizes. The peak fractions
containing the L and S proteins generated using the various methods of proteolysis
were co-run on a single gel (Fig 39. While the position of the L protein was consistent
20 in all the samples, the pattern corresponding to the S protein varied. Only the fast
migrating form of the S protein is found in cells infected with bv-2 and bv-1A and bv-
VP60124K in comparison to cells infected with bv-VP6O and bv-1A where both the fast
and slow migrating forms of the S protein are generated (Fig 39.
25 Transmission electron microscopy of the material obtained from the peak fractions
containing the L and S proteins of the sucrose gradients of insect cell extracts revealed
the presence of virus-like particles (Fig 4b-d) which were similar in appearance to
particles isolated from plants (Fig 4a). Particles were relatively abundant in extracts
from cells infected with bv-VP60124K compared to extracts from cells co-infected with
30 either bv-2 or bv-VPGO and bv-1A and their appeared to be less background material
(Fig 4, compare panels b and c with panel d). No particles were seen in preparations
from extracts of insect cells infected with bv-VP6O alone (Fig 4e).
Example 4 - Processinn of VP60 bv the 24K proteinase in plants leads to VLP
35 formation
To determine whether the 24K-directed processing of VP60 in insect cells also occurs
in plants, we employed a recently developed high-level transient expression system
(Sainsbury and Lomonossoff, 2008). This system has been shown to allow the coexpression
of multiple proteins from separate plasmids in plant cells using agro-
5 infiltration. To examine the ability of VP60 to act as a precursor to capsid formation in
plants, the construct pEAQ-HT-VP6O (Fig. 5) was infiltrated into N. benthamiana leaves
in the presence of a construct (pEAQ-HT-24K; Fig. 5) expressing the 24K proteinase.
Analysis of protein extracts from infiltrated tissue on SDSIpolyacrylamide gels revealed
that VP60 is cleaved into the L and S coat proteins in the presence of the 24K
10 proteinase (Fig. 5, middle panel). Potential VLPs resulting from the co-infiltration of
leaves with pEAQ-HT-VP6O and pEAQ-HT-24K were purified using the standard
CPMV purification protocol (van Kammen, 1971). Electron microscopy revealed the
presence of CPMV particles in the resulting material Fig. 5, bottom panel).
15 SDS-PAGE electrophoresis (Fig. 6, upper panel) showed that the VLPs resulting from
the co-infiltration of leaves with pEAQ-HT-VP6O and pEAQ-HT-24K (lane 3) had a coat
protein composition similar to that of either a natural mixture CPMV particles or purified
Top component isolated from plants (lanes 1 and 4) and to VLPs produced in insect
cells (lane 2). The only significant difference was the presence of larger amounts of the
20 unprocessed form of the S protein in the VLPs produced by the co-infiltration than in
the plant- or insect cell-derived particles. This may simply reflect the relative age of the
preparations, the slower migrating form of the S protein is converted to the faster form
on storage.
25 As an alternative to using pEAQ-HT-24K to process VP60, we investigated whether it is
possible to achieve processing with a full-length version of RNA-1. To this end, pEAQHT-
VP6O was co-infiltrated with pBinP-S1-NT and potential VLPs isolated. SDS-PAGE
electrophoresis of these VLPs showed that they contained mature L and S proteins
(Fig. 6, Top panel, lane 5), indicating the RNA-1 can catalyse effective processing of
30 VP60 in plants.
Gel electrophoresis of CPMV particles on non-denaturing agarose gels has previously
shown to be an effective method for distinguishing between empty and RNA-containing
particles, the migration of RNA-containing particles being greater than that of empty
35 particles (Steinmetz eta/., 2007). However, the migration of the particles is not only
dependent upon their RNA content but also upon the presence or absence of the 24
carboxyl-terminal amino acids of the S protein which is often lost by proteolysis. Fig 6
(lower panels) show an agarose gel stained with either Coomassie blue (top) which is
specific for proteins or with ethidium bromide to detect nucleic acids. The pattern of
bands resulting from electrophoresis of a natural mixture of particles isolated from
5 infected plants can be revealed by staining with either Coomassie blue or ethidium
bromide, indicating that they contain both protein and nucleic acid. By contrast, the
particles resulting from cleavage of VP60 by the 24K proteinase either in insect cells
(lane 2) or in plants (lane 3) can be seen only with Coomassie blue staining, a situation
identical to that found with purified Top components (lane 4). These results are
10 consistent with particles being empty (nucleic acid-free). Intriguingly, VLPs isolated
from leaves co-infiltrated with pEAQ-HT-VP6O and pBinP-S1-NT gave rise to two
bands on the agarose gel, the slower migrating of which stained only Coomassie blue,
while the faster stained with both Coomassie blue and ethidium bromide. This suggests
that the slower band consists of nucleic acid-free particles while faster one while the
15 faster one has encapsidated nucleic acid, probably the RNA-1 generated by pBinP-S1-
NT.
Figure 7 is a Western blot showing the processing of VP60 in plants by the 24kDa
proteinase, including a demonstration that VP60 can be modified such that the S coat
20 protein includes a 19 amino acid FMDV sequence inserted in PB-PC loop, without
impairing proteolytic processing.
Example 5 - Discussion of Examples 1 to 4
25 The Examples above demonstrate the first report of the generation of CPMV capsids
via proteolytic processing.
Insect cells have only previously been shown to support both the activity of the 24K
proteinase in cis (van Bokhoven et al., 1990;1992) and the formation of VLPs from the
30 individually expressed L and s proteins (Shanks and Lomonossoff, 2000). When fulllength
version RNA-2-encoded polyproteins were used as the coat protein precursors
in the above Examples, the mature L and S proteins were released only when an RNA-
1 construct encoding both the 32K proteinase co-factor and the 24K proteinase was
used to achieve processing. This observation is consistent with the conclusion from in
35 vitro translation studies that both the 32K and 24K proteins are required for processing
the RNA-2-encoded polyproteins at the 58W48K-L junction (Vos et a/., 1988).
However, we have further been able to demonstrate that the L and S proteins produced
by processing of the full-length RNA-2 polyproteins can assemble into VLPs, the first
time this has been observed.
5 By contrast to the situation when the full-length RNA-2 polyproteins were used, coexpression
of the 24K proteinase alone was sufficient to achieve processing of VP60
into the L and S proteins. This is consistent with previous studies that the 24K
proteinase alone could cleave at the L-S junction to release the S protein when the
proteinase and VP60 sequences were part of the same artificial precursor (Garcia et
10 al., 1987; Vos et al., 1988; Wellink et al., 1996). However, prior to this report no direct
processing of VP60 by the 24K proteinase to give the mature L and S protein had
previously been observed. The fact that release of the L and S proteins from VP60 by
the action of the 24K proteinase in trans also leads to the formation of VLPs
demonstrates that VP60 can act as a coat protein precursor as originally proposed by
15 Franssen et al. (1982).
The relevance of VP60 cleavage to capsid formation in planta was confirmed by the
demonstration that the transient co-expression of VP60 and the 24K proteinase in N.
benthamiana leaves lead to the production of the L and S proteins and formation of
20 capsids.
Sucrose gradient density analysis of the VLPs produced by proteolytic processing in
insect cells suggested that the particles are essentially RNA-free as they sediment to a
position characteristic of Top components produced during a natural infection. In the
25 case of extracts from cells expressing bv-VP60/24K, which produced the largest
amount of VLPs, this observation was confirmed by agarose gel electrophoresis of
particles. The observation that only the fast migrating form of the S protein is
generated through co-expression of bv-2 and bv-1A or by expression of bv-VP60124K
while cells co-infected with bv-VP6O and bv-1A generate both the fast and slow
30 migrating forms of the S protein is unclear. Expression of VP60 in the absence of the
24K proteinase does not lead to VLP formation, a result consistent with that of Nida et
al. (1 992). However, the protein appears to form amorphous aggregates which migrate
over a considerable portion of a sucrose density gradient. Analysis of the fractions from
the gradients revealed a protein of approximately 175kDa which is roughly 3 times the
35 molecular weight of VP60. This is consistent with it being an SDS-stable trimer of VP60
which might represent an intermediate in the VLP assembly pathway - assembly to
produce capsids only proceeding after cleavage at the L-S site. This raises the
possibility that capsid assembly starts by the association of VP60 molecules around the
3-fold axes which in the mature particles are occupied by the L protein
5 A further interesting feature of the expression of VP60 in both insect cells and in plants
is the appearance, in the absence of the 24K proteinase, of low amounts of protein
whose size is identical to the fast form of the S protein. This product most likely arises
through the non-specific cleavage of the linker between the C-terminal domain of the L
protein and the S protein. This linker consists of 25 amino acids and is probably in an
10 extended conformation making it susceptible to cleavage (Clark et a/., 1999).
Example 6 - Presence of VP60 and 24K aenes in the same T-DNA region enhances
eVLP vield
15 Figure 10 shows the structure of a combined high-level expression plasmid used for
plant expression (pEAQexpress-VP60-24K). The complete sequence is provided as
SEQ ID NO 3.
As shown in Figure 13, expression can be enhanced at least three-fold if one vector
20 encodes both genes, as compared with the use of two separate vectors.
In conjunction with the improved protocol described in Example 7, yields of up to
0.2glKg leaf tissue (i.e. 0.02% wlw) or more can be achieved.
25 Example 7 - Improved extraction of Cowpea mosaic virus emptv virus-like particles
The method for extraction of CPMV eVLPs from N. benthamiana was initially based on
a protocol from van Kammen and de Jager (Database of plant viruses, 1971).
30 Since the 1971 protocol was originally designed for wild-type particles from cowpea, it
was optimised for eVLPs. To identify the key steps in the extraction process where
particles were being lost, samples were collected from each stage of the extraction and
analysed by SDS-PAGE and western blots. Based on this, the protocol was modified
and validated by analysing samples from each step again.
The following observations were made and the eVLP extraction protocol was modified
accordingly.
5
MODIFIED PROTOCOL
Leaf tissue is processed
fresh (e.g. in cold room).
2% PVPP (polyvinylpolypyrrolidone)
is used
while grinding plant tissue
as it binds to
polysaccharides and
phenolics from the plant.
Since PVPP is insoluble, it
is separated in the first
spin and doesn't affect the
next steps.
This step is deleted
completely. Further
purification steps are done
on the final sample to
remove impurities.
After adding buffer to the
PEG precipitate, it is
resuspended thoroughly
by vortexing, pippeting up
and down and shaking the
tubes vigorously for 2-3
hours.
The centrifugation spin
time is increased to 2:30
hours.
OLD PROTOCOL
Leaf tissue was
harvested and frozen.
Sodium phosphate
buffer was used.
A I : I chloroformbutanol
mixture was
used to remove
chlorophyll and other
plant proteins from the
extract.
A 27000 g spin is
done straight after
PEG precipitation.
Ultra-centrifugation
done for 2:15 hours.
PROBLEM
eVLPs degrade upon
freezing.
Polysaccharides from N.
benthamiana purify along
with eVLPs and form a sticky
pellet after ultracentrifugation.
Over a 50% of the eVLPs
were degrading at this step.
eVLPs were being lost in the
pellet after the 27000 g spin.
This indicates that the PEG
ppt. was not resuspended
properly prior to the spin.
The sedimentation coefficient
of eVLPs (58 S) is lesser
than that of the wt particles
(1 18 S).
A preferred modified protocol is as follows:
Equipment
5 Electric blender, Centrifuge, Ultracentrifuge, Magnetic stirrer, Vortex mixer
Procedure
1. Harvest infiltrated leaves and homogenise leaf tissue with 3 volumes (for 1 g
10 tissue, use 3 mls) of 0.1 M Sodium phosphate buffer, pH=7.0 using a blender.
2. Add Polyvinyl-polypyrrolidone (PVPP) to the buffer to a final concentration of
2%. PVPP binds to contaminating polysaccharides and phenolics from the plant.
15 3. Squeeze homogenate through two layers of muslin cloth and spin at 13000 g
for 20 mins at 4 OC to remove cell debris.
4. To the supernatant, add polyethylene glycol 6000 (PEG 6000) to a final
concentration of 4% and NaCl to 0.2 M. Stir at 4 OC overnight to precipitate the virus
20 particles.
5. Spin at 13000 g for 20 mins at 4 OC to pellet the PEG precipitate.
6. Dissolve the pellet in 0.01 M sodium phosphate buffer, pH=7 (0.5 mllg leaf
25 tissue) and resuspend thoroughly by vortexing.
7. Spin at 27000 g for 20 mins at 4 OC.
8. Transfer the supernatant to ultracentrifuge tubes and spin at 11 8,700 g for 150
30 mins at 4 OC in an ultracentrifuge.
9. Resuspend pellet in a small volume (by way of non-limiting example, 500 PI) of
buffer and spin at 10,000 g for 5 mins on a bench-top centrifuge to remove possible
contaminants.
The supernatant contains purified CPMV eVLPs.
As shown in Figure 11, using the modified protocol and the new construct, the yield of
eVLPs from N. benthamiana is in excess of 0.2 glkg RNT. This is about 10-fold more
5 than what it was before optimisation. The eVLPs produced in this way are about 30 nm
in size.
As shown in Figure 12, removal of the organic extraction step increases eVLP recovery
The L and S proteins from particles have been separated by SDS-PAGE using 12%
10 NuPAGE gels stained with Instant Blue Coomassie stain. Comparison of Lanes 1 and 2
shows that deletion of the organic clarification step (Lane 2) increases recovery by
about 60%. An increase in contaminants is seen but these can be easily removed
using dialysis and desalting columns.
Example 8 - Cowpea mosaic virus unmodified empty virus-like particles can be loaded
15 with metal and metal oxide.
The wild-type virus CPMV capsid is stable to moderately high temperature, for example
60 "C (pH 7) for at least one hour, across the range of pH 4 - 10, and in some organic
solvent-water mixtures. This degree of stability is extremely valuable as it enables the
particles to be chemically modified. For example, amino acid residues on the solvent-
20 exposed capsid surface can be used to selectively attach moieties such as redoxactive
molecules, fluorescent dyes, metallic and semi-conducting nanoparticles,
carbohydrates, DNA, proteins and a n t i b o d i e ~A.s~ w~e~ll ~as~ c hemical modification, the
availability of infectious cDNA clones has allowed the production of chimeric virus
particles presenting multiple copies of peptides on the virus surface.22 One application
25 of chimeric virus has been to produce externally mineralized virus-templated
monodisperse nanopartic~esH.~ow~e~v~e~r, for many purposes, such as targeted
magnetic field hyperthermia therapy, it would be desirable to produce particles that are
internally mineralized; eVLPs offer a route to how this could be achieved.
30 The method for the production of eVLPs in this example used pEAQ-HT system to
simultaneously express the VP60 coat protein precursor and the 24K proteinase in
plants via agro-infiltration. As described above, efficient processing of VP60 to the L
and S proteins occurred, leading to the formation of capsids which were shown to be
devoid of RNA.
Incubation of CPMV eVLPs, suspended in 10mM sodium phosphate buffer pH 7, with
cobalt chloride solution, followed by washing, and then subsequent reduction with
sodium borohydride gave cobalt-loaded VLPs (cobalt-VLPs) in which cobalt is
5 encapsulated within the capsid core. Recovery of cobalt-VLPs is approximately 70%
based on initial CPMV eVLP concentration. An unstained transmission electron
microscopy (TEM) image clearly showed the cobalt core (not shown) and energy
dispersive X-ray spectroscopy (EDXS) confirmed the presence of cobalt. CPMV
eVLPs, prior to the reaction, were not visible in the TEM without staining. A uranyl
10 acetate negatively stained TEM image of cobalt-VLPs showed the intact VLP protein
shell (the capsid) surrounding the metallic core (not shown). Dynamic light scattering
(DLS) of the particles in buffer confirms that the external diameter of the VLPs (31.9 k
2.0 nm compared to 32.0 * 2.0 nm for CPMV eVLP) does not change significantly on
internalization of cobalt and that the particles remain monodisperse. The cobalt particle
15 size of ca. 26 nm is as expected if the interior cavity of the VLP is fully filled.
A similar approach was employed to generate internalized iron oxide. A suspension of
CPMV eVLPs was treated with a mixture of ferric and ferrous sulfate solutions in a
molar ratio of 2:1, under conditions which favor the formation of Fe304, magnetite. After
20 mixing overnight at pH 5.1, the particles were washed on 100 kDa cut-off columns
before the pH was raised to 10.1. The resultant iron oxide-VLPs were purified and
obtained in 40-45% yield based on initial CPMV eVLP concentration. Again, unstained
TEM images clearly showed the metal oxide core; negatively stained TEM images
showde the external capsid protein; EDXS confirms the presence of iron and oxygen;
25 and DLS shows that the particles are monodisperse with an external diameter (- 31.6 k
2.0 nm) changed little compared to CPMV eVLPs. The zeta potentials for suspensions
of eVLPs (-32.0 k 2.3 mV) cobalt-VLPs (-32.9 k 1.8 mV) and iron oxide-VLPs (-32.1 k
2.4 mV) indicate that the colloids have good stability and show little propensity to
aggregate. In each case, control experiments performed under identical conditions
30 except for the absence of eVLPs gave non-specific bulk precipitation with a wide size
distribution of nanoparticles as observed by TEM and DLS; thus the eVLPs are
essential for controlled nanoparticle growth.
Previously, we have found that externally mineralized, for example silicated, CPMV
35 particles are robust and the coat proteins cannot be released by denaturation under
harsh conditions (e.g. denaturing with sodium dodecyl sulfate at 100 OC for 30
Here, however, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDSPAGE)
of the denatured proteins from wild-type CPMV isolated from infected plants,
"top component" consisting of empty particles from a wild-type infection,25C PMV
eVLPs, cobalt-VLPs and iron oxide-VLPs (not shown) all gave a similar pattern of
5 bands after Coomassie Blue staining; the slower running L protein and faster running
forms of the S protein. The difference in the S proteins isolated from wild-type virus and
eVLP samples is due to the differing degrees of C-terminal processing. These results
indicate that the coat proteins are accessible and that the mineralization is internal.
Further confirmation that the capsid structure is preserved, and that the eVLPs were
10 not externally mineralized, was provided by analysis of the intact particles by agarose
gel electrophoresis. Coomassie Blue staining revealed that all the VLPs which were
devoid of RNA, whether containing internalized metal/metal oxide or not, had the same
mobility. By contrast the RNA-containing particles from natural populations of particles
gave a typical complex pattern.
15
Further analysis confirmed that the mineralized VLPs contained both the coat proteins
and either cobalt or iron, respectively. Samples of each of unmineralized eVLP, cobalt-
VLP and iron oxide-VLP were spotted onto a nitrocellulose membrane which, after
blocking, was probed with polyclonal antibodies raised in rabbits against CPMV
20 particles. The binding of the antibodies was detected using a goat anti-rabbit IgG
coupled to horseradish peroxidise and the signals were visualized by
electrochemiluminescence. In each case a dark signal was obtained confirming the
presence of CPMV coat protein in all the VLP samples (not shown). Similarly, each of
eVLP, cobalt-VLP and iron oxide-VLP were spotted onto a nitrocellulose membrane
25 and probed with either a cobalt-specific stain (I-nitroso-2-naphthol) or Prussian blue
staining to identify iron. Only the cobalt-VLP stained orange, showing the presence of
cobalt, and only the iron oxide-VLP stained blue, showing the presence of iron, within
the VLPs.
30 To demonstrate that the external coat of the metal containing VLPs is still amenable to
chemical modification, cobalt-VLPs were functionalized at solvent-exposed lysines with
succinimide ester activated biotin by an adaptation of our standard pr~cedureT.h~e~
binding of both biotinylated-cobalt-VLPs and biotinylated-eVLPs to streptavidinmodified
chips was monitored by surface plasmon resonance. In each case a response
35 was observed, confirming that chemical modification of the VLP capsid exterior had
successfully occurred, irrespective of the internal mineralization. This provides the first
evidence that the external surface of eVLPs and internally mineralized VLPs can be
chemically modified using the same approach taken for wild-type CPMV. Comparison
of normalized sensograms recorded at the same VLP concentration (based on protein
content as estimated by UV-visible spectroscopy) showed a two and a half fold
5 increase in resonance units consistent with the increase in mass associated with the
loading of cobalt within the VLP.
In conclusion, this Example confirms that CPMV eVLPs can, without further genetic or
chemical modification, easily encapsulate inorganic payloads such as cobalt or iron
10 oxide within the capsid interior. Previously, it has been shown that wild-type CPMV
particles are permeable to cesium ions and that penetration probably occurs via
channels at the five-fold axes of the virus particles, where the S subunits cluster. These
channels are funnel-shaped, with the narrow end at the outer surface of the virus
particle and the wider end in the interior.lg The opening at the narrow end is about 7.5
15 A in diameter. Further down the five-fold axis, a second constriction can be found
which occurs as a result of the three N-terminal residues of the S subunits forming a
pentameric annulus structure. In this structure, the amino group of the N-terminus
forms a hydrogen bond with the main chain carbonyl oxygen of the neighbouring third
residue; the opening at this point is ca. 8.5 A. We propose that it is through these
20 channels that the cobalt and iron ions enter the inside of the eVLP. That the pentameric
annulus controls access to the interior of the eVLPs is supported by the observation
that the addition of a methionine residue to the N-terminus of the S protein prevents
penetration by cobalt ions, presumably by occluding the channel with a bulky side
chain.27 The charge on the internal surface of the capsid is negative, arising from
25 glutamic acid and aspartic acid residues. The electrostatic interactions between the
internal surface and the incorporated metal ions entrap them within the capsid. Even
six hours dialysis against buffer does not remove the electrostatically entrapped metal
ions. On further treatment, either reduction for cobalt or alkaline hydrolysis for the iron
oxide, the metal ions act as nucleation sites for metal particle formation or further
30 autocatalytic hydrolysisz8 to produce iron oxide, respectively.
The encapsulation processes occur at ambient temperature, in aqueous media,
producing little waste, so are environmentally friendly. In addition, amino acid residues
on the exterior surface of the internally mineralized particles remain amenable for
35 chemical modification. The ability to both encapsulate materials (e.g. nanoparticles or
drugs) within the eVLP and to chemically modify the external surface, opens up routes
for the further development of CPMV-based systems for the targeted delivery of
therapeutic agents and for other uses in biomedicine.
Example 9 - Cowpea mosaic virus unmodified empty virus-like particles can be loaded
5 with dyes and drugs
Two compounds were selected: rhodamine (a fluorescent dye) and doxorubicin (a
fluorescent drug). Both compounds were theoretically just small enough to enter
eVLPs through the pores at the 5-fold axes.
10
Doxorubicin
15 The method for the production of eVLPs in this example used a solution of 1 mglml
eVLP mixed with a final concentration of I mglml Doxorubicin or Rhodamine and
incubated overnight at 4C with occasional agitation.
eVLPs were concentrated and washed with water to remove unbound drugldye.
20
The loaded eVLPs were coated with the positively polymer polyallylamine
hydrochloride (PAH) to coat the virus and prevent leaching of the drugldye.
Particles were washed with water
Examination of loaded eVLPs on agarose gels showed co-migration of coat protein and
fluorescence.
Uvlvis spectrophotometry suggests 8 Rhodamine or 10 Doxorubicin molecules per
5 eVLP.
Gemcitabine is a nucleoside analog used in chemotherapy. It is marketed as Gemzar
by Eli Lilly and Company. It is predicted to be smaller than either of the compounds
above may be loaded into eVLPs using corresponding methods.
10
NI H2
OH F Gemcitabine
Example 10 - oligonucleotides for cloning of sequences
1 5 a) 24K Cloninq 5' oliao
KS 19 = GAGITTGGG GATC GLV-TGTCTTTGGATCAG TI!
a G T T M F L S R E E F G Q T H K C L W I -
b V Q Q C S S Q E X S L G R R T
C Y N N V P L K R R 7 ? W A D k QOH S LGD Q -S -
24K Start
KS 19 = GAGTTTGGGCAGATCTAGAAATGTCTTTGGATCAG
20
b) 24K Cloning 3' oliqo
3' GCTTC 5' = KS20
STOP Spel
5 C) VP60 Cloninq 5' oliqo
A G S T K W E C G F S T
w T H E M G M W L F H S K T C L P F -
KS 17 = GGCTAr GGCTAIr GAT'+ CA?'&TGG AGc,:B3JLF,CTTG
KS 17 = GGCTAGTGATCACACAAATGGAGCAAAACTTG
dl VP60 Clonina 3' oliao
Eco RI
KS 1 8 = TAATGAATTCCCAGAGTTAAGCAGCAGTAGC
el .Cloning of ?A - 5' oligo
5 Into Barn HI compatible site (Bbs I) using Barn Hi site in RNA 1 at 3857
and -
R D F L S L D P T W V S Q l 4 M R P I V R -
G T F L V L T Q G S P R I I * G R k * G -
G L 5 c S " P N0M G L P Tr Y E A D S E A -
4 3 2 K
I
I
I
I
C
I
I
AACATGGGTCTCCCAG = KSll
Barn HI'
KS11 = GTCGGATCCCAACATGGGTCTCCCAG
R Clonina of ?A - 3' oliqo
Into Barn HI compatible site (Bbs I) using Barn Hi site in RNA 1 at 3857
KS 10 = 5' TTATCCTAGTTTGCGCGCTA
5 Sequence located in the Nos terminator of pBinPSl NT
After PCR the product was digested with Barn HI and the
appropriate product ligated into pMFBD previously digested
with Barn HI
10
KS I 0 = 5' TTATCCTAGTTTGCGCGCTA
g) 24K protease sequence map
ATGTCTTTGGATC
- - + - - - - - - - - - + 3060
TACAGAAACCTAG
C L W I -
V F G S -
M S L D Q -
DdeI
NlaIII I
AlwI CviAII I I
Hpy188I I Fatll I I Cvi JI Mnl I Tsp5 0 9 I
I I _ I I I I I I I
AGAGTAGTGTTGCTATCATGTCTAAGTGTGTAGGGCTAAGTTCTGGTTTTTGGAGGCACTMTT
a R V V L L S C L S V G L I W F L E A L I -
b E * C C Y H V * V * G * S G F W R H * F -
C S S V A I M S K C R A N L V F G G T N L -
BstNI
ScrFI
KPnI 1 HphI
PSPGI l I MboII I
~ty~41I l HPYCH4VI I
~ l a 1 ~I I 1 ~la111l I
RsaI l I I N ~ P I I I
AlfIl I I I SP~lI I
CSP~II I I I cac81 1 1 I
Acc65I I I I I I CV~AII1~1 I
Ban1 l I I I I ~at-111 I I I
NlaIII I I I I I HgaI I I I I I I
CviAII I I I I I I MboII 1 I I I I I
15 HPYCH~V Fat1 1 I I 1 1 / 1 BbsI I 1 1 1 1 1 I
I I I I I I I I I I I I l l I I I
TGCAAATAGTTAGTCATGGTACCAGGAAGACGCTTTTTGGCATGCAAATAGTCATTTCTTCACCCACA
ACGTTTATCAGTACCATGGTCCTTCTGCGWCCGTACGTTTGTWGAAGTGGGTGT
20
a C K * S W Y Q E D A F W H A N I S S P T -
b A N S H G T R K T L F G M Q T F L H P H -
C Q I V M V P G R R F L A C K H F F T H I -
AlwI
Tsp509I
MboII I
FokI I I
TaqII RsaI I I
Tsp509I XcmI BccI BstF5I ~sp61I I I MboI
I I I I I l I I I
TAAAGACCAAATTGCGTGTGGAAATAGTTAGTTATGGATGGAAGAAGGTACTATCATCAATTTG
3181 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3240
ATTTCTGGTTTAACGCACACCTTTATCAATACCTACCTTCTTCCATGATAGTAGTTAAAC
35
a * R P N C V W K * L W M E E G T I I N L -
b K D Q I A C G N S Y G W K K V L S S I * -
C K T K L R V E I V M D G R R Y Y H Q F D -
HpyCH4V
BstKTI I
~py1881 BstF5I AluI
HinfI I RsaI I BccI
BspCNI 1 ~de11 csp61 I I CviJI
~pn11 I Ssp1 B S ~ M I I ~ T ~I ~I IF okI ~at111 I BfaI I
/ I I I I I I I I I I l l I I I
ATCCTGCAAATATTTATGATATACCTGATTCTGAGTTGGTcTTGTAcTcccATccTAGcT
3241 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3300
TAGGACGTTTATAAATACTATATGGACTAAGACTCAACCAGAACATGAGGGTAGGATCGA
a I L Q I F M I Y L I L S W S C T P I L A -
b S C K Y L * Y T * F * V G L V L P S * L -
C P A N I Y D I P D S E L V L Y S H P S L -
10
AcuI
Eco57MI
NlaIV I
~mg~l201l I
~ l a 1 ~ 1I
BS~KTI A V ~ I I I I I
~pn11 ~co01091ll I
BbsI BstYI I I PPm1 1 I I
TaiI mol I I S ~ ~ D I I I I BsmFI
HpyCH4IV IMbo11 BseYI I I I AlwI ~au961I I I Tsp509I
I I I I I I I I I l l I I
TGGAAGACGTTTCCCATTCTTGCTGGGATCTGTTCTGTTGGGACCCAGACAAAGAATTGC
3301 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3360
ACCTTCTGCAAAGGGTAAGAACGACCCTAGACAAGACAACCCTGGGTCTGTTTCTTAAcG
a W K T F P I L A G I C S V G T Q T K N C -
b G R R F P F L L G S V L L G P R Q R I A -
C E D V S H S C W D L F C W D P D K E L P -
Hpyl88III
AciI I
BsrBI SmlI BpuE I MnlI
I I I I
CTTCAGTATTTGGAGCGGATTTCTTGAGTTGTAAATACAACAAGTTTGGGGGTTTTTATG
35 3361 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3420
GAAGTCATAAACCTCGCCTAAAGAACTCAACATTTATGTTGTTCAAACCCCCAAAAATAC
a L Q Y L E R I S * V V N T T S L G V F M -
b F S I W S G F L E L * I Q Q V W G F L * -
40 c S V F G A D F L S C K Y N K F G G F Y E -
FSPI l
HhaI FS~A1I
HinPlI IMWOI EcoRV ~in~l11 1 BsmI Fa11
I I I I I I I I I
AGGCGCAATATGCTGATATCAAAGTGCGCACAAAGAAAGAATGCCTTACCATACAGAGTG
3421 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3480
TCCGCGTTATACGACTATAGTTTCACGCGTGTTTCTTTCTTACGGAATGGTATGTCTCAC
a R R N M L I S K C A Q R K N A L P Y R V -
10 b G A I C * Y Q S A H K E R M P Y H T E W -
C A Q Y A D I K V R T K K E C L T I Q S G -
TstI
Bsu36I I
DdeI I
TspDTI I I
BPuEI l I I
Hi1141 1 I I
MnlIlI I I
BSPCNI I I I I I
B ~ ~ M I I I I I I I I
Hpyl88III Alul 1 1 1 1 1 I I
Tsp509I Hpy8I BsrnAI SmlI cviJ1 1 1 1 1 1 I I
I I I I I I I I l l I I
GTAATTATGTGAACAAGGTGTCTCGCTATCTTGAGTATGAAGCTCCTACTATCCCTGAGG
3481 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3540
CATTAATACACTTGTTCCACAGAGCGATAGAACTCATACTTCGAGGATGATAGGGACTCC
a V I M * T R C L A I L S M K L L L S L R -
30 b * L C E Q G V S L S * V * S S Y Y P * G -
c N Y V N K V S R Y L E Y E A P T I P E D -
BstKTI
DPnI 1 TstI NlaIII
35 BstYI I I Ale1 I TspDTI CviAII I
MboI I I AlwI Hin4I MslI I TaqII I Fat11 I
I I1 I I I I I I I I I
ATTGTGGATCTCTTGTGATAGCACACATTGGTGGGAAGCATTGTGGGTGTTCATG
3541 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3600
40 TAACACCTAGAGAACACTATCGTGTGTAACCACCCTTCGTGTT~TAA~A~~~A~AAGTA~
L W I S C D S T H W W E A Q D C G C S C -
C G S L V I A H I G G K H K I V G V H V -
Cvi JI
BstFSI FokI N ~ ~1 I V
I I I I
TTGCTGGTATTCAAGGTAAGATAGGATGTGcTTccTTATTGccAccATTGGAGccAATAG
3601 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3660
AACGACCATAAGTTCCATTCTATCCTACACGAAGGAATAACGGTGGTAACCTCGGTTATC
10
a L L V F K V R * D V L P Y C H H W S Q * -
b C W Y S R * D R M C F L I A T I G A N S -
C A G I Q G K I G C A S L L P P L E P I A -
Mwo I
MnlI I
BspCNI I I
HhaI 1 I
B S ~ M I I ~ I I
~ i n ~ l 1I l I I
I l l I I
CACAAGCGCAA
25 3661 - - - - - - - - - + -
GTGTTCGCGTT
a H K R K V
b T S A R C
30 c Q A Q *
h) VP60 seauence map
ATGGAGCAAAACTTGTTTGCCCT
- - + - - - - - - - - - + - - - - - - - - - + 1560
TACCTCGTTTTGAACAAACGGGA
G A K L V C P -
M E Q N L F A L -
W S K T C L P F -
PspXI
I
TTCTTTGGATGATACAAGCTCAGTTCGTGGTTCTTTGCTTGACACWTTCGCACAAAC
1561 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 1620
AAGAAACCTACTATGTTCGAGTCAAGCACCAAGmCGAACTGTGTTTTAAGCGTGTTTG
a F F G * Y K L S S W F F A * H K I R T N -
b S L D D T S S V R G S L L D T K F A Q T -
C L W M I Q A Q F V V L C L T Q N S H K L -
10
BstXI
I
TCGAGTTTTGTTGTCCAAGGCTATGGCTGGTGGTGATGTGTTATTGGATGAGTATCTCTA
1621 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 1680
15 AGCTCAAAACAACAGGTTCCGATACCGACCACCACTACACAATAACCTACTCATAGAGAT
TGATGTGGTCAATGGACAAGATTTTAGAGCTACTGTCGCTTTTTTGCGCACCCATGTTAT
1681 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + 1740
ACTACACCAGTTACCTGTTCTAAAATCTCGATGACAGCGCGCGTGGGTACAATA
AACAGGCAAAATAAAGGTGACAGCTACCACCAACATTTCTGACAACTCGGGTTGTTGTTT
30 1741 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 1800
TTGTCCGTTTTATTTCCACTGTCGATGGTGGTTGTmGACTGTTGAGCCCAACAACAAA
ScaI
I
GATGTTGGCCATAAATAGTGGTGTGAGGGGTAAGTATAGTACTGATGTTTATACTATCTG
40 1801 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 1860
CTACAACCGGTATTTATCACCACACTCCCCATTCATATCATGACTACMTATGATAGAC
a D V G H K * W C E G * V * Y * C L Y Y L -
b M L A I N S G V R G K Y S T D V Y T I C -
c C W P * I V V * G V S I V L M F I L S A -
BmgBI
I
CTCTCAAGACTCCATGACGTGGAACCCAGGGTGC-GAACTTCTCGTTCACATTTAA
1861 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + 1920
GAGAGTTCTGAGGTACTGCACCTTGGGTCCCACGTTTTTCTTGAAGAGCAAGTGTAAATT
10
a L S R L H D V E P R V Q K E L L V H I * -
b S Q D S M T W N P G C K K N F S F T F N -
c L K T P * R G T Q G A K R T S R S H L I -
T C C A A A C C C T T G T G G G G A T T C T T G G T C T G C T G A G A T G A T A
1921 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + 1980
AGGTTTGGGAACACCCCTAAGAACCAGACGACTCTACTATTCAGCTTCGTCTCAATCCTA
a S K P L W G F L V C * D D K S K Q S * D -
20 b P N P C G D S W S A E M I S R S R V R M -
C Q T L V G I L G L L R * * V E A E L G * -
Ale1
I
GACAGTTATTTGTGTTTCGGGATGGACCTTATCTCCTACCACAGATGTGATTGCCAAGCT
1981 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2040
CTGTCAATAAACACAAAGCCCTACCTGGAATAGAGGATGGTGTCTACACTAACGGTTCGA
a D S Y L C F G M D L I S Y H R C D C Q A -
30 b T V I C V S G W T L S P T T D V I A K L -
c Q L F V F R D G P Y L L P Q M * L P S * -
AGACTGGTCAATTGTCAATGAGAAATGTGAGCCCACCATTTACCACTTGGCTGATTGTCA
2041 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2100
35 TCTGACCAGTTAACAGTTACTCTTTACACTCGGGTGGTAAATGGTGAACCGACTAACAGT
a R L V N C Q * E M * A H H L P L G * L S -
b D W S I V N E K C E P T I Y H L A D C Q -
C T G Q L S M R N V S P P F T T W L I V R -
40
GAATTGGTTACCCCTTAATCGTTGGATGGGAAAATTGACTTTTCCCCAGGGTGTGACAAG
2101 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + - + 2160
CTTAACCAATGGGGAATTAGCAACCTACCCTTTTAACTGAAAAGGGGTCCCACACTGTTC
TGAGGTTCGAAGGATGCCTCTTTCTATAGGAGGCGGTGCTGGTGCGACTCAAGCTTTCTT
2161 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2220
ACTCCAAGCTTCCTACGGAGAAAGATATCCTCCGCCACGAccAcGcTGAGTTcGmGAA
10
a * G S K D A S F Y R R R C W C D S S F L -
b E V R R M P L S I G G G A G A T Q A F L -
C R F E G C L F L * E A V L V R L K L S W -
GGCCAATATGCCCAATTCATGGATATCAATGTGGAGATATTTTAGAGGTGAACTTCACTT
2221 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2280
C C G G T T A T A C G G G T T A A G T A C C T A T A G T T A C A C C T C T A T A
a G Q Y A Q F M D I N V E I F * R * T S L -
20 b A N M P N S W I S M W R Y F R G E L H F -
C P I C P I H G Y Q C G D I L E V N F T L -
TGAAGTTACTAAAATGAGCTCTCCATATATTAAAGCCACTGTTACATTTCTCATAGCTTT
2281 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2340
25 ACTTCAATGATTTTACTCGAGAGGTATATAATTTCGGTGACAATGTAAAGAGTATCGAAA
BplI
I
TGGTAATCTTAGTGATGCCTTTGGTTTTTATGAGAGTTTTCCTCATAGAATTGTTCAATT
2341 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2400
35 A C C A T T A G A A T C A C T A C G G A A A C C A ? U U i A T A C T C T C A A A A
a W * S * * C L W F L * E F S S * N C S I -
b G N L S D A F G F Y E S F P H R I V Q F -
C V I L V M P L V F M R V F L I E L F N L -
40
BbvCI
Bpul 0 I
I
TGCTGAGGTTGAGGAAAAATGTACTTTGGTTTTCTCCCAACTGCTTG
2401 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2460
ACGACTCCAACTCCTTTTTACATGAAACCAAAAGAGGGTTGTTCTCAAACAGTGACGAAC
5
a C * G * G K M Y F G F L P T R V C H C L -
b A E V E E K C T L V F S Q Q E F V T A W -
C L R L R K N V L W F S P N K S L S L L G -
10 GTCAACACAAGTAAACCCCAGAACCACACTTGAAGCAGATGGTTGTCCCTACCTATATGC
2461 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2520
CAGTTGTGTTCATTTGGGGTCTTGGTGTGAACTTCGTCTACCAACAGGGATGGATATACG
a V N T S K P Q N H T * S R W L S L P I C -
15 b S T Q V N P R T T L E A D G C P Y L Y A -
C Q H K * T P E P H L K Q M V V P T Y M Q -
BsaWI
BspHI BspEI
I I
AATTATTCATGATAGTACAACAGGTACAATCTCCGGAGATTTTAATCTTGGGGTCAAGCT
2521 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2580
TTAATAAGTACTATCATGTTGTCCATGTTAGAGGCCTCTAAAATTAGAACCCCAGTTCGA
25 a N Y S * * Y N R Y N L R R F * S W G Q A -
b I I H D S T T G T I S G D F N L G V K L -
C L F M I V Q Q V Q S P E I L I L G S S L -
NciI
I
TGTTGGCATTAAGGATTTTTGTGGTATAGGTTCTAATCCGGGTATTGATGGTTCCCGCTT
2581 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2640
ACAACCGTAATTCCT~CACCATATCCAAGATTAGGCCCATAACTACCAAGGGCGAA
35 a C W H * G F L W Y R F * S G Y * W F P L -
b V G I K D F C G I G S N P G I D G S R L -
C L A L R I F V V * V L I R V L M V P A C -
Eco0109I
PsrI PpuMI
I I
GCTTGGAGCTATAGCACAAGGACCTGTTTGTGCTGAAGCCTCAGATGTGTATAGCCCATG
a A W S Y S T R T C L C * S L R C V * P M -
5 b L G A I A Q G P V C A E A S D V Y S P C -
C L E L * H K D L F V L K P Q M C I A H V -
Nhe I
BseRI l~rnt1
10 I I I
TATGATAGCTAGCACTCCTCCTGCTCCATTTTCAGACGTTACAGCAGTAACTTTTGACTT
2701 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2760
ATACTATCGATCGTGAGGAGGACGAGGTAAAAGTCTGCAATGTCGTCATTGAAAACTGAA
15 a Y D S * H S S C S I F R R Y S S N F * L -
b M I A S T P P A P F S D V T A V T F D L -
C * * L A L L L L H F Q T L Q Q * L L T * -
AATCAACGGCAAAATAACTCCTGTTGGTGATGACAATTGGAATACGCACATTTATAATCC
20 2761 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2820
TTAGTTGCCGTTTTATTGAGGACAACCACTACTGTTAACCTTATGCGTGTAAATATTAGG
a N Q R Q N N S C W * * Q L E Y A H L * S -
b I N G K I T P V G D D N W N T H I Y N P -
25 c S T A K * L L L V M T I G I R T F I I L -
TCCAATTATGAATGTCTTGCGTACTGCTGCTTGGAAATCTGGAACTATTCATGTTCAACT
2821 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2880
AGGTTAATACTTACAGAACGCATGACGACGAACCTTTAGACCTTGATAAGTACAAGTTGA
30
a S N Y E C L A Y C C L E I W N Y S C S T -
b P I M N V L R T A A W K S G T I H V Q L -
C Q L * M S C V L L L G N L E L F M F N L -
35 TAATGTTAGGGGTGCTGGTGTCAAAAGAGCAGAGCAGATTGGGATGGTCAAGTCTTTGTTTACCT
2881 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 2940
ATTACAATCCCCACGACCACAGTTTTCTCGTCTAACCCTACCAGTTCAGAAACAAATGGA
a * C * G C W C Q K S R L G W S S L C L P -
40 b N V R G A G V K R A D W D G Q V F V Y L -
C M L G V L V S K E Q I G M V K S L F T C -
BstUI
I
GCGCCAGTCCATGAACCCTGAAAGTTATGATGCGCGGACATTTGTGATCTCACAACCTGG
2941 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3000
CGCGGTCAGGTACTTGGGACTTTCAATACTACGCGCCTGTAAACACTAGAGTGTTGGACC
a A P V H E P * K L * C A D I C D L T T W -
b R Q S M N P E S Y D A R T F V I S Q P G -
C A S P * T L K V M M R G H L * S H N L V -
10
TTCTGCCATGTTGAACTTCTCTTTTGATATCATAGGGCCGAATAGCGGATTTGMTTTGC
3001 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3060
AAGACGGTACAACTTGAAGAGAAAACTATAGTATCCCGGCTTATCGCCTAAACTTAAACG
15 a F C H V E L L F * Y H R A E * R I * I C -
b S A M L N F S F D I I G P N S G F E F A -
C L P C * T S L L I S * G R I A D L N L P -
NcoI
I
C G A A A G C C C A T G G G C C A A T C A G A C C A C C T G G T A T C T T G A A
3061 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3120
GCTTTCGGGTACCCGGTTAGTCTGGTGGACCATAGAACTTACACAACGATGGTTAGGGTC
25 a R K P M G Q S D H L V S * M C C Y Q S Q -
b E S P W A N Q T T W Y L E C V A T N P R -
C K A H G P I R P P G I L N V L L P I P D -
NaeI
BsrFI I
NspI NgoMIV I
I I I
ACAAATACAGCAATTTGAGGTCAACATGCGCTTCGATCCTAATTTCAGGGTTGCCGGCAA
3121 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3180
35 TGTTTATGTCGTTAAACTCCAGTTGTACGCGAAGCTAGGATTAAAGTCCCAACGGCCGTT
a T N T A I * G Q H A L R S * F Q G C R Q -
b Q I Q Q F E V N M R . F D P N F R V A G N -
C K Y S N L R S T C A S I L I S G L P A I -
40
TspGWI
I
TATCCTGATGCCCCCATTTCCACTGTCAACGGAAACTCCACCGTTATTAAAGTTTAGGTT
3181 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + 3240
ATAGGACTACGGGGGTAAAGGTGACAGTTGCCTTTGAGGTGGCAATAATTTCAAATCCAA
5 a Y P D A P I S T V N G N S T V I K V * ~-
b I L M P P F P L S T E T P P L L K F R F -
C S * C P H F H C Q R K L H R Y * S L G F -
TCGGGATATTGAACGCTCCAAGCGTAGTGTTATGGTTGGACACACTGCTACTGCTGCTTM
10 3241 - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + - - - - - - - - - + + + 3301
AGCCCTATAACTTGCGAGGTTCGCATCACAATACCAACCTGTGTGACGATGACGACGAATT
a S G Y * T L Q A * C Y G W T H C Y C C L -
b R D I E R S K R S V M V G H T A T A A * -
15 c G I L N A P S V V L W L D T L L L L L N -
REFERENCES
20 (1) Flynn, C. E.; Lee, S.-W.; Peelle, B. R., Belcher, A. M. Acta Mat. 2003, 51, 5867-
5880.
(2) Singh, P.; Gonzalez, M. J.; Manchester, M. Drug Develop. Res. 2006, 67, 23-41.
(3) Uchida, M.; Klem, M. T.; Allen, M.; Suci, P.; Flenniken, M.; Gillitzer, E.; Varpness,
Z.; Liepold, L. 0.Y;o ung, M.; Douglas, T. Adv. Mater. 2007, 19, 1025-1042.
25 (4) Steinmetz, N. F.; Evans, D. J. Org. Biomol. Chem. 2007, 5, 2891-2902.
(5) Young, M.; Willits, D; Uchida, M.; Douglas, T. Annu. Rev. Phytopathol. 2008, 46,
361 -384.
(6) Evans, D. J. J. Mater. Chem. 2008, 18, 3746-3754,
(7) Escosura, A. de la; Nolte, R. J. M.; Cornelissen, J. J. L. M. J. Mater. Chem. 2009,
30 19, 2274-2278.
(8) Evans, D. J. Biochem. Soc. Trans. 2009, 37, 665-670.
(9) Manchester, M.; Steinmetz, N. F. (Eds) Cur. Top. Microbial. Immunol.;Viruses and
Nanotechnology; Springer-Verlag: Berlin, Heidelberg, 2009.
(10) Douglas, T.; Young, M. Nature 1998, 393, 152-155.
35 (1 1) Douglas, T.; Young, M. Adv. Mater. 1999, 1 1, 679-681.
(12) Klem, M. T.; Young, M.; Douglas, T. J. Mater. Chem. 2008, 18, 3821-3823.
(13) Escosura, A. de la; Vewegen, M.; Sikkema, F. D.; Comellas-Aragones,M.;
Kirilyuk, A.; Rasing, T.; Nolte, R. J. M.; Cornelissen, J. J. L. M. Chem. Commun. 2008,
1542-1 544.
(14) Langeveld, J. P. M.; Brennan, F. R.; Martinez-Torrecuadrada, J. L.; Jones, T. D.;
5 Boshuizen, R.S.; Vela, C.; Casal J. I.; Kamstrup, S.; Dalsgaard, K.; Meloen, R. H.;
Bendig, M. M.; Hamilton, W. D. 0. Vaccine 2001, 19, 3661-3670.
(15) Rae, C.; Koudelka, K. J.; Destito, G.; Estrada, M. N.; Gonzales, M. J.; Manchester,
M. PLoS ONE 2008 3(10):e3315.doi: 10.13711journal.pone.0003315.
(16) Phelps, J. P.; Dang, N.; Rasochova, L.; J. Virol. Meth. 2007, 141, 146-153.
10 (17) Ochoa, W. F.; Chatterji, A.; Lin, T.; Johnson, J. E. Chemistry & Biology 2006, 13,
77 1 -778.
(18) Saunders, K.; Sainsbury, F.; Lomonossoff, G. P. Virology 2009, 393, 329-337.
(19) Lin, T; Johnson, J. E. Adv Virus Res 2003, 62, 167-239.
(20) Sainsbury, F.; Lomonossoff, G. P. Plant Physiol. 2008, 148, 1212-1218.
15 (21) Sainsbury, F.; Thuenemann, E. C.; Lomonossoff, G. P. Plant Biotech J. 2009, 7,
682-693.
(22) Lomonossoff, G. P.; Hamilton, W. D. 0. Curr. Top. Microbiol. Immunol. 1999, 240,
177-1 89.
(23) Steinmetz, N. F.; Shah, S. N.; Barclay, J. E.; Rallapalli, G.; Lomonossoff, G. P.;
20 Evans, D. J. Small 2009, 5, 81 3-81 6.
(24) Shah, S. N.; Steinmetz, N. F.; Aljabali, A. A. A.; Lomonossoff, G. P.; Evans, D. J.
Dalton Trans. 2009, 8479-8480.
(25) Lomonossoff, G. P.; Johnson, J. E. Prog. Biophys. Mol. Biol. 1991, 55, 107-137.
(26) Steinmetz, N. F.; Calder, G.; Lomonossoff, G. P.; Evans, D. J. Langmuir2006, 22,
25 1 0032-1 0037.
(27) Aljabali, A. A. A.; Sainsbury, F.; Evans, D. J.; Lomonossoff, G. P. unpublished
results.
(28) Wade, V. J.; Levi, S.; Arosio, P.; Treffry, A.; Harrison, P. M.; Mann, S. J. Mol. Biol.
1991, 221, 1443-1452.
30
OTHERREFERENCES
Bu, M. and Shih, D.S. (1989). Inhibition of proteolytic processing of the polyproteins of
cowpea mosaic virus by hemin. Virology 173, 348-351.
35
Chatterji, A., Ochoa, W., Paine, M., Ratna, B.R., Johnson, J.E. & Lin, T. (2004). New
addresses on an addressable virus nanoblock Uniquely reactive Lys residues on
cowpea mosaic virus. Chem. Biol. 11, 855-863.
5 Clark, A.J., Bertens, P., Wellink, J., Shanks, M. & Lomonossoff, G.P. (1999). Studies
on hybrid comoviruses reveal the importance of three-dimensional structure for
processing of the viral coat proteins and show that the specificity of cleavage is greater
in trans than in cis. Virology 262, 184-1 94.
10 Destito, G., Schneemann, A. and Manchester, M (2009). Biomedical nanotechnology
using virus-based nanoparticles. In Current Topics in Microbiology and lmmunology
(Steinmetz N.F. & Manchester M., eds) 327, 95-122.
Franssen, H., Goldbach, R., Broekhuijsen, M., Moerman, M. & van Kammen, A. (1982).
15 Expression of middle-component RNA of cowpea mosaic virus: in vitro generation of a
precursor to both capsid proteins by a bottom-component RNA-encoded protease from
infected cells. Journal of Virology 41, 8-1 7.
Garcia, J. A., Schrijvers, I., Tan, A., Vos, P. Wellink, J. and Goldbach, R. (1987).
20 Proteolytic activity of the cowpea mosaic virus encoded 24K protein synthesized in
Escherichia coli. Virology 159, 67-75.
Goldbach, R. W. and Wellink, J. (1996). Comovirus: molecular biology and replication.
In The Plant Viruses, vol. 5, pp. 35-76. Edited by B. D. Harrison &A. F. Murrant. New
25 York: Plenum Press.
Holness, C. L., Lomonossoff, G. P., Evans, D. and Maule, A. J. (1989). Identification of
the initiation codons for translation of cowpea mosaic virus middle component RNA
using site-directed mutagenesis of an infectious cDNA clone. Virology, 172, 31 1-320.
30
Langeveld, J.P.M., Brennan, F.R., Martinez-Torrecuadrada, J.L., Jones, T.D.,
Boshuizen, R.S., Vela, C., Casal, J.I., Kamstrup, S., Dalsgaard, K., Meloen, R.H.,
Bendig., M.M. and Hamilton, W.D.0 (2001). Inactivated recombinant plant virus
protects dogs from a lethal challenge with canine parvovirus. Vaccine 19, 3661-3670.
Lin, T., Chen, Z., Usha, R., Stauffacher, C.V., Dai, J.B., Schmidt, T. & Johnson, J.E.
(1999). The refined crystal structure of Cowpea mosaic virus at 2.8A resolution.
Virology 265, 20-34.
5 Liu, L. and Lomonossoff, G.P. (2002). Agroinfection as a rapid method for propagating
Cowpea mosaic virus-based constructs. J Virol Meth 105, 343-348.
Liu, L., Caiiizares, M.C., Monger, W., Perrin, Y., Tsakiris, E., Porta, C., Shariat, N.,
Nicholson, L. and Lomonossoff, G. P. (2005). Cowpea mosaic virus-based systems for
10 the production of antigens and antibodies in plants. Vaccine 23, 1788-1792.
Lomonossoff, G.P. and Montague, N.P. (2008) Plant viruses as gene expression and
silencing vectors. Encyclopedia of Life Sciences, John Wiley & Sons, Chichester. DO1
10.10021978047001 5902.a0020709.
15
Lomonossoff, G. P. & Shanks, M. (1983). The nucleotide sequence of cowpea mosaic
virus B RNA. EMBO Journal 2, 2253-2258.
Lomonossoff, G.P. and Johnson J. E. (1991). The synthesis and structure of comovirus
20 capsids. Prog. Biophys. Molec Biol 55, 107-137.
Nida, D.L., Anjos, R. J., Lomonossoff, G.P. & Ghabrial, S.A. (1 992). Expression of
cowpea mosaic virus coat protein precursor in transgenic tobacco plants. Journal of
General Virology 73, 157-1 63.
25
Ochoa, W., Chatterji, A., Lin, T. and Johnson, J.E. (2006). Generation and structural
analysis of reactive empty particles derived from an icosahedral virus. Chem. Biol. 13,
771-778.
30 Phelps, J.P., Dang, N and Rasochova, L. (2007). Inactivation and purification of
cowpea mosaic virus-like particles displaying peptide antigens from Bacillus anthracis.
J. Virol. Meth. 141, 146-1 53.
Porta, C., Spall, V.E., Findlay, K.C., Gergerich R.C., Farrance, C.E. and Lomonossoff,
35 G.P. (2003). Cowpea mosaic virus-based chimaeras. Effects of inserted peptides on
the phenotype, host-range and transmissibility of the modified viruses. Virology 310,
Rae, C., Koudelka, K.J., Destito, G., Estrada, M.N., Gonzales, M.J., Manchester, M.
(2008) Chemical addressability of ultraviolet-inactivated viral nanoparticles (VNPs).
5 PLoS ONE 3(10):e3315.doi:10.1371/journal.pone.O003315
Rezelman, G., van Kammen, A. and Wellink, J. (1989). Expression of cowpea mosaic
virus M RNA in cowpea protoplasts. J. Gen. Virol. 70, 3043-3050.
10 Sainsbury, F. and Lomonossoff, G.P. (2008). Extremely high-level and rapid transient
protein production in plants without the use of viral replication. Plant Physiology 148,
1212-1218.
Shanks, M. and Lomonossoff, G. P. (2000). Co-expression of the capsid proteins of
15 cowpea mosaic virus in insect cells leads to the formation of virus-like particles. J Gen
V~I-01813,0 93-3097.
Steinmetz, N. F., Evans, D. J. and Lomonossoff, G. P. (2007). Chemical introduction of
reactive thiols into a viral nanoscaffold: A method that avoids virus aggregation.
20 ChemBioChem 8, 1 1 31 -1 1 36.
Steinmetz, N. F., Lin, T., Lomonossoff, G.P. and Johnson, J.E. (2009). Structure-based
Engineering of an lcosahedral Virus for Nanomedicine and Nanotechnology. In Current
Topics in Microbiology and lmmunology (Steinmetz N.F. & Manchester M., eds) 327,
25 23-58
Taylor, K. M., Spall, V. E., Butler, P. J. G. and Lomonossoff, G. P. (1999). The
cleavable carboxyl-terminus of the small coat protein of cowpea mosaic virus is
involved in RNA encapsidation. Virology 255, 129-1 37.
30
Van Bokhoven, H., Wellink, J., Usmany, M., Vlak, J.M., Goldbach, R. and van
Kammen, A. (1990). Expression of plant virus genes in animal cells: high level
synthesis of cowpea mosaic virus B-RNA-encoded proteins with baculovirus
expression vectors. J. Gen. Virol. 71, 2509-251 7.
35
Van Bokhoven, H., van Lent, J.W.M., Custers, R. , Vlak, J.M.,. Wellink, J., and van
Kammen, A. (1 992). Synthesis of the complete 200K protein encoded by cowpea
mosaic virus B-RNA in insect cells. J. Gen. Virol. 73, 2775-2784.
5 Van Kammen, A. (1971). Cowpea mosaic virus. CMIIAAB Descriptions of plant viruses
No. 47.
Vezina, L-P., Faye, L., Lerouge,P., DIAoust, M.A., Marquet-Blouin, E., Burel, C.,
Lavoie, P-O., Bardor, M. & Gomord, V. (2009). Transient co-expression for fast and
10 high-yield production of antibodies with human-like N-glycans in plants. Plant
Biotechnology Journal 7,442-455
Vos, P., Verver, J., Jaegle, M., Wellink, J., van Kammen, A. and Goldbach, R. (1988).
Two viral proteins involved in the proteolytic processing of the cowpea mosaic virus
15 polyproteins. Nuc. Acids Res. 16, 1967-1 985.
Wellink, J., Jaegle, M., Prinz, H., van Kammen, A. and Goldbach, R. (1987).
Expression of middle component RNA of cowpea mosaic virus in vivo. J. Gen. Virol.
68, 2577-2585.
20
Wellink, J., Rezelman, G., Goldbach, R. And Beyreuther, K. (1986). Determination of
the proteolytic processing sites in the polyprotein encoded by the bottom-component
RNA of cowpea mosaic virus. Journal of Virology 59, 50-58.
25 Wellink, J., Verver, J., van Lent, J. and van Kammen. A. (1996). Capsid proteins of
cowpea mosaic virus transiently expressed in protoplasts form virus-like particles.
Virology 224, 352-355.
Wu, G.-J. & Bruening, G. (1971). Two proteins from cowpea mosaic virus. Virology 46,
30 506-512.
Young, M., Willits, D., Uchida, M. & Douglas, T, (2008). Plant Viruses as Biotemplates
for materials and their use in nanotechnology. Annu. Rev. Phytopathol. 46, 361-384

Claims
1 A method of producing RNA virus capsids in a host cell, which method
5 comprises:
(a) introducing one or more recombinant DNA vectors into the host cell or an ancestor
thereof, wherein said one or more vectors comprise:
(i) a first nucleotide sequence encoding a polyprotein which can be
proteolytically processed in the host cell to viral small (S) and large (L) coat
10 proteins from said RNA virus for assembly in the host cell into viral capsids;
and
(ii) a second nucleotide sequence encoding a proteinase capable of said
proteolytic processing;
(b) permitting expression of said polyprotein and proteinase from said first and second
15 nucleotide sequences,
such that the polyprotein is proteolytically processed in the host cell to viral S
and L coat proteins which assemble in the host cell into viral capsids,
which capsids are incapable of infection of the host cell.
20 2 A method as claimed in claim 1 wherein the one or more vectors are high-level
expression vectors. '
3 A method as claimed in claim 1 or claim 2 wherein the first nucleotide
sequence encodes a polyprotein consisting essentially of the S and L coat proteins,
25 one or both of which is optionally modified by way of sequence insertion, subtitution, or
deletion.
4 A method of producing RNA virus capsids in a plant cell, which method,
comprises:
30 (a) introducing one or more high-level expression recombinant DNA vectors into the
plant cell or an ancestor thereof, wherein said one or more high-level expression
recombinant DNA vectors comprise:
(i) a first nucleotide sequence encoding a viral S coat protein from said RNA
virus; and
35 (ii) a second nucleotide sequence encoding a viral L coat protein from said
RNA virus,
(b) permitting expression of said S coat protein and L coat protein from said first and
second nucleotide sequences,
such that S and L coat proteins are assembled in the host cell into viral capsids,
and wherein the one or more vectors are high-expression vectors, which
5 capsids are incapable of infection of the host cell.
5 A method as claimed in claim 4 wherein one or both of said S and L proteins is
modified by way of sequence insertion, subtitution or deletion.
10 6 A method as claimed in claim 3 or claim 5 wherein said modification is selected
from the list consisting of: display of a heterologous peptide; incorporation of pores into
the capsid; incorporation of a tag to facilitate purification of the protein or capsid.
7 A method as claimed in any one of claims 1 to 6 wherein the RNA virus capsids
15 are essentially free of native viral genomic RNA.
8 A method as claimed in claim 7 wherein the RNA virus capsids are essentially
free of RNA.
20 9 A method as claimed in any one of claims 1 to 8 wherein the DNA vector or
vectors do not encode entire native viral genomic RNA.
10 A method as claimed in any one of claims 1 to 9 wherein the host cell is a plant
cell, which is present in a plant.
25
11 A method as claimed in claim 10 wherein the DNA vector or vectors are plant
vectors which include an expression cassette comprising:
(i) a promoter, operably linked to
(ii) an enhancer sequence derived from the RNA-2 genome segment of a bipartite RNA
30 virus, in which a target initiation site in the RNA-2 genome segment has been mutated;
(iii) said first and\or second nucleotide sequences;
(iv) a terminator sequence; and optionally
(v) a 3' UTR located upstream of said terminator sequence.
35 12 A method as claimed in claim 11 wherein the enhancer sequence consists of all
or part of nucleotides 1 to 507 of the cowpea mosaic virus RNA-2 genome segment
sequence shown in Table A, wherein the AUG at position 161 has,been mutated as
shown in Table B
13 A method as claimed in claim 11 or claim 12 wherein said first nucleotide
5 sequence encoding the polyprotein and said second nucleotide sequence encoding a
proteinase are present on a single vector.
14 A method as claimed in any one of claims 11 to 13 wherein the plant vector is a
plant binary vector which includes a suppressor of gene silencing.
10
15 A method as claimed in any one of claims 10 to 14 further comprising
harvesting a tissue from the plant in which the RNA virus capsids have been
assembled, and isolating the capsids from the tissue.
15 16 A method as claimed in claim 15 wherein isolating the capsids from the tissue
comprises the steps of:
(1) providing said plant tissue material;
(2) homogenising said material;
(3) adding an insoluble binding-agent which binds polysaccharides and phenolics;
20 (4) removing solid matter including said binding agent;
(5) precipitate the virus particles with a polyol;
(6) recovering the polyol precipitate, optionally by centrifugation;
(7) redissolving the pellet in aqeous buffer;
(8) high-speed centrifuging and discarding pelletable material not including said
25 capsids;
(9) ultracentrifuging and discarding supernatant not including said capsids;
(1 0) resuspending the pellet in aqeous buffer.
17 . A method as claimed in claim 15 or claim 16 wherein isolating the capsids from
30 the tissue does not comprise an organic solvent extraction step.
18 A method as claimed in any one of claims 14 to 17 wherein the plant vector is a
high-level expression vector such that % yield of isolated capsids from the harvested
plant tissue at least 0.01% or 0.02% wlw.
19 A method as claimed in any one of claims 1 to 18 wherein the RNA virus is a
bipartite RNA virus is a member of the family Comoviridae, which is optionally a
Comovirus, which is optionally Cowpea mosaic virus (CPMV).
5 20 A method as claimed in claim 19 wherein (i) the first nucleotide sequence
encodes CPMV VP60 in which one or both of the CPMV S and L proteins is optionally
modified by way of sequence insertion, subtitution or deletion; and (ii) the second
nucleotide sequence encodes the CPMV 24K proteinase.
10 21 A method as claimed in any one of claims 1 to 20 wherein the RNA virus
capsids are subsequently chemically modified, optionally for display of a molecule via
chemical bioconjugation of the molecule to the capsid surface.
22 A gene expression system for producing RNA virus capsids in a host cell,
15 which system comprises one or more high expression recombinant DNA vectors,
wherein said one or more high expression recombinant DNA vectors comprise:
(i) a first nucleotide sequence encoding a polyprotein which can be
proteolytically processed in the host cell to viral S and L coat proteins from said
RNA virus for assembly in the host cell into capsids; and
(ii) a second nucleotide sequence encoding a proteinase from said RNA virus
capable of said proteolytic processing.
23 A gene expression system as claimed in claim 22 for use in a method as
claimed in any one or claims 1 to 3, or claims 6 to 21 as dependent on claims 1 to 3.
25
24 A method of producing RNA virus capsids in a plant cell, which method
comprises the step of introducing the gene expression system of claim 22 or claim 23
into the host cell, or ancestor thereof. and causing or allowing recombination between
the or each vector and the plant cell genome.
30
25 A plant cell obtained or obtainable by a method of any one of claims 10 to 14, or
claim 24.
26 A plant transiently transfected with a gene expression system of claim 22 or
35 claim 23 or a transgenic plant stably transformed with a gene expression system of
claim 229 or claim 23.
27 A method of producing RNA virus capsids encapsidating a desired payload in
vifro, ,
which method comprises:
5 (a) introducing a recombinant DNA vector into a host cell or an ancestor thereof,
wherein said vector comprises a nucleotide sequence encoding a polyprotein which
comprises viral small (S) and large ( ~cojat proteins from said RNA virus,
(b) permitting expression of said polyprotein from said nucleotide sequence, wherein
said.polyprotein is not proteolytically processed in the host cell to said viral S and L
10 coat proteins,
(c) purifying said polyprotein from said host cell,
(d) contacting said polyprotein in vifro with (i) a proteinase capable of proteolytically
processing the polyprotein to said viral S and L coat proteins and (ii) said payload,
such that the viral S and L coat proteins assemble in vifro into viral capsids
15 encapsidating said payload.
28 A method as claimed in claim 27 wherein said polyprotein includes a tag at the
N- or C terminal to facilitate protein purification.
20 29 An RNA virus capsid obtained or obtainable by a method of any one of claims 1
to 21, or claims 24,27 or 28.
30 An RNA virus capsid as claimed in claim 29 which is a CPMV capsid essentially
free of CPMV RNA and which optionally includes a payload selected from the list
25 consisting of: nucleic acid which is optionally siRNA, protein, carbohydrate, lipid, a drug
molecule, an inorganic material such as a heavy metal or salts thereof.
31 An RNA virus capsid as claimed in claim 29 or claim 30 which is a CPMV
capsid essentially free of CPMV RNA and which includes foreign protein sequence as
30 part of the L or S sequence.
32 An RNA virus capsid as claimed in claim 31 wherein the foreign protein
sequence is a tag at the N- or C terminal to facilitate protein or capsid purification,
Dated this 1l tdhay o f January 2012,